CN1842591A - Method for elevation of oil levels in plants - Google Patents

Abstract

This present invention provides a method for increasing oil levels I corn kernel tissue by expression of an HOI001 GBSS allele. The present invention also provides isolated nucleic acid molecules encoding a HOI001 GBSS polypeptide.

Description

Improve the method for grease level in the plant

It is that June 27, application number in 2003 are U.S.60/483 that the application requires the applying date, the right of priority of 491 provisional application, and it incorporates this paper into way of reference.

The application relates to nucleic acid chemistry and agricultural biological technical field.Particularly, the present invention directly relates to coding and is used for increasing the evaluation of proteinic nucleic acid of maize plant grease level and the preparation that comprises the maize plant of this class nucleic acid.

Plant is the greasy main source that is used for feed, food and industrial use.Though all only contain a spot of grease in the tissue of most of plant species,, plantation certain plants kind can make that also a large amount of Vegetable oil lipoprotein is produced on very big acre area.If can increase the fat content in this class plant, then can produce Vegetable oil lipoprotein more efficiently.For example, conventional fat content is about 4% in the yellow dent corn of #2 (yellow#2, dent corn).If the fat content of corn can be increased to 8% or even 12%, so under the situation of not remarkably influenced output, can from half or even the cultivated area of 1/3rd acreages produce the grease of isodose.

At present, by traditional breeding and system of selection, can progressively increase the grease level in oilseeds (oilseed) crop.Almost there is not any reference to relate to the transgenic plant that the grease level improves.On the contrary, by in oilseeds, importing or handle the biosynthesis gene of various vegetable fatty acids, can improve the ratio of some important (strategic) lipid acid.For example, Voelker etc., record among the Science, 257:72-74 (1992): in Cruciferae (Brassicaceae) plant, express the medium chain acyl-ACP thioesterase that derives from California Bay, can increase lauric acid (12: 0) content.Hitz etc., Proc.9 ^ThInternationalCambridge Rapeseed Congress UK, pp 470-472 (1995) have put down in writing and have carried out common inhibition by the just construct with coded plant microsome FAD-2 (Δ 12) desaturase and increase oleic ratio in soybean (Glycine max) plant.Though adopt these plant transgenes can realize increasing the lauric output in the rape (canola) and change oleic ratio in the soybean, do not have evidence to show that it has increased the total fatty acid content in these transgenic plant, or increased grease yield.

Some people attempts to increase or regulate fat content in the plant by grease biosynthetic pathway gene is operated.For example, the United States Patent (USP) U.S.6 of Gengenbach etc. provides the nucleic acid of the corn acetyl CoA carboxylase that is used to change Vegetable oil lipoprotein content in 268,550.In addition, the United States Patent (USP) U.S.5 of Ohlrogge etc. provides Arabidopis thaliana (Arabidopsis) acetyl CoA carboxylase that can be used for increasing Vegetable oil lipoprotein content gene in 925,805.Yet the synergy of the many enzymes of synthetic needs of lipid acid does not wherein have a kind of enzyme to be found and has following attribute: can significantly increase fat content when only just transferring it to express separately.

Therefore, need a kind of improved method to be used for changing the fat content of plant, particularly increase the fat content in the Plants and Seeds.

Except grease, the starch in the corn has agricultural and significance economically equally.Starch has constituted the main component of animal-feed and human foods.Starch equally can be by industrial application, and it is used for the production of papermaking, weaving, plastics and tackiness agent, and the starting material that are used to be provided for some bio-reactor.

In higher plant, starch is made of straight chain that is known as amylose starch and amylopectin respectively and side chain dextran.In different plants, found to have the amylose starch of multiple content and the starch of amylopectin.Typically, W-Gum contains 25% the amylose starch of having an appointment, and remaining is an amylopectin.Amylopectin contains short chain and long-chain, and short chain is between the 5-30 glucose unit, and long-chain is between 30-100 or more between the glucosan unit.The ratio of straight chain and amylopectin, and the distribution of the short chain long-chain in the amylopectin component all can influence the physical property (for example, thermostability, retrogradation and viscosity) of starch.

The WAXY locus of corn has been determined the amylose content in pollen and the kernel endosperm, (Shure etc., Cell, 35 (1): 225-233 (1983)), thereby produced the starch with unique property.Coding particle mating type starch synthase (granule bound starchsynthase, the great majority sudden change at corn WAXY locus place GBSS) can produce in endosperm, pollen and blastular has the opaque endosperm of smooth, blocky non-keratinocyte starch, its amylose starch by most of amylopectin and reduction constitutes (" WAXY phenotype ") (referring to Okagaki and Wessler, Genetics, 120 (4): 1137-1143 (1988)).When in the WAXY mutant of isozygotying during synthetic no function GBSS, its while also lacks amylose starch (Echt and Schwartz, Genetics, 99:275-284 (1981)).

In addition, when comparing, can find with the #2 Semen Maydis, typically, recessive WAXY can only very faintly influence fat content (Pfahler and Linskens, Tlteoretical and applied Genetics, 41 (1): 2-4 (1971)) of kernel (about 0.5% increase).Comparatively speaking, inbred lines HOI001 is recorded in the dominance WAXY sudden change inbreeding body in the United States Patent (USP) that publication number is No.20030172416, has to exceed total kernel fat content of 4 times than #2 Semen Maydis, and above-mentioned patent is incorporated this paper into way of reference.

Summary of the invention

The present invention puts down in writing and provides the nucleic acid molecule of coding HOI001 GBSS polypeptide.In addition, the present invention relates to and the nucleic acid molecule complementary nucleic acid molecule of the HOI001 GBSS polypeptide of encoding.In addition, the present invention relates to comprise the expression cassette of these nucleic acid molecule.In addition, the present invention relates to contain the rotaring gene corn plant of this class expression cassette.In addition, the present invention relates to the seed of this class rotaring gene corn plant.The invention further relates to the grease and the animal-feed that derive from this class rotaring gene corn plant seed.

In another embodiment, the present invention relates to can be in vegetable cell the recombinant DNA construction body of performance function, it comprises the nucleic acid molecule that can handle the coding HOI001 GBSS polypeptide that is connected with promotor, and relevant with the increase of grease yield in the plant.

The present invention puts down in writing and provides a kind of increases greasy method in the maize plant by expressing the HOI001 gbss gene.The present invention further provides a kind of by expressing the method that the HOI001 gbss gene changes kernel component in the maize plant.The present invention further puts down in writing and provides the HOI001 gbss gene sequence that derives from corn (Zea mays).The present invention further provides the vector construction body that is used for Plant Transformation and tissue specific expression HOI001 gbss gene.The present invention further provides the maize plant that transformed with gbss gene, it is compared with the plant that has identical or similar genetic background but do not contain the HOI001 gbss gene of insertion has higher grease level.The present invention further provides the seed that derives from this class maize plant.The present invention further provides and derived from the kernel that adopts the maize plant that the HOI001 gbss gene transformed, it is compared with the maize plant kernel that contains the HOI001 gbss gene that has identical or similar genetic background but do not insert has higher grease level.The present invention also provides grease and the animal-feed that derives from these seeds and kernel.

The present invention further provides a kind of marker-assisted breeding method that is used for producing high grease level at corn.

The accompanying drawing summary

Fig. 1 has shown the particle mating type starch synthase gene (HOI001GBSS that separates from HOI001, pMON72506) [SEQ ID NO:1] and the particle mating type starch synthase gene (GBSS) that derives from inbreeding body LH59 are (pMON72510), and be recorded in Shure etc., supra, in the open sequence (X03935) of gbss gene between nucleotide sequence contrast (sequencealignment).For further comparison, provided the encoding sequence (CDS22509) of disclosed gbss gene.

Fig. 2 shown derive from respectively separation from the corresponding predicted amino acid sequence [SEQ ID NO:3] of the gbss gene (deriving from the HOI001 GBSS of pMON72506) of HOI001 with derive from gbss gene (X03935) contrast between predicted amino acid sequence [SEQ ID NO:4] accordingly that is recorded among the aforementioned Shure etc.

Fig. 3 has shown and has derived from separation respectively from the corresponding predicted amino acid sequence [SEQ ID NO:10] of the Zea mays of inbreeding body LH59 gbss gene and be recorded in contrast between the corresponding predicted amino acid sequence of Zea mays particle mating type starch synthase gene among aforementioned Shure etc.

Fig. 4 has described the pMON72506 plasmid map.

Fig. 5 has described the pMON72510 plasmid map.

Fig. 6 A and 6B have represented that in the mode of chart employing contains GBSS (the SEQ ID NO:1 that derives from HOI001, pMON72506 6A) transformed and adopted and contained GBSS (SEQ ID NO:8, the grease level difference in pMON72510 transformed plants kernel 6B) that derives from LH59.All carried out comparison in each incident to gene masculine and the negative kernel of gene.In 6A, only listed incident with significant grease variation (14/29ths) on the statistics.

Fig. 7 has described the pMON81464 plasmid map.

Fig. 8 has described the pMON68298 plasmid map.

Fig. 9 has described the pMON81465 plasmid map.

The sequence summary

SEQ ID NO:1 is the nucleotide sequence from the particle mating type starch synthase gene (deriving from the HOI001 GBSS of pMON72506) of HOI001.

SEQ ID NO:2 is the disclosed nucleotide sequence from the Zea mays GBSS of aforementioned Shure etc.

SEQ ID NO:3 is the predicted amino acid sequence that derives from the HOI001 GBSS of pMON72506.

SEQ ID NO:4 is the predicted amino acid sequence of the Zea mays GBSS that delivers such as aforementioned Shure.

SEQ ID NO:5 is the primer sequence of primer numbering 14543.

SEQ ID NO:6 is the primer sequence of primer numbering 14547.

SEQ ID NO:7 derives from the nucleotide sequence of dna molecular that corn is the GBSS of LH59 for coding.

SEQ ID NO:8 derives from the predicted amino acid sequence that corn is the GBSS of LH59.

SEQ ID NO:9 is the primer sequence of primer numbering 20095.

SEQ ID NO:10 is the primer sequence of primer numbering 20092.

SEQ ID NO:11 is the cDNA coding region of the GBSS of HOI001.

Detailed Description Of The Invention

As give a definition for helping to understand detailed description of the invention.

Phrase " coded sequence ", " code area ", " structure sequence " and " structural nucleic acid sequence " refers to comprise the physical arrangement that nucleotide sequence is arranged. Nucleotides is arranged with a series of triplets and is formed, and wherein each triplet forms a codon. Each codon coding one specific amino acid. The a series of amino acid thereby coded sequence, structure sequence and structural nucleic acid sequence are encoded, thus protein, polypeptide or peptide sequence formed. Coded sequence, structure sequence and structural nucleic acid sequence can be comprised in larger nucleic acid molecules, the carrier etc. In addition, the arranged sequentially of nucleotides can be put down in writing with the form of sequence table, figure, table, electronic media etc. in these sequences.

Phrase " codon degeneracy " refers to the difference (divergence) of genetic code, and it allows nucleotide sequence to change and does not affect the amino acid sequence of the polypeptide of its coding. Therefore, the present invention relates to following any nucleic acid fragment, it comprises the nucleotide sequence of encode complete or most amino acid sequence as herein described. Those skilled in the art know " codon preference " that particular host cell shows fully in the application of adopting nucleotides codon performance specific amino acids. Therefore, when synthesizing the nucleic acid fragment of the expression that is used for the raising host cell, nucleic acid fragment being designed, is that people are needed thereby make its codon usage frequency near the preferred codon usage frequency of host cell.

Term " cDNA " refers to derive from mRNA and the double-stranded DNA complementary with it.

Phrase " dna sequence dna ", " nucleotide sequence " and " nucleic acid molecule " are meant and comprise the physical structure that nucleotide sequence is arranged.Dna sequence dna or nucleotide sequence can be included in bigger nucleic acid molecule, the carrier etc.In addition, the series arrangement of these sequence amplifying nucleic acid can be put down in writing with forms such as sequence table, figure, table, electronic media.

" expression " is meant: genetic transcription produces corresponding mRNA and this mRNA translation produces corresponding gene product (for example peptide, polypeptide or protein).

" expression of sense-rna " is meant: DNA transcribe generation can with a RNA molecule of the 2nd RNA molecular hybridization, wherein the 2nd RNA molecule encoding is by negative gene product of transferring ideally.

As application herein, " gene " is meant the nucleic acid fragment of expressing specified protein, and it comprises before the encoding sequence (5 ' non-coding sequence) and the regulating and controlling sequence of (3 ' non-coding sequence) afterwards." natural gene " gene that be meant natural discovery and that carry himself regulating and controlling sequence." mosaic gene " be meant and be not natural gene, comprises regulation and control that native state exists not together and any gene of encoding sequence.Thereby mosaic gene can comprise the regulating and controlling sequence and the encoding sequence of different sources, or identical source but to be different from regulating and controlling sequence and the encoding sequence that natural existing way is arranged." native gene " is meant the natural gene that is present in natural site in the species gene group." foreign gene " or " transgenosis " is meant the non-natural gene by step of converting quiding gene group.

" (hemizygous) that narrow " is meant the diploid individuality (for example, because chromosome deletion) of the specific gene that only has a copy." isozygoty " and be meant the mutually homoallelic gene pairs that has in two homologous chromosomess.

" allogenic " is meant the two or more nucleic acid that derive from different sources or the relation between the protein sequence.For example, if described complex body is not normally naturally occurring, then promotor is allogenic for encoding sequence.In addition, particular sequence can be " allogenic " (for example, not being natural being present in this specific cells or the organism) for cell that it inserted or organism.

" homology " is meant two or more nucleic acid or the similar level of aminoacid sequence aspect position percent homology (for example sequence similarity or homology).Homology also refers to the notion of the identity function character in different nucleic acid or the protein.

" hybridization " is meant: when two nucleic acid chains had enough sequence complementarity, nucleic acid first chain and second chain were by the ability of hydrogen bond base pairing.As application herein, if two nucleic acid molecule demonstrate complete complementarity, then wherein nucleic acid molecule is considered to " complement " of another nucleic acid molecule.As application herein, when the Nucleotide of each Nucleotide of a part and another molecule was complementary, this two molecule was considered to show " complementary fully ".Hybridize each other when two nucleic acid chains can have enough stability, and then when allowing it to keep as-annealed condition each other under suitable condition, described two nucleic acid chains are considered to have enough complementarity.

Phrase " mark assisting sifting " or " marker-assisted breeding " are meant that genetic marker determining and screening has application aspect the plant of advantage phenotype potential.By the chain feature between marker gene work and character gene seat, can adopt the genetic marker of formerly determining relevant to disclose the genotype of character gene seat with one or more character gene seats.Can select to contain the allelic plant of purpose feature according to the genotype of its linked marker locus.

Phrase " breeding group " is meant based on identifying one or more hereditary heterogeneous (heterogeneous) colonies that purpose produced with individuality of purpose phenotypic characteristic.Term " phenotype " is meant the expression of viewed one or more plant characteristics.

" genetic marker " is any phenotypic difference based on morphology, biological chemistry or nucleic acid, and it has reacted dna polymorphism.The example of genetic marker includes but are not limited to RFLPs, RAPDs, allozyme, SSRs, and AFLPs.

Phrase " marker gene seat " is meant the position that the heredity of the dna polymorphism that genetic marker discloses is determined." character gene seat " is meant the position that the heredity of one or more genes (allelotrope) set is determined, described gene is relevant with observed feature.

Phrase " restriction fragment length polymorphism " (RFLP) is meant genetic marker based on DNA, wherein can be observed the difference in size (Botstein etc. that restricted endoenzyme is cut the dna fragmentation of generation by hybridization, Am.J.Huni..Gene t., 32:314-331 (1980)).

Phrase " randomly amplified polymorphic DNA " (RAPD) is meant genetic marker based on DNA, wherein used short, sequence primer at random, the amplified production that is obtained simultaneously is not of uniform size, and observe in the amplification pattern and there are differences (Williams etal., NucleicAcids Res., 18:6531-6535 (1990)).

Phrase " simple sequence repetition " (SSR) is meant genetic marker based on DNA cloning, the short amplified fragments of tandem repetitive sequence primitive (motifs) has wherein increased, the amplified production that is obtained simultaneously is not of uniform size, and observe Nucleotide multiple length and there are differences (Tautz, Nucleic Acids Res., 112:4127-4138 (1989)).

Term " AFLP " is meant the genetic marker based on DNA cloning, the dna fragmentation that produces of restriction enzyme (Vos etc. that are connected with the short dna fragment that helps restricted dna fragmentation to increase wherein, Nucleic Acids Res., 23:4407-4414 (1995)).Amplified fragments is not of uniform size, and observes in the amplification pattern and there are differences.

The functional spatial disposition of two or more nucleic acid region or nucleotide sequence " can be handled connection " and be meant in phrase.For example, promoter region can be positioned at the relevant position of nucleotide sequence, and this position makes can instruct transcribing of nucleotide sequence by promoter region.Thus, promoter region " can be handled connection " in nucleotide sequence.

Term " promotor " or " promoter region " are meant and are present in encoding sequence upstream (5 ') usually, can instruct nucleotide sequence to be transcribed into the nucleotide sequence of mRNA.Promotor or promoter region typically provide RNA polymerase and the correct recognition site of transcribing other required factor that starts.As shown here, promotor or promoter region comprise: by inserting or the disappearance regulation domain, make promotor at random or the variant of the promotor that produces of method such as rite-directed mutagenesis.Can be according to the amount of the RNA of its generation, or in cell or tissue the proteinic amount of cumulative, measure the activity or the intensity of promotor with respect to second promotor that adopts similar approach to measure.

Phrase " 3 ' non-coding sequence " is meant and is positioned at the downstream, coding region, comprises that polyadenylic acid recognition sequence and coding can influence the nucleotide sequence of other sequence of the conditioning signal of mRNA processing or genetic expression.The polyadenylic acid signal is a feature to influence the 3 ' end that the polyadenylic acid short chain is added into the mRNA precursor usually.3 different ' non-coding sequences be applied in Ingelbrecht etc., on the books among the Plant Celt 671-680 (1989).

" translation leader sequence " or " 5 ' non-translational region " or " 5 '-UTR " all are meant the nucleotide sequence between gene promoter sequence and encoding sequence.Described 5 '-UTR is present in the mRNA upstream of processing fully of translation initiation sequence.Described 5 '-UTR may influence process, mRNA stability or the translation efficiency that primary transcription is formed to mRNA.The example of translation leader sequence is on the books in (Turner and Foster, MolecularBioteclanology, 3:225 (1995)).

" rna transcription " is meant that RNA polymerase catalytic dna sequence transcribes the product of generation.When described rna transcription is the preferred complementary copy of dna sequence dna, be meant that it can be the primary transcription product, perhaps it can be to derive from the RNA sequence of the primary transcription product being transcribed post-treatment, perhaps is meant as mature rna." messenger RNA(mRNA) " (mRNA) is meant and do not comprise intron and can be translated into the RNA of polypeptide by cell." just RNA " thus be meant and comprise that mRNA can be become rna transcription of polypeptide by cell translation." sense-rna " be meant and purpose mRNA complementary rna transcription, thereby can produce specific RNA:RNA disome, and this is to form by the base pairing between sense-rna reactant and the purpose mRNA.

" recombinant vectors " is meant following medium arbitrarily, by this medium or therein, interested nucleic acid can increase, expresses or store, for example plasmid, clay, virus, autonomously replicating sequence, phage, or the DNA of wire strand, cyclic single strand, wire two strands or ring-type two strands or RNA nucleotide sequence.Described recombinant vectors can be any source, and can carry out genome conformity or self-replicating.

" regulating and controlling sequence " be meant and be positioned at encoding sequence upstream (5 '), among, or the nucleotide sequence of downstream (3 ').In addition, intron also may have regulation activity.Typically, the transcript and expression of encoding sequence is subjected to the existence of regulating and controlling sequence and the influence of disappearance.

" homology basically " be meant utilize the Omiga program to adopt default parameters (Version 2.0; Accelrys, San Diego CA), calculates 90% the sequence homogeny of having an appointment at least between two sequences through CLUSTAL W method.

" purifying basically " be meant with its native state under the common isolating basically molecule of other molecule of bonded.More preferably, the molecule of purifying is the main kind that exists in preparation basically.Basically the molecule of purifying can not contain up to about 60%, and more preferably from about 75% does not contain, and further preferred about 90% does not contain and most preferably from about 95% do not contain other molecule (except solvent) that is present in the natural mixture.The molecule to exist under its native state do not attempted to comprise in phrase " purifying basically ".

Term " conversion " is meant nucleic acid is imported among the acceptor host.Term " host " is meant bacterial cell, fungi, animal or zooblast, plant or seed or any plant parts or tissue, and it comprises vegetable cell, protoplasma, callus (calli), root, stem tuber, seed, stem, leaf, rice shoot, plumule and pollen.

As application herein, " transgenic plant " are to carry stable its genome that imports, for example, and the plant of the nucleic acid of nuclear or plasmon.

Term " seed " is understood that to have identical implication with " kernel ".The term kernel is through being usually used in describing the seed of corn or rice plants.In all plants, the ripe ovule that described seed is made up of kind of a skin, plumule in plant of the present invention, is meant endosperm.

HOI001 GBSS nucleic acid

The invention provides coding and separate from the particle mating type starch synthase (HOI001 GBSS) of the inbreeding body plant HOI001 nucleic acid of homologous polypeptide basically.In one embodiment, these nucleic acid molecule in the context of the invention are used for increasing the fat content of plant tissue.In one embodiment, the invention provides coding HOI001 GBSS proteinic isolating nucleic acid, described nucleic acid is selected from by SEQ ID NO:1 and complementary strand thereof, and has the group that the nucleic acid at least about 94% sequence homology constitutes with SEQ ID NO:3.The per-cent sequence homogeny of the polypeptide of nucleic acid encoding of the present invention is preferably at least about 95%, most preferably at least about 98%.

The present invention also provides the carrier that comprises this class HOI001 GBSS nucleic acid.As being described in further detail hereinafter, preferred nucleic acid comprises with it can handle the suitable controlling element that is connected, and described element helps to efficiently express nucleic acid of the present invention in the host, and described host includes but are not limited to bacterium, fungi or plant host.The carrier that uses in the context of the invention can comprise this class controlling element.

Nucleic acid that the present invention includes and carrier do not need its definite nucleotide sequence of write up in the text.Opposite, the sequence of this class nucleic acid and carrier can change, as long as described nucleic acid represents the function of its expection or has some other effect, for example, as the nucleic acid probe that is used for complementary nucleic acid.For example, in any part of HOI001 GBSS nucleic acid, some sequence variations allows, as long as adopt one or more polypeptide plant transformed of sudden change or variation can produce and the substantially similar phenotype of HOI001 GBSS.Most preferably, and have identical or similar genotype but do not have genetically modified plant to compare, above-mentioned sequence variations can cause grease cumulative rises in the plant tissue.

The fragment of SEQ ID NO:1 and the nucleic acid of variation are also included among the present invention.Comprise that there are 3 kinds of general types in nucleic acid fragment in the present invention.The first, non-total length but the nucleic acid fragment that demonstrates its expectation function really comprise in the present invention.The second, be also included among the present invention at this nucleic acid fragment that is considered to have the hybridization probe purposes.The 3rd, be considered to the nucleic acid fragment that can in inhibition technology known in the art, use at this, for example, antisense technology or RNA suppress (RNAi), become grease such as its carbon stream that is used for reducing plant, provide more carbon to be used for protein or starch is assembled.Therefore, nucleic acid sequence fragments, for example SEQ ID NO:1 can be at least about 15 Nucleotide, about 17 Nucleotide, about 18 Nucleotide, about 20 Nucleotide, about 50 Nucleotide, about 100 Nucleotide or more Nucleotide.In general, nucleic acid fragment of the present invention can have the length upper limit arbitrarily, as long as it relates to nucleic acid of the present invention on sequence, need not comprise its total length.

As application herein, " varient " with reference to or wild-type sequence compare and have substantially similar or homologous sequence basically.For the nucleotide sequence of coded protein, because the genetic code degeneracy, varient comprises that also coding and reference protein have those sequences of same acid sequence.Variant nucleic acid also comprises following nucleic acid, and its coding has the polypeptide of not quite identical aminoacid sequence with the determined protein of this paper but has the conservative active protein that changes in the encoding amino acid sequence.

The present invention is not limited only to the static change of described nucleotide sequence, and it also comprises the variant nucleic acid sequence that causes polypeptid acid sequence of the present invention that conservative change takes place.Owing to determine that protein biological function activity is protein interactions ability and characteristic, can carry out some aminoacid sequence in protein sequence replaces, certainly its basic dna encoding sequence also can change, and even so, still can obtain to have the protein of similar characteristics.The inventor thinks, can be in protein peptide sequence of the present invention or fragment, or carry out various changes in the corresponding dna sequence dna of the described peptide of encoding, its biological utilisation or active aspect do not produce perceptible loss, also be that the present invention is included.According to the present invention, reference nucleic acid of the present invention and varient are by one or more replacements, interpolation, insertion, disappearance, fusion and brachymemma, thereby there are differences aspect the coded aminoacid sequence, replacement, interpolation, insertion, disappearance, fusion and brachymemma can arbitrary combination, the active HOI001 GBSS protein as long as varient nucleic acid can be encoded.This class varient nucleic acid can not encoded and the identical aminoacid sequence of reference nucleic acid, but conserved sequence variation takes place for it.The codon that this class conserved amino acid replaces of encoding is well known in the art.

The another kind of method of determining that conserved amino acid replaces needs the analysis of considered amino acid hydrophilic index.Those skilled in the art can understand the hydrophile amino acid number usually in the importance (Kyte and Doolittle, J.Mol.Biol., 157:105-132 (1982)) of giving aspect the protein interaction biological function.Generally speaking, the relative wetting ability of amino acid is relevant with the secondary structure of polypeptide, thereby has determined described protein and other molecule, for example, and the interaction of enzyme, substrate, acceptor, DNA, antibody, antigen etc.

According to its hydrophobicity and charge characteristic each amino acid has been carried out hydrophilic index assignment (Kyte and Doolittle, J.Mol.Biol., 157:105-132 (1982)); These are: Isoleucine (+4.5), Xie Ansuan (+4.2), leucine (+3.8), phenylalanine (+2.8), halfcystine/Gelucystine (+2.5), methionine(Met) (+1.9), L-Ala (+1.8), glycine (0.4), Threonine (0.7), Serine (0.8), tryptophane (0.9), tyrosine (1.3), proline(Pro) (1.6), Histidine (3.2), L-glutamic acid (3.5), glutamine (3.5), aspartic acid (3.5), asparagine (3.5), Methionin (3.9) and arginine (4.5).

Carrying out this class when changing, preferably hydrophilic index is ± 2 with interior aminoacid replacement, and those are ± 1 with interior preferred especially, those ± 0.5 with interior being more preferably.

Be appreciated that equally in this area on the wetting ability basis and can effectively carry out similar aminoacid replacement.United States Patent (USP) 4,554, record is relevant with proteinic biological nature by the average wetting ability in the maximum site of protein of the wetting ability decision of its adjacent amino acid in 101.

As United States Patent (USP) 4,554, described in detail in 101, amino-acid residue has been carried out the wetting ability assignment: arginine (+3.0), Methionin (+3.0), aspartic acid (+3.0 ± 1), L-glutamic acid (+3.0 ± 1), Serine (+0.3), asparagine (+0.2), glutamine (+0.2), glycine (0), Threonine (0.4), proline(Pro) (0.5 ± 1), L-Ala (0.5), Histidine (0.5), Gelucystine (1.0), methionine(Met) (1.3), Xie Ansuan (1.5), leucine (1.8), Isoleucine (1.8), tyrosine (2.3), phenylalanine (2.5) and tryptophane (3.4).

Carrying out this class when changing, preferred hydrophilicity value is ± 2 with interior aminoacid replacement, and those are ± 1 with interior preferred especially, those ± 0.5 with interior being more preferably.

Can according to the homology degree of reference nucleic acid, determine and characteristic is described the varient nucleic acid of static and conservative variation.Preferred varient nucleic acid and reference nucleic acid of the present invention be homology basically.As is known to the person skilled in the art, the substantially similar nucleic acid of this class can be under rigorous condition and the defined reference nucleic acid hybridization of SEQ ID NO:1 herein.This class homologous nucleic acid basically is included in the scope of the invention.

Can detect and dissociation body nucleic acid by the standard hybridizing method.For detect or separate this class sequence and the hybridization carried out usually " medium rigorous ", preferably under " rigorous " condition, carry out.The experiment of the contextual nucleic acid hybridization of this paper is depended on sequence as the medium rigorous hybridization conditions that adopts in Southern and the northern hybrid experiment and relevant medium rigorous and rigorous hybridization wash conditions thereof, and different under the varying environment parameter.Longer sequence can be at specific hybrid under the comparatively high temps.The guide of the popularity of nucleic acid hybridization can be referring to Tijssen, Laboratory Techniques in Biochemistry and MolecularBiology-Hybridization with Nucleic Acid Probes, page 1, the 2nd chapter " Overview of principles of hybridization and the strategyof nucleic acid probeassays " Elsevier, NY (1993).Also can be referring to J.Sambrook etc.: Molecular Cloning:A Laboratory Manual, ColdSpring Harbor Press, NY, pp 9.31-9.58 (1989); J.Sambrook etc., Molecular Cloning:A Laboratory Manual, Cold Spring HarborPress, NY (3rd ed.2001).

The present invention also provides and has detected and the method for separating coding proteinic derivative provided herein or varient nucleic acid.This method relate to comprise about the nucleic acid of the SEQID NO:1 any part of HOI001 GBSS correlated series to small part and sample nucleic acid hybridization, thereby form hybridization complex; And detection hybridization complex.The existence of complex body is relevant with the existence of derivative or varient nucleic acid, can and be used for determining when being converted into plant whether derivative or varient have kept the test of the ability of grease level in the plant tissue that increases further to identify above-mentioned nucleic acid by nucleic acid sequencing, RNA and/or protein expression.Generally speaking, the nucleic acid moiety that is used to hybridize, comprise SEQ ID NO:1 any part is preferably at least 15 Nucleotide, and hybridization carries out under enough rigorous hybridization conditions, thereby allows detection and be separated to homologous nucleic acid basically; Preferably, described hybridization conditions is " medium rigorous ", and more preferably, described hybridization conditions is " rigorous ", and above-mentioned condition has definition in this article with in traditional Protocols in Molecular Biology background well known in the art.

Generally speaking, under ionic strength of determining and pH condition situation, highly rigorous hybridization and wash conditions are selected for use than the low about 5 ℃ condition of specific double-stranded sequence heat fusion joint.For example, under " highly rigorous condition " or " highly rigorous hybridization conditions ", the degree of nucleic acid and the hybridization that its complementary strand takes place will be than higher with the degree of other sequence hybridization, and this is can detected height (for example, exceeding 2 times of backgrounds at least).By the rigorous degree of control hybridization and/or wash conditions, 100% complementary nucleic acid can be identified with separating and be obtained.

Typically, rigorous hybridization conditions is: salt concn is lower than about 1.5M Na ion, typically, about 0.01 to 1.0M Na ionic concn (or other salt), pH 7.0 to 8.3, and for temperature the short probe (for example, 10 to 50 Nucleotide) at least about 30 ℃, temperature is at least about 60 ℃ (for example, more than 50 amino acid) for long probe.By add destabilizing agent for example methane amide also can realize rigorous condition, hybridization temperature can be lowered in this case.(50 * Denhardt ' s is 5%Ficoll, and 5% polyvinylpyrrolidone 5%BSA) also can be included in the hybridization reaction solution for T 500 (dextran sulfate) and/or Denhardt ' s solution.

The example of low rigorous condition comprises adopting to have 30 to 50% methane amides, (20 * SSC is 3M NaCl to 5 * SSC, 0.3M trisodium citrate), the 50mM sodium phosphate, pH7,5mM EDTA, 0.1%SDS (sodium laurylsulfonate), the damping fluid that adds 5 * Denhardt ' s of 100 μ g/ml sex change salmon sperm dnas is hybridized under 37 ℃, and places 1 * to 5 * SSC (20 * SSC is 3.0M NaCl and 0.3M trisodium citrate), among the 0.1%SDS 37 ℃ of washings down.The example of medium rigorous condition comprises adopting to have 40 to 50% methane amides, 5 * SSC, the 50mM sodium phosphate, pH7,5mM EDTA, 0.1%SDS, the damping fluid that adds 5 * Denhardt ' s of 100 μ g/ml sex change salmon sperm dnas is hybridized under 42 ℃, and place 0.1 * to 2 * SSC, among the 0.1%SDS 42 ℃ to 55 ℃ washings down.The example of highly rigorous condition comprises adopting to have 50% methane amide, 5 * SSC, the 50mM sodium phosphate, pH7.0,5mM EDTA, 0.1%SDS, the damping fluid that adds 5 * Denhardt ' s of 100 μ g/ml sex change salmon sperm dnas is hybridized under 42 ℃, and place 0.1 * SSC, wash down at 60 ℃ to 65 ℃ among the 0.1%SDS.

In another embodiment of the present invention, utilize routine analyzer well known in the art, define nucleic acid of the present invention according to specific nucleic acid and with the relation of per-cent homogeny between other species of guiding principle.This alanysis program include but not limited to: and the CLUSTAL in the PC/Gene program (can be from Intelligenetics, Mountain View, CA, or Omiga program version2.0Accelrys Inc., San Diego, CA obtains); ALIGN program (Version2.0); And Wisconsin Genetics software package, the GAP among the Version8 (can be from GeneticsComputer Group (GCG), 575 Science Drive, Madison, WI acquisition), BESTFIT, BLAST, FASTA, and TFASTA.Adopt default parameters, utilize these programs can carry out sequence alignment.CLUSTAL program write up is in Higgins etc., Gene, 73:237-244 (1988); Higgins etc., CABIOS, 5:151-153 (1989); Corpet etc., Nucleic Acids Res., 16:10881-10890 (1988); Huang etc., CABIOS, 8:155-165 (1992); With Pearson etc., Meth.Mol.Biol. is among the 24:307-331 (1994).The ALIGN program is based on Meyers ﹠amp; The Miller algorithm, referring to Computer Applic.Biol.Sci., 4:11-17 (1988).Altschul etc., the blast program of record is based on Karlin ﹠amp among the J.Mol.Biol., 215:403 (1990); The Altschul algorithm, referring to Proc.Natl.Acad.Sci.U.S.A., 87:2264-2268 (1990).Purpose based on the comparison in order to realize the breach comparison, can adopt to be recorded in Altschul etal. Nucleic AcidsRes., the Gapped BLAST among the 25:3389 (1997) (carrying out with BLAST 2.0).Perhaps, PSI-BLAST (with BLAST2.0) thus but can be used for carrying out distance relation between the repeated retrieval detection molecules.Referring to Altschul etc., supra..When adopting BLAST, Gapped BLAST during PSI-BLAST, can adopt default parameters in the described program (for example, be used for the BLASTN of nucleotide sequence and be used for proteinic BLASTP) respectively.The default value that BLAS TN program (being used for nucleotide sequence) adopts is: byte length (W) 11, and expected value (E) 10, brachymemma 100, M=5, N=-4, and carry out two strands relatively.For aminoacid sequence, the default value that the BLASTP program adopts is: byte length (W) 3, and expected value (E) 10 and BLOSUM62 keep the score matrix (referring to Henikoff﹠amp; Henikoff, Proc.Natl.Acad.Sci.U.S.A., 89:10915 (1989)) (referring to http://www.ncbi.nlm.nih.gov.).Comparison also can be undertaken by artificial observation.

With regard to purpose of the present invention, preferred BLASTN (version 1.4.7 or the higher) program that adopts its default parameters of utilization, or any program that other is equal to compares nucleotide sequence, thereby determines the sequence per-cent homogeny between itself and nucleotide sequence disclosed herein." equivalent procedures " is meant following sequence comparison program arbitrarily, for any two sequences of inquiring about, compare with the corresponding comparative result of preferable procedure gained, described program can produce the comparison result with identical Nucleotide or amino-acid residue coupling and identical sequence per-cent homogeny.

Expression vector and expression cassette

Expression vector of the present invention and expression cassette comprise the nucleic acid of coding HOI001 GBSS.The transgenosis that comprises HOI001 GBSS can be by subclone to expression vector or expression cassette, and the expression of HOI001GBSS can be detected and/or measure.This screening method can be used for being accredited as transgenosis and the expression of HOI001 GBSS in the plant transformed cell that HOI001GBSS expresses to be provided.

The plasmid vector that can easily screen in protokaryon and eukaryotic cell, amplification and transgenosis transforms comprises: for example, the pUC-serial carrier, the pSK-serial carrier, the pGEM-serial carrier, the pSP-serial carrier, the pBS-serial carrier is used for pFastBac (the Invitrogen Corporation of baculovirus expression, Carlsbad is CA) with the pYES2 (Invitrogen) that is used for yeast expression.In this class carrier, also can there be other element, comprise the replication orgin that can make the carrier self-replicating, the selected marker, its optimized encoding microbiotic or Herbicid resistant can allow coded gene or the specific multiple clone site of dna sequence dna and the sequence of enhancing protokaryon and eukaryotic cell conversion of multidigit point insertion in transgenosis.A kind of carrier that can be used for plant and procaryotic cell expression is double base Ti-plasmids (disclosed like that as the United States Patent (USP) 4,940,838 of Schilperoot etc.), for example carrier pGA582.Once at Methods in Enzymology, 153:292 had description in (1987) to this double base Ti-plasmids carrier in the past.This class double base Ti carrier can for example duplicate in E.coli and the Agrobacterium (Agrobacterium) on the protokaryon bacterium.The Agrobacterium plasmid vector also can be used for transgenosis is transferred in the vegetable cell.Described double base Ti carrier preferably includes and can effectively carry out T DNA left margin and the right margin that vegetable cell transforms, and selectable marker gene is positioned at the specific multiple clone site of T borderline region, and colE1 replication orgin and host range be replicon widely.Carry the genetically modified double base Ti of the present invention carrier and can be used for transforming protokaryon and eukaryotic cell, but it is preferred for transformed plant cells (referring to Glassman etc., U.S. patent 5,258,300).The example of plant expression vector comprises business-like carrier pBI101, pBI101.2, and pBI101.3, and pBIN19 (Clontech, PaloAlto, CA).

Generally speaking, except the nucleic acid of coding HOI001 GBSS, expression vector of the present invention and expression cassette also comprise at least: can be in vegetable cell the promotor and the terminator of expressed rna.Other element also can be present in the expression cassette of the present invention.For example, expression cassette also can contain, enhanser, intron, untranslated leader, cloning site, in order to eliminate matrix attachment regions and known other element of those skilled in the art of the influence of karyomit(e) controlling elements.

Expression cassette has the promotor of energy regulate gene expression.In eucaryon and prokaryotic cell prokaryocyte, promoter region typically is positioned at the flank of upstream of coding region dna sequence dna.Promoter sequence is used to regulate and control transcribing of downstream gene sequence, and comprises that typically about 50 is right to about 2000 nucleotide bases.Promoter sequence also comprises regulating and controlling sequence, for example can influence the enhancer sequence of gene expression dose.Some isolating promoter sequence can be used for heterologous gene, promptly is different from natural or homogenic expression of gene.Promoter sequence can knownly be strong or weak or induction type.Strong promoter can provide high-caliber genetic expression, and weak promoter can only provide very low-level genetic expression.Inducible promoter is the reagent or the environment that can add external source or grows to stimulate to produce and reply and the promotor of opening and closing genetic expression.Promotor also can be used for tissue specificity or grows and regulate.For heterologous gene is that the isolating promoter sequence of strong promoter is useful, because it can provide the genetic expression of enough levels, thereby allows easily to detect and screen transformant, and when wishing, can provide high-caliber genetic expression.Preferentially in seed tissue, express, and can't detected transcription initiation zone to be considered to improve for the seed grease in other plant parts be ideal very that this is to minimize for any destructiveness or the side effect that makes gene product.

But promotor of the present invention generally includes and is not limited only to, and has the promotor of function in bacterium, vegetable cell or plastid.The useful promotor that is used for bacterial expression is lacZ, T7, T5, or E.coli glg C promotor.Useful promotor comprises the wheat high-molecular-weight glutenin promoter (2647-3895bp of Genbank registration number X12928 in the vegetable cell, version X12928.3, the original Anderson etc. that is recorded in, Nucleic AcidsRes., 17:461-462 (1989)), glb promoter is (referring to Belanger and Kriz, Genet., 129:863-872, (1991)), γ zein Z27 promotor is (referring to U.S.SerialNumber 08/763,705; With Lopes etc., Mol Gen Genet., 247:603-613 (1995)), L3 oleosin promotor (U.S. patent 6,433,252), CaMV35S promotor (Odell etc., Nature, 313:810 (1985)), CaMV 19S (Lawton etc., Plant Mol.Biol., 9:31F (1987)), nos (Ebert etc., Proc.Natl.Acad.Sci.U.S.A, 84:5745 (1987)), Adh (Walker etc., Proc.Natl.Acad.Sci.U.S.A, 84:6624 (1987)), sucrose synthase (Yang etc., Proc.Natl.Acad.Sci.U.S.A, 87:4144 (1990)), tubulin, Actin muscle (Wang etc., Mol.Cell.Biol., 12:3399 (1992)), cab (Sullivan etc., Mol.Gen.Genet., 215:431 (1989)), PEPCase promotor (Hudspeth etc., Plant Mol.Biol., 12:579 (1989)), or those promotors relevant (Chandler etc., The Plant Cell, 1:1175 (1989)) with the R gene complex.

In fact, in a kind of preferred embodiment, the promotor that is adopted is expressed at the endosperm camber.The example of promotor comprises that those derive from the promotor of zein (zein), and they are one group of storage proteins finding in corn embryosperm.Genomic clone for the zein gene also is split into (Pedersen etc., Cell, 29:1015-1026 (1982) and Russell etc., Transgenic Res., 6 (2): 157-168 (1997)), also can adopt from these clones' promotor, described promotor comprises 15KD, 16KD, 19KD, 22KD and 27KD gene (Z27, U.S. sequence numbering 08/763,705; And Reina etc., Nucl.AcidsRes., 18:6426 (1990), Lopes etc., Mol.Gen.Genet., 247:603-613 (1995)).Known other preferred promoter that has function in corn and other plant comprises the startup word that is used for following gene: WAXY (particle mating type starch synthase; Shure etc., Cell, 35:225-233 (1983); Russell etc., Transgenic Res., 6 (2): 157-168 (1997)), Brittle 2 and Shrunken 2 (ADP glucose pyrophosphorylase (pryophosphorylase), Anderson etc., Gene, 97:199-205 (1991), Russell etc., Transgenic Res., 6 (2): 157-168 (1997)), Shrunken1 (sucrose synthase, Yang and Russell, Proc.Natl.Aca d.Sci.U.S.A, 87:4144-4148 (1990)), q enzyme I and II, paddy rice WAXY promotor (Terada etc., Plant Cell Physiology, 41 (7): 881-888 (2000)), debranching factor, gluten (Zheng etc., Plant J., 4:357-366 (1993), Russell etc., Transgenic Res., 6 (2): 157-168 (1997)), and Betll (substrate endosperm transfer layer; Huero s etc., Plant Physio., 121:1143-1152 (1999)).Those skilled in the art are known, other useful promotor in the invention process, are also included among the present invention.

In addition, transcriptional enhancer or enhanser copy can be used for increasing the expression from specific promotor.The example of this class enhanser includes but are not limited to, and derives from the element (Last etc., U.S. patent 5,290,924) of CaMV 35S promoter and octopine synthase gene.Dna sequence dna between transcription initiation site and encoding sequence starting point, promptly untranslated leader can influence expression of gene, and the technician also wishes to adopt specific leader sequence.Any leader sequence that those skilled in the art can obtain all can adopt.Preferred leader sequence can instruct the expression of the optimum level of appended gene, for example, and by increasing or maintenance mRNA is stable and/or by preventing to translate incorrect initial (Joshi, Nucl.Acid.Res., 15:6643 (1987)).Judge the selection of this class sequence by those skilled in the art.Derive from the sequence of higher plant and the gene that particularly efficiently expresses in soybean, corn and rape is included in.

Expression cassette of the present invention also is included near the sequence described expression cassette 3 ' end, and it is had an effect as signal, to stop deriving from transcribing of heterologous nucleic acids, instructs the mRNA polyadenylic acidization that is obtained simultaneously.It is commonly referred to as 3 ' non-translational region or 3 ' UTRs.Some the 3 ' element that can be used as the transcription termination signal use comprises wheat HSP17 3 ' UTR (532-741bp position of GenBank X13431, version X13431.1, McElvain and Spiker, Nucleic AcidsRes., 17:1764 (1989)), those derive from 3 ' UTR (Bevan etc. of the nopaline synthase gene of Agrobacterium tumefac ì ens, Nucl.Acid Res., 11:369 (1983)), napin 3 ' UTR (Kridl etc., Seed Sci Res., 1:209-219 (1991)), sphaeroprotein 3 ' UTR (Belanger and Kriz, Genetics, 129:863-872 (1991)), perhaps derive from the zein gene, 3 ' UTR of Z27 (Lopes etc., Mol Gen Gebiet., 247:603-613 (1995)) for example.Known other the 3 ' element of those skilled in the art all can use in carrier of the present invention.

When wishing, controlling element, Adh introne 1 (Callis etc. for example, GenesDevelop., 1:1183 (1987)), rice actin intron (McElroy etc., Mol.Gell.Genet., 231 (1): 150-160 (1991)), sucrose synthase intron (Vasil etc., Plant Physiol., 91:5175 (1989)), corn HSP70 intron (Rochester etc., EMBO J., 5:451-458 (1986)) or TMV ω element (Gallie etc., The Plant Cell, 1:301 (1989)) also can further be included.Can adopt as An, Methods inEnzymology, the described method of 153:292 (1987) obtains these 3 ' untranslated regulating and controlling sequences, and this class sequence also can be present in can be from the plasmid that commercial source is buied, Clontech for example, Palo Alto, CA.3 ' end of any heterologous nucleic acids that the expression cassette that 3 ' untranslated regulating and controlling sequence can be operably comprises with carrier of the present invention is expressed is connected.Other useful in the invention process this class controlling element belongs to those skilled in the art's technique known, and it also can place carrier of the present invention.

Can adopt other codon of coding same amino acid to replace one or more codons and make described polypeptide can under the translating mechanism of the plant species that carrier imports, carry out best translation, thereby optimize carrier of the present invention and the claimed expression of coding region in plant of this paper.

Selected marker

Selected marker or reporter gene also can be used for the present invention.This genoid brings unique phenotype can for the cell of presentation markup gene, thereby can allow this class cell transformed and the cellular regions of not carrying mark are separated.The selected marker has a kind of by chemical means, just by using selective reagent (for example, weedicide, microbiotic or its analogue) to come the characteristic of " selection ".Reporter gene, or screening-gene has and can and test the feature that just " screening " (for example, R-site characteristic) identified by observation.Obviously, much the example of suitable marker gene is well known in the art, and can adopt in enforcement of the present invention.

A lot of selected markers are known in the art, and can use in the present invention.The preferred selected marker that can use in the present invention comprises the gene that the weedicide such as glyphosate is had resistance, for example EPSP (Della-Cioppa etc., Bio/Teclmology, 5 (6): 579-84 (1987)).Particularly preferred selected marker comprises the gene (Hinchee etc., Biotech., 6:915 (1988)) of the EPSP synthase protein of coding variation.Can include but are not limited to other possible selected marker that the present invention unites use: neo gene (Potrykus etc., Mol.Gen.Genet., 199:183 (1985)), its coding kalamycin resistance also can be by adding for example geneticin (Sigma Chemical Company of kantlex, kantlex analogue, St.Louis MO) waits and screens; The bar gene of coding bialaphos resistance; Nitrilase gene for example derives from the bxn of Klebsiellaozaenae, and it has resistance (Stalker etc., Science, 242:419 (1988)) to bromoxynil; Mutant acetolactic acid sy nthase gene (ALS), it gives the resistance (EP 154 204A1 (1985)) that imidazolone, sulfonylurea or other ALS is suppressed compound; The DHFR gene of Rheumatrex resistance (Thill et al., J.Biol.Chem., 263:12500 (1988)); The dalapon dehalogenation enzyme gene that weedicide dalapon is had resistance.When adopting sudden change epsp synthase gene, can obtain extra effect by mixing suitable plastid transit peptides (CTP).

But adoptable selection markers includes but are not limited to: GRD beta-glucuronidase or uidA gene (GUS), and its coding has the enzyme of multiple known chromogenic substrate; R-locus gene, the product of its coding can be regulated and control (Dellaporta etc., In Chromosome Structure and Function, pp.263-282 (1988)) to the production of anthocyanin pigment (red pigment) in the plant tissue; β-Nei Xiananmei gene (Sutcliffe, Proc.Natl.Acad.Sci.U.S.A., 75:3737 (1978)), its coding have the enzyme (for example, PADAC, a kind of colour developing cynnematin) of multiple known chromogenic substrate; XylE gene (Zukowsky etc., Proc.Natl.Acad.Sci.U.S.A., 80:1101 (1983)), its coding transforms the catechol dioxygenase enzyme of colour developing catechol; Alpha-amylase gene (Ikuta etc., Biotech., 8:241 (1990)); Tyrosinase cdna (Katz etc., J.Gen.Microbiol., 129:2703 (1983)), its coding can be oxidized to tyrosine the enzyme of DOPA and DOPA quinone (dopaquinone), and above-mentioned substance concentrates the Compound Black pigment that can form easy detection; Beta-galactosidase gene, its a kind of enzyme of encoding with chromogenic substrate; Fluorescein (lux) enzyme gene (Ow etc., Science, 234:856 (1986)), it allows the carrying out of bioluminescent detection; Or aequorin (Aequorin) gene (Prasher etc., Biochem.Biophys.Res.Comm., 126:1259 (1985)), it can adopt in the responsive bioluminescent detection of calcium, or green fluorescence protein gene (Niedz etc., Plant Cell Reports, 14:403 (1995)).In preferred embodiments, screenable marker gene with as Kriz etc., at United States Patent (USP) 6,307, the aleurone specificity promoter of being put down in writing in 123 operably connects.

Except the plant consideration conveyization, the present invention also comprises directly to the genomic conversion of plant plastid.Therefore, also can realize the cell chamber of gene product target to the vegetable cell by directly gene being transported to cell inner cavity chamber.In some embodiments, directly carry out the plastom conversion and can bring the benefit that exceeds outside the consideration conveyization.For example, directly carry out HOI001 GBSS plastid transform then need not the plastid target polypeptide and, and to the post-translational transport and the course of processing of the carrying out of the precursor protein matter that obtains from corresponding consideration convey beggar.Plant plastid transforms and is recorded in P.Maliga, Current Ppinion in Plant Biology, 5:164-172 (2002), Heifetz, Biochimie, 82:655-666 (2000), Bock, J.Mol.Biol., 312:425-438 (2001), with Daniell etc., Trends in Plant Sicence, in 7:84-91 (2002) and the reference quoted thereof.

After having made up the transgenosis that contains HOI001 GBSS, expression vector or expression cassette can be imported in the vegetable cell then.According to the type of vegetable cell, the level of genetic expression and the enzymic activity of genes encoding, the DNA of coding HOI001 GBSS is imported vegetable cell the fat content in the plant tissue is increased.

Plant Transformation

Adopt nucleic acid construct, for example the technology of carrier transformed plant cells, plant tissue, plant organ or plant is known in the art.For example, these class methods comprise plant tissue culture technique.As application herein, " conversion " is meant: nucleic acid is imported the acceptor host and express in the host.

Vegetable cell, plant tissue, plant organ or plant can contact with carrier by any suitable mode known in the art.Preferably, produce the transgenic plant that to express target protein matter.Being used for the whole bag of tricks that polynucleotide of interest sequence with coding target protein matter imports vegetable cell includes but are not limited to: (1) physical method, microinjection (Capecchi for example, Cell, 22 (2): 479-488 (1980)), electroporation (Fromm etc., Proc.Nat.Acad.Sci.U.S.A., 82 (17): 5824-5828 (1985); U.S. patent 5,384, and 253), and conversion (Christou etc., Bio/Technology, the 9:957 (1991) of microparticle bombardment mediation; Fynan etc., Proc.Nat.Acad.Sci.U.S.A., 90 (24): 11478-11482 (1993)); (2) virus-mediated method for transformation (Clapp, Clin.Perinatol., 20 (1): 155-168 (1993); Lu etc., J.Exp.Med., 178 (6): 2089-2096 (1993); Eglitis ﹠amp; Anderson, Biotechniques, 6 (7): 608-614 (1988); (3) method for transformation of Agrobacterium mediation.

The most frequently used method of transformed plant cells is the DNA method for transformation (Fraley etc., Proc.Nat.Acad.Sci.U.S.A., 80:4803 (1983)) of Agrobacterium mediation and the method for microparticle bombardment mediation.Typically, consideration conveyization is an ideal, but to plastid, for example to carry out specific conversion also be ideal for chloroplast(id) or amyloplast, in specific plant species, for example in tobacco, Arabidopis thaliana (Arabidopsis), potato and rape (Brassiaca) species, can adopt the method for transformation of microparticle bombardment mediation that polynucleotide of interest is converted in the plant plastid.

Can realize agriculture bacillus mediated conversion by what employing Agrobacterium (Agrobacterium) belonged to through genetically engineered soil bacteria.Some Agrobacterium species can mediate the transfer of the specific DNA that is known as " T-DNA ", " T-DNA " thus can any target DNA fragment can be imported in many plant species through genetically engineered.The critical event that the pathogenic course of sign T-DNA mediation takes place is: the importing of virulent gene, processing, the transfer of T-DNA.This process is theme (Ream, Ann.Rev.Plrytopatlaol., the 27:583-618 (1989) of many reference; Howard ﹠amp; Citovsky, Bioassays, 12:103-108 (1990); Kado, Crit.Rev.Plant Sci., 10:1-32 (1991); Zambryski, Annual Rev.Plant Pliysiol.Plant Mol.Biol., 43:465-490 (1992); Gelvin, In Transgenic Plants, Kung and Wu, (eds.), Academic Press, SanDiego, CA, pp.49-87 (1993); Binns and Howitz, In BacterialPathogenesis of Plants and Animals, Dang, (ed.) .Berlin:Springer Verlag, pp.119-138 (1994); Hooykaas andBeijersbergen, Ann.Rev.Phytopathol., 32:157-179 (1994); Lessl and Lanka, Cell, 77:321-324 (1994); Zupan and Zambryski, Annual Rev.Phytopathol., 27:583-618 (1995)).

Agriculture bacillus mediated plant genetic transforms and relates to many steps.The first step, will cause a disease earlier Agrobacterium and vegetable cell are in contact with one another, and it is commonly referred to as " inoculation ".By outwelling or the mode of sucking-off will contain the liquid of Agrobacterium from removing with the explant state of contact.After the inoculation, make Agrobacterium and vegetable cell/be organized in be fit to grow together under the condition that growth and T-DNA shift a few hours extremely several days or longer time.This step is known as " cultivating altogether ".Cultivate altogether and after T-DNA transported, employing sterilant or fungistat were handled vegetable cell, thereby kill with explant and/or contain Agrobacterium residual in the container of explant.If this step is can promote to carry out under the situation of transgenic cell than any selective reagent of non-transgenic plant cell preferred growth in shortage, this step typically is known as " delay " step so.If carry out under the selection pressure situation that is beneficial to transgenic plant cells having, it is known as " selection " step so.When using " delay ", typically, followed one or more " selection " step." delay " and " selection " step all typically comprises the sterilant or the fungistat that can kill any residual agrobatcerium cell, and this is because after infecting (inoculation and cultivation altogether) step, the growth of agrobatcerium cell is that people do not infer.

The wild-type of many Ti of carrying or Ri plasmid and mild (disarmed) agrobacterium tumefaciens (Agrobacterium tumefaciens) and Agrobacterium rhizogenes (Agrobacteriumrhizogenes) all can be used for carrying out gene transformation to plant.Described Agrobacterium host is contained mild Ti or Ri plasmid, and it does not contain the oncogene that can cause tumour to take place or take root, and it can be used as carrier and uses, and contains the interested gene that is imported into subsequently in the plant.Preferred bacterial strain includes but are not limited to: agrobacterium tumefaciens bacterial strain C58, and this is to be used for nopaline type (nopaline-type) bacterial strain that mediated dna is converted into vegetable cell; Octopine type (octopine-type) bacterial strain is LBA4404 for example; Or succinamopine-type bacterial strain, for example EHA101 or EHA105.Be fed to appropriate host for example among the E.coli with the nucleic acid molecule of the external preparation of DNA composition forms, and with Agrobacterium hybridization, or directly be converted in the competence Agrobacterium.It is known that these technology are those skilled in the art.

Described Agrobacterium can by direct inoculation glycerine stock solution to liquid nutrient medium (for example, Luria Burtani (LB) substratum), or get that the glycerine stock solution is streak culture to be prepared to the mode of solidifying substratum, wherein allow bacterium in the suitable selectivity condition, general about 26 ℃-30 ℃, or about 28 ℃ cultivated down, and picking mono-clonal or a little transfering loop Agrobacterium are seeded in the liquid nutrient medium that contains selective reagent from flat board.Cultural method of Agrobacterium and the culture condition that is fit to, and inoculation step subsequently is those skilled in the art and is familiar with.The density of the Agrobacterium culture that is used to inoculate can change according to the different of system with the ratio of explant with agrobatcerium cell, therefore all wishes for any method for transformation for these Parameter Optimization.

Typically, the Agrobacterium culture is inoculated in streak plate or glycerine stock solution, and overnight incubation, and adopts the substratum be suitable for inoculating explant to wash and resuspended above-mentioned bacterial cell.

As for microparticle bombardment technology (U.S. patent 5,550,318; 5,538,880; With 5,610,042; And PCT publication number WO 95/06128; The mode that each piece all quoted is in full incorporated this paper into), adopt the nucleic acid bag by particle and by in the thruster transfered cell.The particulate example comprises tungsten, platinum and preferred gold.It should be noted that in some cases it is not that to utilize the microparticle bombardment technology that DNA is imported recipient cell necessary that DNA is deposited on the metallic particles.But, it should be noted that particle can contain DNA rather than be wrapped quilt by DNA.Therefore, though the particle of DNA bag quilt can increase the level of DNA through the partickle bombardment transfered cell, itself is not essential.

For the bombardment technology, the cell of suspension need be concentrated on film or the solid medium.Perhaps, rudimentary plumule or other purpose cell can be arranged on the solid medium.Cell to be bombarded is placed under the particulate stop board according to suitable distance.

Is Biolistics Particle Delivery System (BioRad by microprojectile bombardment methods with a kind of exemplary that DNA imports vegetable cell, Hercules, CA), it can be used for advancing the particle of DNA or cell envelope to pass a web plate (screen), for example stainless steel or Nytex web plate arrive the screen plate surface of the monocot plant cell that is coated with suspension culture.Described web plate can make particles dispersed open, thereby particle can not import recipient cell in the mode of agglomerate aggregation.Can believe that insertion grenade instrumentation and the web plate of waiting to bombard between the cell can reduce the size of throwing aggregation, and damage, thereby help improving the frequency of conversion by having reduced the excessive recipient cell that causes of projectile.

In order to carry out the microparticle bombardment experiment, the experimenter adheres to DNA (just " bag quilt ") on particulate, thereby DNA is imported into recipient cell in the mode that is suitable for its conversion.In this respect, in order to transform, at least some DNA to be transformed must arrive the purpose cell, simultaneously on DNA described in the DNA importing process must be attached to particulate.Therefore, after particulate imports the purpose cell, obtain the physics reversal procedures that DNA can comprise connecting key between DNA to be transformed and the particulate from particulate.But, when the purpose cell obtain DNA be DNA or other physical attachment that covers particulate molecule the fracture of not binding fragment as a result the time, then situation just needn't be such.Directly or indirectly be attached to the result of the associative key fracture between the molecule on the particulate as DNA to be transformed and other, can realize further that described DNA obtains.It should be noted that further the purpose transformation is to realize by the direct reorganization between DNA to be transformed and recipient cell genomic dna.Therefore, as application herein, the particulate of " coated " can be the particulate that can be used to transform the purpose cell, and wherein said DNA to be transformed can be imported into the purpose cell, and described purpose cell can obtain this DNA and then realize conversion.

The bag that any permission DNA to be transformed imports the purpose cell all can be adopted by the technology of particulate.Having confirmed well to be applied to bag of the present invention is had been described in detail in this article by the method for particulate.But also can adopt other technology that DNA is bonded on the particulate.For example, the DNA end that can adopt Streptavidin (streptavidin) and have long-chain mercaptan (Thiol) cleavable biotinylated nucleotide chain mark wraps by particle.Described DNA is attached on the particle by the interaction between Streptavidin-vitamin H, but thereby the reductive agent that exists in the cell reduces the mercaptan connecting key discharges DNA in cell.

Perhaps, can be functionalized, provide free amine to prepare particle by the surface that makes golden oxidation particle.The DNA that carries strong negative charge can combine with functionalized particle.In addition, electrically charged particle can be deposited in the lip-deep controlled array of the polyester film flying disc that uses in the PDS-1000Biolistics device, thereby helps to control the size distribution that imports the purpose tissue.

As indicated above, further specify, being used to wrap by the concentration of the DNA of particulate to influence the recovery that contains the genetically modified transformant of single copy.For example, lower DNA concentration can not change transformation efficiency, might increase the ratio of single copy insertion incident on the contrary.In view of this consideration, every 1.8mg initial particle can be used the transfering DNA of about 1ng to 2000ng.In another embodiment of the present invention, every 1.8mg initial particle can be used about 2.5ng to 1000ng, 2.5ng to 750ng, 2.5ng to 500ng, 2.5ng to 250ng, 2.5ng to 100ng, or the transfering DNA of 2.5ng to 50ng.

The microparticle bombardment technology can be extensive use of, and in fact can be used for transforming any plant species.The example of species that can be by the microparticle bombardment technical transform comprises: the unifacial leaf species, for example corn (PCT application number WO 95/06128), barley, wheat (U.S. patent 5,563,055, it in full incorporates this paper into way of reference), paddy rice, oat, rye, sugarcane and jowar; And many dicotyledonss, generally include tobacco and soybean (U.S. patent 5,322,783, it in full incorporates this paper into way of reference), Sunflower Receptacle, peanut, cotton, tomato and beans (U.S. patent 5,563,055, it incorporates this paper into way of reference in full).

For the microparticle bombardment transformation technology among the present invention, its physics and biological parameter all can be optimised.Physical agent is that those relate to the DNA/ particulate deposits is handled or the factor of those influences large-scale or minitype particle range (flight) and speed.Biotic factor is included in before the bombardment and the back to back Overall Steps that relates to cell operation in bombardment back, for example thereby the osmoregulation of purpose cell is assisted to alleviate the damage that bombardment causes, do not grow plumule or other purpose tissue with respect to the ballistic orientation of particle, and the attribute of DNA to be transformed, for example linear DNA or complete super spirial plasmid.Can believe that it is very important that pre-bombardment is handled for the successful conversion of not growing plumule.

Therefore, it should be noted that the experimenter wishes on a small scale to adjust all kinds of bombardment parameters in the research, thus optimal conditions fully.The experimenter wishes to adjust physical parameter especially, for example DNA concentration, breach distance, range straggling, tissue distance and helium pressure.Grade that further it should be noted that helium can influence transformation efficiency.The experimenter also can optimize the injury repairing factor (TRFs) by revising those conditions that can influence recipient cell physiological situation and then influence conversion and integration efficiency.For example,, can adjust the osmotic pressure situation, organize the subclone state or the cell cycle of hydration and recipient cell in order to optimize conversion.

Other method of cell transformation also can adopt, and it includes but are not limited to: by directly DNA being changed over to pollen (Hess etc., Interna Rev.Cytol., 107:367 (1987); Luo etc., Plant Mol Biol.Reporter, 6:165 (1988)), by directly DNA being injected into plant propagation organ (Pena etc., Nature, 325:274 (1987)), by directly DNA being injected into rudimentary embryo cell and making exsiccant endosperm aquation (Neuhaus etc. subsequently, Tlzeor.Appl.Genet., 75:30 (1987)), DNA is imported plant.

From the method for explant regeneration, growth and the culturing plants of single plant protoplast transformant or all kinds of conversions all are (Weissbach and Weissbach well known in the art, In:Methodsfor Plant Molecular Biology, Academic Press, SanDiego, CA, (1988)).Above-mentioned regeneration and culturing process typically comprise the steps: the conventional stage of growing through the above-mentioned individuation cell process of selection, the cultivation plumule of transformant and take root the seedling stage.Subsequently, the transgenosis that the obtains seed that takes root is planted in suitable plant-growth media, for example in the soil.

Regeneration or the growth of plant that contains the foreign gene of coding proteins of interest matter is well known in the art.Preferably, thus the regenerated plant carries out self-pollination produces homozygotic transgenic plant.Perhaps, the pollen that derives from aftergrowth can be hybridized with the plant that can produce seed that derives from agriculture important strain.On the contrary, the plant pollen that derives from the important strain of this class can be used for aftergrowth is pollinated.The transgenic plant of the present invention that contain desired polypeptides can adopt those skilled in the art's known method to cultivate.

There is the multiple method that from plant tissue, produces aftergrowth.The regenerated concrete grammar is by initial plant tissue and treat that the concrete plant species of regenerated determines.

Nucleic acid molecule is being imported on the basis of vegetable cell by polyethylene glycol processing, electroporation or particle bombardment, develop the genetic expression experiment (Marcotte etc. that based on the transient expression of cloning nucleic acid construct, Nature, 335:454-457 (1988); Marcotte etc., Plant Cell, 1:523-532 (1989); McCarty etc., Cell, 66:895-905 (1991); Hattori etc., Genes Dev., 6:609-618 (1992); Goff etc., EMBO J., 9:2517-2522 (1990)).The transient expression cell can be used for function distinguishing gene construct (generally referring to Maliga etc., Methods in Plant MolecularBiology, Cold Spring Harbor Press (1995)).

Any nucleic acid molecule of the present invention all can with other genetic elements, for example carrier, promotor, enhanser etc. import vegetable cell in permanent or temporary transient mode together.In addition, any nucleic acid molecule of the present invention all can import in the vegetable cell with the protein that allows described nucleic acid molecule encoding or the mode of its fragment expression or overexpression.

Transgenic plant can be applicable to protein or other molecule, for example greasy commercially producing, wherein said molecule (s) of interest extract or purifying in the part of plant, seed etc.Can also cultivate cell or tissue from above-mentioned plant, growth in vitro or fermentation, prepare this quasi-molecule.

Improvement by recombinant DNA coding can be transferred, for example, and the cell from a kind of cell of species to other species, for example mode that merges by protoplastis.Transgenic plant also can be used to the commercial procedure of breeding, or can be used for hybridizing or breeding with the plant of relevant crop species.For example, can will can handle the nucleic acid of the present invention that is connected with promotor by hybridization and import in the specific plant variety, and need not directly to transform the plant of this given kind.Therefore, the present invention not only comprises directly and also to comprise the offspring of this class plant by the resulting plant that regenerates according to the inventive method cell transformed.

The present invention also provide a kind of in plant the method for the interested HOI001 GBSS of stably express, it comprises, can effectively carrier transformed and be integrated under the condition of cell nucleus gene group, vegetable cell is contacted with the carrier that carries the nucleic acid of the interested HOI001 GBSS of coding of the present invention.Promotor in the described expression cassette can be any promotor provided herein, for example, and constitutive promoter, inducible promoter, tissue-specific promoter or seed specific promoters.The HOI001 GBSS that this class promotor can realize encoding is in object time, or the purpose etap, or expresses in the predetermined tissue.Described carrier also can comprise the selected marker.When carrier is used for agrobacterium tumefaciens, the replication origin of described carrier portability agrobacterium tumefaciens.

Plant

The plant optimization that uses with carrier of the present invention comprises monocotyledons, particularly produces greasy species, most preferably is corn (Zea mays).Other species that the present invention includes comprise clover (Medicago sativa), paddy rice (Oryza sativa), barley (Hordeumvulgar), millet (Panicum miliaceum), rye (Secale cereale), wheat (Triticum aestivum) and jowar (Sorghum bicolor).

Any plant of the present invention or plant parts can be used to produce feed, meal, protein or grease preparation.Particularly preferred plant parts is a seed for this purpose.The method of seeding, meal, protein and grease preparation is known in the art.Referring to, for example the U.S. patent 4,957, and 748; 5,100,679; 5,219,596; 5,936,069; 6,005,076; 6,146,669; With 6,156,227.

Through transforming the characteristic of plant

Can adopt all kinds of technology well known in the art to confirm genetically modified existence in the aftergrowth.The example of these technology includes but are not limited to: (a) DNA integrates or the experiment of rna expression molecule, for example Southern or northern blot hybridization, TAQMAN ^Technology (AppliedBiosystems, Foster City, CA) and PCR; (b) detect the Biochemistry Experiment whether protein exists, ELISA for example, western blot hybridization or by the enzyme functional experiment; (c), for example seed tissue is carried out qualitative and quantitative assay about grease, protein or starch to the chemical analysis at target plant position.

Following embodiment is used to illustrate the present invention, and it does not attempt to limit the present invention from any approach.

Embodiment 1

It is to separate the HOI001 gbss gene the HOI001 and to its method that checks order that present embodiment has been put down in writing from corn.HOI001 is inbreeding body plant (the MaizeGenetic Stock Center that derives from MGSC 915E, Urbana, IL), it is recorded among the U.S. Patent Publication text Nos.20030172416 20030154524 in more detail, and these two parts of documents are all incorporated this paper into way of reference.

Adopt following method, after pollination 22 days, from maize germ tissue, extract genomic dna from HOI001.With the plumule tissue of 50-100mg chopping with extraction damping fluid and granulated glass sphere place Bio101 Multimix pipe (Qiagen, Carlsbad, CA, Cat.No.657-601).Described extraction damping fluid is made up of 100mM Tris-HCl (pH8.0), 50mMEDTA, 100mM NaCl, 5mM DTT and 1%SDS.Adopt Bio 101FASTPREP subsequently ^Instrument (Qiagen) pulse came broken tissue in 3 times each 20 seconds.65 ℃ of incubations added 330 μ l 5M Potassium ethanoates after 15 minutes in every pipe.Subsequently test tube was made the SDS precipitation in 20 minutes at 0 ℃ of incubation, subsequently 12,000rpm (Eppendorf Model 54172) centrifugal 10 minutes down.Subsequently supernatant liquor is transferred in the new pipe and adds 100 μ l 5M ammonium acetates (pH 7.0) and 700 μ l Virahols, with deposit D NA.Test tube put upside down to mix be incorporated in 14, under the 000rpm centrifugal 10 minutes.After the supernatant discarded, precipitation is resuspended in the ethanol of 500 μ l 70%, and by 14,000rpm reclaimed precipitation in centrifugal 5 minutes.The recovery precipitation that will contain DNA is resuspended in the 50 μ l TE damping fluids, and stores down at 4 ℃.

(round pcr CA) is isolated the HOI001 gbss gene from the genomic dna that extracts for BD Biosciences Clontech, PaloAlto from Advantage GC to adopt reorganization.According to Shure etc., Cell, 35 (1): disclosed corn GBSS sequence [SEQ ID NO:2] among the 225-233 (1983), designed following primer:

5 ' end primer (primer numbering 14543)

5′-TCAGCCGTTCGTGTGGCAAGATTCATCTGTTGTCTC-3′[SEQ ID NO：5]

3 ' end primer (primer numbering 14547)

5′-TCAGCGGGATTATTTACTCCACCACTACAGGTCCATTT-3′[SEQ ID NO：6]。

Collect following PCR reactant to cumulative volume 50 μ l;

37 μ l PCR level water

5 μ l, 5 * Advantage GC PCR damping fluid

1 μ l, 50 * dNTP mixture (every kind of 10mM)

1 μ l, 50 * Advantage GC polysaccharase mixture

2.5 μ l primer 14543

2.5 μ l primer 145471

1 μ l genomic dna

Loop parameter is: 95 ℃ 1 minute, 95 ℃ of 35 round-robin 30 seconds, and 68 ℃ 3 minutes.

Separate the PCR product by agarose gel electrophoresis, can be observed the fragment of the 4.7kB that contains gene of interest.Utilize primer same as described above and condition, get the original PCR reaction solution of 5 microlitres and carry out other amplification as template.The employing agarose gel electrophoresis separates the 4.7kB amplified production from independent amplified reaction, adopts TOPO TA clone's test kit (Invitrogen) to be cloned in PCR 2.1 cloning vectors, and subsequent transformation is to E.coli host.From the culture that each bacterium colony is cultivated, prepare plasmid DNA, check order to deriving from the insertion fragment that 3 independent plasmids prepare product subsequently.These sequences are carried out sequence alignment can produce a common sequence, itself and disclosed gbss gene height homology are not quite identical, though there is not concrete insertion sequence to be equivalent to this common sequences fully.A kind of clone (called after pCGN9480-2) has the insertion sequence that minimum sequence variation takes place with respect to common sequences.By non-common sequences being carried out the cutting of restriction enzyme mediation, thereby it is reconnected with the fragment that contains common sequences prepare the clone who contains common sequences, the described fragment that contains common sequences obtains by other clone being digested or carrying out pcr amplification from the HOI001 genomic dna.The common sequences that comprises about 300 base pairs of transcription initiation site upstream 1.5kB and terminator codon downstream is shown in SEQ ID NO:1.

Adopt method and primer mentioned above, separate obtaining deriving from the gbss gene [SEQ ID NO:7] of superior corn inbred strain LH59, and be cloned into binary vector pMON68203.The plasmid that contains LH59GBSS that is obtained is named as pMON72510 (Fig. 5).

Fig. 1 has shown and has utilized Omiga software package 2.0, (Accelrys Inc., San Diego, CA), to HOI001 GBSS[SEQ ID NO:1] with aforementioned Shure etc. in disclosed sequence [SEQ ID NO:2], and derive from the result that the GBSS sequence [SEQ ID NO:7] of LH59 is carried out the nucleotide sequence comparison.Comparison result shows, following polymorphism is special to be present in the HOI001GBSS sequence, and does not all exist in the disclosed sequence in LH59 GBSS sequence or aforementioned Shure etc.:

1. single nucleotide polymorphism

A. at the 158th, T＞C

B. at the 337th, G＞A

C. at the 343rd, C＞A

D. at the 349th, C＞A

E. at the 441st, G＞A

F. at the 666th, C＞T

G. at the 777th, G＞C

H. at the 878th, T＞A

I. at the 980th, C＞T

J. at the 1210th, T＞A

K. at the 1216th, C＞T

L. at the 1450th, A＞T

M. at the 1709th, T＞C

N. at the 1720th, A＞G

O. at the 1721st, T＞A

P. at the 1722nd, G＞C

Q. at the 1761st, C＞T

R. at the 1836th, G＞A

S. at the 1852nd, C＞T

T. at the 1953rd, G＞A

U. at the 2043rd, C＞T

V. at the 2109th, C＞T

W. at the 2110th, C＞G

X. at the 2115th, G＞C

Y. at the 2448th, A＞T

Z. at the 2454th, C＞T

Aa. at the 2609th, T＞G

Bb. at the 2929th, A＞G

Cc. at the 2933rd, G＞T

Dd. at the 2946th, C＞T

Ee. at the 3875th, G＞T

Ff. at the 4008th, T＞A

Gg. at the 4018th, T＞C

Hh. at the 4023rd, T＞G

Ii. at the 4025th, C＞A

Jj. at the 4169th, C＞T

Kk. at the 4225th, A＞T

Ll. at the 4562nd, C＞A

2. insert:

A. at the 632nd, sequence g

B. in the 1185-1189 position, sequence atgc

C. in the 1456-1467 position, sequence tgcaccagcagc

D. in the 1746-1750 position, sequence atgca

E. in the 1868-1874 position, sequence catcaca

F is in the 2100-2101 position, sequence ct

G. in the 2488-2491 position, sequence ccat

H. in the 3810-3812 position, sequence tat

3. lack:

A. in the 288-290 position, sequence cgt

B. in the 704-705 position, sequence aa

C. at the 882nd, sequence c

D. in the 1139-1143 position, sequence atccg

E. in the 1256-1262 position, sequence ctctctg

F. in the 1714-1715 position, sequence tc

G. in the 1917-1932 position, sequence tgcaactgcaaatgca

H. at the 3790th, sequence g or a

I. in the 4393-4467 position, sequence cgagccaggggt (t or c) gaaggcgaggagatcgcgccgctcgccaagg

agaacgtggccgcgccctgaagagttcggcct

Fig. 2 has shown the sequence alignment result of the corresponding predicted amino acid sequence [SEQ ID NO:4] of separating the gbss gene of putting down in writing in the corresponding predicted amino acid sequence [SEQ ID NO:3] of the gbss gene of HOI001 and aforementioned Shure etc.The result shows that there is the additional amino acid residue sequence in the C-terminal at HOI001 GBSS, and it is from about the 1441st, and has the non-alignment zone in zone, amino-acid residue 55-60 position.

The sequence alignment that Fig. 3 has shown the corresponding predicted amino acid sequence of separating the particle mating type starch synthase gene of putting down in writing in the corresponding predicted amino acid sequence [SEQ ID NO:8] of the corn gbss gene of inbred lines LH59 and aforementioned Shure etc. is the result.The result shows that there is the additional amino acid residue sequence in the C-terminal at HOI001GBSS, and it is from about the 1441st, and existence is positioned at the non-alignment zone in zone, amino-acid residue 55-60 position.

Embodiment 2

Present embodiment has been put down in writing containing the structure of the HOI001 GBSS and the plant conversion carrier of the GBSS sequence [being respectively SEQ ID NOs:1 and 7] that derives from inbred lines LH59.

Utilize restriction enzyme EcoR 1 to downcut HOI001 GBSS sequence from the correct pMON9480-2 version of common sequences.According to Qiagen miniprep test kit (Qiagen, Inc., Valencia, the record on manufacturers's handbook CA), the 4.7kb fragment of coming purifying to obtain.According to Stratagene PCR polishing test kit (Stratagene, Inc., LaJolla, the record on manufacturers's handbook CA), it is flat terminal that described segmental end is become.Adopt Qiagen Gel to extract test kit (Qiagen) subsequently and come, and be cloned into the binary vector pMON68203 that is used for Plant Transformation by the described fragment of gel-purified.Binary vector pMON68203 comprises and is used for left margin and the right margin that T-DNA shifts, the CaMV 35S promoter:: nptII::nos 3 ' UTR plant selected marker element (is recorded in United States Patent (USP) 6,255,560) and be used to carry out the expression of plants box sequence (19-1117bp of registration number #S78780 of the Z27 promotor that comprises 1.1kb that endosperm expresses, Lopes etc., Mol.Gen.Genet., 247 (5): 603-613 (1995)), corn hsp70 intron (the corn gene 4-153 base pair of heat-shocked 70 exon 2s, registration number #X03679, EMBO J. such as Rochester, 5:451-458 (1986)), with no 3 ' UTR, (the 2924-2671 base pair of agrobacterium tumefaciens bacterial strain C58 Ti-plasmids, registration number #AE009420, Wood etc., Science, 294:2317-2323 (2001)).Adopt Stul digestion binary vector pMON68203, by adopting alkaline phosphatase (the Roche Applied Science of shrimp, Indianapolis IN) made it dephosphorylation in 60 minutes at 37 ℃ of following incubations, and was connected with the 4.7kb gel-purified fragment of HOI001 GBSS mentioned above.With the plasmid called after pMON72506 (Fig. 4) that obtains.

The gbss gene [SEQ ID NO:7] that adopts similar mode will derive from corn strain LH59 is cloned among the binary vector pMON68203, thereby forms pMON72510.

Embodiment 3

Present embodiment has been put down in writing by using embodiment 2 described carriers, adopts HOI001 GBSS and the technical scheme that derives from the GBSS maize transformation of inbred lines LH59.

According to following steps, adopt pMON72506 and pMON72510 conversion carrier to come the maize transformation plant.

In the greenhouse, cultivate maize plant according to standard method.The pollination of controlling plant.When the hybridization radicel length that obtains reached 1.5 to 2.0mm, normally the pollination back gathered in the crops the fringe of plant in the time of 10-15 days.After removing decapsidate, the kernel on the fringe is carried out surface sterilization by the mode of spraying or be soaked in 80% ethanol.

Agrobacterium strains ABI and agrobacterium tumefaciens binary vector system are used to transform.According to method well known in the art, plasmid pMON72506 and pMON72510 are imported in the agrobacterium tumefaciens.Before the inoculation maize cell, agrobatcerium cell at room temperature placed to contain be suitable for keeping the microbiotic of plasmid and the AB substratum (Chilton etc. of 200 μ M Syringylethanones, Proc.Nat.Acad.Sci.U.S.A., overnight incubation 71:3672-3676 (1974)).Before the next-door neighbour inoculation,, and it is resuspended in CRN122 substratum (2.2g/L MS (Murashige and Skoog by the centrifugation agrobatcerium cell, Plxysiol.Platzt, 15:473-497 (1962)) basic salt, 2mg/L glycine, 0.5g/L niacin, 0.5g/lL-pyridoxol-HCl,), 0.1g/L thiamines, 115mg/L L-proline(Pro), 36g/L glucose and 68.5g/L sucrose, pH 5.4) or contain 200 μ M Syringylethanones and 20 μ MAgNO ₃CRN347 substratum (comprise 0.44g/L MS salt, 10g/L glucose, 20g/L sucrose and 100mg/L xitix, in addition, identical) with the CRN122 substratum in.

From single kernel, downcut rudimentary maize germ, immerse in the Agrobacterium suspension, and at room temperature cultivated 5-15 minute.Shift out Agrobacterium solution subsequently, the plumule of not growing of inoculation is transferred to the common cultivation CRN123 substratum that contains 200 μ M Syringylethanones and 20 μ M Silver Nitrates in the mode on the scutellum side direction from inoculation CRN122 substratum and (comprises thiamines-HCl that 0.5mg/L is extra, 20g/L sucrose, 10g/L glucose, and 3mg/L2,4D, in addition identical with CRN122) on place 23 ℃ to cultivate 1 day down.Perhaps, the plumule that downcuts can be at 211V substratum (3.98g/L Chu N6 salt (Chu, C.C., N6 substratum and the application in cereal crop pollen sac culture thereof are illustrated in: Plant Tissue Culture PlantTissue Culture.Proceedings of the Peking Symposium, Boston, MA (1981), 43-45), 0.5mg/L thiamines HCl, the 0.5mg/L niacin; 1.0mg/L2,4D, 20g/L sucrose, 0.69g/L L-proline(Pro), 0.91g/L L-asparagine monohydrate, 1.6g/L MgCl ₂Hexahydrate, 0.1g/L caseic hydrolysate, 0.5g/LMES, 0.1g/L inositol and 16.9mg/L Silver Nitrate, pH 5.8, adopt 2g/L Gelgro that it is solidified) the middle cultivation 8-11 days, inoculate callus with Agrobacterium CRN347 substratum suspension, and no longer add other substratum, place 23 ℃ to cultivate 3 days down.

Plumule is transferred to CRN220 selective medium (4.4g/L MS salt, 1.3mg/L niacin, 0.25mg/L Benadon HCl, 0.25mg/L thiamines HCl, 0.25mg/L calcium pantothenate, 30g/L sucrose, 12mM proline(Pro), 0.05g/L casamino acid, the 500mg/L Pyocianil, 200mg/L paromycin, 2.2mg/L picloram, 0.5mg/L 2,4D and 3.4mg/L Silver Nitrate, pH5.6 adopt the plant of 7g/L with agar (Phytagar) it to be solidified) in, perhaps callus is transferred to CRN344 selective medium (3.98g/L ChuN6 salt, 1.0mg/L thiamines HCl, the 0.5mg/L niacin; 1.0mg/L2,4D, 20g/L sucrose, 0.69g/L L-proline(Pro), 0.91g/L L-asparagine monohydrate, 1.6g/L MgCl ₂Hexahydrate, the 0.1g/L caseic hydrolysate, 0.5g/L MES, the 0.1g/L inositol, the 500mg/L Pyocianil, 200mg/L paromycin and 16.9mg/L Silver Nitrate, pH 5.8, adopt the 6g/L plant with agar it to be solidified) in.Place 27 ℃ of following dark 2-3 after week, the tissue of survival is transferred in the identical selective medium, and cultivated for 2 weeks again or be transferred in the regeneration culture medium as mentioned below.

By being transferred to the CRN232 substratum from CRN220, possible transgenic calli (do not contain picloram, 2,4-D, and Silver Nitrate, and contain the CRN220 substratum of 3.52mg/L benzyladenine (BAP) and 250mg/L Pyocianil) in, or (do not contain Silver Nitrate from CRN344 media transfer to 217A substratum, 2,4-D, and paromycin, and contain 211 RTTV of 3.52mg/LBAP and 250mg/L Pyocianil) and place 27 ℃ to cultivate down and can realize the regeneration of plant in 5-7 days.To organize subsequently from CRN232 and be transferred to CRN264 substratum (4.4g/L MS salt, 1.3g/L niacin, 0.25mg/L Benadon HCl, 0.25mg/L thiamines HCl, 0.25mg/L calcium pantothenate, 10g/L glucose, 20g/L maltose, 1mM L-asparagine, 0.1g/L inositol, 250mg/L Pyocianil and 100mg/L paromycin, pH 5.8, adopt the 6g/L plant it to be solidified with agar) in, perhaps from the 217A substratum, be transferred to CRN346 substratum (4.4g/L MS salt, MS VITAMIN, 60g/L sucrose, 0.05g/L inositol, 250mg/L Pyocianil, 75mg/L paromycin, pH5.8 adopts 6g/L KOH to make its curing), described substratum is among the Phytatrays, and places the following 28 ℃ of cultivations of illumination until producing well-developed (typically, 2-3 week).These seedlings of growing are transferred in the soil, and at 27 ℃, 80% humidity and low light made it to take exercise strong in 1 week according to cultivation in the grown cultures chamber of intensity, and were transferred to subsequently in the greenhouse, and the R0 plant grows under the greenhouse experiment of standard.Phase mutual cross between described R0 plant, and collect prematurity/developmental kernel and the sophisticated kernel of the plant of each strain acquisition, be used for subsequent analysis.The result who analyzes is recorded among the embodiment 6.

The plantlet that these are being grown (plantlet) is transferred in the soil subsequently, and at one 27 ℃, 80% humidity and low light made it to take exercise strong in 1 week according to cultivation in the grown cultures case of intensity, and were transferred in the greenhouse subsequently.The R0 plant grows under the greenhouse experiment of standard.To have the hybridization of the R0 plant of fecundity and not genetically modified samsara inbred lines (recurrent inbread), wherein the R0 plant in hybridization as female parent or male parent (both is once in a while).Developmental and sophisticated F1 kernel as each fringe of embodiment 4 described acquisitions is all carried out Collection and analysis.Analytical results is reported in following embodiment 5.

Embodiment 4

Present embodiment provides the following analysis method, is used for determining containing grease, protein and the starch level of the transgenic plant kernel of HOI001 gbss gene or LH59 gbss gene.

Fat content is analyzed: the plumule and the grease level in the endosperm (based on quality, to account for the per-cent of tissue weight) of single corn kernel of the first-generation and cutting-out are passed through low resolution ¹H nucleus magnetic resonance (NMR) (Tiwari etc., JAOCS, 51:104-109 (1974); Or Rubel, JAOCS, 71:1057-1062 (1994)) method detects, wherein the NMR to the nucleolus sample measures time of releasing, adopt typical curve based on regression analysis, calculate its grease level, described typical curve adopts accelerated solvent to extract after gravimetric analysis has determined that the kernel of various grease levels obtains by analyzing.

For the relatively grease analysis of transgenosis and non-transgenic kernel, employing is arranged in one section sequence of Hsp70 intron as 5 ' primer, the one section sequence that is arranged in the HOI001 gbss gene determines by the PCR product that detects the specific 517bp of transgenosis whether transgenosis exists as 3 ' end primer:

5 ' primer (primer numbering 19056):

5′-ATCTTGCTCGATGCCTTCTC-3′[SEQ ID NO：16]，

3 ' primer (primer numbering 18986):

5′-GCCTTCGCTTGTCGTGGGT-3′[SEQ ID NO：17].

Grease level in the plant that NI T spectrography is determined to produce in advance, wherein detected the NIT spectrum of the seed sample of collecting of from single plant, gathering in the crops, and adopt typical curve to calculate its grease level based on regression analysis, described typical curve adopts accelerated solvent to extract after gravimetric analysis or ultimate analysis (%N) have determined that the kernel of various grease levels obtains by analyzing.

One-way analysis of variance and student T-check are used to determine the significant difference of (% kernel weight) between the mark positive and the interseminal grease level of mark heliophobous plant.

Perhaps, the grease level from the kernel that single fringe is collected can be passed through low resolution ¹H nucleus magnetic resonance (NMR) (Tiwari etc., JAOCS, 51:104-109 (1974); Or Rubel, JAOCS, 71:1057-1062 (1994)) method detects, wherein the NMR to the kernel collected detects time of releasing, and adopt typical curve based on regression analysis, calculated its grease level, described typical curve adopts accelerated solvent to extract after gravimetric analysis has determined that the kernel of various grease levels obtains by analyzing.

Protein analysis: in order to analyze the protein in the kernel,, detect by the near-infrared reflection spectroscopic analysis (InfraTec model 1221, Teccator, Hogannas Sweden) be used for every kind of processing by 50-100 kernel form small amount of sample.This method is based on following observations: have linear relationship between the amount of the chemical constitution in the typical grain sample and the near infrared radiation absorption.Before analyzing unknown sample, collect spectroscopic data by correcting sample, adopt nitrogen combustion analysis technology (Murray subsequently, I., and P.C.Williams, 1987, Chemical Principles of Near-infrared Technology, Iv Near-Infrared Technology in the Agricultural and Food Industries, P.Williams and K.Norris eds.) analyze.Spectroscopic data and raw data that employing obtains from spectrograph have been set up multivariate model.In the present embodiment, adopt 152 correcting samples to construct PLS-1 (least square partial regression type I Partial LeastSquares Regression Type I) multivariate model.By spectrograph each unknown sample is scanned 5 times at least, and by each its protein content of scanning prediction.During each scanning samples, sample all is added back in the sample cuvette, minimizes thereby make with the irrelevant multiplication dispersion effect of target chemical property.Repeatedly scanning result on average promptly gets the starch content of predicting, the result of each sample is reported.

Starch is analyzed: in order to analyze the starch of kernel, (InfraTec model 1221, Teccator, Hogannas Sweden) detects the small amount of sample that contains the 50-100 kernel that is used for each detection by the near-infrared reflection spectroscopic analysis.This method is based on following observations: have linear relationship between the amount of the chemical constitution in the typical grain sample and near infrared radiation absorption.Before analyzing unknown sample, collect spectroscopic data by correcting sample, adopt standard wet-chemical analysis technology (Murray subsequently, I., and P.C.Williams, 1987, ChemicalPrinciples of Near-infrared Technology, Iv Near-InfraredTechnology in the Agricultural and Food Industries, P.Williams and K.Norris eds.) come it is analyzed.Spectroscopic data and raw data that employing obtains from spectrograph have been set up multivariate model.By spectrograph every kind of unknown sample is scanned 5 times at least, and by each its starch content of scanning prediction.During each scanning samples, sample all is added back in the sample cuvette, minimizes thereby make with the irrelevant multiplication dispersion effect of target chemical property.Repeatedly scanning result on average promptly gets the starch content of predicting, the result to every kind of sample reports then.

Embodiment 5

Present embodiment has been put down in writing the analysis to adopting HOI001 GBSS and the kernel that derives from the GBSS plant transformed of LH59 to carry out.

Adopt the method for record among the embodiment 4, the kernel of expressing in the allelic 54 kinds of transgenic events altogether of HOI001 GBSS transgenosis is analyzed.Table 1 has shown: adopt the nucleolus NMR method of record among the embodiment 4, the transgenosis (positive) and non-transgenic (feminine gender) F1 of the fringe that derives from 20 kinds of transgenic events analyzed for total nucleolus oil lipid level of kernel.Only listed and had the result that the grease level on the meaning on the statistics significantly increases the incident of (p＜0.05).

The result shows, with respect to the non-transgenic kernel on the same fringe, the full kernel fat content (% dry weight) that derives from the transgenosis kernel of the fringe on 20 kinds in 54 kinds of transgenic events has the remarkable increase on the statistical significance.

Table 1

	Positive		Negative
							Strain	n	Mean value	n	Mean value	δ	Prob＞F
ZM_S67336/LH172	12	4.22	12	3.19	1.03	0.0000
							ZM_S66829/LH172	8	4.33	16	3.44	0.89	0.0013
ZM_S67359/LH172	12	4.36	12	3.52	0.84	0.0003
							ZM_S71593/LH172	14	3.09	10	2.40	0.69	0.0258
ZM_S67345/LH172	8	3.31	15	2.67	0.64	0.0199
							ZM_S67335/LH172	9	3.85	15	3.25	0.61	0.0000
ZM_S71577/LH172	4	3.50	20	2.92	0.59	0.0298
							ZM_S66804/LH172	10	3.50	14	2.94	0.56	0.0017
ZM_S67348/LH172	6	3.76	16	3.20	0.56	0.0000
							ZM_S67351/LH172	11	3.73	13	3.19	0.54	0.0173
ZM_S69437/LH172	9	3.70	15	3.16	0.54	0.0002
							ZM_S67331/LH172	13	3.70	11	3.17	0.53	0.0026
ZM_S67330/LH172	12	3.90	12	3.43	0.47	0.0071
							LH172/ZM_S71581	17	3.47	7	3.07	0.40	0.0004
ZM_S66805/LH172	11	3.76	13	3.37	0.39	0.0151
							LH172/ZM_S69443	11	3.23	13	2.86	0.37	0.0243
LH172/ZM_S67360	11	3.34	13	2.98	0.36	0.0080
							LH172/ZM_S67338	17	3.01	7	2.68	0.34	0.0287
ZM_S71569/LH172	11	2.99	12	2.74	0.25	0.0354
							LH172/ZM_S66817	14	3.05	9	2.83	0.22	0.0391

The transgenosis pollen that derives from the R0 male parent with respect to employing (for example, strain LH172/ZM_S66817, negative) (hereinafter two data are respectively for it: account for 5/37 in the plant of analysis for the kernel of the non-transgenic strain plant of pollination, 0.34% remarkable grease increases), the transgenosis kernel of the R0 plant of employing non-transgenic strain pollen pollination (for example, strain ZM_S67336/LH172, the positive) the remarkable grease with higher frequency increases (accounting for 15/29 in the plant of analysis) and higher average significantly grease increase level (0.61%).The result shows: because the transgenosis dosage of finding in the kernel endosperm of R0 plant that the matrilinear inheritance effect causes is big more, the level that then causes grease to increase is high more.

Similarly, to analyzing from the kernel that contains 15 kinds of transgenic events of the allelic total of LH59 GBSS transgenosis.With respect to the non-transgenic kernel on the identical fringe, have remarkable increase on the statistical significance from its full kernel fat content (% dry weight) of none in the kernel on the fringe of any one occurrence, increase of this explanation grease level is that HOI001 GBSS allelotrope is peculiar.

Embodiment 6

Present embodiment has been put down in writing the transgenosis F2 that derives from the field planting plant increase for the grease level in the kernel.

In order to determine the influence of HOI001 gbss gene to the nucleolus oil lipid level of field planting plant, each from 40 kinds of incidents is got the isolating F1 of 24-48 grain and is planted in the nursery, field for seed.Adopt the experiment of non-lethality kalamycin resistance, at whether there being transgene expression cassette, the plant that is growing is screened, wherein antibiotic solution (0.1% (w/v) kantlex and 0.1% (w/v) paromycin) is administered to the surface, blade face, and antibiotic administration writes down the appearance of withered spot damage after 1 week deny (transgenosis) with (non-transgenic).From the fringe of transgenosis and non-transgenic plant, separate kernel, analyze grease, protein and the starch content of kernel subsequently by the near infrared ray transmittance spectrographic technique.

Table 2 has shown to derive from and has contained (positive) and lack the mean value of full grease level in the plant fringe of transgenosis box that (feminine gender) contain selective marker and HOI001GBSS gene and the increased value (δ) of full nucleolus oil lipid level.Determine the grease level by the NIT method that is recorded among the embodiment 4, and only listed the grease level and have the incident of the remarkable increase (p＜0.05) on the statistical significance.

Table 2

	Positive		Negative
							Incident	n	Mean value	n	Mean value	δ	Prob＞F
ZM_S67359
		8	4.76	7	3.83	0.93	＜.0001
ZM_S71546								5	5.42	3	4.50	0.92	0.0012
	ZM_S67354	2	4.85	13	4.02	0.83	＜.0001
ZM_S66817								3	4.37	1	3.70	0.67	0.0099
	ZM_S71577	3	4.60	8	3.95	0.65	＜.0001
ZM_S67343								5	4.42	4	3.78	0.65	0.0142
	ZM_S71555	5	5.10	3	4.47	0.63	0.0343
ZM_S71551								9	4.69	6	4.07	0.62	0.041
	ZM_S69437	3	4.57	8	3.95	0.62	0.0002
ZM_S66804								7	5.04	7	4.44	0.60	0.0016
	ZM_S67338	7	4.30	6	3.73	0.57	0.0068
ZM_S71573								3	4.87	3	4.40	0.47	0.0405
	ZM_S67331	4	4.35	12	3.92	0.43	0.0025
ZM_S71594								2	4.35	8	3.95	0.40	0.0037
	ZM_S67340	12	4.04	11	3.72	0.32	0.0115
ZM_S66800								1	4.30	8	3.95	0.30	0.0396

The result shows, in 16 kinds of 36 kinds of incidents being analyzed, and with respect to the non-transgenic fringe, the full grease level in the transgenosis fringe raise (p＜0.05).

Table 3 has shown and has derived from the variation that contains (positive) and lack average kernel starch level (%) and kernel starch level in the plant fringe of transgenosis box that (feminine gender) contain selective marker and HOI001GBSS gene.Only list the grease level and had the incident of the remarkable increase (p＜0.05) on the statistical significance.

Table 4 has shown and has derived from the variation that contains (positive) and lack average kernel protein matter level (%) and p120 protein level in the plant fringe of transgenosis box that (feminine gender) contain selective marker and HOI001GBSS gene.Only list the grease level and had the incident of the remarkable increase (p＜0.05) on the statistical significance.

Analyze based on NIT, starch level slightly reduces (table 3) in the incident that the grease level raises, its protein matter level remain unchanged substantially (table 4).

Table 3

	Positive		Negative
							Incident	n	Mean value	n	Mean value	δ	Prob＞F
ZM_S67359 ZM_S71546 ZM_S67354 ZM_S66817 ZM_S71577 ZM_S67343 ZM_S71555 ZM_S71551 ZM_S69437 ZM_S66804 ZM_S67338 ZM_S71573 ZM_S67331 ZM_S71594 ZM_S67340 ZM_S66800	8 5 2 3 3 5 5 9 3 7 7 3 4 2 12 1	69.15 70.10 69.50 69.73 71.47 69.92 70.30 70.49 69.77 71.19 69.81 69.77 70.10 70.75 70.82 70.50	7 3 13 1 8 4 3 6 8 7 6 3 12 8 11 8	70.94 71.33 71.12 70.00 71.40 71.20 71.23 71.23 71.40 72.27 71.25 70.67 71.23 71.40 71.35 71.40	-1.79 -1.23 -1.62 -0.27 0.07 -1.28 -0.93 -0.74 -1.63 -1.09 -1.44 -0.90 -1.13 -0.65 -0.53 -0.90	0.0004 0.0451 0.0024 0.5286 0.8702 0.0187 0.118 0.117 0.0018 0.0073 0.0009 0.1352 0.0026 0.1906 0.0257 0.16

Table 4

	Positive		Negative
							Incident	n	Mean value	n	Mean value	δ	Prob＞F
ZM_S67359 ZM_S71546 ZM_S67354 ZM_S66817 ZM_S71577 ZM_S67343 ZM_S71555 ZM_S71551 ZM_S69437 ZM_S66804 ZM_S67338 ZM_S71573 ZM_S67331 ZM_S71594 ZM_S67340 ZM_S66800	8 5 2 3 3 5 5 9 3 7 7 3 4 2 12 1	11.84 12.86 12.55 12.70 9.50 11.46 12.58 12.23 11.80 12.14 12.26 11.37 12.18 11.80 11.44 11.40	7 3 13 1 8 4 3 6 8 7 6 3 12 8 11 8	11.29 12.30 12.07 14.40 12.03 11.40 12.43 11.97 12.03 11.07 11.87 11.30 12.23 12.03 11.28 12.03	0.55 0.56 0.48 -1.70 -2.53 0.06 0.15 0.27 -0.23 1.07 0.39 0.07 -0.05 -0.23 0.16 -0.63	0.2942 0.1775 0.2885 0.1336 0.0005 0.929 0.6995 0.4938 0.7384 0.0304 0.452 0.8416 0.9133 0.6682 0.578 0.412

Embodiment 7

Present embodiment has been put down in writing from the transgenosis F2 that derives from the field planting plant and has been raise for the grease level that the hybridization kernel obtains.

In order to determine the influence of HOI001 gbss gene to the nucleolus oil lipid level of the hybrid plant of field planting, from 14 kinds of incidents with enough seeds, every kind of F1 that gets the 24-48 grain respectively plants in the nursery, field for seed.As described in above-mentioned embodiment 6, adopt the experiment of non-lethality kalamycin resistance, at whether having the transgenosis box, the plant that is growing is screened.Pollen envelop from transgenic plant is used for hard stem (stiff-stalk) inbred lines LH244 is pollinated.The isolating F1 that plantation is produced adopts the experiment of non-lethality kalamycin resistance for transgenic seed, at whether having transgenosis, the plant that obtains is screened.From the fringe of transgenosis and non-transgenic plant, separate F2 for the hybridization kernel, and, detect the kernel grease by NMR spectroscopy as described in the embodiment 4.

Table 5 has shown to derive from and has contained (positive) and lack average full nucleolus oil lipid level (%) and the increase (δ) of nucleolus oil lipid level entirely in the hybrid plant fringe of transgenosis box that (feminine gender) contain selective marker and HOI001GBSS gene.Adopt and to determine the grease level, and only listed the grease level and have the incident of the remarkable increase (p＜0.05) on the statistical significance as embodiment 4 described bigger device (bulkset) NMR methods.Data show, in 9 kinds in 14 kinds of incidents analyzing, the transgenosis fringe is with respect to its full grease level of non-transgenic fringe raise (p＜0.05).

Table 5

	Positive		Negative
							Incident	n	Mean value	n	Mean value	δ	Prob＞F
ZM_S67354
		6	4.43	1	3.00	1.43	0.0431
ZM_S67346								9	3.90	8	3.13	0.78	0.0003
	ZM_S71546	9	4.24	5	3.58	0.66	0.0016
ZM_S71556								10	4.12	4	3.48	0.65	0.0044
	ZM_S71577	8	3.94	6	3.30	0.64	0.0047
ZM_S71594								10	3.91	7	3.30	0.61	0.0041
	ZM_S71573	10	4.02	6	3.42	0.60	0.0001
ZM_S67343								10	3.72	4	3.15	0.57	0.0009
	ZM_S67331	8	3.80	3	3.40	0.40	0.0281

Embodiment 8

Present embodiment has been put down in writing in the corn embryosperm tissue of expressing the HOI001 gbss gene, the active increase of GBSS.

After pollination the 24th day, gathered in the crops at the fringe of growing of the F1 plant that whether exists the transgenosis box to filter out through the experiment of non-lethality kalamycin resistance, and by freezing immediately.The F2 of peel separation cuts into plumule and endosperm part subsequently for kernel from the fringe.As described in embodiment 4, use the transgenosis Auele Specific Primer, by at from separating the ability of the part of pcr amplification transgenosis box from the genomic dna of single plumule, thereby identify that single isolating kernel is transgenosis type or non-transgenic type.For in 6 kinds of incidents each, about 10 endosperm that derive from corresponding transgenosis and non-transgenic kernel have been collected respectively.

In liquid nitrogen, adopt mortar and pestle that every kind of endosperm gleanings is ground into fine powder, and according to Shure etc., Cell, 35 (1): the method for 225-233 (1983) is divided three parts of separating starch particles.Isolating particle is adopted Vos-Scheperkeuter etc., PlantPlzysiol., the method for 82:411-416 (1986) detects the activity of its particle mating type starch synthase.

Table 6 has shown the developmental F2 that contains or the lack HOI001 GBSS transgenosis box activity (pmol/min/mg starch) for the particle mating type starch synthase in the endosperm.The mean value and the standard deviation of three repeated experiments have been listed.Data show, the starch granules of transgenosis kernel has the GBSS activity of rising usually, this explanation HOI001 allelotrope is not to reduce the effect that whole GBSS activity are produced to the influence of grease level, but owing to the effect that sp act produced that adds by the special coding of HOI001 gbss gene.

Table 6

	Transgenosis		Non-transgenic
						Incident	Mean value	SE	Mean value	SE	p＞F
S67338 S67359 S71546 S66804 S71551 S71555	585 583 635 587 588 486	41 20 16 50 9 24	455 521 540 454 574 464	15 15 23 20 11 12	0.0392 0.0665 0.0281 0.0702 0.3712 0.4641

Embodiment 9

Present embodiment has been put down in writing from corn strain HOI001 and have been separated GBSS cDNA coding region and to its technical scheme that checks order.

Adopt improvement from Opsahl-Ferstad etc., Plant J., 12 (10): the method for 235-246 (1997), pollinated back 22 days, from the corn embryosperm tissue of growing of HOI001, extract mRNA.In brief, from 3 isolating kernels, collect the endosperm of growing, freezing in liquid nitrogen, adopt mortar and pestle to be ground into fine powder subsequently.Adopt 0.5mL damping fluid (0.5M LiCl, 10mM EDTA, 5mM dithiothreitol (DTT), 100mM Tris-HCl, pH 8.0,1% (w/v) SDS) to extract the endosperm of the lyophilized powder of about 50mg.Adopt phenol subsequently: chloroform: primary isoamyl alcohol (25: 24: 21) comes this aqueous extract of extracting, discards the organic phase part.By adding isopyknic primary isoamyl alcohol, carry out centrifugally subsequently, go out nucleic acid from the water-based partly precipitated.Discard the supernatant liquor that obtains.Adopt 70% washing with alcohol to contain the precipitation twice of mRNA, drying is resuspended in the 50 μ L water that contain the acid of the two ethyl coke of 0.1% (v/v) subsequently.

Adopt Clontech SMART ^TMCDNA synthesis system (BD Biosciences) is synthesized the first chain cDNA from isolating mRNA.The above-mentioned first chain cDNA is as the template HOI001 GBSS cDNA sequence that is used to increase, the primer that is adopted contains the EcoRV restriction enzyme site, following the prediction translation initiation site (5 ' primer) of 18bp thereafter, also contain the Sse83871 restriction enzyme site, following the 17bp (3 ' primer) that predicts translation termination site 3 ' end thereafter:

5 ' primer (primer numbering 20095):

5′-GGATATCACCATGGCGGCTCTGGCCACG-3′[SEQ ID NO：9]，

3 ' primer (primer numbering 20092):

5′-GTCCTGCAGGCTACACATACTTGTCCA-3′[SEQ ID NO：10].

Adopt agarose gel electrophoresis from independent amplified reaction thing, to separate the 1.8kB amplified production that obtains obtaining, adopt TOPO TA clone test kit (Invitrogen) with its independent cloning to PCR

2.1 in the cloning vector, subsequent transformation is to E.coli host.Isolate a plurality of bacterium colonies from transforming each time, prepare plasmid DNA from the culture of each bacterium colony, the insertion fragment that every kind of plasmid is prepared product checks order subsequently.These sequences are compared, contain and the common sequences that is predicted as the open reading frame that the coded sequence of HOI001 gbss gene is equal to, though do not have specific insertion sequence and this common sequences identical can produce.Clone's (being named as 7345705-10) comprises the insertion sequence that lacks single base pair with respect to common sequences.Adopt Quick-Change mutator gene test kit (Stratagene),, utilize above-mentioned clone's to make up the plasmid (being named as pMON 81463) that contains described common sequences by inserting other Nucleotide.The sequence of above-mentioned expression HOI001 GBSS cDNA coding region is shown in SEQ ID NO:11.

Embodiment 10

Present embodiment has been put down in writing the structure to the plant conversion carrier that contains HOI001 GBSS cDNA coding region [SEQ ID NO:11], and it is designed to: be used to the different levels, different time and the spatial model that obtain to express, and subsequently to the conversion of corn.

Made up the plant conversion carrier that contains HOI001 GBSS coding region, described coding region is subjected to the Z27 promoters driven.Adopt EcoRV and Sse83871 restriction enzyme digestion digestion pMON81463, therefrom separate obtaining HOI001 GBSS coding region, and be cloned into binary vector pMON71274.This binary vector contains left margin and the right margin that is useful on the TDNA transfer, the rice actin promotor:: the rice actin intron:: CP4::nos3 ' UTR, plant selected marker element and be used for the endosperm Z27 promotor (bp19-1117 of GenbankAccession#S78780 that express, that comprise 1.1kb, Lopes et al., Mol.Gen.Genet., 247 (5): expression of plants box sequence 603 613 (1995)); Corn hsp70 intron (the corn gene 4-153 base pair of heat-shocked 70 exon 2s, Genbank registration number #X03679, EMBO J. such as Rochester, 5:451-458 (1986)) and sphaeroprotein 3 ' UTR.With the plasmid called after pMON81467 (Fig. 7) that obtains.

Made up and contained wheat high-molecular-weight glutenin promoter (the bp2647-3895 position of Genbank registration number X12928, version X12928.3, the original Anderson etc. that is recorded in, Nucleic Acids Res., 17:461-462 (1989)) and the second expression of plants binary vector of corn hsp70 intron, its with and wheat HSP17n 3 ' UTR (bp532-741 position of Gen Bank registration number X13431, version X13431.1, McElvain and Spiker, Nucleic Acids Res., 17:1764 (1989)) merge the GBSS coding region of merging.Increase from middle carrier and obtain: contain the sequence of the wheat high-molecular-weight glutenin promoter that merges with corn hsp70 intron, amplification is adopted and is contained 5 of AscI and NotI restriction enzyme site ' and 3 ' primer respectively:

5 ' primer (primer numbering 21084):

5′-GGCGCGCCGTCGACGGTATCGATAAGCTTGC-3′[SEQ ID NO：12]，

3 ' primer (primer numbering 21085):

5′-GCGGCCGCCCGCTTGGTATCTGCATTACAATG-3′[SEQ ID NO：13].

Through agarose gel electrophoresis, promotor and the segmental amplified production of intron that contains the restriction enzyme site that carries importing carried out purifying, and be cloned into pCR2.1TOPO (Invitrogen), be used for the plasmid vector (pOP28) that E.coli transforms thereby produce.After being transferred in the E.coli carrier, isolated plasmid dna, and adopt AscI and NotI that it is digested, with the fragment cloning of purifying to binary vector pMON71274, thereby produce a carrier (pOP29) that contains expression cassette, described expression cassette comprises the wheat high-molecular-weight glutenin promoter that corn HSP70 intron merges, and described intron and sphaeroprotein 3 ' UTR merge.Adopt NotI/Sse83871 digestion pMON81464, separate and obtain HOI001 GBSS coding region, and be cloned into pOP29, thereby produce binary vector pOP31, this carrier comprises the expression cassette that carries the high molecular weight glutenin promotor, described promotor and corn HSP70 intron merge, and merge corn HSP70 intron and HOI001 GBSS coding region, and described coding region and sphaeroprotein 3 ' UTR merge.Adopt AscI/Sse83871 digestion pOP31, obtain promotor/intron/HOI001 GBSS coding region fragment thereby separate, and be cloned among the plant binary carrier pMON71290 (containing target gene expression cassette) that contains interested expression casette and TR7 3 ' UTR with TR7 3 ' UTR, thereby produce pOP35, it contains the expression cassette that carries the high molecular weight glutenin promotor, described promotor and corn HSP70 intron merge, merge corn HSP70 intron and HOI001 GBSS coding region, and described coding region and TR7 3 ' UTR merge.Adopt AscI/Sse83871 digestion pOP35 then, separate and obtain promotor/intron/HOI001 GBSS coding region fragment, and be cloned among the plant binary carrier pMON67647, described carrier contains the target gene expression cassette that has wheat HSP17 3 ' UTR.The plasmid that is obtained contains the expression cassette that carries the high molecular weight glutenin promotor, and described promotor and corn HSP70 intron merge, and merge corn HSP70 intron and HOI001 GBSS coding region, and described coding region HSP17 3 ' UTR merges.The plasmid of this called after pMON68298 as shown in Figure 8.

Made up the promotor that contains HOI001 GBSS and the third expression of plants binary vector of 5 ' UTR, merge itself and HOI001 GBSS coding region, described coding region and corn sphaeroprotein 3 ' UTR fusion.Utilization contains 5 ' primer of PmeI restriction enzyme site, and increasing to separate from pMON72506 by pcr amplification obtains HOI001 GBSS promotor and 5 ' UTR (it also contains the intron of first kind of prediction):

5 ' primer (primer numbering 20362):

5′-GATCGTTTAAACGTTCGTGTGGCAGATTCATC-3′[SEQ ID NO：14]，

3 ' primer (primer numbering 20363):

5′-GACGTGGCCAGAGCCGCCATGCCGATTAATCCACTGCATAG-3′[SEQ ID NO：15].

By agarose gel electrophoresis purifying amplified production, amplified production is: contain prediction HOI001 GBSS translation initiation site upstream 1125bp and from the fragment (corresponding to the bp 17-1162 position of SEQ ID NO:1) of the 20bp of the predictive coding sequence of pMON72506, be cloned into pCR2.1TOPO (Invitrogen), to produce pMON81466.

From pMON81463, downcut HOI001 GBSS coding region, thereby and be cloned into carrier pMON81466 and produce pMON81468, it contains the HOI001 GBSS promotor/5 ' UTR that merges with HOI001 GBSS coding region, has long external source polylinker (polylinker) sequence of 45bp between promotor/UTR and coding region element.By adopting the MluI enzyme to cut digestion pMON81468, to remove the fragment of the 780bp that crosses over exogenous array, anneal once more with similar 735bp fragment (lacking exogenous array) subsequently, produce pMON81469.The fragment of above-mentioned 735bp obtains by utilizing MluI digestion pMON72506 and separated product fragment.Adopt PmeI and Sse83871 digestion pMON81469 subsequently, separate obtaining complete promotor/UTR/ coding region sequence, and be cloned among the binary vector pMON71274, to produce binary vector pMON81465.This carrier contains promotor and the expression cassette of 5 ' UTR, described coding region and corn sphaeroprotein 3 ' UTR fusion (Fig. 9) of carrying the HOI001GBSS gene that merges with the GBSS coding region.

With this three kind of plant conversion carrier be converted into superior corn inbred lines (LH244) (CornStates Hybrid Serv., LLC, Des Moines, IA) in.In brief, after pollination about 10 days, results contained the fringe of prematurity plumule, and place 4 ℃ freezing until using (gathering in the crops back 5 days).For this method for transformation, preferred plumule size is about 1.0-2.0mm.Usually pollination can reach above-mentioned size in back 10 days in the greenhouse, and wherein growth conditions is: 87 of medial temperatures, provide additional illumination by GE 1000Watt high-pressure mercury lamp, and the duration of day is 14 hours.

From the fringe of surface sterilization, separate immature plumule, and directly be dipped in the agrobatcerium cell suspension for preparing that is contained in the 1.5-mL Eppendorf tube.Above-mentioned separation continues 15 minutes.Test tube is placed 5 minutes on one side subsequently, thereby total inoculation time of individual plumule is reached 5 to 20 minutes.After adopting the aseptic transfer pipet of tip to remove the agrobatcerium cell suspension, immature plumule is transferred in the common culture medium (table 7).Then described plumule is placed on the substratum in the mode on the scutellum side direction and cultivate.Described plumule places dark incubator (23 ℃) to cultivate about 24 hours.

Subsequently plumule is transferred to through in the MS substratum of improvement (MSW50, table 7), is added with 0.1 or 0.25mM grass glycosides phosphine and 250mg/L Pyocianil in the described substratum, it is used for suppressing the culture dish (Agrobacterium of 100mm * 25mm).Described culture is cultivated 2-3 week in 27 ℃ in the culturing room of dark.Subsequently all callus lines are transferred to the first kind of regeneration culture medium (MS/6BA, table 7) that is added with par grass glycosides phosphine respectively and go up cultivation.Culture is grown on this substratum, and to place temperature be 27 ℃, cultivates 5-7 days in 16 hours illumination/8 hour dark photoperiodic culturing room.Subsequently they are transferred to and place culture dish (second kind of 15 regeneration culture medium (MSOD, table 7) of 100mm * 25mm) cultivated about 2 weeks.All callus lines with tissue of regenerated root and survival are transferred to place the same medium of plant plate (phytatrays) to cultivate, so that (about 2-4 week) root can further growth before in being transferred to soil.Above-mentioned regeneration culture medium (MS6BA and MSOD) all is added with 250mg/L Pyocianil and 0.1 or 0.25mM grass glycosides phosphine.

Subsequently these developmental plantlets are transferred in the soil, and place the culture chamber of 27 ℃, 80% humidity and lower optical densities to cultivate about 1 week, make it to take exercise strong, be transferred to subsequently in the greenhouse, under the standard greenhouse experiment, cultivate.Collect the kernel that obtains, and analyze according to embodiment 4 described methods.The result shows that different promotors is to producing different influences based on HOI001 GBSS coding region expression intensity and the gathering of the grease on opportunity.

Table 7 is used for the composition of the substratum of corn conversion

Composition	Be total to culture medium	MSW50	MS/6BA	MSOD
					MS salt	2.2g/L	4.4g/L	4.4g/L	4.4g/L
Sucrose	20g/L	30g/L	30g/L
					Maltose				20g/L
Glucose	10g/L			10g/L
					The 1-proline(Pro)	115mg/L	1.38g/L	1.36g/L
Casamino acid		500mg/L	50mg/L
					Glycine	2mg/L	2mg/L
The 1-l-asparagine				150mg/L
					Inositol	100mg/L	100mg/L		100mg/L
Niacin	0.5mg/L	0.5mg/L	1.3mg/L	1.3m/L
					The hot HCl of pyrazoles	0.5mg/L	0.5mg/L	0.25mg/L	0.25mg/L
Thiamines-HCl	0.5mg/L	0.6mg/L	0.25mg/L	0.25mg/L
					Calcium pantothenate			0.25mg/L	0.25mg/L
2，4-D	3mg/L	0.5mg/L
					Picloram
Silver Nitrate	1.7mg/L
					BAP			3.5mg/L

Adopt the low EEO agarose of 5.5mg/l to solidify common culture medium.Be used for NPTII when screening, all other substratum all adopt the 7g/l plant to solidify with agar, when being used for careless glycosides phosphine screening, all adopt the 3g/l plant to solidify with agarose (phytagel).

Embodiment 11

Present embodiment has been put down in writing polymorphism in the HOI001 gbss gene as being used for of molecule marker, and it is used for quickening HOI001 GBSS sequence polymorphism and is incorporated into other corn germplasm, thereby obtains the rising of nucleolus oil lipid level.

The invention provides the maize plant that a kind of kernel grease increases, it is used the marker-assisted breeding screening and obtains, and wherein screens plant population at the existence of the peculiar polymorphic sequence of HOI001 gbss gene (SEQ ID NO:1).Listed the peculiar polymorphism of HOI001GBSS sequence in the foregoing description 1, it does not exist in LH59 GBSS sequence or disclosed sequence (aforementioned Shure etc.).

The screening that the plant of carrying the HOI001 gbss gene that is used for high grease level is carried out comprises: in screening process, adopt probe and the genomic dna of the plant that obtains to hybridize, be used for the existing of molecule marker of HOI001 gbss gene with detection.Described molecule marker is the dna molecular of peculiar polymorphism in the representative HOI001 gbss gene, and it is as probe or primer, and target HOI001 GBSS plays a role in the targeted plants genome.Selected polymorphism can be or can not derive from the coding region of gene.The plant that contains the HOI001 gbss gene is used to continue breeding and screening process.

Sequence table

<110>Ravanello，Monica P

Foley，Terry J

LeDeaux，John R

Wyrick，Annette E

Savage，Thomas J

＜120〉method of grease level in the raising plant

<130>REN-00-119

<140>US 60/483,491

<141>2003-06-27

<160>17

<170>PatentIn version 3.2

<210>1

<211>4470

<212>DNA

＜213〉corn (Zea mays)

<400>1

aattcgccct ttcagccgtt cgtgtggcag attcatctgt tgtctcgtct cctgtgcttc 60

ctgggtagct tgtgcagtgg agctgacatg gtctgagcag gcttaaaatt tgctcgtaga 120

cgaggagtac cagcacagca cgttgcggat ttctctgcct gtgaagtgca acgtctagga 180

ttgtcacacg ccttggtcgc gtcgatgcgg tggtgagcag agcagcaaca gctgggcgac 240

ccaaagttgg attccgtgtc ttcgtcgtac gtacgcgcgc gccggggaca cgcagagagc 300

ggagagcgag ccgtgcacgg ggaggtggtg tggaagtgaa gccgcgcgcc cggccgcccg 360

cgcccggtgg gcaacccaaa agtacccacg acaagcgaag gcgccaaagc gatccaagct 420

ccggaacgca tcagccacaa gcagccgaga accgaaccgg tgggcgacgc gtcgtgggac 480

ggacgcgggc gacgcttcca aacggggcca cgtacgccgg cgtgtgcgtg tgtgcgtgca 540

gacgacaagc caaggcgagg cagcccccga tcgggaaaag cgtcaagtag gtgcgccggg 600

ctttggcttt gggcgcgagc gctggcgtgc gggtcagtcg ctggtgcgca gtgccggggc 660

gaacgggtat cgtggggggc gcgggcggag gagagcgtgg cgagggccga gagcagcgcg 720

cggccgggtc acgcaacgcg ccccacgtac agcctccccc tccgcgcgcg ctagaaatac 780

cgaggcctgg accgggggcc ccccggcaca tccatccatc gaccgatcga tcgatcgcca 840

cagccaacat cacccgccga ggcgacgcga cagccgccag gaggaaggaa taaactcact 900

gccagccagt gaagggggag aagtgtactg ctccgtcgac cagtgcgcgc accgcccggc 960

agggctgctc atctcgtcga cgaccaggtt ccgttccgtt ccgatccgat cctgtccttg 1020

agtttcgtcc agatcctggc gtgtatctgc atgcgtgttt gatgatccag gttcatcgaa 1080

tctaaatctg tccgtgcaca tgtcttctct ctctctgtct gctatgcagt ggattaatcg 1140

gcatggcggc tctggccacg tcgcagctcg tcgcaacgcg cgccggcctg ggcgtcccgg 1200

acgcgtccac gttccgccgc ggcgccgcgc agggcctgag gggggcccgg gcgtcggcgg 1260

cggcggacac gctcagcatg cggaccagcg cgcgcgcggc gcccaggctc cagctgcacc 1320

agcagcagca gcaggcgcgc cgcggggcca ggttcccgtc gctcgtcgtg tgcgccagcg 1380

ccggcatgaa cgtcgtcttc gtcggcgccg aggtggcgcc gtggagcaag accggcggcc 1440

tcggcgacgt cctcggcggc ctgccgccgg ccatggccgt aagcgcgcgc accgagacat 1500

gcatccgttg gatcgcgtct tcttcgtgct cttgccgcgt gcatgatgca tgtgtttcct 1560

cctggctcgt gtatgtgact gacgtgtgtg ttcgggcatg caatgcatgc aggcgaatgg 1620

gcaccgtgtc atggtcgtct ctccccgcta cgaccagtac aaggacgcct gggacaccag 1680

cgtcgtgtcc gaagtacggc caccgagatc agattcagat cacacatcac agtcacacac 1740

accgtcatat gaacctttct ctgctctgat gcctgcagat caagatggga gacaggtacg 1800

agacggtcag gttcttccac tgctacaagc gcggagtgga ccgcgtgttc gttgaccacc 1860

cactgttcct ggagagggtg agatgagatc tgatcactcg atacgcaatt accaccccat 1920

tgtaagcagt tacagtgagc cttttttttt gcccccgcct ggtcgctggt ttcaggtttg 1980

gggaaagacc gaggagaaga tctacgggcc tgtcgctgga acggactaca gggacaacca 2040

gctgcggttc agcctgctat gccaggtcag gatggcttgc tactacaact tcagatcatc 2100

tgtatgcagc agtatacacc gatgagaaat gcatgctgtt ctgcaggcag cacttgaagc 2160

tccaaggatc ctgagcctca acaacaaccc atacttctcc ggaccatacg gtaagagttg 2220

tagtcttcgt atatatatct gttgagctcg agaatcttca caggaaacgg cccatcagac 2280

ggactgtctt tttatactga ctactgctgc tgctcttcgt ccatccatcc atacaagggg 2340

aggacgtcgt gttcgtctgc aacgactggc acaccggccc tctctcgtgc tacctcaaga 2400

gcaactacca gtcccacggc atctacaggg acgcaaaggt tgccttctcg gaactgaaca 2460

acgccgtttt cgttctccat gctcgtatat acctcatctg gtggtggtgc ttctctgaaa 2520

ctgaaactga aactgactgc atgtctgtct gaccatcttc acgtactacc taccagaccg 2580

ctttctgcat ccacaacatc tcctaccagg gccggttcgc cttctccgac tacccggagc 2640

tgaacctccc cgagagattc aagtcgtcct tcgatttcat cgacgggtct gttttcctgc 2700

gtgcatgtga acattcatga acggtaaccc acaactgctc gcgtcctgct ggttcattat 2760

ctggccttga ttgcattgta gctacgagaa gcccgtggaa ggccggaaga tcaactggat 2820

gaaggccggg atcctcgagg ccgacagggt cctcaccgtc agcccctact acgccgagga 2880

gctcatctcc ggcatcgcca ggggctgcga gctcgacaac atcatgcgcc tcaccggcat 2940

caccggcatc gtcaacggca tggacgtcag cgagtgggac cccagcaggg acaagtacat 3000

cgccgtgaag tacgacgtgt cgacggtgag ctggctagct agctgattct gctgcctggt 3060

cctcctgctc atgctggttc ggttctgacg cggcaagtgt acgtacgtgc gtgcgacggt 3120

ggtgtggtgt ccggttcagg ccgtggaggc caaggcgctg aacaaggagg cgctgcaggc 3180

ggaggtcggg ctcccggtgg accggaacat cccgctggtg gcgttcatcg gcaggctgga 3240

agagcagaag ggccccgacg tcatggcggc cgccatcccg cagctcatgg agatggtgga 3300

ggacgtgcag atcgttctgc tggtacgtgt gcgccggccg ccacccggct actacatgcg 3360

tgtatcgttc gttctactgg aacatgcgtg tgagcaacgc gatggataat gctgcagggc 3420

acgggcaaga agaagttcga gcgcatgctc atgagcgccg aggagaagtt cccaggcaag 3480

gtgcgcgccg tggtcaagtt caacgcggcg ctggcgcacc acatcatggc cggcgccgac 3540

gtgctcgccg tcaccagccg cttcgagccc tgcggcctca tccagctgca ggggatgcga 3600

tacggaacgg tacgagagaa aaaaaaacat cctgaatcta tcctgacgag agggacagag 3660

acagattgat tatgaatgct tcatcgattt gaattgattg atctatgtct cccgctgcga 3720

ctcttgcagc cctgcgcctg cgcgtccacc ggtggactcg tcgacaccat catcgaaggc 3780

aagaccgggt tccacatggg ccgcctcagc gtcgacgtaa gcctacctct gccatgatct 3840

ttcttccttc tgtatgtatg tatgtatgta tgaatcagca ccgccattct tgtttcgtcg 3900

tcctctcttc ccagtgcaac gtcgtggagc cggcggacgt caagaaggtg gccaccacct 3960

tgcagcgcgc catcaaggtg gtcggcacgc cggtgtacga ggagatggtg aggaactgca 4020

tgatccagga tctctcctgg aaggtacgtt cgcccgcccc gccagagcag agcgccaaga 4080

tcgatcgatc gaccgaccac acgtacgcgc ctcgctcttg tcgctgaccg tggtttaatt 4140

tgcgaaatgc gcagggccct gccaagaact gggagaacgt gctgctcagc ctcggggtcg 4200

ccggcggtgc agggcccctg atctcgcgcg tggtgcaaag atgttgggac atcttcttat 4260

atatgctgtt tcgtttatgt gatatggaca agtatgtgta gatgcttgct tgtgctagtg 4320

taatgtagtg tagtggtggc cagtggcaca acctaataag cgcatgaact aattgcttgc 4380

gtgtgtagtt aagtaccgat cggtaatttt atattgcgag taaataaatg gacctgtagt 4440

ggtggagtaa ataatcccgc tgaaagggcg 4470

<210>2

<211>1818

<212>DNA

＜213〉corn (Zea mays)

<400>2

atggcggctc tggccacgtc gcagctcgtc gcaacgcgcg ccggcctggg cgtcccggac 60

gcgtccacgt tccgccgcgg cgccgcgcag ggcctgaggg gggcccgggc gtcggcggcg 120

gcggacacgc tcagcatgcg gaccagcgcg cgcgcggcgc ccaggcacca gcagcaggcg 180

cgccgcgggg gcaggttccc gtcgctcgtc gtgtgcgcca gcgccggcat gaacgtcgtc 240

ttcgtcggcg ccgagatggc gccgtggagc aagaccggcg gcctcggcga cgtcctcggc 300

ggcctgccgc cggccatggc cgcgaacggg caccgtgtca tggtcgtctc tccccgctac 360

gaccagtaca aggacgcctg ggacaccagc gtcgtgtccg agatcaagat gggagacggg 420

tacgagacgg tcaggttctt ccactgctac aagcgcggag tggaccgcgt gttcgttgac 480

cacccactgt tcctggagag ggtttgggga aagaccgagg agaagatcta cgggcctgtc 540

gctggaacgg actacaggga caaccagctg cggttcagcc tgctatgcca ggcagcactt 600

gaagctccaa ggatcctgag cctcaacaac aacccatact tctccggacc atacggggag 660

gacgtcgtgt tcgtctgcaa cgactggcac accggccctc tctcgtgcta cctcaagagc 720

aactaccagt cccacggcat ctacagggac gcaaagaccg ctttctgcat ccacaacatc 780

tcctaccagg gccggttcgc cttctccgac tacccggagc tgaacctccc ggagagattc 840

aagtcgtcct tcgatttcat cgacggctac gagaagcccg tggaaggccg gaagatcaac 900

tggatgaagg ccgggatcct cgaggccgac agggtcctca ccgtcagccc ctactacgcc 960

gaggagctca tctccggcat cgccaggggc tgcgagctcg acaacatcat gcgcctcacc 1020

ggcatcaccg gcatcgtcaa cggcatggac gtcagcgagt gggaccccag cagggacaag 1080

tacatcgccg tgaagtacga cgtgtcgacg gccgtggagg ccaaggcgct gaacaaggag 1140

gcgctgcagg cggaggtcgg gctcccggtg gaccggaaca tcccgctggt ggcgttcatc 1200

ggcaggctgg aagagcagaa gggccccgac gtcatggcgg ccgccatccc gcagctcatg 1260

gagatggtgg aggacgtgca gatcgttctg ctgggcacgg gcaagaagaa gttcgagcgc 1320

atgctcatga gcgccgagga gaagttccca ggcaaggtgc gcgccgtggt caagttcaac 1380

gcggcgctgg cgcaccacat catggccggc gccgacgtgc tcgccgtcac cagccgcttc 1440

gagccctgcg gcctcatcca gctgcagggg atgcgatacg gaacgccctg cgcctgcgcg 1500

tccaccggtg gactcgtcga caccatcatc gaaggcaaga ccgggttcca catgggccgc 1560

ctcagcgtcg actgtaacgt cgtggagccg gcggacgtca agaaggtggc caccacattg 1620

cagcgcgcca tcaaggtggt cggcacgccg gcgtacgagg agatggtgag gaactgcatg 1680

atccaggatc tctcctggaa gggccctgcc aagaactggg agaacgtgct gctcagcctc 1740

ggggtcgccg gcggcgagcc aggggtcgaa ggcgaggaga tcgcgccgct cgccaaggag 1800

aacgtggccg cgccctga 1818

<210>3

<211>620

<212>PRT

＜213〉corn (Zea mays)

<400>3

Met Ala Ala Leu Ala Thr Ser Gln Leu Val Ala Thr Arg Ala Gly Leu

1 5 10 15

Gly Val Pro Asp Ala Ser Thr Phe Arg Arg Gly Ala Ala Gln Gly Leu

20 25 30

Arg Gly Ala Arg Ala Ser Ala Ala Ala Asp Thr Leu Ser Met Arg Thr

35 40 45

Ser Ala Arg Ala Ala Pro Arg Leu Gln Leu His Gln Gln Gln Gln Gln

50 55 60

Ala Arg Arg Gly Ala Arg Phe Pro Ser Leu Val Val Cys Ala Ser Ala

65 70 75 80

Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser Lys

85 90 95

Thr Gly Gly Leu Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met Ala

100 105 110

Ala Asn Gly His Arg Val Met Val Val Ser Pro Arg Tyr Asp Gln Tyr

115 120 125

Lys Asp Ala Trp Asp Thr Ser Val Val Ser Glu Ile Lys Met Gly Asp

130 135 140

Arg Tyr Glu Thr Val Arg Phe Phe His Cys Tyr Lys Arg Gly Val Asp

145 150 155 160

Arg Val Phe Val Asp His Pro Leu Phe Leu Glu Arg Val Trp Gly Lys

165 170 175

Thr Glu Glu Lys Ile Tyr Gly Pro Val Ala Gly Thr Asp Tyr Arg Asp

180 185 190

Asn Gln Leu Arg Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala Pro

195 200 205

Arg Ile Leu Ser Leu Asn Asn Asn Pro Tyr Phe Ser Gly Pro Tyr Gly

210 215 220

Glu Asp Val Val Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu Ser

225 230 235 240

Cys Tyr Leu Lys Ser Asn Tyr Gln Ser His Gly Ile Tyr Arg Asp Ala

245 250 255

Lys Thr Ala Phe Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe Ala

260 265 270

Phe Ser Asp Tyr Pro Glu Leu Asn Leu Pro Glu Arg Phe Lys Ser Ser

275 280 285

Phe Asp Phe Ile Asp Gly Tyr Glu Lys Pro Val Glu Gly Arg Lys Ile

290 295 300

Asn Trp Met Lys Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr Val

305 310 315 320

Ser Pro Tyr Tyr Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly Cys

325 330 335

Glu Leu Asp Asn Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val Asn

340 345 350

Gly Met Asp Val Ser Glu Trp Asp Pro Ser Arg Asp Lys Tyr Ile Ala

355 360 365

Val Lys Tyr Asp Val Ser Thr Ala Val Glu Ala Lys Ala Leu Asn Lys

370 375 380

Glu Ala Leu Gln Ala Glu Val Gly Leu Pro Val Asp Arg Asn Ile Pro

385 390 395 400

Leu Val Ala Phe Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp Val

405 410 415

Met Ala Ala Ala Ile Pro Gln Leu Met Glu Met Val Glu Asp Val Gln

420 425 430

Ile Val Leu Leu Gly Thr Gly Lys Lys Lys Phe Glu Arg Met Leu Met

435 440 445

Ser Ala Glu Glu Lys Phe Pro Gly Lys Val Arg Ala Val Val Lys Phe

450 455 460

Asn Ala Ala Leu Ala His His Ile Met Ala Gly Ala Asp Val Leu Ala

465 470 475 480

Val Thr Ser Arg Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met

485 490 495

Arg Tyr Gly Thr Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp

500 505 510

Thr Ile Ile Glu Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val

515 520 525

Asp Cys Asn Val Val Glu Pro Ala Asp Val Lys Lys Val Ala Thr Thr

530 535 540

Leu Gln Arg Ala Ile Lys Val Val Gly Thr Pro Val Tyr Glu Glu Met

545 550 555 560

Val Arg Asn Cys Met Ile Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys

565 570 575

Asn Trp Glu Asn Val Leu Leu Ser Leu Gly Val Ala Gly Gly Ala Gly

580 585 590

Pro Leu Ile Ser Arg Val Val Gln Arg Cys Trp Asp Ile Phe Leu Tyr

595 600 605

Met Leu Phe Arg Leu Cys Asp Met Asp Lys Tyr Val

610 615 620

<210>4

<211>605

<212>PRT

＜213〉corn (Zea mays)

<400>4

Met Ala Ala Leu Ala Thr Ser Gln Leu Val Ala Thr Arg Ala Gly Leu

1 5 10 15

Gly Val Pro Asp Ala Ser Thr Phe Arg Arg Gly Ala Ala Gln Gly Leu

20 25 30

Arg Gly Ala Arg Ala Ser Ala Ala Ala Asp Thr Leu Ser Met Arg Thr

35 40 45

Ser Ala Arg Ala Ala Pro Arg His Gln Gln Gln Ala Arg Arg Gly Gly

50 55 60

Arg Phe Pro Ser Leu Val Val Cys Ala Ser Ala Gly Met Asn Val Val

65 70 75 80

Phe Val Gly Ala Glu Met Ala Pro Trp Ser Lys Thr Gly Gly Leu Gly

85 90 95

Asp Val Leu Gly Gly Leu Pro Pro Ala Met Ala Ala Asn Gly His Arg

100 105 110

Val Met Val Val Ser Pro Arg Tyr Asp Gln Tyr Lys Asp Ala Trp Asp

115 120 125

Thr Ser Val Val Ser Glu Ile Lys Met Gly Asp Gly Tyr Glu Thr Val

130 135 140

Arg Phe Phe His Cys Tyr Lys Arg Gly Val Asp Arg Val Phe Val Asp

145 150 155 160

His Pro Leu Phe Leu Glu Arg Val Trp Gly Lys Thr Glu Glu Lys Ile

165 170 175

Tyr Gly Pro Val Ala Gly Thr Asp Tyr Arg Asp Asn Gln Leu Arg Phe

180 185 190

Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala Pro Arg Ile Leu Ser Leu

195 200 205

Asn Asn Asn Pro Tyr Phe Ser Gly Pro Tyr Gly Glu Asp Val Val Phe

210 215 220

Val Cys Asn Asp Trp His Thr Gly Pro Leu Ser Cys Tyr Leu Lys Ser

225 230 235 240

Asn Tyr Gln Ser His Gly Ile Tyr Arg Asp Ala Lys Thr Ala Phe Cys

245 250 255

Ile His Asn Ile Ser Tyr Gln Gly Arg Phe Ala Phe Ser Asp Tyr Pro

260 265 270

Glu Leu Asn Leu Pro Glu Arg Phe Lys Ser Ser Phe Asp Phe Ile Asp

275 280 285

Gly Tyr Glu Lys Pro Val Glu Gly Arg Lys Ile Asn Trp Met Lys Ala

290 295 300

Gly Ile Leu Glu Ala Asp Arg Val Leu Thr Val Ser Pro Tyr Tyr Ala

305 310 315 320

Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly Cys Glu Leu Asp Asn Ile

325 330 335

Met Arg Leu Thr Gly Ile Thr Gly Ile Val Asn Gly Met Asp Val Ser

340 345 350

Glu Trp Asp Pro Ser Arg Asp Lys Tyr Ile Ala Val Lys Tyr Asp Val

355 360 365

Ser Thr Ala Val Glu Ala Lys Ala Leu Asn Lys Glu Ala Leu Gln Ala

370 375 380

Glu Val Gly Leu Pro Val Asp Arg Asn Ile Pro Leu Val Ala Phe Ile

385 390 395 400

Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp Val Met Ala Ala Ala Ile

405 410 415

Pro Gln Leu Met Glu Met Val Glu Asp Val Gln Ile Val Leu Leu Gly

420 425 430

Thr Gly Lys Lys Lys Phe Glu Arg Met Leu Met Ser Ala Glu Glu Lys

435 440 445

Phe Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn Ala Ala Leu Ala

450 455 460

His His Ile Met Ala Gly Ala Asp Val Leu Ala Val Thr Ser Arg Phe

465 470 475 480

Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg Tyr Gly Thr Pro

485 490 495

Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr Ile Ile Glu Gly

500 505 510

Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp Cys Asn Val Val

515 520 525

Glu Pro Ala Asp Val Lys Lys Val Ala Thr Thr Leu Gln Arg Ala Ile

530 535 540

Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val Arg Asn Cys Met

545 550 555 560

Ile Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn Trp Glu Asn Val

565 570 575

Leu Leu Ser Leu Gly Val Ala Gly Gly Glu Pro Gly Val Glu Gly Glu

580 585 590

Glu Ile Ala Pro Leu Ala Lys Glu Asn Val Ala Ala Pro

595 600 605

<210>5

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>5

tcagccgttc gtgtggcaag attcatctgt tgtctc 36

<210>6

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>6

tcagcgggat tatttactcc accactacag gtccattt 38

<210>7

<211>4207

<212>DNA

＜213〉corn (Zea mays)

<400>7

gttcgtgtgg cagattcatc tgttgtctcg tctcctgtgc ttcctgggta gcttgtgtag 60

tggagctgac atggtctgag caggcttaaa atttgctcgt agacgaggag taccagcaca 120

gcacgttgcg gatttctctg cctgtgaagt gcaacgtcta ggattgtcac acgccttggt 180

cgcgtcgcgt cgatgcggtg gtgagcagag cagcaacagc tgggcggccc aacgttggct 240

tccgtgtctt cgtcgtacgt acgcgcgcgc cggggacacg cagcgagcgg agaacgagcc 300

gtgcacgggg gaggtggtgt gcaagtggag ccgcgcgccc ggccgcccgc gcccggtggg 360

caacccaaaa gtacccacga caagcgaagg cgccaaagcg atccaagctc cggaacgcat 420

cagccacaag cagccgagaa ccgaaccggt gggcgacgcg tcgtgggacg gacgcgggcg 480

acgcttccaa acgggccacg tacgccggcg tgtgcgtgcg tgcgtgcaga cgacaagcca 540

aggcgaggca gcccccgatc gggaaaaaag cgtcaagtag gtgcgccggg ctttggcttt 600

gggcgcgagc gctggcgtgc gggtcagtcg ctggtgcgca gtgccggggg gaacgggtat 660

cgtgggggcg cgggcggagg agagcgtggc gagggccgag agcagcgcgc ggccgggtca 720

cgcaacgcgc cccacgtact gccctccccc tccgcgcgcg ctagaaatac cgaggcctgg 780

accgggggcc ccccggcaca tccatccatc gaccgatcga tcgatcgcca cagccaacac 840

cacccgccga ggcgacgcga cagccgccag gaggaaggaa taaactcact gccagccagt 900

gaagggggag aagtgtactg ctccgtcgac cagtgcgcgc accgcccggc agggctgctc 960

atctcgtcga cgaccaggtt ccgttccgtt ccgatcctgt ccttgagttt cgtccagata 1020

ctggcgtgta tctgcgtgtt tgatgatcca ggttcttcga acctaaatct gtccgtgcac 1080

atgtcctctc tctctctgtc tctctctgct atgcagtgga ttaatcggca tggcggctct 1140

ggccacgtcg cagctcgtcg caacgcgcgc cggcctgggc gtcccggacg cgtccacgtt 1200

ccgccgcggc gccgcgcagg gcctgagggg ggcccgggcg tcggcggcgg cggacacgct 1260

cagcatgcgg accagcgcgc gcgcggcgcc caggcaccag caccagcagg cgcgccgcgg 1320

ggccaggttc ccgtcgctcg tcgtgtgcgc cagcgccggc atgaacgtcg tcttcgtcgg 1380

cgccgagatg gcgccgtgga gcaagaccgg aggcctcggc gacgtcctcg gcggcctgcc 1440

gccggccatg gccgtaagcg cgcgcaccga gacatgcatc cgttggatcg cgtcttcttc 1500

gtgctcttgc cgcgtgcatg atgcatgtgt ttcctcctgg cttgtgttcg tgtatgtgac 1560

gtgtttgttc gggcatgcat gcaggcgaac gggcaccgtg tcatggtcgt ctctccccgc 1620

tacgaccagt acaaggacgc ctgggacacc agcgtcgtgt ccgaggtacg gccaccgaga 1680

ccagattcag atcacagtca cacacaccgt catgtgaacc tttctctgct ctgatgcctg 1740

caactgcaaa tgcatgcaga tcaagatggg agacgggtac gagacggtca ggttcttcca 1800

ctgctacaag cgcggagtgg accgcgtgtt cgttgaccac ccactgttcc tggagagggt 1860

gagacgagat ctgatcactc gatacgcaat taccacccca ttgtaagcag ttacagtgag 1920

ctttttttcc ccccggcctg gtcgctggtt tcaggtttgg ggaaagaccg aggagaagat 1980

ctacgggcct gtcgctggaa cggactacag ggacaaccag ctgcggttca gcctgctatg 2040

ccaggtcagg atggcttgct actacaactt cagatcatct gtatgcagca gtatacaccg 2100

atgagaaatg catgctgttc tgcaggcagc acttgaagct ccaaggatcc tgagcctcaa 2160

caacaaccca tacttctccg gaccatacgg taagagttgc tgctcttcgt ccatcagacg 2220

gactgtcatt ttacactgac tactgctgct gctcttcgtc catccataca aggggaggac 2280

gtcgtgttcg tctgcaacga ctggcacacc ggccctctct cgtgctacct caagagcaac 2340

taccagtccc acggcatcta cagggacgca aaggttgcct tctctgctga actgaacaac 2400

gccgccttcg ttctccatgc tcgtatatac ctcatctggt ggtggtgctt ctctgaaact 2460

gaaactgaaa ctgactgcat gtctgtctga ccatcttcac gtactaccta ccagaccgct 2520

ttctgcatcc acaacatctc ctaccagggc cggttcgcct tctccgacta cccggagctg 2580

aacctccccg agagattcaa gtcgtccttc gatttcatcg acgggtctgt tttcctgcgt 2640

gcatgtgaac attcatgaac ggtaacccac aactgttcgc gtcctgctgg ttcattatct 2700

gacctggatt gcattgcagc tacgagaagc ccgtggaagg ccggaagatc aactggatga 2760

aggccgggat cctcgaggcc gacagggtcc tcaccgtcag cccctactac gccgaggagc 2820

tcatctccgg catcgccagg ggctgcgagc tcgacaacat catgcgcctc accggcatca 2880

ccggcatcgt caacggcatg gacgtcagcg agtgggaccc cagcagggac aagtacatcg 2940

ccgtgaagta cgacgtgtcg acggtgagct ggctggctag ctgattctgc tgcctggtcc 3000

tcctgctcat gctggttcgg ttctgacgcg gcgagtgtac gtacgtgcgt gcgacggtgg 3060

tgtggtgtcc ggttcaggcc gtggaggcca aggcgctgaa caaggaggcg ctgcaggcgg 3120

aggtcgggct cccggtggac cggaacatcc cgctggtggc gttcatcggc aggctggaag 3180

agcagaaggg ccccgacgtc atggcggccg ccatcccgca gctcatggag atggtggagg 3240

acgtgcagat cgttctgctg gtacgtgtgc gccgcccgcc acccggctac tacatgcgtg 3300

tatcgttcta ctggaacata cgtgtgagca acgcgatgga taatgctgca gggcacgggc 3360

aagaagaagt tcgagcgcat gctcatgagc gccgaggaga agttcccagg caaggtgcgc 3420

gccgtggtca agttcaacgc ggcgctggcg caccacatca tggccggcgc cgacgtgctc 3480

gccgtcacca gccgcttcga gccctgcggc ctcatccagc tgcaggggat gcgatacgga 3540

acggtacgag agagaaaaaa aacatcctga atccctgacg agagggacag agacagattg 3600

attatgaatg cttcatcgat ttgaattgat tgatcgatgt ctcccgctgc gactcttgca 3660

gccctgcgcc tgcgcgtcca ccggtggact cgtcgacacc atcatcgaag gcaagaccgg 3720

gttccacatg ggccgcctca gcgtcgacgt aagcctacct ctgccatgtt ctttcttctt 3780

tctttctgta tgtatgtatg tatgtacgaa tcagcaccgc cattcttgtt tcgtcgtcct 3840

ctcttcccag tgcaacgtcg tggagccggc ggacgtcaag aaggtggcca ccaccttgca 3900

gcgcgccatc aaggtggtcg gcacgccggc gtacgaggag atggtgagga actgcatgat 3960

ccaggatctc tcctggaagg tacgtacgcc cgccccgcca gagcagagcg ccaagatcga 4020

tcgatcgacc gaccacacgt acgcgcctcg ctcttgtcgc tgaccgtggt ttaatttgcg 4080

aaatgcgcag ggccctgcca agaactggga gaacgtgctg ctcagcctcg gggtcgccgg 4140

cggcgagcca ggggttgaag gcgaggagat cgcgccgctc gccaaggaga acgtggccgc 4200

gccctga 4207

<210>8

<211>606

<212>PRT

＜213〉corn (Zea mays)

<400>8

Met Ala Ala Leu Ala Thr Ser Gln Leu Val Ala Thr Arg Ala Gly Leu

1 5 10 15

Gly Val Pro Asp Ala Ser Thr Phe Arg Arg Gly Ala Ala Gln Gly Leu

20 25 30

Arg Gly Ala Arg Ala Ser Ala Ala Ala Asp Thr Leu Ser Met Arg Thr

35 40 45

Ser Ala Arg Ala Ala Pro Arg His Gln His Gln Gln Ala Arg Arg Gly

50 55 60

Ala Arg Phe Pro Ser Leu Val Val Cys Ala Ser Ala Gly Met Asn Val

65 70 75 80

Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser Lys Thr Gly Gly Leu

85 90 95

Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met Ala Ala Asn Gly His

100 105 110

Arg Val Met Val Val Ser Pro Arg Tyr Asp Gln Tyr Lys Asp Ala Trp

115 120 125

Asp Thr Ser Val Val Ser Glu Ile Lys Met Gly Asp Gly Tyr Glu Thr

130 135 140

Val Arg Phe Phe His Cys Tyr Lys Arg Gly Val Asp Arg Val Phe Val

145 150 155 160

Asp His Pro Leu Phe Leu Glu Arg Val Trp Gly Lys Thr Glu Glu Lys

165 170 175

Ile Tyr Gly Pro Val Ala Gly Thr Asp Tyr Arg Asp Asn Gln Leu Arg

180 185 190

Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala Pro Arg Ile Leu Ser

195 200 205

Leu Asn Asn Asn Pro Tyr Phe Ser Gly Pro Tyr Gly Glu Asp Val Val

210 215 220

Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu Ser Cys Tyr Leu Lys

225 230 235 240

Ser Asn Tyr Gln Ser His Gly Ile Tyr Arg Asp Ala Lys Thr Ala Phe

245 250 255

Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe Ala Phe Ser Asp Tyr

260 265 270

Pro Glu Leu Asn Leu Pro Glu Arg Phe Lys Ser Ser Phe Asp Phe Ile

275 280 285

Asp Gly Tyr Glu Lys Pro Val Glu Gly Arg Lys Ile Asn Trp Met Lys

290 295 300

Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr Val Ser Pro Tyr Tyr

305 310 315 320

Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly Cys Glu Leu Asp Asn

325 330 335

Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val Asn Gly Met Asp Val

340 345 350

Ser Glu Trp Asp Pro Ser Arg Asp Lys Tyr Ile Ala Val Lys Tyr Asp

355 360 365

Val Ser Thr Ala Val Glu Ala Lys Ala Leu Asn Lys Glu Ala Leu Gln

370 375 380

Ala Glu Val Gly Leu Pro Val Asp Arg Asn Ile Pro Leu Val Ala Phe

385 390 395 400

Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp Val Met Ala Ala Ala

405 410 415

Ile Pro Gln Leu Met Glu Met Val Glu Asp Val Gln Ile Val Leu Leu

420 425 430

Gly Thr Gly Lys Lys Lys Phe Glu Arg Met Leu Met Ser Ala Glu Glu

435 440 445

Lys Phe Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn Ala Ala Leu

450 455 460

Ala His His Ile Met Ala Gly Ala Asp Val Leu Ala Val Thr Ser Arg

465 470 475 480

Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg Tyr Gly Thr

485 490 495

Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr Ile Ile Glu

500 505 510

Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp Cys Asn Val

515 520 525

Val Glu Pro Ala Asp Val Lys Lys Val Ala Thr Thr Leu Gln Arg Ala

530 535 540

Ile Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val Arg Asn Cys

545 550 555 560

Met Ile Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn Trp Glu Asn

565 570 575

Val Leu Leu Ser Leu Gly Val Ala Gly Gly Glu Pro Gly Val Glu Gly

580 585 590

Glu Glu Ile Ala Pro Leu Ala Lys Glu Asn Val Ala Ala Pro

595 600 605

<210>9

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>9

ggatatcacc atggcggctc tggccacg 28

<210>10

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>10

gtcctgcagg ctacacatac ttgtcca 27

<210>11

<211>1863

<212>DNA

＜213〉corn (Zea mays)

<400>11

atggcggctc tggccacgtc gcagctcgtc gcaacgcgcg ccggcctggg cgtcccggac 60

gcgtccacgt tccgccgcgg cgccgcgcag ggcctgaggg gggcccgggc gtcggcggcg 120

gcggacacgc tcagcatgcg gaccagcgcg cgcgcggcgc ccaggctcca gctgcaccag 180

cagcagcagc aggcgcgccg cggggccagg ttcccgtcgc tcgtcgtgtg cgccagcgcc 240

ggcatgaacg tcgtcttcgt cggcgccgag atggcgccgt ggagcaagac cggcggcctc 300

ggcgacgtcc tcggcggcct gccgccggcc atggccgcga atgggcaccg tgtcatggtc 360

gtctctcccc gctacgacca gtacaaggac gcctgggaca ccagcgtcgt gtccgagatc 420

aagatgggag acaggtacga gacggtcagg ttcttccact gctacaagcg cggagtggac 480

cgcgtgttcg ttgaccaccc actgttcctg gagagggttt ggggaaagac cgaggagaag 540

atctacgggc ctgtcgctgg aacggactac agggacaacc agctgcggtt cagcctgcta 600

tgccaggcag cacttgaagc tccaaggatc ctgagcctca acaacaaccc atacttctcc 660

ggaccatacg gggaggacgt cgtgttcgtc tgcaacgact ggcacaccgg ccctctctcg 720

tgctacctca agagcaacta ccagtcccac ggcatctaca gggacgcaaa gaccgctttc 780

tgcatccaca acatctccta ccagggccgg ttcgccttct ccgactaccc ggagctgaac 840

ctccccgaga gattcaagtc gtccttcgat ttcatcgacg gctacgagaa gcccgtggaa 900

ggccggaaga tcaactggat gaaggccggg atcctcgagg ccgacagggt cctcaccgtc 960

agcccctact acgccgagga gctcatctcc ggcatcgcca ggggctgcga gctcgacaac 1020

atcatgcgcc tcaccggcat caccggcatc gtcaacggca tggacgtcag cgagtgggac 1080

cccagcaggg acaagtacat cgccgtgaag tacgacgtgt cgacggccgt ggaggccaag 1140

gcgctgaaca aggaggcgct gcaggcggag gtcgggctcc cggtggaccg gaacatcccg 1200

ctggtggcgt tcatcggcag gctggaagag cagaagggcc ccgacgtcat ggcggccgcc 1260

atcccgcagc tcatggagat ggtggaggac gtgcagatcg ttctgctggg cacgggcaag 1320

aagaagttcg agcgcatgct catgagcgcc gaggagaagt tcccaggcaa ggtgcgcgcc 1380

gtggtcaagt tcaacgcggc gctggcgcac cacatcatgg ccggcgccga cgtgctcgcc 1440

gtcaccagcc gcttcgagcc ctgcggcctc atccagctgc aggggatgcg atacggaacg 1500

ccctgcgcct gcgcgtccac cggtggactc gtcgacacca tcatcgaagg caagaccggg 1560

ttccacatgg gccgcctcag cgtcgactgc aacgtcgtgg agccggcgga cgtcaagaag 1620

gtggccacca ccttgcagcg cgccatcaag gtggtcggca cgccggtgta cgaggagatg 1680

gtgaggaact gcatgatcca ggatctctcc tggaagggcc ctgccaagaa ctgggagaac 1740

gtgctgctca gcctcggggt cgccggcggt gcagggcccc tgatctcgcg cgtggtgcaa 1800

agatgttggg acatcttctt atatatgctg tttcgtttat gtgatatgga caagtatgtg 1860

tag 1863

<210>12

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>12

ggcgcgccgt cgacggtatc gataagcttg c 31

<210>13

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>13

gcggccgccc gcttggtatc tgcattacaa tg 32

<210>14

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>14

gatcgtttaa acgttcgtgt ggcagattca tc 32

<210>15

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>15

gacgtggcca gagccgccat gccgattaat ccactgcata g 41

<210>16

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>16

atcttgctcg atgccttctc 20

<210>17

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer sequence

<400>17

gccttcgctt gtcgtgggt 19

Claims (20)

1. the nucleic acid molecule of purifying basically, its be selected from by:

A) comprise the nucleic acid molecule of SEQ ID NO:1 or its complement;

B) comprise the nucleic acid molecule of SEQ ID NO:11 or its complement; With

C) coding and SEQ ID NO:3 have the nucleic acid molecule at least about the polypeptide of 94% amino acid homogeny

The group that is constituted.

2. the expression cassette that comprises the described nucleic acid molecule of claim 1, wherein said nucleic acid molecule operably is connected with the promotor that has function in vegetable cell.

3. the vegetable cell that comprises the described expression cassette of claim 2.

4. the plant that comprises the described vegetable cell of claim 3.

5. plant as claimed in claim 4, wherein said plant are monocotyledons.

6. plant as claimed in claim 5, wherein said monocotyledons are corn.

7. from the seed of maize plant acquisition, wherein said seed comprises the described nucleic acid molecule of claim 1.

8. Accessory Right requires the animal-feed that 7 described seeds obtain.

9. carry stable plant of incorporating its genomic nucleic acid molecule into, wherein said nucleic acid molecule be selected from by:

A) comprise the nucleic acid molecule of SEQ ID NO:1 or its complement;

B) comprise the nucleic acid molecule of SEQ ID NO:11 or its complement; With

C) coding and SEQ ID NO:3 have the nucleic acid molecule at least about the polypeptide of 94% amino acid homogeny

The group that is constituted.

10. plant as claimed in claim 9, wherein said plant are monocotyledons.

11. monocotyledons as claimed in claim 10, described plant are corn.

12. the seed that Accessory Right requires 11 described plants to obtain.

13. the grease that Accessory Right requires 12 described seeds to obtain.

14. the animal-feed that Accessory Right requires 12 described seeds to obtain.

15. a method is used to produce the plant of the grease production level with increase, described method comprises:

(a) adopt the expression cassette comprise a kind of nucleic acid molecule to transform plant, described nucleic acid molecule be selected from by:

I) comprise the nucleic acid molecule of SEQ ID NO:1 or its complement;

The nucleic acid molecule that ii) comprises SEQ ID NO:11 or its complement; With

Iii) coding and SEQ ID NO:3 have the nucleic acid molecule at least about the polypeptide of 94% amino acid homogeny

The group that is constituted;

Wherein, described expression cassette further comprises the promoter region that operably is connected with described nucleic acid molecule, have function in vegetable cell; With

(b) cultivate described plant transformed.

16. method as claimed in claim 15, wherein said plant are monocotyledons.

17. method as claimed in claim 16, wherein said monocotyledons are corn.

18. method as claimed in claim 17, wherein said promoter region are the endosperm promoter region.

19. method as claimed in claim 18, wherein said promoter region are the Z27 promotor.

20. a method of screening corn germplasm, it comprises the steps:

A) definite distinctive at least a polymorphism of HOI001 GBSS sequence shown in SEQ ID NO:1;

B) select the fragment of SEQ ID NO:1 to use, contain a kind of at least a portion in the described definite polymorphism in the described fragment as molecule marker;

C) existence at described mark is detected maize plant; With

D) filter out the plant that contains described mark.

Images