CN1879727B - Novel hepatitis B inhibitor and application thereof - Google Patents

Novel hepatitis B inhibitor and application thereof Download PDF

Info

Publication number
CN1879727B
CN1879727B CN200610026391XA CN200610026391A CN1879727B CN 1879727 B CN1879727 B CN 1879727B CN 200610026391X A CN200610026391X A CN 200610026391XA CN 200610026391 A CN200610026391 A CN 200610026391A CN 1879727 B CN1879727 B CN 1879727B
Authority
CN
China
Prior art keywords
coffee
extract
hepatitis
powdered
add
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN200610026391XA
Other languages
Chinese (zh)
Other versions
CN1879727A (en
Inventor
左建平
赵维民
王桂凤
刘群芳
石丽萍
张如隽
任宇丹
邹健
何佩岚
冯加权
唐炜
朱峰华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Institute of Materia Medica of CAS
Original Assignee
Shanghai Institute of Materia Medica of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institute of Materia Medica of CAS filed Critical Shanghai Institute of Materia Medica of CAS
Priority to CN200610026391XA priority Critical patent/CN1879727B/en
Publication of CN1879727A publication Critical patent/CN1879727A/en
Priority to PCT/CN2007/001096 priority patent/WO2007128191A1/en
Application granted granted Critical
Publication of CN1879727B publication Critical patent/CN1879727B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/74—Rubiaceae (Madder family)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Molecular Biology (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention provides an anti-hepatitis B virus (HBV) suppressing agent containing coffee extract and use thereof, test results show that the suppressing agent can effectively inhibit DNA copying ofhepatitis B virus, synthesis of hepatitis B virus s antigen and e antigen, and has the advantages of high effectiveness and low cost.

Description

Novel hepatitis B inhibitor and application thereof
Technical field
The present invention relates to drug world, particularly, the present invention relates to a kind of anti-hepatitis virus (HBV) inhibitor and application thereof that contains coffee-extract.Described hepatitis B inhibitor suppresses HBVDNA and duplicates, and suppresses the synthetic and secretion of HBeAg and HbsAg, can be used as the medicine of treatment and auxiliary treatment hepatitis B.
Background technology
Coffee component comprises chlorogenic acid (A), caffeic acid (B) and quinine (Buddhist nun) acid (C) etc., and its chemical structural formula is as follows.Though there is statistical research report long-term drink coffee can reduce the sickness rate of hepatocellular carcinoma, reduce the generation (comprising chronic viral hepatitis) of chronic hepatitis, and coffee component has anti-HIV, the activity report of HSV etc., but have direct anti-HBV active function about coffee and composition thereof, not seeing both at home and abroad has the research report.Result of study of the present invention has proved coffee, and the natural micromolecular compound of a class that contains in coffee crude extract and the coffee has tangible anti-hepatitis B activity effect, suppresses HBVDNA and duplicates, and suppresses the synthetic and secretion of HBeAg and HbsAg.Our result of study has confirmed that daily coffee for drinking may have the hepatitis B virus hepatitis that the control hepatitis B virus causes.
Summary of the invention
The purpose of this invention is to provide a kind of hepatitis B inhibitor that comprises coffee-extract.
A further object of the present invention provides above-mentioned hepatitis B inhibitor and is used for the treatment of application in the medicine of hepatitis B in preparation.
The invention provides a kind of hepatitis B inhibitor, it comprises coffee-extract and adjuvant, wherein, based on the described hepatitis B inhibitor of 100 weight portions, contains the coffee-extract of 10～90 weight portions, and surplus is an adjuvant.
In hepatitis B inhibitor of the present invention, wherein said coffee-extract is the extract of normal coffee, low-caffeine coffee or decaf; Described adjuvant is vitamin C, hydroxypropyl vitamin, pregelatinized Starch, micropowder silica gel, sucrose, ethanol, antiseptic and/or magnesium stearate.
According to technical scheme of the present invention, described coffee-extract prepares by the following method,
1) coffee filters or hot water boiled 5～10 minutes at 80～100 ℃ hot water, obtains coffee solution, wherein, the weight ratio of coffee and water is 1: 15～1: 5, and lyophilizing coffee solution, obtains the powdered coffee extract, wherein, the weight ratio of preferably coffee and water is 1: 10; Or
2) taking by weighing coffee places in the round-bottomed flask, add 95% edible ethanol, the ratio of ethanol volume and coffee quality is 1: 5ml/g, mixture heated to 90 ℃ refluxed 1.5 hours, filter, filtrate is carried out spray drying and is got the powdered coffee crude extract on the Rotary Evaporators, is condensed into extractum under 60 ℃; Or
3) taking by weighing coffee places in the round-bottomed flask, add the 40-60% edible ethanol, the ratio of ethanol volume and coffee quality is 1: 5ml/g, mixture heated to 90 ℃ refluxed 1.5 hours, filter, filtrate on Rotary Evaporators 60 ℃ be condensed into extractum, carry out spray drying and get the powdered coffee crude extract.
The present invention also provides above-mentioned hepatitis B inhibitor to be used for the treatment of application in the medicine of hepatitis B in preparation.
For hepatitis B inhibitor of the present invention, its form of taking comprises tablet (comprising effervescent tablet), capsule (comprising soft capsule), electuary, oral liquid, pill existing any one peroral dosage forms such as (comprising drop pill).
The present invention studies have shown that coffee and coffee-extract can suppress effectively that hepatitis B virus DNA duplicates, hepatitis B virus s antigen and e are antigenic synthetic, coffee is a kind of beverage/food commonly used, no obvious toxic and side effects, its extract can be used for making the medicine of treatment or auxiliary treatment hepatitis B.
The specific embodiment
Embodiment
Embodiment 1 extracts the coffee crude extract
Normal coffee (Mace Weir coffee, 100% plain coffee, U.S. Maxwell coffee company) and low-caffeine coffee (the classical Decaffeinated Coffee of Melaleuca, moderate roasting accompanying, 100% pure Melaleuca coffee comprises and is no more than 0.4% caffeine, German Melitta group) available from the METRO supermarket.The extracting method of crude extract is: (1) takes by weighing 40g coffee, adds about 400ml water, boil into fresh coffee with coffee pot (coffee pot special-purpose 18k covered with gold leaf metal filter screen) after, lyophilizing obtains the powdered coffee crude extract; Perhaps, (2) take by weighing the round-bottomed flask that 100g coffee places 1L, add the about 500ml of 95% edible ethanol, being heated to 90 ℃ refluxed 1.5 hours, filter, filtrate is carried out spray drying and is got the powdered coffee crude extract on the Rotary Evaporators, is condensed into extractum under 60 ℃; Perhaps, (3) take by weighing the round-bottomed flask that 100g coffee places 1L, add the about 500ml of 40-60% edible ethanol, being heated to 90 ℃ refluxed 1.5 hours, filter, filtrate on Rotary Evaporators 60 ℃ be condensed into extractum, carry out spray drying and get the powdered coffee crude extract.Weigh, compare, get the response rate with former coffee quality.Chlorogenic acid, the content of caffeic acid and quinine (Buddhist nun) acid in the coffee crude extract is contrast with separately standard substance respectively, does standard curve, adopts the HPLC-ESI-MS/MS method to carry out assay.
Embodiment 2～3 extracts the coffee crude extract
Except the weight ratio of coffee and water is 1: 15 and 1: 5, extract the coffee crude extract with the method identical with embodiment 1.
Embodiment 4
Select the coffee or the decaf extract of following consumption for use, and use the medicine food dual purpose plant Flos Lonicerae extract to be equipped with adjuvant, with following mixed:
Coffee or decaf extract 400 grams
Flos Lonicerae extract 400 grams
Hydroxypropyl vitamin 20 grams
Micropowder silica gel 60 grams
Pregelatinized Starch 120 grams
Magnesium stearate is an amount of
Make 1000
With decaf extract, Flos Lonicerae extract and additives mix homogeneously, as binding agent, wet granulation is dried with 10% pregelatinized Starch slurry, adds an amount of magnesium stearate and mixes, and is pressed into tablet.
Embodiment 5
Select coffee or decaf extract, vitamin C and the adjuvant of following consumption for use, with following mixed:
Coffee or decaf extract 400 grams
Vitamin C 400 grams
Hydroxypropyl vitamin 20 grams
Micropowder silica gel 48 grams
Ethanol is an amount of
Magnesium stearate is an amount of
Make 900
Coffee is mixed with hyprolose and micropowder silica gel, make wetting agent with an amount of 70% ethanol, wet granulation is crossed the 40 mesh sieves granule of hanking, and oven dry adds magnesium stearate, mixes the hard capsule of packing into.
Embodiment 6
Select coffee or decaf extract, vitamin C and the additives of following consumption for use, with following mixed:
Coffee or decaf extract 800 grams
Vitamin C 400 grams
Sucrose 40 grams
Antiseptic is an amount of
Distilled water is an amount of
Make 20000ml
It is an amount of to get distilled water, adds coffee, and the limit edged stirs and makes dissolving, filters.With sucrose and antiseptic distilled water heating for dissolving, under agitation slowly add above-mentioned solution in addition, adding distil water mixes to full dose, and cold preservation is filtered, potting, and sterilization gets oral liquid.
Embodiment 7
Except that using 200g coffee or decaf extract and the 600g Flos Lonicerae extract, with the method preparation identical with embodiment 4 based on the total mixture of 1000g.
Embodiment 8
Except that using 600g coffee or decaf extract and the 200g Flos Lonicerae extract, with the method preparation identical with embodiment 4 based on the total mixture of 1000g.
EXPERIMENTAL EXAMPLE
One, experiment purpose
Sample compound anti-hepatitis B virus (HBV) screening active ingredients.Test comprises: in the test of virus-cellular level, and the cytotoxicity of test sample chemical compound, to the secretion of hepatitis B virus surface and cAg, and the influence of the levels of replication of viral nucleic acid (DNA).
Two, experimental principle
Hepatitis B virus (HBV) transgenic human hepatoma carcinoma cell HepG2.2.15 cell strain can be secreted hepatitis B virus granule (containing antigen and DNA) in culture supernatant when cultivating.
Under the intervention of antiviral drugs, detect HBsAg, HBeAg and the viral DNA content of emiocytosis in the culture supernatant, with reference to the content of dosing matched group not, antiviral activity effect that can the observing samples medicine, the cytotoxic effect of test sample medicine simultaneously.It is CC50 that utilization mtt assay test sample medicine causes the numerical concentration of 50% cytotoxicity death; Reach inhibition HBsAg, HBeAg secretion with ELISA method test sample medicine, and 50% o'clock concentration numerical value of utilization fluorescence quantitative PCR method test sample medicine inhibition viral dna replication amount is IC50.
Three, laboratory sample
Facing the time spent is made into the required example pharmaceuticals concentration of experiment, and each example pharmaceuticals is done the test of 7 diluted concentrations, and establishes the positive control drug of antiviral drugs such as lamivudine as experiment.
Four, experimental technique
1, the collection of culture supernatant
The HepG2.2.15 cell inoculation in 96 orifice plates, is added example pharmaceuticals next day, and the periodic replacement culture fluid reaches the example pharmaceuticals with concentration, and is to be measured in the 8th day collection culture supernatant.Cell in 96 orifice plates adds MTT, adds the reaction of MTT lysate after 4 hours and spends the night, and surveys OD next day on microplate reader 570Calculate the toxic action of example pharmaceuticals according to the OD value, influence the situation of cell growth, cause the required concentration (CC of half cell death amount the HepG2.2.15 cell 50).
2, handle the collection of cell
The HepG2.2.15 cell inoculation in culture bottle, is added example pharmaceuticals next day, through the periodic replacement culture fluid and with the example pharmaceuticals of concentration, to be measured in the 8th day collecting cell.
3, the detection of HBsAg and HBeAg content (ELISA method) in the culture supernatant:
Utilization HBsAg and HBeAg detect with test kit (Huamei Bio-Engrg Co.,, Luoyang, Henan) and detect.Add sample in wrapping by good stripe board, and add the enzyme mark conjugate of equivalent, 37 ℃ of reactions were washed plate after 1 hour, repeated 5 times.Add colour developing liquid A and B, cessation reaction after 15 minutes is measured OD 450/630, and calculate sample to the antigenic half suppression ratio of HBV (IC according to the OD value 50).
4, fluorescence quantitative PCR method detects HBV-DNA content in the sample:
(1) HBV DNA detection in the culture supernatant of extracellular:
Get an amount of culture supernatant and join in isopyknic viral extracting solution, boil behind the mixing, centrifugal 5 minutes then in room temperature 10000rpm, get an amount of supernatant and be used for pcr amplification, 5 of HBV-DNA standard sample are set simultaneously, do standard curve.And according to the viral dna replication value that detects gained, the suppression ratio that when calculating each concentration of each example pharmaceuticals HBV-DNA is duplicated, and then carry out example pharmaceuticals half suppression ratio and calculate its (IC of acquisition 50), to not carrying out IC 50The sample that value is calculated is given and IC XExpression also provides corresponding concentration numerical value.
Test with the PCR primer is:
P1：5’ATCCTGCTGCTATGCCTCATCTT3’
P2：5’ACAGTGGGGAAAGCCCTACGAA3’，
Test with the PCR probe is:
5’TGGCTAGTTTACTAGTGCCATTTTG3’
(2) DNA detection in the interior HBV core granule of cell:
Solution A: 1ml 10mM Tris (pH 7.5)/1mM EDTA/50mM NaCl/8% sucrose/0.25%Nonidet (Nonidet) P-40, lysate
Solution B: DNase I (50g/ml) and RNase A (20g/ml), extracting solution
Solution C: 26% Polyethylene Glycol/1.4M NaCl/25mM EDTA, precipitated liquid
Solution D: 10mM Tris (pH 7.5)/6mM MgCl2, suspension
The method that adopts is: 8 days cell is handled in medication, and the DNA in the core granule is extracted in trypsinization from cell: the cell that digests solution A cracking, and the centrifugal 3min of 4C gets supernatant, and furnishing 6mM MgCl2 concentration adds solution B, 37 ℃ of 30min.Add 330 μ l solution C precipitation core granule, behind 4 ℃ of 30min, centrifugal 4min.Precipitation is resuspended in 100 μ l solution D, add 37 ℃ of digestion of DNase I 15min, the sample that is obtained carries out real-time fluorescence quantitative PCR, is interior mark with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) among the total DNA of HepG2.2.15 cell, detects the change of dna level in the HBV core granule.
The test primer is: P3:5 '-GGTATCGTGGAAGGACTCATG AC-3 '
P4：5’-ATGCCAGTGAGCTTCCCGTTCAGC-3’
Five, experimental result
The coffee-extract and the coffee component chlorogenic acid of table 1, embodiment 1 preparation, caffeic acid and quinine (Buddhist nun) acid is to the inhibitory action of HepG2.2.15 cell HBV
Figure G200610026391XD00091
aCC 50Be the influence of example pharmaceuticals to the growth of HepG2.2.15 cell, 50% lethasl concentration.
bIC 50For sample reaches 50% o'clock concentration to the inhibition that DNA copies.SI selects coefficient for the sample biological activity.
Table 2, chlorogenic acid, the content of caffeic acid and quinine (Buddhist nun) acid in coffee
40g coffee obtains the fresh coffee for drinking of about 400ml after 18k metal filter screen coffee pot covered with gold leaf heating and filtering, be condensed into the coffee crude extract through lyophilizing.Normal coffee reclaim 10g coffee crude extract; Low-caffeine coffee reclaim 8.6g coffee crude extract.Detect the content of corresponding reactive compound in crude extract, be converted into the content in the fresh coffee for drinking of 100ml then.

Claims (3)

1. coffee-extract is used for the treatment of purposes in the medicine of hepatitis B in preparation, and described coffee-extract prepares by the following method:
1) coffee filters or hot water boiled 5～10 minutes at 80～100 ℃ hot water, obtains coffee solution, and wherein, the weight ratio of coffee and water is 1: 15～1: 5, and lyophilizing coffee solution, acquisition powdered coffee extract; Or
2) taking by weighing coffee places in the round-bottomed flask, add 95% edible ethanol, the ratio of ethanol volume and coffee quality is 1: 5ml/g, mixture heated to 90 ℃ refluxed 1.5 hours, filter, filtrate is carried out spray drying and is got the powdered coffee crude extract on the Rotary Evaporators, is condensed into extractum under 60 ℃; Or
3) taking by weighing coffee places in the round-bottomed flask, add the 40-60% edible ethanol, the ratio of ethanol volume and coffee quality is 1: 5ml/g, mixture heated to 90 ℃ refluxed 1.5 hours, filter, filtrate on Rotary Evaporators 60 ℃ be condensed into extractum, carry out spray drying and get the powdered coffee crude extract.
2. purposes according to claim 1 is characterized in that, described coffee is normal coffee, low-caffeine coffee or decaf.
3. purposes according to claim 1 is characterized in that, in method 1) in, the weight ratio of coffee and water is 1: 10.
CN200610026391XA 2006-05-09 2006-05-09 Novel hepatitis B inhibitor and application thereof Expired - Fee Related CN1879727B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN200610026391XA CN1879727B (en) 2006-05-09 2006-05-09 Novel hepatitis B inhibitor and application thereof
PCT/CN2007/001096 WO2007128191A1 (en) 2006-05-09 2007-04-04 Anti-hepatitis b virus inhibitorand use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN200610026391XA CN1879727B (en) 2006-05-09 2006-05-09 Novel hepatitis B inhibitor and application thereof

Publications (2)

Publication Number Publication Date
CN1879727A CN1879727A (en) 2006-12-20
CN1879727B true CN1879727B (en) 2010-04-21

Family

ID=37518228

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200610026391XA Expired - Fee Related CN1879727B (en) 2006-05-09 2006-05-09 Novel hepatitis B inhibitor and application thereof

Country Status (2)

Country Link
CN (1) CN1879727B (en)
WO (1) WO2007128191A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009123183A1 (en) * 2008-03-31 2009-10-08 国立大学法人広島大学 Antiviral agent and antiviral composition

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1175411A (en) * 1996-08-29 1998-03-11 中国人民解放军军事医学科学院放射医学研究所 Use of dicafeoyl quininic acid in treatment of hepatitis B and diseases associated with retrovirus and cafeoyl quininic acid derivs.
CN1620884A (en) * 2004-12-27 2005-06-01 游方 Instant notoginseng coffee and its preparation method

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2848448B1 (en) * 2002-12-13 2007-04-06 Oreal USE OF DECAFFEIN COFFEE GRAIN EXTRACT IN THE PREPARATION OF A COMPOSITION FOR STIMULATING THE SEBACEOUS FUNCTION OF THE SKIN BY ORAL ADMINISTRATION
US20090274777A1 (en) * 2003-10-06 2009-11-05 Hiroshi Shimoda Dietetic composition
US7390874B2 (en) * 2003-12-29 2008-06-24 Kuboyama Bio Ken, Inc. Peptide, method of production thereof, and pharmaceutical composition containing the same
CN1561781A (en) * 2004-04-15 2005-01-12 邝颂谦 Coffee lozenge

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1175411A (en) * 1996-08-29 1998-03-11 中国人民解放军军事医学科学院放射医学研究所 Use of dicafeoyl quininic acid in treatment of hepatitis B and diseases associated with retrovirus and cafeoyl quininic acid derivs.
CN1620884A (en) * 2004-12-27 2005-06-01 游方 Instant notoginseng coffee and its preparation method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
林伟忠.咖啡等饮料脱酸的新方法.食品科学 12.1988,(12),16-19.
林伟忠.咖啡等饮料脱酸的新方法.食品科学 12.1988,(12),16-19. *

Also Published As

Publication number Publication date
CN1879727A (en) 2006-12-20
WO2007128191A1 (en) 2007-11-15

Similar Documents

Publication Publication Date Title
CN102657823B (en) Traditional Chinese medicine composition with anticancer effect and preparation method and detection method thereof
CN101085091A (en) Traditional Chinese medicine extraction for preventing and curing osteoporosis and its preparation method
CN102600225B (en) Wormwood leaf extract and application thereof in preparation of anti-hepatitis B virus medicines
CN106214773A (en) A kind of to chemical liver injury compositions having assistant protection function and preparation method thereof
CN1879727B (en) Novel hepatitis B inhibitor and application thereof
CN103191246A (en) Traditional chinese medicine extract and preparation method thereof
CN101416958B (en) Use of 15-methano-substituted-andrographolide derivative in preparing anti-hepatitis B medicine
CN102823672B (en) A kind of puer tea composition for adjusting blood fat
JP2019535833A (en) Traditional Chinese medicine composition for tumor treatment and its production method and use
CN105106816B (en) Protect the traditional Chinese medicine health care product preparation and preparation method thereof of chemical damage
CN101912594A (en) Traditional Chinese medicine preparation for treating gastrointestinal diseases
CN101606991B (en) Technique for preparing fugui ostealgia compound by microorganism fermentation method
CN101766664B (en) Detection method of total saponin of Radix Ilicis Asprellae
CN100502867C (en) Preparation of sinomenine as antineoplastic medicament
Subramaniyan et al. Molecular modeling studies of repandusinic acid as potent small molecule for hepatitis B virus through molecular docking and ADME analysis
CN102805829B (en) Preparation method of rhizoma smilacis glabrae extract and applications thereof in tumor treatment
CN103784427A (en) Pharmaceutical composition containing sesquiterpene eudesmanolide and application of pharmaceutical composition in pharmaceuticals
CN102727593A (en) New use of wild buckwheat rhizome and wild buckwheat rhizome extract in preparation of hypoglycemic medicine and healthcare food
Sárközi et al. Mineral element content of greater celandine (Chelidonium majus L.)
CN103211898B (en) Traditional Chinese medicine extractive and preparation method thereof
CN105770200A (en) Preparing method and application of coptidis-rhizoma shangqing tablets
CN104147072A (en) Methods for preparing roasted epimedium and medicinal liquor of roasted epimedium
CN105017376B (en) A kind of Herba Sarcopyramis nepalensis steroidal saponin and application thereof
CN1954845B (en) Sarcandra compound medical composite and its preparation method
Yeh et al. Downregulation of hepatitis B surface antigen expression in human hepatocellular carcinoma cell lines by HD‐03, a polyherbal formulation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20100421

Termination date: 20150509

EXPY Termination of patent right or utility model