CN1719971A - Transgenic high tryptophan plants - Google Patents

Transgenic high tryptophan plants Download PDF

Info

Publication number
CN1719971A
CN1719971A CNA028135067A CN02813506A CN1719971A CN 1719971 A CN1719971 A CN 1719971A CN A028135067 A CNA028135067 A CN A028135067A CN 02813506 A CN02813506 A CN 02813506A CN 1719971 A CN1719971 A CN 1719971A
Authority
CN
China
Prior art keywords
anthranilate
synzyme
plant
separated dna
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA028135067A
Other languages
Chinese (zh)
Other versions
CN1719971B (en
Inventor
L·M·韦弗
J·梁
R·陈
S·S·郑
T·米特斯基
S·斯拉特尔
W·拉普
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Renessen LLC
Monsanto Co
Original Assignee
Renessen LLC
Monsanto Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Renessen LLC, Monsanto Co filed Critical Renessen LLC
Publication of CN1719971A publication Critical patent/CN1719971A/en
Application granted granted Critical
Publication of CN1719971B publication Critical patent/CN1719971B/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
    • C12N15/8254—Tryptophan or lysine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides a method for conferring tolerance to an amino acid analog of tryptophan to a plant and/or altering the tryptophan content of a plant by introducing and expressing an isolated DNA segment encoding an anthranilate synthase in the cells of the plant. Transgenic plants transformed with an isolated DNA segment encoding an anthranilate synthase, as well as human or animal food, seeds and progeny derived from these plants, are also provided.

Description

The transgenosis high tryptophan plants
Background of invention
What a lot of important crops comprised that the seed of soybean and corn do not contain capacity makes several completely seed amino acids of nutrition.These amino acid include but not limited to: tryptophan, isoleucine, valine, arginine, lysine, methionine and threonine.Therefore, these amino acid whose biosynthesis pathways, and/or enter the biosynthesis pathway of the metabolite of those approach, be the potential target of operating for the amino acid content that improves these plants.
Anthranilate synzyme (AS, EC 4.1.3.27) catalysis is branched off into plant from the ArAA approach, biosynthetic first reaction of tryptophan in fungi and the bacterium.
Branch's acid esters
↓ Anthranilate synzyme
Anthranilate
↓
The Phosphoribosyl Anthranilate
↓
1-(0-carboxyl phenyl amino)-1-
Deoxyribose-5-phosphate
↓
Indoles-3-glycerophosphate
↓
Indoles
↓
Tryptophan
(for example, corn Anthranilate synzyme) modal form is by two subunits to the Anthranilate synzyme, α or TrpE subunit and β or TrpG subunit, the different tetramer enzyme of formation.Two α subunits and two β subunit assemblings form different tetramer Anthranilate synzyme.Also found the AS of " monomer " form, it comprises the single polypeptide chain (for example rhizobium melioti (Rhizobium meliloti)) with TrpE and two kinds of subunit activity of TrpG.Anthranilate synzyme monomer includes only one type polypeptide, and the enzymic activity form of Anthranilate synzyme monomer is generally by such two homodimers that polypeptide monomer is formed.Anthranilate is synthetic in the reaction of the special-shaped tetramer and monomer Anthranilate synzyme catalysis use glutamine and branch's acid esters.The domain of finding on the α subunit (being called " αJie Gouyu " here) conjugate branch acid esters and eliminate enol pyruvic acid side chain, the domain of finding on the β subunit (being called " beta structure territory " here) with the transamination on the glutamine on the branch's acid esters benzyl ring between carboxylate and the enol pyruvate part.
Next one reaction during tryptophan is synthetic is that the ribose phosphate with the phosphoribosylpyrophosphate ester partly is transferred to Anthranilate.Form indole ring through two steps, comprise the isomerization that ribose groups is transferred to ribulose, then carry out cyclization and obtain indoleglycerolphosphoric acid.Last reaction is comprise one or two subunit single enzymatic in this approach.Reaction realizes the cracking of indoles glyceraldehyde-3-phosphate and the condensation (Umbarger, Ann.Rev.Biochem, 47,555 (1978)) of indolyl radical and serine.
Metabolism logistics in senior plant and the microorganism tryptophan approach obviously is subjected to by the adjusting of tryptophan to Anthranilate synzyme feedback inhibition.Tryptophan can be blocked conformation and reset, and needs conformation to reset and activate the beta structure territory and produce ammonia to the passage that the avtive spot in α-Jie Gou territory passes through.Believe the tryptophan preparation of such feedback inhibition compacting of tryptophan by the Anthranilate synzyme.Referring to Li J. ﹠amp; Last, R.L. mouse ear mustard trp5 mutant have the solubility tryptophan .PlantPhysiol.110 of feedback resistance Anthranilate synzyme and raising, 51-59 (1996).
Identified in the feedback regulation from the Anthranilate synzyme of salmonella typhimurium (Salmonella typhimurium) and related to the several amino acid residue.This information provides the evidence of amino terminal regulatory site.J.Biol.Chem.266，8328-8335(1991)。Application molecular pathways such as Niyogi have further characterized the Anthranilate synzyme from certain plants.Referring to Niyogi and (Plant Cell, 5,1011 (1993)) such as Fink (Plant Cell, 4,721 (1992)) and Niyogi.They belong to the α-subunit of Anthranilate synzyme at find differences two non-allelic genes coding mouse ear mustard that are closely related regulating.In these α-subunit genes one, ASA1 is induced by injury and bacterial pathogens infiltration, infers that it relates in defence responds, and another α-subunit, ASA2 is expressed with composing type foundation level.The both indicates that protein all has the district with bacterium and fungi Anthranilate synthetase protein homology, and comprise conservative amino acid residue (Caligiuri etc. in the site that the tryptophan feedback inhibition of bacterium relates in proof, J.Biol.Chem., 266,8328 (1991)).
The analog of the amino acid analogue of tryptophan and intermediate (for example in the tryptophan biosynthesis pathway, 5-methyl tryptophan, the 4-methyl tryptophan, 5-fluoro tryptophan, the 5-hydroxytryptophan, 7-azatryptophan, 3 β-indole acrylic acid, 3-methyl ortho-aminobenzoic acid), inhibition prokaryotes and Eukaryotic growth have been proved to be.Can select plant cell cultures to these amino acid analogue resistances.For example, because the Anthranilate synzyme that changes, by 5-methyl tryptophan (5-MT), a kind of amino acid analogue of tryptophan has been selected the tobacco of cultivating, carrot, potato, corn and hair Mandala cell-line.
(Plant Physio. such as Ranch, 71,136 (1983)) to the hair Mandala, a kind of cell culture screening 5-MT resistance of broadleaf weed, and report that this resisting cell culture contains the tryptophan levels of raising (higher 8 to 30 times than wild type level) and the Anthranilate synzyme has less susceptibility to the tryptophan feedback inhibition.Aftergrowth also has resistance to 5-MT, contains the Anthranilate synzyme that changes, and the leaf of comparing according to plant has higher free tryptophan concentration (4-44 doubly).Opposite with the research of using tobacco, the enzyme of not expressing change wherein from the plant of resistant cell line regeneration, these results show that amino acid excess production phenotype should select on cellular level, and express in the whole plant of the cytothesis of selecting in the hair Mandala.
Hibberd etc. (U.S. Patent No. 4,581, on April 15th, 847,1986 is open) have described 5-MT resistance maize cell system, and it contains the Anthranilate synzyme littler to feedback inhibition susceptibility than wild type Anthranilate synzyme.A kind of free tryptophan level of 5-MT resistant cell line accumulation is big 20 times than there not being cell transformed almost.
(U.S. Patent No. 6 such as P.C.Anderson, 118,047) disclose from the insensitive α-Jie Gou of the tryptophan territory of the Anthranilate synzyme of C28 corn and prepared the purposes of the rotaring gene corn plant (corn) that has high-level free tryptophan in the seed in transgenosis.
Although might screen the 5-MT resistance in some cell culture and plant, this feature inevitablely is not associated with the excess production of free tryptophan in the whole plant.In addition, usually do not express the enzyme that changes form from the plant of 5-MT resistance system regeneration.Can not foretell that this feature is stable and go down to posterity as inherited characteristics in one period.
From the crude extract of senior plant cell cultures also partial purification go out Anthranilate synzyme (Hankins etc., PlantPhysiol., 57,101 (1976); Widholm, Biochim.Biophys.Acta, 320,217 (1973)).But, find that it is very unsettled.Therefore, need provide plant with the Anthranilate synzyme source that can improve the plant tryptophane.
Summary of the invention
The invention provides the nucleic acid of the coding Anthranilate synzyme (AS) that is used for producing genetically modified plants.When in genetically modified plants, expressing such Anthranilate synzyme nucleic acid, can reach the tryptophan of improving the standard in the plant cell.In one embodiment, the present invention relates to the to encode dna molecular of monomer Anthranilate synzyme, wherein such monomer Anthranilate synzyme are the α of natural or engineered Anthranilate synzyme-and the chimeric fusions in beta structure territory.The natural monomer Anthranilate synzyme that constitutes single polypeptide chain that provides of Anthranilate synthase gene from several species (for example, some bacteriums and other microorganism).But most of species have by two α that find on the subunit separately-and two assorted tetramer Anthranilate synzyme that the beta structure territory is formed.The invention still further relates to the formation of the chimeric Anthranilate synzyme fusion that comprises any Anthranilate synthetase alpha-domain that is connected with any beta structure territory.
Generally speaking, the sequence homogeneity of naturally occurring monomer Anthranilate synzyme and most of plant Anthranilate synzyme is very low.But according to the present invention, such monomer Anthranilate synzyme can provide high-level tryptophan when expressing in plant, although low with the sequence homogeneity of the endogenous Anthranilate synzyme of plant.Therefore, the invention provides the monomer Anthranilate synzyme that has divergent sequence and high-level tryptophan can effectively be provided in the plant host.For example, the genetically engineered soybean plant that contains monomer Agrobacterium tumefaciens (Agrobacterium tumefaciens) Anthranilate synzyme can produce at most about 10,000 to about 12 in seed, the 000ppm tryptophan, average trp horizontal extent about 7,000 is to about 8,000ppm.On the contrary, generally have only about at the most 100 in the non-transgenic soybean plant seed to about 200ppm tryptophan.
Therefore, the invention provides the separated DNA sequence of coding monomer Anthranilate synzyme, wherein monomer Anthranilate synzyme has Anthranilate α-Jie Gou territory and Anthranilate beta structure territory, and wherein expresses monomer Anthranilate synzyme in plant.Such expression can improve the level of L-tryptophan in the plant.
Monomer Anthranilate synzyme can be natural monomer.Therefrom the example of the organism of separating natural monomer Anthranilate synzyme nucleic acid includes but not limited to following organism, Agrobacterium tumefaciens for example, rhizobium melioti (Rhizobium meliloti) (for example, Genbank registration number No.GI 95177), Mesorhizobium loti (for example, Genbank registration number No.GI 13472468), Bacterium melitense (Brucellamelitensis) (for example, Genbank registration number No.GI 17982357), PCC7120 (for example for beads cyanobacteria (Nostoc sp.), Genbank registration number Nos.GI 17227910 or GI 17230725), Azospirillum brasilense (Azospirillum brasilense) (for example, Genbank registration number No.GI 1174156) and fish raw meat cyanobacteria (AnabaenaM22983) (for example, Genbank registration number No.GI 152445).In some embodiments, the separated DNA coding has and for example has Agrobacterium tumefaciens Anthranilate synzyme SEQ ID NO:4 amino acid sequence or that have SEQ ID NO:1 or 75 any nucleotide sequence.
Perhaps, monomer Anthranilate synzyme can be any obtainable Anthranilate synthetase alpha-and the fusion in beta structure territory.Such α-can obtain from following biology: corn with the beta structure territory, rue, sulfolobus solfataricus (Sulfolobussolfataricus), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), Escherichia coli (Escherichia coli), Agrobacterium tumefaciens (Agrobacterium tumefaciens), mouse ear mustard, rhizobium melioti (Rhizobium meliloti) (for example, Genbank registration number No.GI95177), Mesorhizobium loti (for example, Genbank registration number No.GI 13472468), Bacterium melitense (Brucella melitensis) (for example, Genbank registration number No.GI 17982357), PCC7120 (for example for beads cyanobacteria (Nostoc sp.), Genbank registration number Nos.GI 17227910 or GI 17230725), Azospirillum brasilense (Azospirillum brasilense) (for example, Genbank registration number No.GI 1174156) and fish raw meat cyanobacteria (Anabaena) M22983 (for example, Genbank registration number No.GI152445), soybean, rice, cotton, wheat, tobacco or the subunit of coding Anthranilate synzyme or any gene of domain.For example, such α that encodes-or the nucleic acid in beta structure territory can be by using SEQ ID NO:1-70, and the sequence information of any obtains among the 75-103.
In another embodiment, the invention provides coding and comprise the SEQ ID NO:5 or the separated DNA in the α-Jie Gou territory of the Anthranilate synzyme of SEQ ID NO:66 from corn.Such separated DNA can have SEQ ID NO:2,67 or 68 nucleotide sequence.Separated DNA can be connected with the promotor operability, and can provide high-level L-tryptophan when expressing in plant in plant.
Separated DNA also can encoding mutant body Anthranilate synzyme, perhaps mutant Anthranilate synthetase structure domain.Such mutant Anthranilate synzyme, perhaps its domain can have the sudden change of a place or many places.As well known to a person skilled in the art, sudden change can be reticent, can provide to have the gene outcome variant that is similar to the wild-type enzyme activity, perhaps can provide the gene outcome derivative of the enzymic activity with change.The present invention includes all such mutant.
The separated DNA energy of sudden change is external or body is interior produces from wild type Anthranilate synzyme nucleic acid, and can encode, and for example, one or more aminoacid replacement lack or insert.Generation has the activity of raising, higher stability, and perhaps the separated DNA s to the sudden change of the responsive less Anthranilate synthase mutant of tryptophan or tryptophan analog feedback inhibition is that people expect.In one embodiment, the Anthranilate synzyme, perhaps its domain, the inhibitory action that endogenous L-tryptophan or tryptophan analog are given has resistance.For example, the Anthranilate synzyme is at tryptophan binding pocket place or reduce Anthranilate synzyme or its domain there are one or more sudden changes in the other places of the inhibiting susceptibility of tryptophan.What relate to sudden change in the amino acid residue is for example about 48,51,52,293 and the residue of 298 positions.For example, sudden change can be:
A) at about 48, Phe replaces Val;
B) at about 48, Tyr replaces Val;
C) at about 51, Phe replaces Ser;
D) at about 51, Cys replaces Ser;
E) at about 52, Phe replaces Asn;
F) at about 293, Ala replaces Pro;
G) at about 293, Gly replaces Pro; Or
H) at about 298, Trp replaces Phe;
Wherein determine the position that suddenlys change with the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence by the amino acid sequence of the Anthranilate synzyme that will select.Example with Anthranilate synzyme of such sudden change comprises having SEQ ID NO:58-65,69,70, those of 84-94.
Separated DNA can encode other element and function.Comprise any element or function that those skilled in the art expect.For example, separated DNA can also be included in the promotor that function is arranged in the plant cell, and it is connected with the DNA operability of coding Anthranilate synzyme.The separated DNA plastid transit peptides of can also encoding.Separated DNA can also encode selected marker or reporter.Such selectable marker gene can be given the cell conferring herbicide resistance of described plant, high protein content, high oil content, high-lysine content, homoisoleucine content, high vitamin e content etc.Described dna sequence dna can also comprise one or more the sequence of coding from the insecticidal proteins of bacillus thuringiensis (Bacillusthuringiensis).
The present invention further provides the carrier that comprises separated DNA of the present invention.Such carrier can be used to express Anthranilate synzyme polypeptide in prokaryotic and eukaryotic, comes transformed plant cells and produces genetically modified plants.
The present invention also provides the genetically modified plants that comprise separated DNA of the present invention.These separated DNA are expressed in genetically modified plants and can be caused in the genetically modified plants, for example seed of plant or other parts, and the preferably free L-tryptophane of L-tryptophan improves.This content is higher than because of not existing this DNA and genetically engineered soybean plant cell for example not to have cell transformed accordingly or having the content of L-tryptophan in the cell that does not have the different plant of plant transformed of identical genetic background.Described DNA is preferably heritable, but its preferably by breeding plant to its offspring with completely normally have transmit sexual cycle to further going down to posterity again.
The genetically modified plants that can have such separated DNA comprise dicotyledon, for example, and soybean or canola.Perhaps, genetically modified plants can be monocotyledons, for example, and corn, rice, wheat, barley or jowar.
The present invention also provides and comprises separated DNA of the present invention, Anthranilate synzyme polypeptide, the seed of the genetically modified plants of transgenosis or carrier.
The present invention further provides animal feed or people's food of at least a portion that contains plant with separated DNA of the present invention.The part of the plant that can comprise in animal feed or the people's food comprises, for example, and seed, leaf, stem, root, stem tuber, or fruit.The part of plant of expectation has the tryptophan of improving the standard that the expression of the Anthranilate synzyme of separated DNA coding of the present invention provides.
The present invention further provides by changing the preferred method that improves the tryptophane of plant (dicotyledonous or unifacial leaf) in the regenerable cell that separated DNA of the present invention is imported plant.Described dna sequence dna preferably is connected with an exercisable promotor operability in the plant cell.Identify or the screening cell transformed that regeneration then obtains comprising the plant of the cell of expressive function Anthranilate synzyme polypeptide.In some embodiments, the DNA of coding Anthranilate synzyme or its domain is mutant DNA.The DNA that imports is preferably heritable, but and plant optimization be breeding plant.For example, the DNA of importing preferably can go down to posterity by the complete sexual circulation that produces the offspring plant, and gives the high tryptophan phenotype can for offspring's the next generation.
Anthranilate synzyme-coding DNA s, preferably be inserted in the carrier or in the transgenosis, the dna sequence dna that wherein can also comprise the transit peptides of encoding, plastid transit peptides for example, with selected marker or reporter, they are connected with one or more promotor operability that function is arranged in the target plant cell.Promotor can be, for example, and inducible promoter, tissue-specific promoter, strong promoter or weak promoter.Other is transcribed or translation adjusting element, and for example, enhancer or termination also can be connected in Anthranilate synzyme-coding DNA fragment by function.
By various transformation technologies, for example, by microparticle bombardment, the obtainable method of conversion and other this area of electroporation and Agrobacterium tumefaciens mediation, can transform in the suspension culture or as the embryo, the cell of complete tissue or organ.
Therefore, the cell of conversion plant comprises transgenosis or other dna fragmentation of natural Anthranilate synthase gene and encoding exogenous Anthranilate synzyme.The expression of external source Anthranilate synzyme in plant cell can cause the raising of tryptophan and secondary metabolites level thereof.In some embodiments, the tolerance to a certain amount of endogenous L-tryptophan analog is given in such expression, for example, compare with plant cell like this, have about at least 10% above Anthranilate synthase activity with wild type or tryptophan responsive type Anthranilate synzyme.
The present invention also provides the method that changes tryptophane in the plant, comprise: the transgenosis that (a) in the plant regenerable cell, imports the separated DNA that comprises coding Anthranilate synthetase structure domain and plastid transit peptides, its operability is connected in the promotor that function is arranged in plant cell, obtain transformant; (b) from described transformed plant cells regeneration transformed plant, wherein said plant cell reaches the Anthranilate synthetase structure domain that separated DNA is encoded with the scale that does not have effectively to improve tryptophane in the plant transformed the tryptophane in described plant with respect to identical genetic background.Described domain can be Anthranilate synthetase alpha-domain.The Anthranilate synthetase structure domain can have one or more sudden changes, for example, reduces the sudden change of domain to the inhibiting susceptibility of tryptophan.Such sudden change can be in tryptophan binding pocket for example.Such domain can be for example from the Anthranilate synthetase structure domain of following microorganism: Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense), Bacterium melitense (Brucella melitensis), Escherichia coli (Escherichia coli), Euglenagracilis, Mesorhizobium loti, beads cyanobacteria (Nostoc sp.) PCC7120, rhizobium melioti (Rhizobium meliloti), rue, color Rhodopseudomonas (Rhodopseudomonas palustris), salmonella typhimurium (Salmonellatyphimurium), serratia marcescens (Serratia marcescens), sulfolobus solfataricus (Sulfolobus solfataricus), soybean, rice, cotton or corn.Rue has the chloroplast transit sequence of itself, and it can use with Anthranilate synzyme transgenosis.Therefore, those skilled in the art do not need to add the plastid transit sequence when using rue DNA.
The present invention also provides new separation and dna molecular purifying of the DNA that comprises coding monomer Anthranilate synzyme or its domain.Such Anthranilate synthetase dna can provide high-level tryptophan when expressing in plant.In some embodiments, the Anthranilate synzyme has resistance to the inhibitory action of free L-tryptophan or its analog basically.The example of the new dna sequence dna that the present invention relates to includes but not limited to from following microorganism isolated DNA molecule: Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillumbrasilense), Bacterium melitense (Brucella melitensis), Escherichia coli (Escherichia coli), Euglena gracilis, Mesorhizobium loti, beads cyanobacteria (Nostoc sp.) PCC7120, rhizobium melioti (Rhizobiummeliloti), rue, color Rhodopseudomonas (Rhodopseudomonas palustris), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratiamarcescens), sulfolobus solfataricus (Sulfolobus solfataricus), or corn.
These dna sequence dnas comprise the Anthranilate synzyme synthetic or naturally occurring monomeric form in the α-Jie Gou territory with the Anthranilate synzyme that is connected with at least a other Anthranilate synthetase structure domain on the polypeptide strand.Monomer Anthranilate synzyme can be Anthranilate synthetase alpha-or the fusion in beta structure territory for example.Such Anthranilate synthetase alpha-or the beta structure territory can be from Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense), Bacterium melitense (Brucella melitensis), Escherichia coli (Escherichia coli), Euglena gracilis, Mesorhizobium loti, beads cyanobacteria (Nostocsp.) PCC7120, rhizobium melioti (Rhizobium meliloti), rue, color Rhodopseudomonas (Rhodopseudomonas palustris), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), sulfolobus solfataricus (Sulfolobus solfataricus), soybean, rice, cotton, wheat, tobacco or corn (zea mays), the subunit of the Anthranilate synzyme of perhaps encoding or any gene of domain.The Anthranilate synzyme nucleic acid that separates from following source is also for example understood such Anthranilate synzyme and domain thereof here: Agrobacterium tumefaciens, (SEQ ID NO:1,75,84-94), corn, (SEQ ID NO:2,67,68,96), rue (SEQ ID NO:3), fish raw meat cyanobacteria M22983, mouse ear mustard (SEQID NO:45), Azospirillum brasilense (SEQ ID NO:78), Bacterium melitense (SEQID NO:79), Mesorhizobium loti (SEQ ID NO:77), beads cyanobacteria PCC7120 (SEQ ID NO:80 or 81), rhizobium melioti (SEQ ID NO:7), color Rhodopseudomonas (SEQ ID NO:57), sulfolobus solfataricus (SEQ ID NO:8), rice (SEQ ID NO:94 or 95), wheat (SEQ ID NO:97), or tobacco (SEQ ID NO:98).These are nucleotide sequence coded from the Anthranilate synzyme of originating below or its α-Jie Gou territory: Agrobacterium tumefaciens (SEQ ID NO:4,58-65,69,70); Corn (SEQ ID NO:5,66 or 101) and rue (SEQ ID NO:6), fish raw meat cyanobacteria M22983, Azospirillum brasilense (SEQ ID NO:78), Bacterium melitense (SEQ IDNO:79), Mesorhizobium loti (SEQ ID NO:77), beads cyanobacteria PCC7120 (SEQ ID NO:80 or 81), rhizobium melioti (SEQ ID NO:7 or 43), color Rhodopseudomonas (SEQ ID NO:57 or 82), sulfolobus solfataricus (SEQ ID NO:8 or 44), rice (SEQ ID NO:99 or 100), wheat (SEQ ID NO:102), or tobacco (SEQ ID NO:103).
The present invention also provides and comprises that coding Agrobacterium tumefaciens Anthranilate synzyme or its have the isolated DNA molecule of dna sequence dna of the domain of enzymatic activity.Such dna molecular can be encoded and be had SEQ ID NO:4,58-65, and 69 or 70 Anthranilate synzyme has its domain or the variant of Anthranilate synthase activity.Described dna molecular can also have the SEQ of comprising ID NO:1, and 75, the sequence of 84-94, perhaps its domain or variant.The also code area of any dna molecular that can provide here at the plant of for example selecting the organism of selecting or the expression optimization in the microorganism.The example that has the dna molecular of optimizing codon use for the plant of selecting is the Agrobacterium tumefaciens Anthranilate synthetase dna molecule with SEQ ID NO:75.
The present invention also provides separation and dna molecular purifying of the dna sequence dna that comprises coding corn Anthranilate synthetase structure domain.Such dna molecular can be encoded and be had SEQID NO:5,66 Anthranilate synthetase structure domain or have its variant or the derivative of Anthranilate synthase activity.Described dna molecular also can have the SEQID of comprising NO:2,67 or 68 sequence, perhaps its domain or variant.
The present invention further provides under rigorous condition and comprise SEQ ID NO:1,75 or any isolated DNA molecule of at least 8 nucleotide of complementary sequence hybridization of dna molecular of 84-94.Such dna molecular can be probe or primer, for example, has any nucleic acid of SEQ ID NO:9-42 or 47-56.Perhaps, described DNA can comprise at the most at the Anthranilate synzyme of selecting or the whole code area of its domain.Such DNA can also comprise that the dna sequence dna that is coded in exercisable promotor in the plant cell and/or the plastid of encoding transmit the dna sequence dna of peptide.The invention further relates to the carrier that the dna molecular that is used for these types transforms and expresses in plant and/or microorganism.
Also comprise the dna sequence dna and the amino acid sequence sequence homogeneity 50% that show with clear description here in the scope of the invention, preferred 60%, more preferably 70%, more preferably 80%, most preferably 90%, for example, 95% to 99% function Anthranilate synthetase dna sequence and function Anthranilate synzyme polypeptide.For example, the 85% homogeneity meaning be when two sequences maximum matching ratios to the time 85% amino acid be identical.Have vacant position in the maximum coupling (one in two sequences mates); Room length is 5 or is preferred more for a short time, 2 or be preferred more for a short time.
Perhaps and preferably, according to this term used herein, to have accidental data matrix and room default value be 6 or bigger ALIGN program if use, and they have the comparison score value greater than 5, and then these two peptide sequences are homologies.Referring to Dayhoff, M.O., Atlas ofProtein Sequence and Structure, 1972, the 5 volumes, NationalBiomedical Research Foundation, pp.101-110 and the supplementary issue 2 that should roll up, pp.1-10.When utilizing the optimum comparison of ALIGN program, if their amino acid homogeneity more than or equal to 50%, then these two sequences or its part are more preferably homology.
The present invention further provides the expression vector that produces genetically modified plants, comprise the separated DNA sequence that the coding that is connected with the promotor operability that function is arranged comprises the monomer Anthranilate synzyme of the Anthranilate synthetase alpha-domain that is connected with plastid transit peptides with Anthranilate enzyme beta-domain in plant cell with the horizontal tryptophan of high seed.Such monomer Anthranilate synzyme can be, for example, Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense,
Beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.Monomer Anthranilate synzyme can also be Anthranilate synthetase alpha-or the fusion in beta structure territory, such Anthranilate synthetase alpha-or the beta structure territory from Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillumbrasilense), Bacterium melitense (Brucella melitensis), Mesorhizobiumloti, beads cyanobacteria (Nostoc sp.) PCC7120, rhizobium melioti (Rhizobiummeliloti), rue, color Rhodopseudomonas (Rhodopseudomonas palustris), sulfolobus solfataricus (Sulfolobus solfataricus), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), soybean, rice, cotton, wheat, tobacco or corn, the subunit of the Anthranilate synzyme of perhaps encoding or any gene of domain.
The transmission of separation and Anthranilate synthetase dna purifying of the tryptophan levels of raising can be provided with the molecular level evaluation, for example, Southern or Northern engram analysis, PCR-is the method on basis, the biochemistry of Anthranilate synzyme or immune detection, perhaps by phenotype analytical, that is, the offspring's of conversion cell whether can a certain amount of inhibition do not have the growth of plant transformed cell tryptophan amino acid analogue in the presence of grow.
The present invention also is provided at for example yeast of the preferred protokaryon that can cultivate with commercial size or eukaryotic host cell, insect cell, or produce the method for Anthranilate synzyme in the bacterium.This method comprises and will comprise coding Anthranilate synzyme or its domain, monomer Anthranilate synzyme for example, at least comprise α and β Anthranilate synthetase structure domain or its functional variety, the transgenosis of dna fragmentation import host cell, and in host cell, express the Anthranilate synzyme to obtain the step of function Anthranilate synzyme or its domain.Transgenosis generally comprises transcribes and translation adjusting element, for example, the promotor of function is arranged in the host cell in eucaryon or protokaryon source.Preferably, transgenosis is imported into prokaryotic, Escherichia coli for example, perhaps eukaryotic, for example yeast or insect cell, known they be used to produce recombinant protein.Cultivate the enhancing that transformant can cause tryptophan and derivative thereof to be produced, tryptophan and derivative thereof can reclaim from cell or medium.The accumulation of tryptophan can also cause the increase of cometabolism deposits yields in microorganism and the plant, for example contains the metabolite of indoles in the plant, for example simple indoles, indole coupled thing, indole alkaloid, indoles phytoalexin and indoles glucosinalates.
The insensitive Anthranilate synzyme of tryptophan is had the possibility of the kind that increases the metabolite that chorismate mutase derives, comprise since the tryptophan by chorismate mutase derive to the synthetic stimulation of phenyl alanine and from phenyl alanine those.Referring to Siehl, D., from chorismic acid biosynthesis tryptophan, tyrosine and phenyl alanine (The biosynthesis oftryptophan, tyrosine, and phenylalanine from chorismate), PlantAmino Acids:Biochemistry and Biotechnology, BK Singh writes, pp171-204.When there being the insensitive Anthranilate synzyme of feedback is that other chorismic acid metabolite that can increase comprises phenyl propanoids, flavonoids, and quasi-isoflavone, and derive from Anthranilate those, indoles for example, indole alkaloid and indoles glucosinolates.Much important plant hormone in these compounds, plant defense compound, the chemoprophylactic drug of various health status, and/or pharmaceutical active compounds.The scope of its synthetic these compounds that may increase because of the expression of Anthranilate synzyme depends on the organism of wherein expressing the Anthranilate synzyme.The present invention relates to secondary colour propylhomoserin and other useful compound in various protokaryons and eukaryotic and organism, comprise plant cell, microorganism, fungi, yeast, bacterium, insect cell and mammalian cell.
Therefore, the invention provides the method for preparing tryptophan: under the condition of the monomer Anthranilate synzyme that is enough to express the separated DNA coding, cultivate protokaryon or the eukaryotic host cell that comprises separated DNA, wherein monomer Anthranilate synzyme comprises Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, and the condition that wherein is enough to express monomer Anthranilate synzyme comprises enough nutrition and precursors for host cell utilizes monomer Anthranilate synzyme secondary colour propylhomoserin.
The example of the useful compound that can produce when expressing in various host cells and/or organism comprises heteroauxin and other plant hormone, the isoflavonoid compound of finding in the soybean important to cardiovascular health, the volatility benzazolyl compounds that works as signal to teosinte feeding habits insect natural enemy, the cancer therapy drug of finding in the crucifer family, indoles glucosinolates (indole-3-carbinol) for example, and the indole alkaloid of some fungal species generations, ergot compound (Barnes etc. for example, Adv Exp Med Biol, 401,87 (1996); Frey etc., Proc Natl Acad Sci, 97,14801 (2000); Muller etc., BiolChem, 381,679 (2000); Mantegani etc., Farmaco, 54,288 (1999); Zeligs, J Med Food, 1,67 (1998); Mash etc., Ann NY Acad Sci, 844,274 (1998); Melanson etc., Proc Natl Acad Sci, 94,13345 (1997); Broadbent etc., Curr Med Chem, 5,469 (1998)).
The present invention also is provided at medium, under the preferred high rigorous condition, with separate and dna molecular purifying of at least 7 nucleotide bases of the complementary sequence hybridization of Anthranilate synzyme coding DNA molecule.Such separation and dna molecular purifying comprise the new dna fragmentation of coding Anthranilate synzyme or its domain or mutant.Can encode basically inhibitory action that the amino acid analogue of free L-tryptophan or tryptophan is given of mutant DNA has the Anthranilate synzyme of resistance.Such Anthranilate synthetase dna molecular energy for example with Agrobacterium tumefaciens, color Rhodopseudomonas or rue Anthranilate synzyme or its α-Jie Gou territory comprise the hybridization of its function mutation body.When these dna molecule encode function Anthranilate synzyme or Anthranilate synthetase structure domain, they are known as coding Anthranilate synzyme, " variant " of the one-level dna molecular of Anthranilate synthetase structure domain or its mutant.Shorter dna molecule or oligonucleotides can be used as the primer that is used for by pcr amplification target DNA sequence, perhaps as the synthetic intermediate of full-length gene.
Also provide comprise detectable label or can with the hybridization probe of new separate and dna fragmentation purifying of at least 7 nucleotide bases of detectable combination, wherein said dna fragmentation under the rigorous condition of medium or preferred height with comprise coding Anthranilate synzyme, monomer Anthranilate synzyme for example, perhaps its domain, α-Jie Gou territory for example comprises that its inhibitory action of basically amino acid analogue of tryptophan being given has the noncoding strand hybridization of dna molecular of dna fragmentation of the function mutation body of resistance.Medium and rigorous hybridization conditions is for being known in the art, referring to, Sambrook etc. for example, molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual) 0.47-9.51 chapters and sections, second edition (1989); Also can referring to, Sambrook and Russell, molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual), the third edition (January 15 calendar year 2001).For example, rigorous condition is those: (1) uses the condition washing of low ionic strength and high temperature, for example, and 0.015M NaCl/0.0015M sodium citrate (SSC); 0.1% lauryl sodium sulfate (SDS) under 50 ℃, perhaps (2) use denaturant in crossover process, formamide for example, for example, under 42 ℃, 750mM NaCl is arranged, 50% formamide of 75mM sodium citrate and 0.1% bovine serum albumin(BSA)/0.1%Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer, pH 6.5.Another example is under 42 ℃; use 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate); 50mM sodium phosphate (pH 6.8); 0.1% sodium pyrophosphate, 5x Denhardt ' s solution, the salmon sperm DNA of ultrasonic processing (50 mcg/ml); 0.1% dodecane acyl group sodium sulphate (SDS); with 10% dextran sulfate, under 42 ℃, with 0.2x SSC and 0.1%SDS washing.
The accompanying drawing summary
Fig. 1 is the pMON61600 restriction map.
Fig. 2 describes the translation sequences (top sequence) (SEQ ID NO:4) of Agrobacterium tumefaciens (Agrobacterium tumefaciens) Anthranilate synthetase dna sequence and from the translation sequences (following sequences) (SEQ ID NO:7) of the Anthranilate synthetase dna sequence of rhizobium melioti (Rhizobium meliloti).
Fig. 3 is the pMON34692 restriction map.
Fig. 4 is the pMON34697 restriction map.
Fig. 5 is the pMON34705 restriction map.
Fig. 6 (A-B) describes the Anthranilate synzyme amino acid sequence comparison of comparing Agrobacterium tumefaciens α-Jie Gou territory sequences (SEQ ID NO:4) and sulfolobus solfataricus α-Jie Gou territory sequence (SEQ ID NO:8).
Fig. 7 (A-B) describes the sequence (SEQ IDNOs 9-42) of 34 primers that are used for mutagenesis SEQ ID NO:1.Underscore is the codon of sudden change, below this situation be the base that changes.
Fig. 8 describes the restriction map of plasmid pMON13773.
Fig. 9 describes the restriction map of plasmid pMON58044.
Figure 10 describes the restriction map of plasmid pMON53084.
Figure 11 describes the restriction map of plasmid pMON58045.
Figure 12 describes the restriction map of plasmid pMON58046.
Figure 13 describes the restriction map of plasmid pMON38207.
Figure 14 describes the restriction map of plasmid pMON58030.
Figure 15 describes the restriction map of plasmid pMON58006.
Figure 16 describes the restriction map of plasmid pMON58041.
Figure 17 describes the restriction map of plasmid pMON58028.
Figure 18 describes the restriction map of plasmid pMON58042.
Figure 19 describes the restriction map of plasmid pMON58029.
Figure 20 describes the restriction map of plasmid pMON58043.
Figure 21 (A-D) describes monomer " TrpEG " Anthranilate synzyme with SEQ ID NO:4 and 43 (respectively from Agrobacterium tumefaciens and rhizobium melioti) and compares from the TrpE (α) of the different tetramer Anthranilate synzyme of sulfolobus solfataricus (SEQ ID NO:44) and mouse ear mustard (SEQ ID NO:45) and the multisequencing of TrpG (β) domain.Underscore is a connector area.
Figure 22 is the restriction map of plasmid pMON52214.
Figure 23 is the restriction map of plasmid pMON53901.
Figure 24 is the restriction map of plasmid pMON39324.
Figure 25 is the restriction map of plasmid pMON39322.
Figure 26 is the restriction map of plasmid pMON39325.
Figure 27 is the figure that describes free tryptophan levels in the soya seeds that pMON39325 transforms.Each incident is observed 5 times.
NT represents not genetically modified soya seeds.
Figure 28 is the restriction map of plasmid pMON25997.
Figure 29 is the restriction map of plasmid pMON62000.
Figure 30 describes the sequence (K-12wt F+) (SEQ ID NO:46) of trpE gene of the Escherichia coli EMG2 (K-12wt F+) of brachymemma.The preceding 30bp of this trpE nucleic acid is connected by the EcoR1 restriction enzyme site with back 150bp.The beginning of trpG gene is the trpE terminator then.
Figure 31 illustrates the structure of Escherichia coli trpE gene in-frame deletion.
Figure 32 (A-C) describes from the dna sequence dna (SEQ ID NO:1) and the amino acid sequence (SEQ ID NO:4) in the α-Jie Gou territory of the Anthranilate synthase gene of Agrobacterium tumefaciens separation.
Figure 33 (A-C) describe from corn dividing from the dna sequence dna (SEQ ID NO:2) in α-Jie Gou territory of Anthranilate synthase gene.Figure 33 (D) describe from corn dividing from the amino acid sequence (SEQ ID NO:5) in α-Jie Gou territory of Anthranilate synthase gene.
Figure 34 is the restriction map of plasmid pMON58120.
Figure 35 (A-E) provides from Agrobacterium tumefaciens (AgrTu_15889565) (SEQ IDNO:4), rhizobium melioti (RhiMe_136328) (SEQ ID NO:7), Mesorhizobiumloti (MesLo_13472468) (SEQ ID NO:77), Azospirillum brasilense (AzoBr_1717765) (SEQ ID NO:78), Bacterium melitense BruMe_17986732) (SEQ ID NO:79), beads cyanobacteria (Nostoc_17227910) (SEQ ID NO:80), the sequence of the Anthranilate synzyme amino acid sequence of beads cyanobacteria (Nostoc_17230725) (SEQ ID NO:81) and color Rhodopseudomonas (RhoPa_TrpEG) (SEQ ID NO:82) relatively.
Figure 36 (A-B) provides the nucleotide sequence of optimizing for Agrobacterium tumefaciens Anthranilate synzyme (SEQ ID NO:75).
Figure 37 (A-C) provides the comparison of (following chain) Agrobacterium tumefaciens Anthranilate synzyme nucleotide sequence (SEQ ID NO:1 and 75) of wild type (cochain) and optimization.These two sequences 94% are identical.
Detailed Description Of The Invention
The invention provides the DNAs of separation, carrier, host cell and genetically modified plants are comprising the code nucleic acid of the separation of the Anthranilate synzyme that high-level tryptophan can be provided when expressing in plant. In one embodiment, the nucleic acid coding monomer Anthranilate synzyme (AS) of separation. In another embodiment, the nucleic acid coding Anthranilate synzyme of separation, perhaps its inhibitory action of basically amino acid analogue of free L-Trp or tryptophan being given has the domain of resistance. The expression of Anthranilate synzyme or its domain improves in the seed for example level of free tryptophan of tryptophan, makes its level be higher than the level that exists in the plant that does not have this expression.
The genetically modified plants that prepare the generation high level tryptophan with nucleic acid relevant with the Anthranilate synthase activity that improves are also provided, the cell that preparation is cultivated, plant tissue, plant, the method for plant part and seed. Such genetically modified plants preferably can will produce the sexual offspring who passes to them of ability of high-level tryptophan. Also described the method that produces the DNAs of the encoding mutant body Anthranilate synzyme that separates, and selected excess production tryptophan and/or the tryptophan analog is had the cell of the new phenotype of resistance cultivate triage techniques. For example, in order to produce the soybean line that can produce high-level tryptophan, preparation and sign comprise the genetically engineered soybean cell of the DNAs of at least a separation of the present invention, and then generate plant. The growth inhibition effect that the DNAs of some separation gives the tryptophan analog has resistance. The method that provides among the present invention can also be used in dicotyledon, for example other beans, and monocotyledon, and such as grain produces high-caliber tryptophan.
Definition
Such as definition here, be converted plant, plant tissue, " change " level of tryptophan is the plant that transforms than not having accordingly in plant part or the plant cell, plant tissue, the higher level of finding in plant part or the plant cell or lower.
As used herein, " α-structure territory " is conjugate branch acid and removes the enzyme of enol pyruvic acid side chain or the part of combined enzyme agent. Such α-structure territory can be by the TrpE gene code. In some cases, the α-structure territory is single chain polypeptide, and its function is conjugate branch acid and removes enol pyruvic acid side chain from chorismic acid. In other cases, the α-structure territory is to remove a part that also has the larger polypeptide of other enzyme function the enol pyruvic acid side chain except conjugate branch acid and from chorismic acid.
Term " beta structure territory " refers to enzyme that the transamination of glutamine is put to the branch's acid esters Preordering between carboxylate and enol pyruvate part or the part of combined enzyme agent. Such beta structure territory is by the TrpG gene code. In some cases, the beta structure territory is single chain polypeptide, and its function is just put the transamination of glutamine to the branch's acid esters Preordering between carboxylate and enol pyruvate part. In other cases, the beta structure territory be except with the transamination of glutamine to a part that also has the larger polypeptide of other enzyme function on the branch's acid esters ring between carboxylate and the enol pyruvate part.
As used herein, " amino acid analogue of tryptophan " is that structure is relevant with tryptophan and can be in conjunction with the amino acid of tryptophan binding site in the wild type Anthranilate synzyme. These analogs include but not limited to, 6-methyl Anthranilate, and 5-methyl tryptophan, the 4-methyl tryptophan, the 5-fluorotryptophan, 5HTP, the 7-azatryptophan, 3 β-indole acrylic acid, 3-methyl ortho-aminobenzoic acid, etc.
Here about dna molecular of the present invention, sequence or fragment and the term that uses " basically by ... consist of and " be defined as the major part, sequence or the fragment coding Anthranilate synzyme that refer to dna molecular. Except as otherwise noted, dna molecular, sequence or the fragment volume protein except the Anthranilate synzyme of generally not encoding.
Term " with ... complementary " here be used to refer to can with the nucleic acid chains sequence of all or part of hybridization of reference polynucleotide sequence. In order to describe in detail, nucleotide sequence " TATAC " concerning canonical sequence 5 '-TATAC-3 ' homogeneity 100%, but with canonical sequence 5 '-GTATA-3 ' 100% complementation.
As used herein, " external source " Anthranilate synzyme is imported into host cell, preferably with its natural cell that does not have to transform in any dna sequence dna of existing not identical, the Anthranilate synzyme of the dna encoding of separation. " endogenous " or " natural " Anthranilate synzyme is naturally occurring Anthranilate synzyme in host cell or organism.
As used herein, plant cell, plant tissue, free L-Trp " raising " or " increasing " level are to be the plant cell that not have conversion in plant part or the plant, plant tissue, about 2 to 200 times of the level of finding in plant part or the plant, preferably approximately 5 to 150 times, more preferably about 10 to 100 times level, that is, the existence of external source Anthranilate synzyme nucleic acid or its domain does not change genomic level. For example, the level of free L-Trp can be compared with the level in the vegetable seeds (parent material) that does not have to transform in the vegetable seeds of conversion.
The dna molecular of coding Anthranilate synzyme, the dna molecular or the label/reporter that transmit peptide with coding are " separation ", because they are separated from their natural origin and no longer their naturally occurring cells. The dna molecular of such separation at least part ofly prepares or utilizes external, for example, separates purifying, and amplification from their natural found cells. The dna molecular of such separation also can be " restructuring ", is that they are combined with exogenous DNA molecule. For example, recombinant DNA can be and exogenous promoter or the DNA that separates that is connected with the endogenous promoter operability of host cell.
As used herein, about the Anthranilate synzyme, term " monomer " meaning is that two or more Anthranilate synthetase structure domains are inserted in the Single polypeptide chain with functional mode. Monomer Anthranilate synzyme can be assembled into dimeric forms in the body.
Can be from various organism separating monomer Anthranilate synzyme nucleic acid and polypeptide, Agrobacterium tumefaciens for example, fish raw meat cyanobacteria M22983, Azospirillum brasilense, Bacterium melitense, Euglena gracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti. Perhaps, the combination from the domain that is selected from any conventional monomer or polymer Anthranilate synthase gene can make up monomer Anthranilate synzyme nucleic acid and polypeptide. Such microorganism comprises, for example, Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense), Bacterium melitense (Brucella melitensis), Mesorhizobium loti, beads cyanobacteria (Nostoc sp.) PCC7120, rhizobium melioti (Rhizobium meliloti), color Rhodopseudomonas (Rhodopseudomonas palustris), rue, salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), sulfolobus solfataricus (Sulfolobus solfataricus), soybean, rice, cotton or corn, the subunit of the Anthranilate synzyme of perhaps encoding or any gene of domain. The connection of can recombinating of the nucleic acid of the domain of codes selection. For example, the nucleic acid of the C-end of coding for alpha-domain is connected with the nucleic acid of the N-end in coding beta structure territory by forming phosphodiester bond, and vice versa. Perhaps, such single-stranded structure domain polypeptide can be connected by chemistry. For example, the α-structure territory is connected with the N-in beta structure territory is terminal by peptide bond by its C-end, and vice versa.
As used herein, " natural " gene means the external gene that does not have change, that is, and and external not " wild type " gene of sudden change.
Term " plastid " refers to plant cell organelle kind, comprises amyloplast, chloroplaset, chromoplast, elaioplast, eoplasts, leucoplast, leucoplastid, and proplastid. These organelles are self-replications, and comprise so-called " chloroplast gene group ", and about 120 to about 217kb the ring-shaped DNA molecule of a kind of size depend on plant species, and it comprises inverted duplicate field usually.
As used herein, " polypeptide " refers to the continuous chain of the amino acid that all links together by peptide bond, except having respectively the amino terminal and C-end amino acid of N-that does not connect with peptide bond of being connected with carboxyl. Polypeptide can be any length, and can be posttranslational modification, for example, and by glycosylation or phosphorylation.
As used herein, " inhibitory action that the amino acid analogue of tryptophan is caused has resistance or tolerance " plant cell, plant tissue or plant are to compare the plant cell that keeps about at least Anthranilate synthase activity more than 10% under the existence of L-Trp analog with corresponding wild type Anthranilate synzyme, plant tissue, or plant. Generally speaking, " inhibitory action that the amino acid analogue of tryptophan is caused has resistance or tolerance " plant cell, plant tissue or plant are determined at the plant cell that a certain amount of general inhibition does not have conversion according to method well known in the art, plant tissue perhaps can be grown in the amino acid analogue of the tryptophan of plant. For example, the inbreeding plant that the dna molecular of the coding Anthranilate synzyme that isozygotying backcrosses transforms transforms, described plant has resistance or tolerance to the inhibitory action that the amino acid analogue of tryptophan causes basically, this plant is corresponding in a certain amount of inhibition, namely basically can grow in the amino acid analogue of the tryptophan of isogenic regeneration inbreeding plant growth.
As used herein, " inhibitory action that the amino acid analogue of tryptophan or tryptophan is caused has resistance or tolerance " Anthranilate synzyme is to keep when tolerance/resistance and wild type Anthranilate synzyme are exposed to the amino acid analogue of equivalent tryptophan or tryptophan than the high about Anthranilate synzyme of activity 10% or more of corresponding " wild type " or natural susceptible Anthranilate synzyme. Preferably, resistance or tolerance Anthranilate synzyme keep high about more active more than 20% than corresponding " wild type " or natural susceptible Anthranilate synzyme.
About the Anthranilate synzyme, term used herein " its domain " comprises structure or the function fragment of total length Anthranilate synzyme. Domain comprises appraisable structure in the Anthranilate synzyme. The example of domain comprises the α spiral, β-pleated sheet, avtive spot, substrate or inhibitor binding site etc. Functional domain comprises that realization can identify function, tryptophan binding pocket for example, the fragment of the Anthranilate synzyme of avtive spot or substrate or inhibitor binding site. The functional domain of Anthranilate synzyme comprises those parts of the Anthranilate synzyme of a step in the energy catalysis tryptophan biosynthesis approach. For example, the α-structure territory is that trpE encodes and can be with NH3Be transferred to the domain of branch's acid esters and formation Anthranilate. Can encode beta structure territory and can remove the amino ammonia that forms from glutamine of TrpG. Therefore, functional domain comprises the domain of enzymatic activity fragment and Anthranilate synzyme.
The mutant structure territory that also relates to the Anthranilate synzyme. The wild type Anthranilate synzyme nucleic acid that is used for preparing the mutant structure territory comprises, for example, coding Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983, mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense), Bacterium melitense (Brucella melitensis), Mesorhizobium loti, beads cyanobacteria (Nostoc sp.) PCC7120, rhizobium melioti (Rhizobium meliloti), color Rhodopseudomonas (Rhodopseudomonas palustris), rue, sulfolobus solfataricus (Sulfolobus solfataricus), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), soybean, rice, cotton, wheat, any gene of the domain of tobacco or corn (Zea mays) perhaps is coded in its code area and comprises the subunit of Anthranilate synzyme of at least one 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor or any gene of domain. By mutagenesis or to be connected to form the tryptophan biosynthesis with raising active, larger stability, the domain to the monomer Anthranilate synzyme of the sensitiveness of tryptophan or its analog etc. that reduces is to make us especially interested.
Universal
The present invention relates to obtain to produce new nucleic acid and the method for the plant of the free L-Trp of improving the standard. Importing and the expression of the nucleic acid of coding Anthranilate synzyme or its domain cause excess production. Such Anthranilate synzyme nucleic acid comprises wild type or mutant alpha-domain, perhaps the Anthranilate synzyme of monomeric form. The Anthranilate synzyme of monomeric form for example with in α-domain that the beta structure territory is connected comprises at least two Anthranilate synthetase structure domains at single polypeptide chain.
Natural plants Anthranilate synzyme is generally very responsive to the feedback inhibition that the analog of L-Trp and it is given. Such inhibitory action consists of the crucial mechanism of regulating the tryptophan route of synthesis. Therefore, high activity is more effective or suppress may produce the tryptophan of improving the standard to Anthranilate synzyme or its domain of less degree by tryptophan or its analog. According to the present invention, Agrobacterium tumefaciens Anthranilate synzyme is used in particular for producing high-level tryptophan.
In order to produce high-level tryptophan plant or in the host cell of selection, the Anthranilate synzyme nucleic acid of separate selecting, and can manipulation in vitro make and be included in the needed conditioning signal of gene expression in plant cell or other cell types. Because it is reported to have tryptophan biosynthesis approach in plant in the plastid, external source Anthranilate synzyme nucleic acid or be imported in the plastid or by adding that the nucleic acid fragment that coding amino terminal plastid transmits peptide modifies. Such plastid transmits Toplink Anthranilate synthase gene product is imported plastid. In some cases, the Anthranilate synzyme may contain the plastid transit sequence, there is no need in this case to add one.
In order to change the biosynthesis of tryptophan, the nucleic acid of coding Anthranilate synthase activity must be imported in plant cell or other host cells, and identify directly or indirectly these transformants. Can use whole Anthranilate synzyme or its useful part or domain.
The Anthranilate synzyme stably is inserted in the plant cell genome. Control Anthranilate synzyme is expressed transcribes signal must and have function by plant cell or the identification of other host cells in plant cell or other host cells. Namely, the Anthranilate synzyme must be transcribed into mRNA, and this must be stable in plant nucleolus and be translated in the complete transporte to cells matter. The Anthranilate synzyme must have the suitable translation signals of also being translated suitably by the identification of plant cell ribose body. The polypeptide gene product must be avoided being subject to proteolysis in essence in cytoplasm, and is transported to correct thin compartment (for example plastid) and can presents the three-dimensional conformation of giving enzymatic activity. The Anthranilate synzyme must further be brought into play function in the biosynthesis of tryptophan and derivative thereof; Namely, for the substrate that obtains to require and transmit suitable product, it must be arranged near the natural plant enzyme of the synthetic flank step of catalysis biological (may at plastid).
Even meet these all conditions, successful excess is produced tryptophan neither expected event. Near the negative effect of chromosome element some genetically modified expression may be subject to. Realize high-level tryptophan if reduce feedback inhibition by mutagenesis, the regulating action that may have other control mechanism compensation Anthranilate synzyme step to reduce. May be improved the mechanism of the amino acid whose decomposition rate of accumulation. Tryptophan must be not have virose horizontal excess production with relevant amino acid yet to plant. At last, in order to allow to commercially produce and use, import characteristic and must be stable with heritable.
Separation and the evaluation of the DNA of coding Anthranilate synzyme
Can identify and separate by standard method the nucleic acid of the Anthranilate synzyme of encoding, for example, according to Sambrook etc., Molecular Cloning:A Laboratory Manual, second edition (1989); Sambrook and Russell, Molecular Cloning:A Laboratory Manual, the third edition (January 15 calendar year 2001). For example, by from from the special cells type, clone, primary cell, or DNA or cDNA library that the nucleic acid of tissue produces screen can identification code Anthranilate synzyme or the DNA sequence of its domain. Include but not limited to cDNA library from following biology for the identification of the example with the library of separating the Anthranilate synzyme: Agrobacterium tumefaciens (Agrobacterium tumefaciens) strains A 348, corn inbred strais B73 (Stratagene, La Jolla, California, Cat.#937005, Clontech, Palo Alto, California, Cat. #FL1032a, #FL1032b, and FL1032n), genomic library (Stratagene from corn inbred strais Mo17, Cat.#946102), genomic library (Clontech from corn inbred strais B73, Cat.#FL1032d), from fish raw meat cyanobacteria (Anabaena) M22983 (for example, Genbank registration number No.GI 152445), from mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense) (for example, Genbank registration number No.GI 1174156), Bacterium melitense (Brucella melitensis) (GI 17982357), Escherichia coli (Escherichia coli), Euglena gracilis, Mesorhizobium loti (for example, Genbank registration number No.GI 13472468), PCC7120 (for example for beads cyanobacteria (Nostoc sp.), Genbank registration number Nos.GI 17227910 or GI 17230725), rhizobium melioti (Rhizobium meliloti) (for example, Genbank registration number No.GI 95177), rue, Rhodopseudomonas palustris (Rhodopseudomonas palustris), salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescens), sulfolobus solfataricus (Sulfolobus solfataricus), soybean, rice, cotton, wheat, tobacco, the genomic DNA of corn or other species. In addition, by using the genomic DNA that separates from any these species, the nucleic acid amplification method of mRNA or cDNA can separate Anthranilate synzyme nucleic acid.
By from being used for hybridizing in from the genome of the Anthranilate synthase gene probe of other biological body or cDNA screening plaque or by can realize the screening to all or part of dna fragmentation of the sequence of the Anthranilate synzyme of encoding from the cDNA expression library screening plaque that is used for being combined with the antibody of specific recognition Anthranilate synzyme. With can be subcloned in the carrier from the dna fragmentation that carries with the Anthranilate synzyme hybridization of the other biological body of the dna fragmentation of anti-Anthranilate synzyme antibody mediated immunity reaction and/or plaque, check order and/or be used as other all or part of cDNA of Anthranilate synthase gene of identification code expectation or the probe of genome sequence. Can obtain to be used for screening the cDNA probe in corn or plant library from plasmid clone pDPG600 or pDPG602.
For example by immediately oligomer guiding or oligomer dT guiding, can prepare cDNA library. Use comprises the plaque of dna fragmentation to the specific probe of Anthranilate synzyme or antibody capable screening. The dna fragmentation of a coding Anthranilate synthase gene part can be by subclone, order-checking and as the probe of identified gene group Anthranilate synthase gene. By measure with the sequence homology of other known Anthranilate synzyme or by with the hybridization of Anthranilate synzyme specificity mRNA, the dna fragmentation of the part of can confirm to encode bacterium or plant Anthranilate synzyme. In case obtain 5 ' end of coding Anthranilate synzyme, the cDNA fragment of middle and 3 ' end parts, they can be used as identifying and clone the probe that the complete genome from the Anthranilate synthase gene of genomic library copies.
Can be to the genome copy part order-checking of Anthranilate synthase gene and 5 ' end of identified gene by standard method, comprise by with the dna sequence dna of other Anthranilate synthase gene homologies or by the analysis of RNA enzyme protection, for example, such as Sambrook etc., Molecular Cloning:A Laboratory Manual, second edition (1989); Sambrook and Russell, Molecular Cloning:A Laboratory Manual, the third edition (on January 15th, 2001) is described. Utilize known AS code area also can determine 3 of target gene ' end and 5 ' end by the computer search of sequence library. In case 5 ' end parts of identified gene, can obtain the fully copy of Anthranilate synthase gene by standard method, comprise the PCR (PCR) of Oligonucleolide primers of the dna sequence dna complementation of 5 of clone or use and gene ' end. By hybridization, Analysis of Partial, the perhaps expression by corn Anthranilate synzyme can confirm the existence of total length copy of the separation of Anthranilate synthase gene.
The DNAs of the separation of the present invention that exemplifies comprises having the DNAs that following nucleotide sequence is identified number:
SEQ ID NO:1--Agrobacterium tumefaciens (Agrobacterium tumefaciens) (wild type)
SEQ ID NO:2--corn (wild type)
SEQ ID NO:3--rue
The TrpE gene (K-12wt F+) of the brachymemma of SEQ ID NO:46--Escherichia coli EMG2
SEQ ID NO:67--corn (C28 mutant)
SEQ ID NO:68--corn (C28+ terminator)
SEQ ID NO:71-chloroplaset targeted peptide (g)
SEQ ID NO:73--chloroplaset targeted peptide (a)
SEQ ID NO:75--Agrobacterium tumefaciens (Agrobacterium tumefaciens) (optimization)
SEQ ID NO:76--color Rhodopseudomonas (Rhodopseudomonas palustris)
SEQ ID NO:83--color Rhodopseudomonas (Rhodopseudomonas palustris) (RhoPa_TrpEG)
SEQ ID NO:84--Agrobacterium tumefaciens V48F mutant
SEQ ID NO:85--Agrobacterium tumefaciens V48Y mutant
SEQ ID NO:86--Agrobacterium tumefaciens S51F mutant
SEQ ID NO:87--Agrobacterium tumefaciens S51C mutant
SEQ ID NO:88--Agrobacterium tumefaciens N52F mutant
SEQ ID NO:89--Agrobacterium tumefaciens P293A mutant
SEQ ID NO:90--Agrobacterium tumefaciens P293G mutant
SEQ ID NO:91--Agrobacterium tumefaciens F298W mutant
SEQ ID NO:92--Agrobacterium tumefaciens S50K mutant
SEQ ID NO:93--Agrobacterium tumefaciens F298A mutant
SEQ ID NO:94--rice
SEQ ID NO:95-rice isodynamic enzyme
SEQ ID NO:96-corn (United States Patent (USP) 6,118,047 of Anderson)
SEQ ID NO:97-wheat
SEQ ID NO:98-tobacco
Some primers are useful for implementing the present invention, for example have SEQ ID NO:9-42, the primer of 47-56.
The nucleic acid of all separation of any one Anthranilate synzyme that the invention still further relates to encodes has following amino acid sequence.
SEQ ID NO:4--Agrobacterium tumefaciens (Agrobacterium tumefaciens) (wild type)
SEQ ID NO:5--corn (wild type)
SEQ ID NO:6--rue
SEQ ID NO:7-rhizobium melioti (Rhizobium meliloti)
SEQ ID NO:8--sulfolobus solfataricus (Sulfolobus solfataricus)
SEQ ID NO:43--rhizobium melioti (Rhizobium meliloti)
SEQ ID NO:44-sulfolobus solfataricus (Sulfolobus solfataricus)
SEQ ID NO:45-mouse ear mustard
SEQ ID NO:57-color Rhodopseudomonas (Rhodopseudomonas palustris)
SEQ ID NO:58--Agrobacterium tumefaciens V48F mutant
SEQ ID NO:59--Agrobacterium tumefaciens V48Y mutant
SEQ ID NO:60--Agrobacterium tumefaciens S51F mutant
SEQ ID NO:61--Agrobacterium tumefaciens S51C mutant
SEQ ID NO:62--Agrobacterium tumefaciens N52F mutant
SEQ ID NO:63--Agrobacterium tumefaciens P293A mutant
SEQ ID NO:64--Agrobacterium tumefaciens P293G mutant
SEQ ID NO:65--Agrobacterium tumefaciens F298W mutant
SEQ ID NO:66-corn C 28 mutant
SEQ ID NO:69--Agrobacterium tumefaciens S50K mutant
SEQ ID NO:70--Agrobacterium tumefaciens F298A mutant
SEQ ID NO:74-chloroplast targeted peptide (a)
SEQ ID NO:72--chloroplast targeted peptide (g)
SEQ?ID?NO：77--Mesorhizobium?loti(MesLo_13472468)
SEQ ID NO:78--Azospirillum brasilense (AzoBr_1717765)
SEQ ID NO:79--Bacterium melitense (BruMe_17986732)
SEQ ID NO:80-beads cyanobacteria (Nostoc_17227910)
SEQ ID NO:81-beads cyanobacteria (Nostoc_17230725)
SEQ ID NO:82-color Rhodopseudomonas RhoPa_TrpEG
SEQ ID NO:99-rice
SEQ ID NO:100-rice isodynamic enzyme
SEQ ID NO:101-corn (United States Patent (USP) 6,118,047 of Anderson)
SEQ ID NO:102-wheat
SEQ ID NO:103-tobacco
Can use any of these nucleic acid and polypeptide in the embodiment of this invention, with and any mutant, variant or derivative.
Monomer Anthranilate synzyme
According to the present invention, function is arranged in plant and high-level tryptophan can be provided from the monomer Anthranilate synzyme of plant and non-plant species.Astoundingly, very good from monomer Anthranilate synzyme function in plant of non-plant species, though the sequence of these monomer Anthranilate synzyme and most of plant Anthranilate synzyme have low homology.For example, can successfully use the monomer Anthranilate synzyme of the species of protist and microorganism from different bacteria-likes.Especially, from bacterial species Agrobacterium tumefaciens for example, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, the monomer Anthranilate synzyme of Azospirillum brasilense and fish raw meat cyanobacteria M2298 has function and high-level tryptophan can be provided in plant, although the sequence of these monomer Anthranilate synzyme and most of plant Anthranilate synzyme have very low sequence homogeneity.
For example contain the genetically modified plants of wild type monomer Agrobacterium tumefaciens Anthranilate synzyme and in seed, can produce at most about 10,000 to about 12, the 000ppm tryptophan, average trp horizontal extent is at most about 7,000 to about 8,000ppm.General maximum in the non-transgenic soybean plant seed have only about 100 to about 200ppm tryptophan.By comparing, the genetically modified plants that contain the mutant corn αJie Gouyu of adding produce the tryptophan of how many lower levels (for example, average maximum about 3000 to about 4000ppm).
Monomeric enzyme has been compared some advantages with the polymer enzyme.For example, though the present invention is not limited to specific mechanisms, monomeric enzyme can provide bigger stability, coordinates to express or the like.When domain that synthesizes different tetramer Anthranilate synzyme in the body or subunit, those domain/subunits one fix on enzyme and become the active different tetramer form that is assembled into suitably before.May not provide the excess production of whole different tetramer enzyme by transgenic method to the domain that plant adds an Anthranilate synzyme, the non-transgenic domain of endogenous amount improves the tetrameric level of function basically because may not have enough.Therefore, can advantageously use the nucleic acid of coding monomer Anthranilate synzyme, carrier and enzyme come excess to produce the enzymatic function of all Anthranilate synzyme.
According to the present invention, from the Anthranilate synthetase structure domain of the species of the different tetramer Anthranilate of natural production synzyme can be merge or connect so that, provide the monomer Anthranilate that can produce high tryptophan level synzyme when expressing in plant tissue or the seed when at plant cell.For example, make and the general and natural monomer Anthranilate synzyme comparison of sequence of alpha-beta fusion can prepare monomer Anthranilate synzyme by merging or connecting the α of Anthranilate synzyme and beta structure territory.The example of monomer and different tetramer Anthranilate synzyme sequence alignment is shown in Figure 21 and 35.Use such sequence alignment, space and the orientation that can regulate or modify the Anthranilate synthetase structure domain produce the monomer Anthranilate synzyme that makes up from the different tetramer structure territory of the optimum comparison of the most suitable and natural monomer Anthranilate synzyme.Such fusion can be used to improve the tryptophan levels in the plant tissue.
Different tetramer Anthranilate synzyme, for example the Anthranilate synzyme (for example for sulfolobus solfataricus (Sulfolobus solfataricus), Genbank registration number No.GI1004323), with different tetramer Anthranilate synzyme about 30% to about 87% sequence homology is arranged from other plant and microbial species.Monomer Anthranilate synzyme, for example for example rhizobium melioti (Genbank registration number No.GI 15966140) and Azospirillum brasilense (Genbank registration number No.1717765) Anthranilate synzyme have about 83% and about 52% homogeneity respectively for Agrobacterium tumefaciens Anthranilate synzyme and other monomeric enzymes.Bae etc., rhizobium melioti Anthranilate synthase gene: clone, the order-checking and at expression in escherichia coli, J.Bacteriol.171,3471-3478 (1989); De Troch etc., the separation and the sign of Azospirillum brasilense trpE (G) gene of coding Anthranilate synzyme, Curr.Microbiol.34,27-32 (1997).
Yet sequence homogeneity total between natural monomer and the natural tetramer Anthranilate synzyme is less than 30%.Therefore, the comparison that range estimation comparison rather than calculator produce needs to optimize comparison monomer and tetramer Anthranilate synzyme.Description structure and sequence can help sequence alignment in the Anthranilate synzyme.For example, motif " LLES " is the part of beta sheet of β-interlayer that forms the tryptophan binding pocket of Anthranilate synzyme.Such description sequence can be used to compare more reliably the Anthranilate synzyme sequence of scattering, and is used in particular for the Key residues that relates in definite tryptophan combination.
For fusion or the connection that realizes the Anthranilate synthetase structure domain, the C-in the TrpE of selection or α-Jie Gou territory terminal connection of terminal N-with TrpG domain or beta structure territory.In some cases, between domain, can use the joint peptide that suitable space and/or flexibility is provided.Sequence alignment by monomer and different tetramer Anthranilate synzyme can be identified suitable joint sequence.
For example by hybridization, pcr amplification or as Anderson etc., U.S. Patent No. 6,118,047 is described, the beta structure territory of energy Immune Clone Selection.Utilize standard method also can make plastid transit peptides connect Anthranilate synzyme code area.For example, mouse ear mustard belongs to small subunit (SSU) chloroplast targeted peptide (CTP, SEQ ID NO:71-74) and can be used for this purpose.Also referring to, Stark etc. (1992) Science 258:287.Fusion is used for Plant Transformation as described here being inserted into then in the suitable carriers.
The Anthranilate synthase mutant
The Anthranilate synthase mutant that the present invention relates to can have the sudden change of any kind, comprises, for example, and aminoacid replacement, disappearance is inserted and/or is reset.Such mutant can be the concrete here Anthranilate synzyme nucleic acid of identifying and the derivative or the variant of polypeptide.Perhaps, can comprise those that identify are not described in detail in detail here, obtain the Anthranilate synthase mutant from any obtainable species.Described mutant, derivative and variant can with SEQ ID NO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 30% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In preferred embodiments, polypeptide derivative and variant and SEQ IDNO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 50% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In a more preferred embodiment, polypeptide derivative and variant and SEQ ID NO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 60% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In a more preferred embodiment, polypeptide derivative and variant and SEQ ID NO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 70% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In addition the embodiment that is more preferably in, polypeptide derivative and variant and SEQ ID NO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 80% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In addition the embodiment that is more preferably in, polypeptide derivative and variant and SEQ ID NO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 90% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.In addition the embodiment that is more preferably in, polypeptide derivative and variant and SEQ IDNO:4-8,43-45,57-66,69-70,77-82, the amino acid position of any has about 95% homogeneity at least among the 99-103, and has the Anthranilate synthase activity.
In one embodiment, by medium, perhaps, preferably, under highly rigorous condition, SEQ ID NO:1-3,942,46,47-56,67-68,75-76, among the 83-98 any, perhaps its fragment or primer, with the nucleic acid source hybridization of selecting, can identify the Anthranilate synthase mutant, variant and derivative.Medium and rigorous hybridization conditions is well known in the art, referring to, Sambrook etc. for example, molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual) 0.47-9.51 chapters and sections, second edition (1989); Also can referring to, Sambrook and Russell, molecular cloning: laboratory manual (Molecular Cloning:ALaboratory Manual), the third edition (January 15 calendar year 2001).For example, rigorous condition is those: the condition of low ionic strength and high temperature is used in (1) washing, for example, and 0.015MNaCl/0.0015M sodium citrate (SSC); 0.1% lauryl sodium sulfate (SDS) under 50 ℃, perhaps (2) use denaturant in crossover process, formamide for example, for example, under 42 ℃, 750mM NaCl is arranged, 50% formamide of 75mM sodium citrate and 0.1% bovine serum albumin(BSA)/0.1%Fico11/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer, pH 6.5.Another example is under 42 ℃; use 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate); 50mM sodium phosphate (pH 6.8); 0.1% sodium pyrophosphate, 5x Denhardt ' s solution, the salmon sperm DNA of ultrasonic processing (50 mcg/ml); 0.1% dodecane acyl group sodium sulphate (SDS); with 10% dextran sulfate, under 42 ℃, with 0.2x SSC and 0.1%SDS washing.
The present invention further provides comprise can detectable label or with the hybridization probe and the primer of new separate and dna fragmentation purifying of at least 7 nucleotide bases of detectable label combination.Such hybridization probe or primer can be under medium or highly rigorous conditions and any chain hybridization of the dna molecular of coding Anthranilate synzyme.The such hybridization probe and the example of primer comprise SEQ ID NO:9-42, any among the 47-56.
Described Anthranilate synzyme can be any Anthranilate synzyme, perhaps its mutant or domain, for example α-Jie Gou territory.The Anthranilate synzyme can be a monomer Anthranilate synzyme.The function mutation body is preferred, particularly produces those of high-level tryptophan in plant, and for example, the inhibitory action that the amino acid analogue of tryptophan is given has those mutant of resistance basically.
The nucleic acid of coding Anthranilate synthase mutant also can produce from any suitable species, for example, come the nucleic acid in any structure territory below the own coding: Agrobacterium tumefaciens (Agrobacterium tumefaciens), fish raw meat cyanobacteria (Anabaena) M22983 (for example Genbank registration number No.GI 152445), mouse ear mustard, Azospirillum brasilense (Azospirillum brasilense) (for example, Genbank registration number No.GI1174156), Bacterium melitense (Brucella melitensis) (for example, Genbank registration number No.GI 17982357), Escherichia coli (Escherichia coli), Euglenagracilis, Mesorhizobium loti (for example, Genbank registration number No.GI13472468), PCC7120 (for example for beads cyanobacteria (Nostoc sp.), Genbank registration number No.GI 17227910 or GI 17230725), rhizobium melioti (Rhizobiummeliloti) (for example, Genbank registration number No.GI 95177), rue, color Rhodopseudomonas (Rhodopseudomonas palustris), salmonella typhimurium (Salmonellatyphimurium), serratia marcescens (Serratia marcescens), sulfolobus solfataricus (Sulfolobus solfataricus), soybean, rice, the cotton wheat, tobacco, corn (Zea mays) or the subunit of coding Anthranilate synzyme or any gene of domain.
Expectation has the Anthranilate synthase activity of raising, and is less to tryptophan or tryptophan analog feedback inhibition sensitivity, and/or can produce the Anthranilate synthase mutant of the ability of recruitment tryptophan in plant.Such mutant has function to change on activity level that they show or type really, and the Anthranilate synzyme nucleic acid that provides here and " derivative " of polypeptide are provided sometimes.
Yet, the invention still further relates to the Anthranilate synzyme variant and the Anthranilate synzyme nucleic acid that have " silence " sudden change.As used herein, but silent mutation is to change the nucleotide sequence of Anthranilate synzyme the sudden change of amino acid sequence that does not change the Anthranilate synzyme of coding.Nucleic acid mutation body coding Anthranilate synthase mutant, variant has one or several amino acid change that does not change its activity when comparing with corresponding wild type Anthranilate synzyme basically.The present invention relates to have all such derivatives of silent mutation, variant and Anthranilate synzyme nucleic acid.
Can obtain the amino acid analogue of L-tryptophan or tryptophan is had the coding DNA of the sudden change Anthranilate synzyme of resistance and/or tolerance by several method.Described method includes but not limited to:
Idiovariation and in culture direct screening mutant;
2. to any cell type or tissue, the direct or indirect method of mutagenesis of the tissue culture of seed or plant;
3. by for example mutagenesis; Point specificity or direct mutagenesis (Sambrook etc., above citation), transposon-mediated mutagenesis (Berg etc., Biotechnology, 1,417 (1983)), and deletion mutagenesis (Mitra etc., the mutagenesis of clone's Molec.Gen.Genetic., 215,294 (1989)) Anthranilate synthase gene;
4. the appropriate design of Key residues sudden change; With
5.DNA mixing is so that be inserted into interested sudden change in the various Anthranilate synzyme nucleic acid.
For example, can use the Anthranilate synthase mutant that comes appropriate design to have the active of raising or reduce from the protein structure information of obtainable Anthranilate synthetase protein to the height possibility of the susceptibility of tryptophan or tryptophan analog.For example, for sulfolobus solfataricus (Sulfolobus solfataricus) Anthranilate synzyme, such protein structure information is (Knochel etc., Proc.Natl.Acad.Sci.USA, 96, the 9479-9484 (1999)) that can get.By the Anthranilate synzyme amino acid sequence that will select with from the Anthranilate synzyme of known structure for example the Anthranilate synzyme amino acid sequence comparison of sulfolobus solfataricus (Sulfolobus solfataricus) Anthranilate synzyme can finish the appropriate design of sudden change.Referring to Fig. 6,21 and 35.Design the tryptophan combination and the catalytic domain of the prediction of Anthranilate synzyme by integrated structure information knowledge and sequence homology performance.For example, the residue in the tryptophan binding pocket can be accredited as and change the potential candidate of enzyme to the sudden change of the resistance of the feedback inhibition of tryptophan.Utilize such structural information, appropriate design in site that several Agrobacterium tumefaciens Anthranilate synthase mutants relate to or the domain in the tryptophan combination.
Utilize such sequence and structural analysis, identified in monomer Agrobacterium tumefaciens Anthranilate synzyme with the about position 25-60 of monomer Agrobacterium tumefaciens Anthranilate synzyme or 200-225 or 290-300 or 370-375 and similarly distinguished that these are potential useful residues for the sudden change that produces the active Anthranilate synzyme of the less sensitivity of tryptophan feedback inhibition.More particularly, with P29 in the monomer Agrobacterium tumefaciens Anthranilate synzyme, E30, S31, I32, S42, V43, V48, S50, S51, N52, N204, P205, M209, F210, G221, N292, P293, the similar amino acid residue of F298 and A373 are for the potential useful residue of sudden change that produces the active Anthranilate synzyme of the less sensitivity of tryptophan feedback inhibition.The present invention relates to any aminoacid replacement or the insertion in any site in these sites.Perhaps, can lack the amino acid in any site in these sites.
Can utilize direct mutagenesis to produce aminoacid replacement, disappearance and insertion in each site.The example of the special sudden change of carrying out in the Agrobacterium tumefaciens Anthranilate synzyme code area comprises following:
At about 48, Phe displacement Val (referring to for example, SEQ ID NO:58);
At about 48, Tyr displacement Val (referring to for example, SEQ ID NO:59);
At about 51, Phe displacement Ser (referring to for example, SEQ ID NO:60);
At about 51, Cys displacement Ser (referring to for example, SEQ ID NO:61);
At about 52, Phe displacement Asn (referring to for example, SEQ ID NO:62);
At about 293, Ala displacement Pro (referring to for example, SEQ ID NO:63);
At about 293, Gly displacement Pro (referring to for example, SEQ ID NO:64);
At about 298, Trp displacement Phe (referring to for example, SEQ ID NO:65);
The amino acid sequence and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence of the Anthranilate synzyme by will mutagenesis can be carried out similar sudden change in the similar site of any Anthranilate synzyme.An example of the Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence that can be used to compare is SEQ ID NO:4.
Also can identify useful mutant by traditional mutagenesis and genescreen.By enzyme being exposed to the analog of free L-tryptophan or tryptophan,, can detect the changes of function of activity of the enzyme of gene code perhaps by utilizing restriction map or dna sequence analysis to measure change in the dna molecular.
For example, can separate the Anthranilate synthetase-coding gene that basically 5-methyl tryptophan is tolerated from 5-methyl tryptophan tolerance cell-line.Referring to U.S. Patent No. 4,581, on April 15th, 847,1986 is open, and this patent documentation disclosure is hereby incorporated by reference.In brief, expose and low-level 5-methyl tryptophan continuously, the plant cell of cultivation part differentiation also goes down to posterity.In the presence of normal toxin 5-methyl tryptophan level, cell or tissue is grown in to repeat to go down to posterity under the 5-methyl tryptophan existence and cultivates and characterize.The stability of the 5-methyl tryptophan resistance characteristics of cultured cells can be estimated the growth after the cell-line cultivation different time post analysis tissue contact 5-methyl tryptophan of selecting by not existing under the 5-methyl tryptophan.The cell-line that tolerates owing to the Anthranilate synzyme with change can be tested and appraised normal toxicity, that is, the 5-methyl tryptophan of growth inhibitor level exists the cell-line that has enzymic activity down to screen.
According to laid-open U.S. Patents No.4 on April 15th, 1986,581,847 descriptions, can be by standard method to 5-MT-or 6-MA-resistant cell line clone's Anthranilate synthase gene to 5-MT, 6-MA, the perhaps tolerance of other amino acid analogues of tryptophan, this patent documentation is hereby incorporated by reference.
The 5-methyl tryptophan inhibitory action there is the cell-line with Anthranilate synzyme of the susceptibility of reduction can be used to separate 5-methyl tryptophan-resistance Anthranilate synzyme.Can produce the DNA library that 5-methyl tryptophan is had the cell-line of resistance, and by with the cDNA probe hybridization of the part of coding Anthranilate synthase gene, all or part of dna fragmentation that can identification code Anthranilate synthase gene.By cloning and being connected or synthesizing the copy fully of the gene that can acquire change by the PCR that uses suitable primer.Whether keep enzymic activity by measuring the Anthranilate synzyme of when being exposed to the 5-methyl tryptophan of normal toxicity level, expressing, can confirm the separation of the gene of the change of coding Anthranilate synzyme in the plant transformed cell.Referring to, U.S. Patent No.s such as Anderson 6,118,047.
For the organism of selecting, for example, express in the plant of selection or other host cell types, the code area of any dna molecular that provides here can also be provided.For the plant of selecting the example of the dna molecular that the codon of optimization uses being arranged is the Agrobacterium tumefaciens Anthranilate synthetase dna molecule with SEQ ID NO:75.The Agrobacterium tumefaciens Anthranilate synthetase dna of this optimization (SEQ ID NO:75) has 94% homogeneity with SEQ ID NO:1.
Transgenosis and carrier
In case obtain and the nucleic acid of amplification coding Anthranilate synzyme or its domain, it be connected with the promotor operability and, randomly, be connected the formation transgenosis with other element operability.
The known most of genes that are promotor and adjusting base table reach have the dna sequence dna district.Generally in protokaryon and eukaryotic, find promoter region in the flanking DNA sequence upstream of coded sequence.Promoter sequence the adjusting of transcribing of downstream gene sequence is provided and generally comprise about 50 right to about 2,000 nucleotide bases.Start in sequence and also contain the regulating and controlling sequence that can influence gene expression dose, for example enhancer sequence.The promoter sequence of some separation can provide the gene expression of heterologous gene, that is, and and with genes natural or that homologous gene is different.Know that also promoter sequence is strong or weak or derivable.Strong promoter provides high-level gene expression, and weak promoter provides very low-level gene expression.Inducible promoter is material or environment or the enlightening promotor of opening and closing that gene expression is provided that stimulates that response external adds.Promotor can also provide tissue specificity or developmental character to regulate.For heterologous gene is that the promoter sequence of the separation of strong promoter is favourable, because it provides the gene expression of enough levels, makes and detects easily and screening transformant and high-level gene expression is provided when expectation.
Promotor in the transgenosis of the present invention can provide the dna sequence dna of coding Anthranilate synzyme to express the Anthranilate synzyme.Preferably, express coded sequence, make in plant tissue, for example in the seed of plant, obtain the raising of tryptophan levels.In another embodiment, express coded sequence, make to cause the plant cell that improves, perhaps make the increase that causes the total tryptophane of cell to the tolerance of feedback inhibition or to the Growth Inhibition tolerance of the amino acid analogue of tryptophan.Promotor can also be an induction type, and the gene expression that the material that makes the outside add causes opens or closes.For example, the bacterium promotor, Piac promotor for example can be induced to the varying level of gene expression, depends on the level to the added different thiopropyl galactoside of bacterial cell that transforms.Preferably make the gene binding energy that tissue specific expression or startability regulatory gene expression promoter are provided in plant.Useful a lot of promotors are obtainable for those skilled in the art among enforcement the present invention.
Preferred promotor generally comprises but is not limited on bacterium, and phage has the promotor of function in plastid or the plant cell.Useful promotor comprises CaMV 35S promoter (Odell etc., Nature, 313,810 (1985)), the CaMV 19S (Lawton etc., Plant Mol.Biol., 9,31F (1987)), no (Ebert etc., PNAS USA, 84,5745 (1987)), Adh (Walker etc., PNAS USA, 84,6624 (1987)), sucrose synthase (Yang etc., PNASUSA, 87,4144 (1990)), alpha-tubulin, napin, actin (Wang etc., Mol.Cell.Biol., 12,3399 (1992)), cab (Sullivan etc., Mol.Gen.Genet., 215,431 (1989)), PEPCase promotor (Hudspeth etc., Plant Mol.Biol., 12,579 (1989)), 7S-α '-conglycinin promotor (Beachy etc., EMBO J, 4,3047 (1985)) or those promotors relevant (Chandler etc., The Plant Cell with the R gene complex, 1,1175 (1989)).Other useful promotors comprise phage SP6, T3 and T7 promotor.
Also can use the plastid promotor.Most of plastogenes contain and are useful on many subunits plastid-coding RNA polymerase (PEP) and the nuclear-encoded RNA polymerase of single subunit.Hajdukiewicz etc., 1997, can find the consensus sequence of nuclear-encoded polymerase (NEP) promotor among the EMBO J.Vol.16 pp.4041-4048 and be used for the specific promoter sequence table of several natural plastogenes, the document is hereby incorporated by reference.
The example of the plastid promotor that can use comprises corn plastid RRN (ZMRRN) promotor.When having mouse ear mustard plastid RNA polymerase, the ZMRRN promotor can be expressed by promotor gene.The similar promotor that can use in the present invention is maximum plastid RRN (SOYRRN) of glycine and tobacco plastid RRN (NTRRN) promotor.Mouse ear mustard plastid RNA polymerase can be discerned three kinds of all promotors.Hajdukiewicz etc. and United States Patent (USP) 6,218,145 have described the general character of RRN promotor.
In addition, can use transcriptional enhancer or enhancer copy to improve the expression of using specific promotor.The example of such promotor includes but not limited to, from the element (Last etc., U.S. Patent No. 5,290, on March 1st, 924,1994) of CaMV 35S promoter and octopine synthase gene.For example, relate to structure carrier used according to the invention, make to comprise the ocs enhancer element.The quilt evaluation for the first time of this element is 16bp palindrome enhancer (Ellis etc., EMBO J., 6 from agrobacterium octopine synthase (ocs) gene, 3203 (1987)), and at least 10 other promotors, have (Bouchez etc., an EMBO J., 8,4197 (1989).Propose to use enhancer element, for example ocs element and a plurality of copies of this element especially, when using in monocotyledon conversion background, the level of raising from adjacent promoter transcription can work.Also comprise tissue-specific promoter, include but not limited to, root-cell promotor (Conkling etc., Plant Physio., 93,1203 (1990)), and (the Fromm etc. of tissue-specific promoter, The Plant Cell, 1,977 (1989)) be useful especially,, they are inducible promoters, for example ABA-and full-inducible promoter or the like.
Because the dna sequence dna between transcription initiation site and the coded sequence initiation site promptly, does not have the targeting sequencing of translation, can influence gene expression, people also wish to use specific targeting sequencing.Can use the obtainable any targeting sequencing of those skilled in the art.Preferred targeting sequencing instructs the level of optimization of relevant gene expression, for example, and by improving or maintenance mRNA stability and/or unsuitable initial (Joshi, Nucl.Acid Res., 15,6643 (1987)) by preventing to translate.The selection of such sequence is that those skilled in the art consider.Relate to coming in the comfortable dicotyledon, particularly the sequence of the gene of in soybean, highly expressing.
In some cases, the extreme high expressed that does not need Anthranilate synzyme or its domain.For example, use method of the present invention, can produce high-caliber like this Anthranilate synzyme, i.e. the availability of substrate rather than enzyme can limit the level of the tryptophan of generation.Under these circumstances, those skilled in the art can select the expression of high modulation more or adjusting level.Such those skilled in the art are modulation or adjusting expression easily, for example, and by using more weak promotor or growing adjusting or tissue-specific promoter by using.
The nucleic acid of interested coding Anthranilate synzyme also includes and is beneficial to Anthranilate synzyme polypeptide and is transported in the plastid plastid transit peptides (for example SEQ ID NO:72 or 74) in the chloroplast for example.Be connected with the coded sequence of Anthranilate synzyme in the general frame of the nucleic acid (for example SEQ ID NO:71 or 73) of the plastid transit peptides that coding is selected.Yet plastid transit peptides can place the N-end or the C-end of Anthranilate synzyme.
Construct also comprises interested nucleic acid (DNA of the Anthranilate synzyme of for example encoding) and works and the nucleotide sequence of the mRNA polyadenylation that allows to obtain as transcription stop signals.Such transcription stop signals places 3 of interested code area ' end or downstream.The preferred transcription stop signals that relates to comprises the transcription stop signals (Bevan etc. from the nopaline synthase gene of Agrobacterium tumefaciens, Nucl.Acid Res., 11,369 (1983)), terminator from the octopus synthase genes of Agrobacterium tumefaciens, with the 3 ' end of coding, but also comprise and well known to a person skilled in the art other transcription stop signalses from the gene of the protease inhibitors I of potato or tomato or II.Under the situation of expectation, can further include regulating element, for example Adh introne 1 (Callis etc., Genes Develop., 1,1183 (1987)), sucrose synthase intron (Vasil etc., Plant Physio., 91,5175 (1989)) or TMV ω element (Gallie etc., The Plant Cell, 1,301 (1989)).According to An, Methods in Enzymology, 153,292 (1987) describedly can obtain that these 3 ' untranslateds are regulated sequences or from commercial source Clontech for example, Palo Alto exists in the plasmid that California obtains.3 ' untranslated is regulated sequence and can be connected with 3 of Anthranilate synthase gene ' end operability by standard method.Being used to implement other such regulating elements of the present invention is known for those skilled in the art.
But selectable marker gene or reporter also are useful in the present invention.Such gene give different phenotypes can for the cell of presentation markup gene, makes the cell that such cell transformed is different from does not have mark like this.But selectable marker gene is given a characteristic, and people can pass through chemical method, promptly by using selective reagent (weed killer herbicide for example, antibiotic, perhaps similar) to select.But reporter or screening-gene are given a characteristic, by observing or test, that is, by ' screen ' can be identified (for example, R-site characteristic).A lot of examples of certainly, suitable marker gene are well known in the art and can use in the embodiment of this invention.
The possible selectable marker of use related to the present invention includes but not limited to neo gene (Potrykus etc., Mol.Gen.Genet., 199,183 (1985)), its coding neomycin resistance and for using kanamycin, and G418, etc., can be selected; The bar gene of coding bialaphos resistance; The EPSP synthase protein (Hinchee etc., Biotech., 6,915 (1988)) that coding changes thus the gene of conferring glyphosate resistance; Nitrilase gene is for example given the bxn to the Bromoxynil resistance (Stalker etc., Science, 242,419 (1988)) from ozena mucus bacillus (Klebsiella ozaenae); Give imidazolone, sulfonylurea or other ALS-suppress the mutant acetolactic acid sy nthase gene (ALS) (european patent application 154,204,1985) of the resistance of chemicals; Methopterin-resistance DHFR gene (Thillet etc., J.Biol.Chem., 263,12500 (1988)); Give dalapon dehalogenation enzyme gene to weed killer herbicide dalapon resistance; Perhaps give Anthranilate synthase gene to the sudden change of the resistance of 5-methyl tryptophan.When using the mutant epsp synthase gene, can realize other interests by mixing suitable plastid transit peptides (CTP).
But the embodiment that can use the detailed description of the selectable marker gene of selecting transformant in system is the gene of coding phosphinothricin acetyltransferase; for example from the bar gene of streptomyces hygroscopicus (Streptomyces hygroscopicus) or from the pat gene (U.S. Patent No. 5 of streptomyces viridochromogenes (Streptomyces viridochromogenes); 550; 318, be hereby incorporated by reference).Phosphinothricin acetyltransferase (PAT) is weed killer herbicide bialaphos, the active component deactivation in the phosphinothricin (PPT).PPT suppresses glutamine synthase (Murakami etc., Mol.Gen.Genet., 205,42 (1986); Twell etc., PlantPhysio., 91,1270 (1989)), cause the quick accumulation and the Apoptosis of ammonia.
But operable selection markers thing includes but not limited to β-glucuronidase or uidA gene (GUS), its a kind of enzyme of encoding, and the various product look substrates of this kind of enzyme are known; R-position gene, the product of the production of anthocyanin pigment (redness) in its coding and regulating plant tissue (Dellaporta etc., Chromosome Structure and Function, pp.263282 (1988)); Beta-lactamase gene (Sutcliffe, PNAS USA, 75,3737 (1978)), its a kind of enzyme of encoding, the various product look substrates of this kind of enzyme are known (for example, PADAC produce the look cynnematin); XylE gene (Zukowsky etc., PNASUSA, 80,1101 (1983)), its coding can be changed the catechol dioxygenase that produces the look catechol; Alpha-amylase gene (Ikuta etc., Biotech., 8,241 (1990)); Tyrosinase cdna (Katz etc., J.Gen.Microbiol., 129,2703 (1983)), its a kind of enzyme of encoding, this kind of enzyme can be oxidized to tyrosine DOPA and dopaquinone, and they follow the compound melanin that condensation forms easy detection; Beta-galactosidase gene, its a kind of enzyme of encoding, this kind of enzyme has a lot of product look substrates; Luciferase (lux) gene (Ow etc., Science, 234,856 (1986)) can be used for bioluminescent detection; Or be aequorin gene (Prasher etc., Biochem.Biophys.Res.Comm., 126,1259 (1985)), it can use in calcium-responsive bioluminescent detection, perhaps egfp gene (Niedz etc., Plant CellReports, 14,403 (1995)).Use, for example X-radiography, scinticounting, fluorescence spectrophotometry, half-light video display photographic process, optical counting photographic process, or porous luminometer can detect the existence of lux gene in the transformant.Also expect developing this system and be used for the screening of bioluminescence population, for example to tissue culturing plate, even to whole plant screening.
In addition, can make up transgenosis and being used to provide makes in the born of the same parents in the gene outcome guiding plant cell compartment or protein is oriented to born of the same parents' external environment.This generally transmits by encoding or the dna sequence dna of signal peptide sequence is connected with the specific gene coded sequence and can realizes.The transmission that obtains, or signal peptide is transported to protein in the particular cell respectively, or the outer destination of born of the same parents, can translate the back then and remove.Transhipment or signal peptide effect help protein transports by intracellular membrane, for example, vacuole, capsule, plastid and mitochondrial membrane, and signal peptide indicator protein matter is passed through epicyte.By helping protein transduction to transport in the compartment or the extracellular, these sequences can increase the accumulation of gene outcome.
A kind of like this specific examples of purposes relates to indication Anthranilate synzyme to the specific cells device, for example plastid, rather than kytoplasm.This makes the mouse ear mustard of protein plastid specificity orientation belong to the SSU1A transit peptides by use and explains.Perhaps, transgenosis can comprise the dna sequence dna of plastid transit peptides-DNA sequences encoding or coding rbcS (RuBISCO) transit peptides, this sequence operability between the dna sequence dna of promotor and coding Anthranilate synzyme connects the (summary of the directed peptide of relevant plastid, referring to Heijne etc., Eur.J.Biochem., 180,535 (1989); Keegstra etc., Ann.Rev.Plant Physio.Plant Mol.Biol., 40,471 (1989)).If transgenosis is imported into plant cell, transgenosis can also comprise plant transcription termination and polyadenylation signal with translation signals that 3 of plant Anthranilate synthase gene ' end is connected.
Can use the external source plastid transit peptides of in natural plants Anthranilate synthase gene, not encoding.The general length 40-70 of a plastid transit peptides amino acid and translation back performance function indicator protein matter are to plastid.Be transported to during the plastid or afterwards, the transit peptides cracking produces mature protein.The copy fully of the gene of coded plant Anthranilate synzyme can comprise the plastid transit peptide sequence.Under the sort of situation, do not need the plastid transit peptide sequence that external source obtains is attached in the transgenosis.
External source plastid transit peptide-coding sequence can obtain from various plant nucleus genes, as long as gene product expression is to comprise the preceding protein of amino terminal transit peptides and be transported in the plastid.The known example of the plant gene product of such transit peptide sequence that comprises includes but not limited to, the small subunit of carboxydismutase, chlorophyll a/b is in conjunction with albumen, the plastid ribosomal protein of nuclear gene encoding, some heat shock proteins, amino acid biosynthetic enzymes, acetolactate synthase for example, 3-enolpyruvate phosphate shikimic acid synthase, dihydrodipicolinate synthase, Anthranilate synzyme or the like.In some cases, plastid transit protein is encoded in interested Anthranilate synthase gene, does not need to add such plastid transit sequence in this case.Perhaps, those all or part of chemosynthesis that can list above for example from the sequence of known transit peptides of the dna fragmentation of coding transit peptides.
No matter coding transmits the source of the dna fragmentation of peptide, it should comprise translation initiation codon, for example, and the ATG codon, and be expressed as the amino acid sequence that is identified and suitably brings into play function in the host plant plastid.Be further noted that the amino acid sequence that transmits junction between peptide and the Anthranilate synzyme, its cleaved maturase that obtains at this.Guidance has been identified and can be used as to some conserved amino acid sequences.The for example operation of one or two dna sequence dna of a suitable restriction enzyme site is gone in the correct fusion of transmission peptide-coding sequence and Anthranilate synzyme coded sequence differentiate possibly.By comprising direct mutagenesis, the methods such as insertion of the oligonucleotide joint of chemosynthesis can realize this operation.
The correct fusion of the nucleic acid of coding plastid transit protein is not necessarily essential, as long as the coded sequence of plastid transit protein is in the Anthranilate synzyme frame.For example, often other peptidyl or amino acid can be comprised and the expression or the location of protein of interest matter can be influenced sharply.
In case obtain, the application standard method, the plastid transit peptide sequence can suitably connect the Anthranilate synzyme code area in promotor and the transgenosis.The plasmid that is included in the promotor that function is arranged in the plant cell and has a plurality of cloning sites downstream can be fabricated or obtain from commercial source.Utilize Restriction Enzyme can insert the plastid transit peptide sequence from the promotor downstream.Then, fusion or insertion are translated immediately in Anthranilate synzyme code area in 3 of plastid transit peptide sequence ' terminal downstream and frame.Therefore, plastid transit peptides preferably is connected with the amino terminal of Anthranilate synzyme.In case form, transgenosis can be by subclone in other plasmid or carrier.
Except the nuclear Plant Transformation, the invention still further relates to genomic directed conversion of plant plastid.Therefore, transport by gene orientation of compartment in born of the same parents and can realize that also gene outcome is directed in the plant cell compartment in the born of the same parents.The orientation of plastogene group transforms can provide other benefit to consideration conveyization.For example, the directed plastid of Anthranilate synzyme transforms the requirement of having got rid of the preceding protein that directed peptide of plastid and post-translational transport and processing obtain from corresponding nuclear transformant.P.Maliga.Current Opinion in Plant Biology 5,164-172 (2002), P.B.Heifetz.Biochimie vol.82,655-666 (2000), R.Bock.J.Mol.Biol.312,425438 (2001), with H.Daniell etc., the plastid that Trends in Plant Science7,84-91 (2002) have described plant transforms, and is incorporated by reference here.
Made up after the transgenosis that comprises the Anthranilate synthase gene, this box can have been imported in the plant cell.Type according to plant cell, gene expression dose, activity with the enzyme of this gene code, the DNA of coding Anthranilate synzyme imports the excess production that can cause tryptophan in the plant cell, give amino acid analogue to tryptophan, for example 5-methyl tryptophan or 6-methyl Anthranilate, tolerance, and/or change the tryptophane of plant cell in addition.
The conversion of host cell
The transgenosis that comprises the Anthranilate synthase gene can be by subclone in known expression vector, and AS expresses can detected and/or quantitative assay.This screening technique is used to identify provides the expression of Anthranilate synzyme in the plastid in transgenosis that the Anthranilate synthase gene expresses and the plant transformed cell.
Plasmid vector is included as easy selection, and amplification and transgenosis transform in protokaryon and eukaryotic and the other dna sequence dna that provides, and for example, pUC-comes source carrier, and pSK-comes source carrier, and pGEM-comes source carrier, and pSP-comes source carrier, or pBS-comes source carrier.Additional dna sequence dna is included as the origin of replication that the carrier self-replicating provides, but selectable marker gene, optimized encoding antibiotic or Herbicid resistant, for a plurality of sites being inserted the gene of encoding in unique multiple clone site that dna sequence dnas provide or the transgenosis and strengthening protokaryon and sequence that eukaryotic transforms.
Being used at the another kind of carrier that plant and prokaryotic are expressed is binary Ti-plasmids (as disclosed Schilperoort on the 10th etc. in July nineteen ninety, U.S. Patent No. 4,940,838 is described), and that describe for example is carrier pGA582.This binary Ti-plasmids carrier was before characterized in the document of above citation by An.This binary Ti carrier for example can be replicated in Escherichia coli and the agrobacterium on the protokaryon bacterium.The agrobacterium plasmid vector also can be used to transgenosis is transferred to plant cell.This binary Ti carrier preferably includes the nopaline T DNA right side and left border, so that being provided, effective plant cell transforms, but selectable marker gene, a plurality of cloning sites, colE1 origin of replication and the wide host range replicon of uniqueness in the T marginal zone.Carry genetically modified binary Ti carrier of the present invention and can be used to transform protokaryon and eukaryotic, but preferably be used for transformed plant cells.Referring to, for example, Glassman etc., U.S. Patent No. 5,258,300.
By existing method expression vector is imported in protokaryon or the eukaryotic then.Include but not limited to for monocotyledon and the special effective conversion method of dicotyledon, according to (Plant Cell such as W.J.Gordon-Kamm, 2,603 (1990)), (Bio/Technology such as M.E.Fromm, 8,833 (1990)) and (PlantMolecular Biology such as D.A.Walters, 18,189 (1992)) described to prematurity embryo or the somatic microinjection bombardment of II type embryo generation callosity (U.S. Patent No. 5,990,390), perhaps by (The Plant Cell, 4,1495 (1992)) such as D ' Halluin, perhaps Krzyzek (U.S. Patent No. 5,384,253, January 24 nineteen ninety-five is disclosed) describe to the somatic electroporation of I type embryo generation callosity.Also can transform in the liposome that comprises DNA by the tungsten palpus transformed plant cells (on April 12nd, 523,1994 is open for Coffee etc., U.S. Patent No. 5,302) of application DNA-bag quilt with by cellular exposure.
After the Anthranilate synzyme construct of selecting was transformed in the host cell, host cell can be used for transgenosis Anthranilate synzyme and combine the useful product of generation with host cell enzymatic mechanism.The cultivation transformant can cause the production of the enhancing of tryptophan and other useful compound, can reclaim these products from cell or medium.The example of the useful compound that can produce when expressing in various host cells and/or organism comprises tryptophan, heteroauxin and other plant hormone, the quasi-isoflavone compound of in soybean, finding important to cardiovascular health, as volatility benzazolyl compounds to the signal of herbivorous insect natural enemy in the corn, the indoles glucosinolate (indole-3-carbinol) that cancer therapy drug is for example found in the crucifer section, and the mycetogenetic ergot compound (Barnes etc. that for example plant a bit of certain indole alkaloid, Adv ExpMed Biol, 401,87 (1996); Frey etc., Proc Natl Acad Sci, 97,14801 (2000); Muller etc., Biol Chem, 381,679 (2000); Mantegani etc., Farmaco, 54,288 (1999); Zeligs, J Med Food, 1,67 (1998); Mash etc., Ann NY Acad Sci, 844,274 (1998); Melanson etc., Proc Natl AcadSci, 94,13345 (1997); Broadbent etc., Curr Med Chem, 5,469 (1998)).
The accumulation of tryptophan can also cause the generation of the increase of secondary metabolite in microorganism and the plant, for example, contains the metabolite of indoles, for example simple indoles, indole coupled thing, indole alkaloid, the indoles glucosinolate in indoles phytoalexin and the plant.
The insensitive Anthranilate synzyme of tryptophan is had the potentiality that increase the metabolite that various chorismic acids derive, comprise since by chorismate mutase since synthetic stimulation of phenyl alanine and derive from phenyl alanine those.Referring to Siehl, D., The biosynthesis oftryptophan, tyrosine, and phenylalanine from chorismate in PlantAmino Acids:Biochemistry and Biotechnology, BK Singh writes, pp171-204.When having the insensitive Anthranilate synzyme of feedback, the metabolite that other chorismic acid that may increase is derived comprises phenyl propanoids, flavonoids, and isoflavonoid, and derive from Anthranilate those, for example indoles, indole alkaloid and indoles glucosinolate.Much important plant hormone in these compounds, plant defense compound, the chemopreventive agent of various health status, and/or pharmaceutically active compound.
The scope of its synthetic these compounds that may increase owing to the expression of Anthranilate synzyme depends on the organism of expressing the Anthranilate synzyme.Those skilled in the art determine to use and/or test which kind of organism and host cell in order to produce desired compounds easily.The present invention relates to secondary colour propylhomoserin and other useful compound in various organisms, comprise plant, microorganism, fungi, yeast, bacterium, insect cell, and mammalian cell.
Select the strategy of tryptophan excess production cell-line
The application organizes culture technique is effectively selected the tryptophan analog resistance expected, and the tryptophan excess is produced variant and required the careful alternative condition of determining.Optimize these conditions and make tryptophan analog resistance, tryptophan excess production cell is grown in culture and is accumulated, and suppresses the growth of a large amount of cell populations simultaneously.The vigor height of individual cells depends on that this fact of vigor of flanking cell makes situation complicated in the population.
Determine that by the interaction of characterizing compounds and tissue cell culture is exposed to the condition of tryptophan analog.Should consider to resemble toxic degree and the such factor of inhibiting rate.Need to consider the accumulation of compound in the cell in the culture, the persistence of compound and stability in medium and the cell also have the absorption and the transmission of the cell compartment of expectation.In addition, determine to add tryptophan whether the effect this point of easy converse compound be important.
Careful evaluation analog is active and morphologic influence to culture.The particularly important is selection and the vegetable regeneration capacity of culture is not had the analog exposure condition of influence.Whether analog cell killing or just suppress the selection that cell division also influences the analog exposure condition.
Above-mentioned consideration is depended in the selection of selection scheme.The concise and to the point scheme of describing below in option program, using.For example, for the cell of the growth inhibiting resistance selecting the tryptophan analog is caused, can make the cells contacting high tryptophan analog level blink of last division in the liquid suspension culture.Reclaim and accumulate survivaling cell then, contact the longer time afterwards again.Perhaps, the cell culture that cultured tissue is partly broken up, and continue to be exposed to low-level tryptophan analog and cultivate again.Improve concentration gradually in the inferior several times foster interval of being commissioned to train.Though can use these schemes in selecting step, the present invention is not limited to these operations.
Be used for the gene that plant is modified
As mentioned above, but as the gene of selectable marker gene and reporter performance function in transgenosis of the present invention, can operate the encode dna sequence dna of Anthranilate synzyme or its domain of combination in carrier and the plant.In addition, to transgenosis of the present invention, carrier and plant can add other agronomy character.Such proterties includes but not limited to, insect-resistant or tolerance; Disease resistance or tolerance (virus, bacterium, fungi, nematode); Stress resistance or tolerance, for instance to arid, heat, cold, freezing, undue moist, salt stress, the resistance of oxidative stress or tolerance; The productive rate that improves; Food content and composition; The material outward appearance; Male sterile; Dry; Suffertibility; Productivity; Starch performance; Oil mass and oil; Or the like.People can insert plant of the present invention with one or several gene of giving such proterties.
Insect-resistant or tolerance
Bacillus thuringiensis (Bacillus thuringiensis) (or " Bt ") bacterium almost comprises 20 kinds of bacterium subspecies, when various insect species digest, and their toxigenicity endotoxin polypeptide.The biology of endotoxin protein matter (Bt protein) and corresponding gene (Bt gene) and molecular biological relevant summary be referring to H.R.Whitely etc., Ann.Rev.Microbiol., 40,549 (1986) and H.Hofte etc., Microbiol.Rev., 53,242 (1989).The gene of various Bt protein of encoding is cloned and is checked order.A fragment of Bt polypeptide is necessary for the toxicity to various lepidoptera pests, and is included among about 50% of Bt peptide molecule.As a result, the Bt polypeptide of the brachymemma of the Bt gene code of brachymemma keeps its toxicity to a lot of lepidopterous insects insects under many circumstances.For example, proved HD73 and HD1 Bt polypeptide to the important lepidopterous insects insect of american plant European corn boring worm for example, the larva of root eating insect and corn earworm is toxic.M.Geiser etc., Gene, 48,109 (1986) and M.J.Adang etc., Gene, 36,289 (1985) clone respectively and the gene of checked order coding HD1 and HD73Bt polypeptide, and utilize standard method, can be from deriving from culture collection center (Bacillus Genetic Stock Center for example, Columbus, Ohioor USDA Bt stock collection Peoria, 111.) HD1 and HD73 strain clone.For example U.S. Patent number 6,329, described the example of Bt gene and polypeptide in 574,6,303,364,6,320,100 and 6,331,655.
Utilize the method before be used for cloning the Bt gene can the new previous DNA that not have the Bt toxin of sign of clones coding, can also produce the new synthesized form of Bt toxin from host's micro-organisms bacillus.
Among the present invention useful Bt gene can comprise comprise make plant middle and lower reaches location the Bt sequence transcribe 5 ' dna sequence dna with the dna sequence dna of translation initiation.The Bt gene can also comprise the 3 ' dna sequence dna that comprises the sequence of deriving from 3 ' noncoding region of the gene that can express interested plant.The Bt gene also comprises toxicity Bt polypeptide or its toxicity part that the coding thuringiensis produces or has the dna sequence dna of suitable amino acid sequence homology with it.The Bt coded sequence can comprise: (i) insect pest of the interested plant of antagonism activated with the Bt endotoxin insect-killing protein of homology basically, for example, HD73 or HD1 Bt sequence, DNA sequences encoding; The (ii) insecticidal activity fragment of Bt endotoxin polypeptide, for example from the insecticidal activity HD73 or the HD1 polypeptide of carboxyl and/or amino terminal brachymemma, coded sequence; And/or the Bt sequence of the brachymemma of merging in the sequence frame of the polypeptide of some additional benefit below (iii) for example providing: (a) selectable gene with coding, for example, give gene to antibiotic or Herbicid resistant, (b) the easy reporter that detects or analyze of its product, for example, luciferase or β-glucuronidase; (c) be coded in and stablize that Bt protein is anti-to be decomposed or strengthen the dna sequence dna that the anti-insect of Bt protein has the peptide sequence of some additional purpose in rendeing a service, for example, protease inhibitors and (d) help Bt protein to be oriented in the plant cell or the sequence of outer particular compartment, for example, burst.
Synthetic in order to obtain Bt protein the best in plant, it also is suitable that the dna sequence dna of Bt gene is adjusted to the more similar gene of effective expression in interested plant.Because the codon utilization of Bt gene can with the dissmilarity of in interested plant, expressing that gene utilized, can be by being used in the plant those of effective expression more, for example those codons that often use in interested plant are (referring to E.Murray etc., Nucl.Acids Res., 17,477 (1989)) replace these codons and can improve the expression of Bt gene in plant cell.Such codon displacement requires to replace base and does not change the Bt amino acid sequence of polypeptide that obtains.The Bt peptide sequence can be identical with bacterial gene or its fragment.Contain complete Bt coded sequence than the more preferred codon of indigenous bacteria gene, perhaps its fragment, can utilize the standard chemical synthetic method to synthesize, perhaps utilize standard method to import or be assembled into the Bt gene, for example direct mutagenesis or DNA polymerization be connected or the like.
Protease inhibitors can also provide insect-resistant.For example, use the protease inhibitors II gene from tomato or potato, pinII may be useful.The combination that utilizes pinII gene and Bt toxin gene also is favourable.Other gene of coding insect digestive system inhibitor, perhaps coding helps producing those of the enzyme of inhibitor or co-factor, also is useful.This group comprises that oryzacystatin and amylase inhibitor are for example from those of wheat and barley.
The gene of coding agglutinin can be given other or other insecticidal properties (Murdock etc., Phytochemistry, 29 85 (1990); Czapla ﹠amp; Lang, J.Econ.Entomol., 83,2480 (1990)).Useful agglutinin gene comprises, for example, and barley and wheat germ agglutinin (WGA) and rice agglutinin.(Gatehouse etc., J Sci Food Agric, 35,373 (1984)).
Time control is shaped on the gene of generation of the big or little polypeptide of anti-insect active in importing insect pest, and described polypeptide is the bacteriolyze peptide for example, and peptide hormone and toxin and poisonous substance also may be useful.For example, the expression of juvenile hormone esterase, directed special insect pest also can produce insecticidal activity, and perhaps may causing changes in quality stops (Hammock etc., Nature, 344,458 (1990)).
The genetically modified plants of gene that expressing coding influences the enzyme of the cuticular integrality of insect also are useful.Such gene comprises for example chitinase of encoding, protease, the gene of those genes of lipase and generation nikkomycin.Influencing the active encoding gene of insect molting, for example influence those of generation of moulting hormone UDP-glucosyltransferase, also is useful.
Helping reducing plant also is useful to the encoding gene of the enzyme of the generation of the compound of the nutritional quality of insect pest.For example, might give the plant insecticide activity by the sterol composition that changes it.Other embodiment of the present invention relates to the genetically modified plants of the activity of fatty oxygenase with raising.
The present invention also is provided for changing the method and composition of plant secondary metabolites.An embodiment relates to the change plant and produces DIMBOA, expects, can give European corn boring worm, the resistance of root eating insect and several other insect pests.Referring to, for example, United States Patent (USP) 6,331,880.DIMBOA is from the relevant compound deriving of indoles.The indoles related compound resembles the method for tryptophane in the invention provides the raising plant cell and organizing.Therefore, according to the present invention, the method that provides here can also improve the DIMBOA level, thereby improves the resistance of plant to insect.
In the resistance that helps corn earworm and root eating insect, relate separately to use and can regulate the importing of the gene that dhurrin relates in producing in the gene of maysin and the jowar.
Also can use other encoding genes that characterize protein with potential insecticidal activity.Such gene comprises, for example, can be used as the Cowpea Trypsin Inhibitor (CpTI of root eating insect deterrence; Hilder etc., Nature, 330,160 (1987)); Proof as the corn root eating insect prevent agent the avermectin encoding gene (W.C. writes for avermectin and abamectin, Campbell, 1989; Ikeda etc., J Bacteriol, 169,5,615 1987); The ribosome inactivating protein plasmagene; With the gene of regulating plant structure.The insecticide that does not have toxicity (raw insecticide) that the genetically modified plants that also relate to the gene that comprises anti-insect antibody gene and codase, described enzyme can be used plant outward is converted into insecticide in the plant.
Environment or stress resistance or tolerance
Gene expression can influence the improvement that plant tolerates the ability of various environment-stress.For example, by importing " antifreeze " protein, for example Winter Flounder (Cutler etc., J PlantPhysio, 135,351 1989) protein or its synthetic gene derivative can be given the resistance that cryogenic temperature is improved.Also can give improved cold tolerance (Wolter etc., The EMBO J., 11,4685 (1992)) by the expression that strengthens glycerol-3-phosphate acetyltransferase in the plastid.Can give the resistance to oxidative stress (Gupta etc., Proc.Natl.Acad.Sci USA, 90 by the expression of superoxide dismutase, 1629 (1993)), and can be improved (Bowler etc., Ann Rev.Plant Physio by glutathione reductase, 43,83 (1992)).
Considering advantageously influences vegetation water content, total flow of water, and osmotic potential and full expression of gene can strengthen the ability of plant tolerance arid, are useful therefore.Propose, for example, the expression of the biosynthetic encoding gene of osmotically active solute can be given siccocolous protective effect.This class is the gene of coding mannitol dehydrase (Lee and Saier, J.Bacteriol., 258,10761 (1982)) and trehalose-6-phosphate synthase (Kaasen etc., J.Bacteriology, 174,889 (1992)).
Similarly, other metabolites can protective enzyme function or film integrality (Loomis etc., J.Expt.Zoology, 252,9 (1989)), so the expression of the biosynthetic encoding gene of these compounds can be given arid resistance in the mode that is similar to mannitol.Osmotically active is arranged between arid and/or dry period and/or provide other examples of the naturally occurring metabolite of some direct protective effects to comprise fructose; red tinea alcohol, sorbitol, dulcitol; glucosyl group glycerine; sucrose, stachyose, face sugar; proline; glycine, betain, alcohol in ononitol and the pinane.Referring to, for example, United States Patent (USP) 6,281,411.
Be that three classes embryo's generation in evening protein (referring to Dure etc., Plant Molecular Biology, 12,475 (1989)) has been told on the basis with the structural similarity.The expression of all three groups of LEA structural genes can be given drought tolerance.The other types of inducing during water is coerced can be that useful protein comprises thiol proteinase, aldolase and transmembrane transporter, it can give various protections and/or repairing type function in drying stress.Referring to, for example, PCT/CA99/00219 (Na +/ H +The exchanger polypeptide gene).Influencing the biosynthetic gene of lipid also may be useful in giving arid resistance.
To extract the relevant gene expression of the specific modality proterties of water of recruitment from dry soil also may be useful with making.Improve during coercing that to duplicate adaptive gene expression also can be useful.During also proposing to coerce kernel being ended the amount of the grain that minimized gene expression meeting increase will gather in the crops, is valuable therefore.
Make plant more effectively make water, importing and expression by gene can improve total performance, even when soil water utilizability when being limited.To overcome water conservancy that the gamut relevant with the water utilizability coerce gene by import improving plant, can realize that the stable of productive rate performance is with lastingly with maximized ability.
Disease resistance and tolerance
Can produce resistance by expression of gene to virus.For example, the expression of the antisense gene of directed important viral function or coding virus envelope proteins expression of gene can be given the resistance to virus.
Can give resistance by quiding gene to bacterium and fungus-caused disease.For example, so-called " peptide antibiotic ", pathogenesis (PR) protein of being correlated with, toxin resistance and influence the host disease substance and for example interact that the encoding gene of the protein of morphological feature may be useful.
Mycotoxin minimizing/eliminating
The fungi relevant with plant produces mycotoxin, comprises that aflatoxin and fumonisin are important factors that makes grain useless.These conk inhibitory action can reduce the synthetic of these toxicants, therefore reduce because the grain loss of mycotoxin contamination.Can be with gene transfered plant, mould fungus inhibition toxin synthetic and do not disturb conk like this.In addition, for the mycotoxin contamination of the minimizing that realizes grain, coding can make that the new expression of gene of the enzyme that mycotoxin is nontoxic is useful.
Plant is formed or quality
By all means, comprise the expression that improves native protein, reduction is by bad those protein expressions of forming, change the composition of native protein, perhaps the importing coding has the gene of the whole new protein of advantage composition, can change plant and form, for example, to improve amino acid balance.Referring to, for example, U.S. Patent No. 6,160,208 (changes that the seed storage protein is expressed).The gene importing that changes content of vegetable oil is valuable.Referring to, for example United States Patent(USP) Nos. 6,069,289 and 6,268,550 (ACC enzyme genes).For example, improve starch utilization in the cow by postponing its metabolism by improving the gene that branch degree can import the nutritive value of the starch component that improves plant.
Plant agronomy feature
In the factor that where can grow of decision plant two are the time length between the average day gentle frost of the season of growth.The expression of gene that development of plants relates in regulating is useful, for example, and the on-bladed of having identified in the corn and slightly make the leaf sheath gene.
Can import the gene that improves plant associations ability and other plant growth characteristics to corn.Can give stronger stem, the root system of improvement prevents perhaps or reduces that the expression of gene that fringe drops is valuable for the peasant.
Nutrients utilizes
Utilizing effective nutraceutical ability may be limiting factor in the plant growing.By quiding gene, can change nutrients and take in, the tolerance pH limit, the transfer in plant is stored accumulation and to the validity of metabolic activity.These modifications make that plant is more effective and utilize available nutrients.For example, the raising of the activity of general enzyme that exist and that relate in the nutrients utilization can improve nutraceutical validity in the plant.The example of such enzyme is a phytase.
Male sterile
Male sterile is useful in the production of hybrid seed, and male sterile can produce by gene expression.By transforming, male sterile and disease susceptibility are separated by importing TURF-13.Referring to Levings, Science, 250:942-947,1990.Because for the feed purpose with for grain production need recover male sterile, also can import the gene that coding male sterile recovers.
The selection of resistant cell line and sign
Select,, find these cell or tissues well-grown in the presence of the normal horizontal tryptophan analog of inhibition up to reclaiming cell or tissue.These cells " are " several generations that goes down to posterity in the presence of the tryptophan analog, characterize after removing the cell do not have resistance.By the growth phase of the growth of these cell-lines with nonoptional cell or tissue in the presence of the various tryptophan analogs of various concentration compared, determine the amount of the resistance of acquisition.Cell-line by making selection simply do not have tryptophan in the presence of after the growth different time analysis make tissue be exposed to the growth of analog once more, can estimate the resistance trait stability of cultured cells.Utilize external chemical research to confirm the analog action site is changed over the form less to the inhibitory action susceptibility of tryptophan analog, also can estimate resistant cell line.
Can detect with the quantitative analysis cell transformed in the transient expression of Anthranilate synthase gene.By the RT pcr analysis, use quantitative protein trace to clone's the specific antibody of Anthranilate synzyme, perhaps there is enzymic activity down by the amino acid analogue that detects tryptophan or tryptophan, can quantitative analysis gene expression.By using to clone's the Anthranilate synzyme or the immunochemistry colouring method of the specific antibody of subcellular fraction, then carry out biochemistry and/or immunochemical analyses, can measure the tissue and the Subcellular Localization of clone's Anthranilate synzyme.Also can estimate the susceptibility of clone's Anthranilate synzyme to reagent.Can use then provides the Anthranilate synzyme or has the gene of the Anthranilate synzyme expression of tolerance to come transforming monocots and/or dicotyledon histocyte and regeneration transformed plant and seed to the amino acid analogue of tryptophan or the inhibitory action of free L-tryptophan.But by detecting the existence of selectable marker gene or reporter, for example can select herbicide resistance gene, can select transformant by detecting.The transient expression that can detect Anthranilate synzyme in the transgenic embryo generation corpus callosum is analyzed in utilization to clone's the specific antibody of Anthranilate synzyme or by RT-PCR.
Plant regeneration and seed produce
Can use embryo's generation corpus callosum of conversion then, meristematic tissue, plumule, blade wait and produce the genetically modified plants that show Anthranilate synthase gene genetic stability.By means commonly known in the art (for example, referring to United States Patent(USP) Nos. 5,990,390,5,489,520; With Laursen etc., Plant Mol.Biol., 24,51 (1994)), make the plant cell that shows satisfactory level carry out the plant regeneration program to the tolerance of the amino acid analogue of tryptophan, obtain to express the ripe plant and the seed of tolerance proterties.The plant regeneration program makes the trunk plumule grow and then send out roots and bud.Express in order to determine that the tolerance proterties is broken up in the organ plant, rather than only in the neoblast culture, express, aftergrowth is evaluated and tested in the plant each several part with respect to the tryptophan levels that does not have plants transformed to exist of regenerating.The application standard method can produce genetically modified plants and seed from tryptophane with to vicissitudinous transformant of the resistance of tryptophan analog and tissue.Especially preferred is the tryptophane increase of leaf or seed.By according to Widholm, Biochimica et Biophysica Acta, 279,48 (1972) is described, by measuring the enzymic activity in the transformant, can detect the tryptophan of amount of suppression or its analog and have down that the specific activity of enzyme changes.By as Jones etc., Analyst, 106,968 (1981) described standard methods also can be measured the variation of total tryptophane.
Cell-line from known this proterties of expression obtains ripe plant then.If possible, the plant of regeneration can self-pollination.In addition, the plant hybridization that grows up to of the important inbred line seed of the pollen that obtains from regeneration plant and agricultural.In some cases, the pollen envelop of these inbred line plant is used for regeneration plant is pollinated.Come genetics to characterize this proterties by the independence of estimating this proterties among the first generation and the offspring.If these proterties are commercial particularly useful, the genetics of the proterties of then selecting in tissue culture in plant and expression are particular importances.
If a lot of different hybrid combinations can be discussed sell, then the tryptophan excess is produced soybean, and the commercial methyl esters of cereal and other plant is maximum.According to for example maturing stage, the such difference of suffertibility or other agronomic traits is the basis, and the peasant generally sows more than one hybrid.In addition, because resemble the maturing stage, the difference of the proterties that disease and insect-resistant are such is fit to that regional hybrid and is not suitable for other area.Because like this, need import tryptophan excess production effect to a large amount of parent's inbred line, make to produce a lot of hybrid combinations.
By making original excess production strain and normal elite incross and making the offspring and normal parents is backcrossed, carry out converse process (backcrossing).The offspring that this hybridization produces is isolated, and makes some plant have and is responsible for the gene that excess is produced, and other then do not have such gene.The plant that has such gene hybridizes with normal parents once more, produces the offspring that excess production and ordinary production are isolated again.Like this repeatedly, change into excess production strain up to original normal parents, also have and initial other all important attribute of finding in normal parents.Implement frontal convolution separately for each elite strain that will change into tryptophan excess production strain and hand over program.
After backcrossing, the new excess production strain of the commercial hybrid that produces and the appropriate combination of strain are estimated excess production and important agronomy character combination.Produce excess production strain and hybrid, they represent original normal strain and hybrid really.This require to estimate under various environment the generally whether commercialization growth of these strains or hybrid.For high tryptophan soybean production, need two parents of hybrid to isozygoty for the high tryptophan feature.The parent of the gratifying hybrid of proterties increases and is used for the application standard hybrid to produce the hybrid production of implementing.
The genetically modified plants that expection produces here are useful for various commerce and research purpose.Can create genetically modified plants and be used for traditional farming, be to have the proterties (for example, the nutrient content that improves in human foods or the animal feed) that helps from the consumer of the grain of plant results.In such application, generally, the cereal in the mankind or the animal food plants plant for using.But other parts of plant comprise stem, skin, and Food ﹠ Nutrition Department divides or the like, also has purposes, comprise as the animal silage fodder, fermented forage, living things catalysis perhaps is used to view and admire the part of purpose.
In the commercial production of protein or other molecules, also find the purposes of genetically modified plants, in this case, from plant part, extraction or purifying molecule (s) of interest such as seed.Plant cell or organize also and can be cultivated, growth in vitro, perhaps fermentation prepares such molecule.
Also can in commerce raising project, use genetically modified plants, perhaps can hybridize or breeding with relevant crop plant.For example merge by protoplast, the improvement of recombinant DNA coding can for example be transferred to other species cells from soya cells.
In one embodiment, utilize microparticle bombardment, be imported into responsive unifacial leaf of 5-MT or dicotyledonous tissue from maize cell system transgenosis that separate and that corn Anthranilate synthetase alpha that be connected with 35S CaMV promotor-domain is formed to the 5-MT tolerance.Select the plumule or the meristematic tissue of conversion, and be used to produce transfer-gen plant.The callosity that transforms is venerated body and the transfer-gen plant evaluation genetic stability to tolerance and the tolerance proterties of 5-MT or 6-MA.
The present invention is described in further detail the following examples and the present invention is not subjected to its restriction.
Embodiment 1: from Agrobacterium tumefaciens separation Anthranilate synzyme with at expression in escherichia coli.
This embodiment has described from Agrobacterium tumefaciens and has separated Anthranilate synzyme and its expression Escherichia coli.
The clone of Agrobacterium tumefaciens As
Be used to that (the GenBank registration number: the nucleotide of Anthranilate synzyme code area P15395) and amino acid sequence are retrieved Agrobacterium tumefaciens C58 genomic sequence data storehouse (Goodner etc. from rhizobium melioti (Rhizobium meliloti), Science294,2323-2328 (2001)).Retrieval constitutes (Altschul etc., Nucleic Acid Res., 25,33893402 (1997)) by the tblastn that uses the blosum62 matrix.
Use is cloned in the AS homologue clone who identifies in the Agrobacterium tumefaciens C58 genomic sequence data storehouse from the genomic DNA of Agrobacterium tumefaciens C58 (ATCC No.33970) as template by PCR.Primer below using carries out first round PCR reaction:
5 '-TTATGCCGCCTGTCATCG-3 ' (SEQ ID NO:47) and
5′-ATAGGCTTAATGGTAACCG-3′(SEQ?ID?NO：48)。
The gene magnification parameter is as follows: (a) 95 ℃ of sex change are 30 seconds, (b) 50 ℃ of annealing 30 seconds and (c) 72 ℃ extended 2 minutes, utilize Expand high-fidelity PCR (Roche Biochemicals), instruct according to the manufacturer.
Amplification template that the use previous step obtains and following nested primers carry out another and take turns pcr amplification, obtain the product of the about 2.3Kb of length:
5′-CTGAACAACAGAAGTACG-3′(SEQ?ID?NO：49)
5′-TAACCGTGTCATCGAGCG-3′(SEQ?ID?NO：50)。
The PCR product of purifying is connected to pGEM-T easy (Promega Biotech), obtains plasmid pMON61600 (Fig. 1).Utilize the standard sequence measurement that pMON61600 is checked order.By relatively confirming to obtain correct sequence (Fig. 2) with rhizobium melioti Anthranilate synzyme sequence.The amino acid sequence of translating from the clone who separates (SEQ ID NO:4) has 88% homogeneity (SEQ ID NO:7) (Fig. 2) with the rhizobium melioti enzyme.
Abbreviation " AgroAS " or A.tumefaciens AS are used to refer to Agrobacterium tumefaciens Anthranilate synzyme here simultaneously.
The Bacillus coli expression of Agrobacterium tumefaciens AS
Be built be beneficial to cancer agrobacterium AS gene subclone in suitable expression vector below carrier.
Use prepares 2215 base-pair PCR fragments as the pMON61600 and the following primer of template:
5′-AAAAAGATCTCCATGGTAACGATCATTCAGG-3′(SEQ?ID?NO：51)
5′-AAAAGAA TTCTTATCACGCGGCCTTGGTCTTCGCC-3′(SEQ?ID?NO：52)。
With restriction enzyme NcoI and RsrII digested plasmid pMON61600.In addition, a 409bp fragment (deriving by digest 2215 base-pair PCR products with NcoI and RsrII) is connected in the pMON61600 plasmid of digestion afterwards, thereby displacement NcoI/RsrII fragment, produce NcoI site and Agrobacterium tumefaciens AS translation initiation codon (ATG) in the frame, obtain plasmid pMON34692 (Fig. 3).
(Novogen Inc) produces base T7 colibacillus expression plasmid, pMON34697 (Fig. 4) by using SphI and BamHI restriction digestion pET30a.Purifying obtain 4, the 969bp fragment and with from pET11d (Novogen, 338bp SphI Inc) and BamHI fragment subclone.
By preparing plasmid pMON34705 (Fig. 5) with NcoI and SacI restriction digestion pMON34697.Then purifying obtain 5, the 263bp fragment and be used for self-contained Agrobacterium tumefaciens AS pMON 34692 2, the digestion of 256bp NcoI and Sad fragment.
(Novogen, Inc), plasmid pMON34705 is transformed into e. coli bl21 (DE3) (F-ompTHsdSb (r according to manufacturer's explanation B -m B -) gal dcm (DE3)) in.DE3 comprises host's lysinogen of λ DE3 that isopropyl-1-sulphur-D-galactopyranoside (IPTG) can be induced the chromosome copies of the t7 rna polymerase under the lacUV5 control.
Kanamycin plate to be incubated overnight under 37 ℃ (10 hours) is selected cell transformed.Give 2 milliliters of LB (Luria culture fluids with single colony lift; Every liter, 10 gram tryptones, 5 gram yeast extracts, 10 gram NaCl and 1 gram glucose (optional)) or 2X-YT meat soup (every liter, 16 gram tryptones, 10 gram yeast extracts, 5 gram NaCl), be placed on then that 225rpm shook 3 hours in 37 ℃ of incubators.Take out cell and add 4 microlitre 100mM IPTG, return in 37 ℃ of incubators and cultivated 2-3 hour in addition to culture.Take out 1mL equal portions cell and at ultrasonic processing buffer solution (50mM potassium phosphate (pH 7.3), 10% glycerine, 10mM 2 mercapto ethanol and 10mM MgCl 2) in ultrasonic processing.The cell extract of the dissolving that obtains is the raw material of the standard A S test that describes below.Result's proof can produce soluble enzymic activity Agrobacterium tumefaciens AS protein based on the expression system of plasmid pMON34705, and it accounts for about 50% of total solvable extraction protein.
Embodiment 2: by transforming with wild type Agrobacterium tumefaciens Anthranilate synzyme
Plant is realized high Trp seed level
Expression vector pMON58120
Carrier pMON58120 (Figure 34) coding 264 base-pair mouse ear mustard belong to the fusion (SEQ ID NO:1) between directed peptide (CTP, SEQ ID NO:71) of small subunit (SSU) chloroplast and 2187 base-pair wild type Agrobacterium tumefaciens Anthranilate synzyme (AgroAS) open reading frame.Referring to, Stark etc., (1992) Science 258:287.The expression of this open reading frame is started by soybean 7S α primer (7S α ') promotor.
After the translation, fusion (prematurity protein) is imported in the chloroplast of wherein having removed the chloroplast targeting sequence on cytoribosome.Two cleavage sites are arranged among the CTP1.First site is CDS starting point (C/M) 30 base-pair downstreams, and another is at initial methionine (C/M).Second cleavage site seems not to be effectively handled.Estimate that cutting obtains the mature protein of the about 70Kd with AS activity of enzymic activity data and trp valid data proof.
With the AS gene of the synthetic CP4 genetic transformation of conferring glyphosate resistance, but and the AS gene separately handle the CP4 gene.The FMV promotor starts the CP4 expression of gene, and the FMV promotor is the 35S promoter from Figwort Mosaic virus.Glyphosate makes selects to transform plant.
The Western of AS protein analyzes
35 pMON58120 transformation events are analyzed the AgroAS protein sequence.The polyclonal antibody detection AgroAS protein of the anti-pure His-mark AgroAS that produces with rabbit.The total length Agro-AS polypeptide of His-mark is by CoCalico Biological, and INC. produces the antigen of polyclonal antibody population as rabbit.Reorganization His-mark Agro-AS DNA is inserted in pMON 34701 (pet30a-agroAS) expression vector.In e. coli bl21 (DE3), express the His-AgroAS fusion, and by Ni-NTA resin system (Qiagen protocol) purifying.For protein analysis, with 1: 5,000 dilution factor use rabbit anti--AgroAS one is anti-.With 1: 5,000 dilution factor use goat anti--rabbit alkali phosphatase-coupling two is anti-.In the transgenic lines of carrying 7S α ' Agro AS gene, protein analysis consistently discloses the existence with the single swimming band of anti--AgroAS antibody specificity cross reaction.In the non-transgenic control series, do not detect this swimming band.
Soybean and mouse ear mustard belong to the free amino acid analysis of seed
Amino acid extracts: approximately the soya seeds of 50mg pulverizing (the mouse ear mustard of 5mg belongs to) material is placed in each centrifuge tube.In each sample (belonging to for mouse ear mustard is 100 microlitres), add 1 milliliter of 5% trichloroacetic acid.Allow the sample vortex, leave standstill, at room temperature stirred 15 minutes.Their 14000rpm positions are centrifugal 15 minutes then.Take out some supernatants then, be placed in the HPLC bottle and sealing.Sample remains on 4 ℃ in analyzing row.
Amino acid analysis: the reagent that is used for amino acid analysis comprises the OPA reagent of borate buffer (neighbour-phthaladehyde and 3-mercaptopropionic acid (Hewlett-Packard, PN 5061-3335)), and wherein borate buffer is the 0.4N aqueous solution, and pH 10.2).According to Agilent TechnicalPublication, " using the amino acid analysis of Zorbax Eclipse-AAA post and Agilent 1100HPLC ", on March 17th, 2000 described, and used the serial HPLC of Agilent 1100 system to analyze.At first, the OPA reagent of the sample of 0.5 microlitre and 2.5 microlitres reacts in 10 microlitre borate buffers.Secondly, derivative is annotated 5 microns of Eclipse XDB-C18,4.6 * 150mm post uses the flow velocity of 1.2 ml/min.Utilize the fluoremetry amino acid concentration: 340nm excites, the 450nm emission.Use gradient HPLC buffer A and B wash-out according to Table A, wherein the HPLC buffer A is 40mM Na 2HPO 4, pH=7.8, the HPLC buffer B is 9: 9: 2:: methyl alcohol: acetonitrile: water.
Table A: amino acid wash-out
Time 0 20 21 26 27
The % buffer B 5 65 100 100 100
Use interested all amino acid from dry chemistry product preparation amino acid reference material.The proline analysis requires to use the other derivatization step of 9-fluorenyl methyl-chloro-formate (FMOC).Sometimes also buy the amino acid reference material of 0-100 mcg/ml concentration range.With microgram/gram seed meal report sample.Use MS excel spreadsheet lattice to calculate MynabirdTMBROW＞Public＞Calculators＞External Standard.Xls.
The expression of wild type agrobacterium Anthranilate synzyme in mouse ear mustard belongs to
Vacuum infiltration by excitability fluorescence is transformed into carrier pMON 58120 in the mouse ear mustard, makes plant generate transgenic seed.Collect the existence of seed and screening selectable marker (glyphosate resistance).The glyphosate resistance plant growing generates seed to ripe and each plant, and this specifies a transformation event, analyzes tryptophane (table B).Also the transformation event of selecting is analyzed the existence of the agrobacterium Anthranilate synthetase protein of expressing in the mature seed by western blot analysis shown in table B.
Table B: transformant analysis
Transformation event Trp(ppm) The protein that exists
7317 2547 +
7315 2960 +
7319 3628 +
7313 3979 +
The expression (glycine maximum) of wild type agrobacterium Anthranilate synzyme in soybean
Have in 35 soybean transformation events analyzing that the trp level improves in 33 its seeds, for example, from being higher than 500ppm to maximum 12,000ppm.In the non-transgenic soya seeds, the trp level is lower than 200ppm.The Western blotting proof contains all seed expression Anthranilate synzyme of high-load trp.Table C provides the data with 19 soybean results that high trp level and western blot analysis also be positive to Anthranilate synzyme Anthranilate synthetase protein.
Table C:19 carries Agro AS protein in the soybean transgene incident of pMON58120
Existence and the relation between the tryptophan levels
Pedigree Trp maximum (ppm) Trp mean value (ppm) Is there protein?
A3244(ctr) 306 96 Not
GM_A20380：@. 6444 2246.4 Be
GM_A20532：@. 6055 2556.6 Be
GM_A22043：@. 10422 2557.2 Be
GM_A20598：@. 8861 2859.9 Be
GM_A20744：@. 7121 3373.3 Be
GM_A20381：@. 6392 3572.9 Be
GM_A20536：@. 9951 3581.5 Be
GM_A20510：@. 8916 3592.7 Be
GM_A20459：@. 8043 3900.4 Be
GM_A20337：@. 7674 4088.6 Be
GM_A20533：@. 9666 4183.2 Be
GM_A20577：@. 6276 4434.1 Be
GM_A20339：@. 9028 4687.8 Be
GM_A20386：@. 8487 5285.3 Be
GM_A20457：@. 11007 5888.9 Be
GM_A20379：@. 7672 6416.1 Be
GM_A20537：@. 9163 6695.8 Be
GM_A20534：@. 12676 7618.2 Be
GM_A20576：@. 10814 7870.1 Be
The test of Agro AS enzyme
11 transformation events that carry the pMON58120 construct are measured the specific activity of Anthranilate synzyme.With C.Paulsen (J.Chromatogr.547,1991,155-160) described method for the basis use HPLC to analyze each prematurity soya seeds as the terminal test on basis.In brief, at grinding buffer solution (100mM Tris pH7.5,10% glycerine, 1mM EDTA, 1mM DTT) obtain desalting extracted liquids from various seeds in, and with reaction buffer (100mMtris pH 7.5,1mM branch acid esters, 20mM glutamine and 10mM MgCl 2) incubation 30 minutes.Exist or do not exist 25mM trp to measure Agro AS activity down.Use the phosphoric acid cessation reaction, and use 340nm/ to excite the amount of passing through the Anthranilate of HPLC quantitative assay formation with the fluorescence detector of 410nm/ emission setting.
Compare with the non-transgenic seed, the specific activity scope that prematurity separates AS in the transgenic seed improves 1.5-doubly to 70-times, reaches 6, and 000pmoles/mg/min is high like this.As show shown in last hurdle of D, the Anthranilate synthase activity has resistance (referring to table D) to the tryptophan inhibitory action in the genetically modified plants.
Table D: the Agro AS enzymic activity in the transgenic event 20576
Incident The seed numbering Specific activity (pmoles/mg/min) Specific activity (pmoles/mg/min) (+25micromolar Trp)
Contrast 3244-1 95.4 42.4
Contrast 3244-2 85.5 40.6
20576 20576-1 6060.2 4407.1
20576 20576-2 3783.8 1709.4
20576 20576-3 2768.3 2431.7
20576 20576-4 4244.08 2125.2
Embodiment 3: the carrier that comprises corn Anthranilate synthetase alpha-subunit gene is to greatly
The conversion of beans
By with XbaI digestion bound fraction NcoI digestion (referring to Anderson etc., United States Patent (USP) 6,118,047), separate the coded sequence of corn Anthranilate synthetase alpha-subunit from pMON52214 (Figure 22).The 1952bp dna fragmentation of the representative Anthranilate synzyme code area that obtains carries out gel-purified, and end is become flush end.With BglII and EcoRI digested plasmid pMON53901 (Figure 23), obtain the 6.8Kb fragment.After separating becomes the end of 6.8Kb fragment into flush end and dephosphorylation.Make the 1952Kb fragment that comprises AS α gene connect flush end 6.8kb pMON53901 fragment then, produce pMON 39324, a kind of corn 7SP-AS α-NOS expression vector (Figure 24).
Then digest this pMON39324 with BamHI, corn 7SP-AS α-NOS box obtains comprising the 2.84Kb dna fragmentation of 7S promotor and corn AS α coded sequence.With BamHI digested plasmid pMON39322 (Figure 25), obtain the 5.88kb dna fragmentation.Then these two fragments are linked together and obtain pMON39325 (Figure 26), the conversion carrier that comprise 7S promotor-corn AS α-NOS terminator box of a kind of subclone in the pMON39322.
Use similar approach, sequence from USP promotor downstream clones coding corn Anthranilate synthetase alpha-subunit, produce the pMON58130 expression vector, clone from Arc5 promotor downstream, obtain the pMON69662 expression vector,, obtain the pMON69650 expression vector from Lea9 promotor downstream clone, from Per1 promotor downstream clone, obtain the pMON69651 expression vector.Table E provides these expression vector tabulations.
Table E:C28-corn Anthranilate synzyme construct
Seed generation Expression cassette Container name
R4 7Sa '-corn-AS α PMON39325
R2 Napin-corn-AS α PMON58023
R1 USP-corn-AS α PMON58130
R1 Arc5-corn-AS α PMON69662
R1 Lea9-corn-AS α PMON69650
R1 Per1-corn-AS α PMON69651
These carriers are used for Plant Transformation and multiply test.Use microparticle bombardment technology described herein, with the corn carrier soybean transformation plant that comprises AS.Set up several genetically engineered soybean strains for every type of carrier, and the breeding of going down to posterity several times, shown in table E.
For example, set up three and carry the genetically modified strain of isozygotying from 7S α '-corn-AS of pMON39325.In two different these three systems of place randomization section design plantation.Obtain mature seed and analyzing free amino acids content.Benchmark trp level is determined in contrast, promptly bears the contrast of isogram and non-transgenic accordingly for three.
Table F provides for pMON39325 transformant and control series R4 seed tryptophan, represents with ppm, prove that average non-transgenic soybean contains about 100-200 microgram tryptophan/gram seed meal, and the pMON39325 transformant contains more Trp basically.Also referring to Figure 27.
Table F: with the Trp level in the soybean plant seed of C28 maize mutant body (pMON39325) conversion
Positive isogram number The positive average trp of isogram (ppm) Standard deviation The average trp (ppm) of respective negative isogram Standard deviation
39325-1 3467 377 226 55
35325-2 2623 307 164 20
35325-3 3715 152 184 64
35325-4 2833 165 202 146
35325-5 3315 161 173 34
35325-6 2394 318 144 22
Non-transgenic contrast-7 191 24
Non-transgenic contrast-8 118 23
Five kinds of other constructs of expressing C28 corn Anthranilate synzyme under the control of five kinds of different promotors (table E) are transformed in the soybean, obtain genetically modified plants.Each construct produces the result of high trp.Table G and H provide the result's that the Per1-C28 corn Anthranilate synzyme of detailed description produces embodiment.
Show G:C28 corn AS protein expression and carry Per1-C28 corn AS (pMON69651)
Three transgenic events in the relation of the Trp level that improves
Pedigree Trp mean value (ppm) Whether there is protein
Contrast 96 Not
22689 2375 Be
22787 1707 Be
22631 1116 Be
Table H describes the enzymic activity with C28 corn AS in the R1 seed of the soybean plant strain of pMON69651 expression vector conversion in detail.
The specific activity of C28 corn AS in the R1 seed of table H:pMON69651 transformant.
Incident The seed numbering Specific activity (pmoles/mg/min) Specific activity (pmoles/mg/min) (+25micromolar Trp)
Contrast 51.6 2.6
22689 22689-1 130.9 64.7
22689-2 115.3
22689-3 148.5 61.1
22689-4 149.5
22698-5 133.8 60.3
These results show that tryptophan increases greatly when organizing with C28 corn AS genetic transformation bean plant.The existence of high trp level and AS protein shown in the table G and with for the specific activity of the raising of transgenosis enzyme (contrast than non-transgenic high 2.5 times) relevant (showing H).As show shown in the H-and as the biochemical property of C28 corn AS enzyme estimate-specific activity of transgenic event is the tryptophan resistance.
Embodiment 4: Agrobacterium tumefaciens Anthranilate synzyme tryptophan feedback is insensitive
The appropriate design of mutant.
This embodiment describes and comprises the carrier to tryptophan or tryptophan analog feedback inhibition sensitivity or insensitive mutant Agrobacterium tumefaciens Anthranilate synzyme that has in various degree.
The generation of Agrobacterium tumefaciens mutant Anthranilate synthase gene.
Be used to from the protein structure information of sulfolobus solfataricus (Sulfolobus solfataricus) Anthranilate synzyme as instructing (Knochel etc., Proc.Natl.Acad.Sci.USA, 96,9479-9484 (1999)), utilize the protein information of several residues that relate in the combination of sure design tryptophan, several Agrobacterium tumefaciens Anthranilate of appropriate design synthase mutant.By making Agrobacterium tumefaciens Anthranilate synthase gene and comparing (Fig. 6) from the Anthranilate synzyme amino acid sequence of sulfolobus solfataricus and realize.Tryptophan combination and catalytic domain by integrated structure information and sequence homology sex knowledge derivation Agrobacterium tumefaciens.Residue in the binding pocket is accredited as change so that the possible candidate to the resistance of the feedback inhibition of tryptophan to be provided.
Based on the structural analysis of sulfolobus solfataricus Anthranilate synzyme, propose to relate to amino acid E30, S31, I32, S42, V43, N204, P205, M209, F210, G221, and A373 in the tryptophan combination.Based on to comparison, the N204 of sulfolobus solfataricus, respectively as residue N292, P293 and F298 also guard in monomer Anthranilate synzyme for P205 and F210.
But, because insert many places and disappearance, the N-end region height divergence of sulfolobus solfataricus and Agrobacterium tumefaciens enzyme.Because this reason needs the artificial residue (Fig. 6) that designs the N-end region of the Agrobacterium tumefaciens Anthranilate synzyme that relates in the tryptophan adjusting.Structural analysis shows that motif in the tryptophan binding pocket " LLES " forms beta sheet.Show this structure high conservative in different tetramer enzyme.Use " LLES " motif as boundary mark then, with known monomeric enzyme and the manual comparison of sulfolobus solfataricus sequence (Figure 21).Based on this protein information analysis, relate to the amino acid residue V48 among the Agrobacterium tumefaciens AS in the tryptophan combination too, S50, S51, and N52.
The tryptophan that uses the derivation of comparing in the Agrobacterium tumefaciens monomeric enzyme is in conjunction with residue, and for reducing enzyme to the inhibiting susceptibility of tryptophan, several different strategies are rational.These replacements comprise, for example, enlarge tryptophan-binding pocket (F298A), constriction binding pocket (V48F, V48Y, S51F, S51C, N52F, F298W), improve binding pocket polarity (S50K), or by change the protein main chain conformation change the binding pocket proterties (P293A, P29G).
Agrobacterium tumefaciens AS direct mutagenesis
Utilize direct mutagenesis to produce 10 monamino acids and replace 6 sites.Utilize Quik ChangeTM direct mutagenesis kit (Stratagene), will suddenly change imports among the Agrobacterium tumefaciens ASpMON34705.The primer that is used for direct mutagenesis is SEQ ID NO:9-42 (Fig. 7; The F=forward, R=is reverse).Each primer sequence is specific for the change of specific location nucleic acid in the sequence, therefore changes new amino acid whose coding password of coding.For example, S51 C refers to that amino acid position 51 place's serines become cysteine in the Agrobacterium tumefaciens AS peptide sequence.
After the mutagenesis, reaffirm the sequence of whole gene, and as hereinafter for as described in the wild-type enzyme from Bacillus coli expression variant and purifying.Use embodiment 1 described T7 expression system, the plasmid that obtains that will comprise mutant Agrobacterium tumefaciens AS suitably is cloned in the plasmid of excess production protein.
Agrobacterium tumefaciens AS protein expression and purifying
Described according to embodiment 1 at expression in escherichia coli Agrobacterium tumefaciens AS wild type and mutant enzyme.All Agrobacterium tumefaciens AS enzymes comprise that the purifying of wild type and mutant thereof carries out under 4 ℃.(the 50mM potassium phosphate, pH 7.3,10mM MgCl to be suspended in 20ml purifying buffer solution for cell (about 1 gram of weight in wet base) 2, 10mM 2 mercapto ethanol, 10% glycerine) in, and ultrasonic processing dissolving (Branson sonifier Cell Disruptor, W185).Homogenate is with 20, and 000xg collects supernatant after centrifugal 15 minutes.Supernatant is carried out ammonium sulfate fractionated method (30 to 65% is saturated).With 20, collecting precipitation and being dissolved in the 3ml purifying buffer solution after centrifugal 15 minutes of the 000xg afterwards, all is loaded on the Econo-Pac 1 ODE desalination pillar, and pillar is with identical buffer solution pre-balance mistake.Contain the fraction and the merging of enzyme by the development analyzing and testing.The enzyme (4.3 milliliters) that merges loads gives 10ml DEAE Sephacel (Pharmacia Biotech) pillar of crossing with identical buffer solution balance (1.5 * 7.5cm).With 30ml purifying buffer solution flushing pillar, and with the 50mM NaCl wash-out enzyme of 30ml in the same buffer.Merge the fraction contain high AS activity and with 65% saturated ammonium sulfate precipitation and separation, and desalination as mentioned above.Merge the fraction and the preservation under-80 ℃ that contain enzyme.
The Anthranilate synzyme is measured and dynamic analysis
Under 25 ℃, containing the 100mM potassium phosphate, pH 7.0,10mM MgCl 2, the 1mM dithiothreitol (DTT) carries out standard analysis to Agrobacterium tumefaciens AS in the assay buffer of 200 μ M branch's acid esters and 10mM L-glutamine.Begin reaction by enzyme and the mixing that in reactant mixture, adds 30 microlitres.Increase the formation 3 minutes of directly monitoring Anthranilate by the 320nm trap.The slope that changes the reaction time with trap is a basic calculation reaction initial velocity, with the per second trap unit of rising to.Total measurement (volume) be 1ml contain 100mM potassium phosphate, pH7.0,10mM MgCl 2, the 1mM dithiothreitol (DTT), and measure the Km (K of branch's acid esters between 10mM L-glutamine and the 2.5-100pM branch acid esters in the assay buffer of branch's acid esters of variable concentrations m Cho).Total measurement (volume) be 1ml contain the 100mM potassium phosphate, pH 7.0,10mM MgCl 2, 1mM dithiothreitol (DTT), the K of mensuration glutamine in the assay buffer of the L-glutamine of the variable concentrations between 200 μ M branch's acid esters and the 0.1-2mM L-glutamine m(K m Gln).Total measurement (volume) be 1ml contain the 100mM potassium phosphate, pH 7.0,10mM MgCl 2, 1mM dithiothreitol (DTT), 10mM L-glutamine, the IC of mensuration tryptophan in the assay buffer of the L-tryptophan of the variable concentrations between 200 μ M branch's acid esters and the 0.1-10mM L-tryptophan 50(IC 50 Trp).Calculate kinetic parameter and the IC of AS after data and the non-linear regression match 50(GraFit).
Several mutant proofs still keep the enzymic activity (Table I) that is comparable to wild-type enzyme simultaneously to the inhibiting susceptibility that reduces of tryptophan.These result's proofs can be lowered tryptophan inhibitory action sensitivity level, for example, and by the amino acid in the tryptophan binding pocket of mutagenesis Anthranilate synzyme with by optimizing the sudden change of proof feedback insensitivity.
Table I: Anthranilate synthase activity and tryptophan are to the effect of Agrobacterium tumefaciens AS mutant
Sudden change Codon K m Cho (μM) K m Gln (mM) k cat(s -1) .k cat/K m Cho (μM -1s -1) IC 50 Trp (μM)
WT V48F V48Y S50K S51F S51C N52F P293A P293G F298A F298W TTT TAT AAG TTC TGC TTC GCG GGG GCC TGG 8.0 4.5 4.2 13 10 2.8 5.5 24 33 9.2 18 0.11 0.08 0.10 0.01 0.06 0.08 0.04 0.16 0.07 0.10 0.14 0.43 0.24 0.18 0.13 0.08 0.15 0.21 0.35 0.48 0.46 0.44 5.37×10 -2 5.33×10 -2 4.28×10 -2 1.00×10 -2 0.80×10 -2 5.36×10 -2 3.82×10 -2 1.46×10 -2 1.45×10 -2 5.00×10 -2 2.44×10 -2 5 150 650 0.1 ＞32,000 1,500 41 14 17 5.5 450
Embodiment 5: produce the random mutagenesis that tryptophan feeds back the Agrobacterium tumefaciens AS of insensitive mutant
Except the appropriate design scheme that embodiment 4 describes, other strategies that produce the feedback insensitivity mutant of Anthranilate synzyme include but not limited to mutagenesis immediately.For example, by mutagenesis (separated DNA or whole organism), fallibility PCR and DNA reorganize, and can realize the random mutagenesis of Agrobacterium tumefaciens AS.This embodiment has described the utilization of mutagenesis, then genescreen.The genescreen method also is useful for the selection of the mutant of the expectation that obtains from other induced-mutation techniques.
Contain the preparation of the colibacillus expression plasmid of Agrobacterium tumefaciens AS
The open read frame (the SEQ ID NO:1 of embodiment 1 description) that uses the primer that comprises the Xba1 site on Nco1 site and the reverse primer 3 ' end on forward primer 5 ' end to clone pMON61600 from Agrobacterium tumefaciens AS by pcr amplification:
5 '-CATCCCATGGATGGTAACGATCATT CAGGAT-3 ' (SEQ ID NO:55); With 5 '-GATGTCTAGAGACAC TATAGAATACTCAAGC-3 ' (SEQ ID NO:56).
The PCR product that obtains is connected to (Figure 28) among the pMON25997, and it has the bktB open read frame of removing by with BspH1 and Xba1 digestion (Slater etc., J.Bact.180, p1979-1987 (1998)), produces plasmid pMON62000 (Figure 29).PMON62000 is basic plasmid, is used for the mutagenesis of tryptophan auxotroph and replenishes (EMG2 Δ trpE).
The preparation of Escherichia coli tryptophan auxotroph EMG2 Δ trpE
Use suicide vector pKO3 to make up coli strain (EMG2 Δ trpE) from Chromosome t rpE gene delection 1,383 base-pair of coli strain EMG2 (K-12wt F+) (E.coliGenetic Stock Center).Two amplicons of pcr amplification bacillus coli gene group DNA.First amplicon approximately is the preceding 30bp that 1.5kb and 3 ' end comprises trpE ORF.Comprise a BamH1 s site at amplicon at 5 ' end, comprise an EcoR1 site at 3 ' end.Second amplicon approximately is 1kb and the back 150bp that comprises trpE ORF at 5 ' end.This amplicon comprises an EcoR1 site at 5 ' end, comprises a Sa11 site at 3 ' end.Link together with two amplicons of suitable enzymic digestion and in the EcoR1 site, produce the in-frame deletion of trpE.Figure 30 provides the sequence (SEQ ID NO:46) of the truncated gene that obtains.TrpE disappearance amplicon is connected among the pKO3 at BamH1 and Sa11 site.According to A.J.Link etc., J.Bacteriol, 179,6228 (1997) describedly carry out the gene cutting.
PMON62000 replenishes Escherichia coli tryptophan auxotroph EMG2 Δ trpE's
Cultivate with pMON62000 transformed into escherichia coli bacterial strain Ec-8 (EMG2 Δ trpE) and at M9 minimal medium upper flat plate, determine to add pMON62000 and whether replenish disappearance.Plasmid contrast (lacking Agrobacterium tumefaciens AS insert) and contrast strain Ec-8 also cultivate and cultivate at the M9 minimal medium upper flat plate that 40 mcg/ml tryptophans are arranged at M9 minimal medium upper flat plate.
In the bacterial strain Ec-8 growth that does not have to find on the M9 of tryptophan that pMON62000 transforms, growth is not found in contrast, show that pMON62000 has compensated the trpE disappearance of Ec-8 bacterial strain.
The azanol mutagenesis of pMON62000 and the genetic screening of mutant
In order to prepare the mutant of Anthranilate synzyme, with chemical mutagen azanol mutagenesis pMON62000.Composition below mixing in microcentrifugal tube: 20 microgram pMON62000 plasmid DNA and 4O microlitre 2.5M azanol, pH 6.0.Use 0.1M NaH 2PO 4, pH6.0+5mM EDTA, pH 6.0 make volume reach 200 microlitres.Test tube is at 70 ℃ of following incubations.1.5 after hour, at about 500ml H 2Dialysis 100 microlitre reactant mixtures on the last floating NC Nitroncellulose filter of O.After 15 minutes, use Qiagen PCR purification kit concentration of DNA.After 3 hours, take out and the remaining 100 microlitre reactant mixtures of purifying with identical method.
Then by the pMON62000 transformed into escherichia coli strain Ec-8 of electroporation with the 100ng that uses azanol mutagenesis 1.5 or 3 hours.Each time point carries out this two Transformation Program.Reclaim transformant 4 or 6 hours in the SOC medium (20g/L Bacto-tryptone, 5g/L Bacto yeast extract, 10ml/L 1M NaCl, 2.5ml/L 1M KCl, 18g glucose).
Preparation contains the M9 minimal medium, adds two 245mm square biometric test plate (panel)s of 2% agar and 50 mcg/ml 5-methyl DL-tryptophans (5-MT).All the other 100 microlitres are added on the M9 control board.The transformation mixture that contains 3.0 hours mutagenesis plasmids is implemented identical program.
Then with plate about 2.5 days of 37 ℃ of following incubations.From 5-MT plate separation resistance bacterium colony and streak inoculation to LB-kanamycin (50 mcg/ml) plate, the existence of the basic grain of card.The bacterium colony of all selections is grown on these plates.Prepare each bacterium colony of each resistance clone of double, separation quality grain.Carry out restrictive diges-tion and PCR and prove that all clones contain the Agrobacterium tumefaciens AS insert of expectation.
The plasmid of being rescued transforms back among the bacterial strain Ec-8 then.By being scoring to the each bacterium colony that transforms of purifying on the new LB-kanamycin plate.In order to prove the resistance to 5-MT, the bacterium colony of each purifying is scoring to and contains on the plate that M9 adds 50 mcg/ml 5-MT and 2% agar, cultivates 3 days down at 37 ℃ then.The great majority clone has resistance.For determine in addition higher 5-MT concentration under resistant mutants whether keep resistance, they are cultivated at the plate upper flat plate that M9 adds 300 mcg/ml 5-MT and 2% agar.The great majority clone also confirms to have resistance under this high concentration.
From all resistance clone separation quality grains and to two chain order-checkings.The table J in graphical presentation some sudden changes of this experiment.
Agrobacterium tumefaciens trpEG sequence variation in the table J:5-MT resistance clone
Database clone # Original clone # The sequence variation that records K m cho (μM) IC 50 trp (μM)
Wt 8.0 5.0
Ec-12 1 G4A?Val2He
Ec-18 8 C35T?Thr12Ile 15 2.5
Ec-19 9 C2068T?Pro690Ser 5.0 3.4
Ec-20 11 G1066A?Glu356Lys?&?C1779T?Ile593Ile
As show shown in the data among the J, several mutant are to the K of mutant enzyme mAnd IC 50Almost not influence shows that these sudden changes may not be the sources to the resistance of tryptophan feedback inhibition.For example, 35 nucleotide sport T from C, and it becomes isoleucine (Thr12Ile), K with 12 amino acids from threonine m ChoAnd IC 50 TrpValue changes very little.Similarly, 2068 nucleotide sport T from C, and it becomes serine with proline, K m ChoAnd IC 50 TrpValue changes very little.Therefore these sudden changes may be that " silence " suddenlys change, and obtain having the variant gene product with those the same zymologic properties of wild type.
Embodiment 6: high tryptophan genetically engineered soybean plant
This embodiment describes owing to use tryptophan from the Anthranilate synzyme of Agrobacterium tumefaciens to feed back the preparation of the genetically engineered soybean plant of the tryptophan levels that insensitive mutant conversion has raising.
Vector construction
With restriction enzyme NotI digested plasmid pMON34711, this plasmid carries the Anthranilate synzyme clone of the Agrobacterium tumefaciens that contain the F298W sudden change of embodiment 4 descriptions.Digest with NcoI after the end of the fragment that obtains become flush end.Use limiting enzyme EcoRI digested plasmid pMON13773 (Fig. 8) then, digest with NcoI behind the terminal flush end.Connect the fragment that obtains, obtain plasmid pMON58044, it comprises the AS gene (Fig. 9) under 7S promotor and the control of NOS3 ' terminator.
Use restriction enzyme BglII and NcoI digested plasmid pMON58044 then, and be connected with the fragment that digests pMON53084 (Figure 10) generation with BglII and NcoI.The fragment called after pMON58045 (Figure 11) that obtains, and comprise the sequence that mouse ear mustard belongs to the SSU1A transit peptides.
At last, make up plasmid pMON58046 (Figure 12) by being connected with the fragment that restriction enzyme NotI digestion pMON58045 (Figure 11) and pMON38207 (Figure 13) produce.Obtain pMON58046 carrier (Figure 12), it is used for soybean and transforms.
By the microparticle bombardment soybean transformation
About the microparticle bombardment method for transformation, (that is, Asgrow A3244 A4922) germinates and to spend the night excision meristematic tissue explant about 18-24 hour to be purchased soya seeds.Remove primary leaf and expose meristematic tissue and explant is placed the target medium, meristematic tissue is positioned at particulate and send the vertical direction of passing direction.
Use CaCl 2On the spermidine goldc grains that above-mentioned pMON58046 conversion carrier receiving electrode is small, then be suspended in ethanol again.By to the Mylar thin slice, this thin slice is placed on the electric discharge device then with the suspension bag.By make particulate quicken to enter plant tissue with about 60% capacitor discharge.
After the bombardment, the tissue culture explant is placed on selects medium (WPM+0.075mM glyphosate) (WPM=Woody plant medium (McCown ﹠amp; Lloyd, Proc.InternationalPlant Propagation Soc., 30:421,1981) deduct BAP)) in cultivate 5-7 week, select and the render transgenic blastogenesis long.Approximately 5-7 week gather in the crops the bud that phenotype is positive after the bombardment, and be placed on 2-3 week in the selectivity root media (BRM+0.025mM glyphosate) (vide infra) for the prescription of BRM.The bud that to take root is transferred in the greenhouse and is planted in soil.But the keep fit during selection bud of not taking root is transferred in the non-selective root media (BRM that does not have glyphosate) grew for two weeks in addition.Before in transferring to the greenhouse, planting in soil, to break away from select to take root analyze the expression of plant selectable marker from the root of any blastogenesis.Plant is retained under the standard greenhouse experiment up to results R1 seed.
Provide the prescription that is used for bean or pea root media (BRM) below.
Compound Amount for 4L
MS salt * * * 8.6g
Myo-inositol (cell culture level) 0.40g
SBRM vitamin stoste * * 8.0ml
L-cysteine (10mg/ml) 40.0ml
Sucrose (super alcohol) 120g
Regulate pH to 5.8
Washed agar 32g
Add after the autoclaving:
SBRM/TSG hormone stoste * 20.0ml
* SBRM/TSG hormone stoste (every 1L BRM): 3.0ml IAA (0.033mg/ml), 2.0ml sterile purified water.4 ℃ of following lucifuges are stored stoste.
* SBRM vitamin stoste (every 1L stoste): glycine (1.0g), nicotinic acid (0.25g), hydrochloric acid vitamin B-6 (0.25g), aneurin hydrochloride (0.25g).
* * 3X MInor MS salt (every 1L stoste): H 2BO 3(1.86g), MnSO 4(5.07g), ZnSO 4-H 2O (2.58g), KI (0.249g), 7.5 microlitre NaMoO-2H 2O (1.0mg/ml), 7.5 microlitre CoSO 4-5H 2O (1.0mg/ml), 7.5 microlitre CoCl 2-6H 2O (1.0mg/ml).
Once add a kind of composition and dissolving, add sterile purified water and make volume reach one liter, solution is stored in the bottle that paillon foil covers in the refrigerating box and is no more than one month.
Use the Agrobacterium tumefaciens soybean transformation
For agrobacterium transformation method, (Asgrow A3244, A4922) germination is spent the night (approximately 10-12 hour) and is excised the meristematic tissue explant to be purchased soya seeds.Primary leaf can be removed also and can not be removed, and meristematic tissue and explant are placed in the wound container.
The agrobacterium strain ABI that contains interested plasmid grows to logarithmic phase.Centrifugal cell harvesting and being suspended in again in the inoculation medium that contains derivant.The soyabean tissue's culture of isolated piece and the agrobacterium culture of inducing mix, and are no more than from seed sprouting 14 hours, and utilize ultrasonic wound.
After the wound, the tissue culture explant was grown in agrobacterium about 1 hour.After the inoculation step, inhale and to move agrobacterium, and the tissue culture explant is placed in the coculture 2-4 days.At this moment, they are transferred to selection medium (antibiotic of WPM+0.075mM glyphosate+control agrobacterium excess growth) 5-7 week, selection and render transgenic blastogenesis are long.
Approximately 5-7 week gather in the crops the bud that phenotype is positive after the bombardment, and be placed on 2-3 week in the selectivity root media (BRM+0.025mM glyphosate).The bud that to take root is transferred in the greenhouse and is planted in soil.But the keep fit during selection bud of not taking root is transferred in the non-selective root media (BRM that does not have glyphosate) grew for two weeks in addition.Before in transferring to the greenhouse, planting in soil, to break away from select to take root analyze the expression of plant selectable marker from the root of any blastogenesis.Plant is retained under the standard greenhouse experiment up to results R1 seed.
The analysis of amino acids of R1 seed
Prepare ripe R1 seed and use the fluoroscopic examination analyzing free amino acids content of describing among the Agilent Technologies TechnicalBulletin REV14.Each seed analysis of each result is selected 5 seeds.The soya seeds of expressing AgroAS F298W or AgroAS S51F mutein produces the very tryptophan of high-load.Table K and L provide the result.
Table K: with the protein expression in the seed of pMON58046 conversion
Pedigree Trp mean value Whether there is protein
Contrast ?96 Not
22817 ?9922 Be
22891 ?12955 Be
23026 ?7968 Be
The relation of table L:AS protein expression and pMON58123 transformant
Pedigree Trp mean value Whether there is protein
Contrast 96 Not
23562 88 Not
23590 8795 Be
23911 388 Be
AS enzymic activity in the R1 seed that Agro AS transforms
Prepare ripe R1 seed and analyze the Anthranilate synthase activity.Mensuration is carried Anthranilate synzyme enzymic activity in the R1 soya seeds of Agro AS F298W (SEQ ID NO:65 or 91) or Agro AS S51F (SEQ ID NO:60 or 86) mutant allele.Find very high-caliber tryptophan resistance Anthranilate synthase activity, consistent with the high-load tryptophan that these seeds produce.Table M and N provide the result.
Table M: with the specific activity of AS in the R1 seed of pMON58046 conversion
Incident The seed numbering Specific activity (pmoles/mg/min) Specific activity (pmoles/mg/min) (+25mcromolar Trp)
Contrast 77.6
23076 23076-1 100.5 1.04
23076-2 4512.8
23076-3 9737.4 9290.4
23076-4 136.12
23076-5 8992.5 9749.9
Table N: with the specific activity of AS in the R1 seed of pMON58123 conversion
Incident The seed numbering Specific activity (pmoles/mg/min) Specific activity (pmoles/mg/min) (+25mcromolar Trp)
Contrast 83.7 32.7
23590 23590-1 891 692.3
23590-2 466.2 186.5
23590-3 71.7 38.3
23590-4 320.5 316.2
Embodiment 7: comprise the preparation of the conversion carrier of rue Anthranilate synthetase alpha-subunit
α gene (Genbank registration number No.GI960291) from rue Anthranilate synzyme provides another Anthranilate synthetase structure domain (Bohlmann, J etc., Plant Phys111507-514 (1996)) useful among the present invention.A kind of isoenzymes proof of the Anthranilate synzyme that exists in the rue genome is to the less neurological susceptibility of L-tryptophan feedback inhibition.This allelomorph can be used for improving free L-tryptophan levels in the genetically modified plants in the present invention.Carrier pMON58030 (Figure 14) comprises the α-subunit of rue Anthranilate synzyme, and it is less to tryptophan inhibitory action susceptibility.From the α gene of pMON58030PCR amplification rue Anthranilate synzyme, the PCR primer that comprises these two restriction enzyme sites by use is introduced the BamHI site and is introduced the BglII site at 3 ' end at 5 ' end of the alpha gene fragment of rue Anthranilate synzyme:
5 '-CAAAAGCTGGATCCCCACC-3 ' (SEQ ID NO:53) and
5’-CCTATCCGAGATCTCTCAACTCC-3’(SEQ?ID?NO：54)。
This PCR fragment of purifying, and use the respective limits enzymic digestion, obtaining pMON58041, it comprises the fusion of transcribing of rue AS α and napin promotor.Preparation comprises the napin promotor, rue AS, NOS terminator, glyphosate resistance (CP4), the agrobacterium-mediated Plant Transformation plasmid of the edge of selectable marker and the suitable suitable chromosomal integration of described box, pMON58043.Utilize the technology of standard Plant Transformation described in embodiment 2,3 and 6, transform plant with the plant conversion carrier that obtains.
Embodiment 8: a plurality of polypeptide Anthranilate synzyme are transformed in the monomer single polypeptide Anthranilate synzyme
Expectation is by the monomer Anthranilate synzyme of the fusion generation of many subunits enzyme of selection, for example reach the catalytic efficiency maximization, stablize this enzyme, realize for example having the synchronous expression of the subunit of TrpE and TrpG activity, and the effective transfection between two subunits.In some cases, by the standard induced-mutation technique or by front embodiment embodiment 4 described appropriate design for example, usefully use from plant or microbe-derived TrpE or α subunit, feedback inhibition aspect, described source is not regulated.In other cases, use from plant or microbe-derived wild type TrpE or α subunit.
The TrpE that selects or the C-of α subunit terminal connection of terminal N-, preferably use peptide linker with TrpG or β subunit.Can appropriate design joint, for two subunits suitably comparison provide suitable space with compliance.Perhaps, can identify joint by the sequence alignment of monomer and different tetramer Anthranilate synzyme.Figure 21 and 35 provides the example of the sequence alignment of the monomer of formation and different tetramer Anthranilate synzyme.Also finding needs to produce the monomer Anthranilate synzyme that comprises the allos subunit for the interests maximization.For example, from bacterial origin, for example Escherichia coli can obtain the α subunit, and with from plant for example the mouse ear mustard β subunit that belongs to the source merge.
For example, according to embodiment 2,3 or 6, the new protein that produces can be imported plant.The present invention is not limited to given and described detail.Understand in the spirit and scope of claims definition and can much change and modify.
Embodiment 9: from the evaluation of the Anthranilate synzyme in genomic sequence data storehouse
By for example using BLAST (www.ncbi.nlm.nih.gov/blast/) retrieval GenBank and/or swissprot database, by bioinformatic analysis, can identify monomer Anthranilate synzyme useful among the present invention and α and beta structure territory.Be used to identify that the search sequence of monomer Anthranilate synzyme comprises, for example, Anthranilate synthetase structure domain from sulfolobus solfataricus (Sulfolobus solfataricus), for example αJie Gouyu (GI1004323) or beta structure territory (GI1004324), perhaps monomer Anthranilate synzyme, for example Agrobacterium tumefaciens AS (GI15889565).The monomer Anthranilate synzyme of deriving and the autoploidy of search sequence and should minimumly contain 700 amino acid between 50% and 100%.If use AS-αJie Gouyu query gene group database, except identifying the Anthranilate synthase gene of deriving, also may identify the gene that PABA synthesis example such as 4-amino-4-deoxidation branch acid esters (ADC) synzyme relates in synthetic.With the amide transferase domain (beta structure territory) of ADC synzyme at the N-of protein end and the amide transferase domain (beta structure territory) of AS on the terminal such basis that is viewed as of C-, can easily the monomer A S gene of monomer A DC synthase gene and derivation be distinguished and come.The monomer Anthranilate synzyme that uses among the present invention by the bioinformatic analysis evaluation includes but not limited to, for example rhizobium melioti (Rhizobium meliloti) (GI95177), Mesorhizobium loti (GI 13472468), Bacterium melitense (Brucella melitensis) (GI 17982357), (GI 17227910 for beads cyanobacteria (Nostoc sp.) PCC7120, GI 17230725), Azospirillum brasilense (Azospirillumbrasilense) (GI 1174156), color Rhodopseudomonas (Rhodopseudomonaspalustris), fish raw meat cyanobacteria (Anabaena) M22983 (GI 152445).Figure 21 is two the monomer Anthranilate synzyme (Agrobacterium tumefaciens and rhizobium melioti) useful among the present invention and the example of the sequence alignment of two different tetramer Anthranilate synzyme (sulfolobus solfataricus and mouse ear mustard).Figure 35 is the example of the sequence alignment of several monomer Anthranilate synzyme and the different tetramer Anthranilate of color Rhodopseudomonas synzyme.
Embodiment 10: the codon of optimization uses
The optimization that this embodiment description is used by codon improves the Anthranilate synthase gene in seed expression.
The existence of the codon that nucleotide sequence (the SEQ ID NO:1) inspection of Anthranilate synzyme (AS) gene that comes the wild type Agrobacterium tumefaciens is not given full expression to.In order to identify the codon that does not give full expression to, to the relative codon frequency of sequence checking from the high expressed seed-protein of corn and soybean.Table O provides relative codon usage frequency, represents with the desired value form.The desired value form can be exemplified below: suppose that given amino acid of coding has four codons, and suppose that they are used equally well, expect that then each codon accounts for 25% (0.25) to that amino acid whose frequency.But, because redundancy, be standardized as 1.0 with 0.25, compare the relative scoring that provides each codon with those amino acid whose other codons of coding.For this analysis, more general if codon is compared to given amino acid whose other selections, then accept number greater than 1.0.Correspondingly, if a codon is not general, it accepts the number less than 1.0.For the research,, think that then specific cryptosystem is not given full expression to if codon usage frequency is lower than 0.5 relatively.
The result of application table O shows the rigorous inspection of wild type agrobacterium AS sequence, thinks that codon 125 is not given full expression to (being lower than 0.5 threshold value) (table P) in corn and the soybean.With these codons that do not given full expression to of more universal code displacement defined above.Modified nucleotide sequences as shown in figure 36.Utilize the bioinformatics instrument, assembling obtains sequence, and analyzes the conformability of translation, and with nucleotide and protein sequence and corresponding wild type AS sequence alignment.Simultaneously, protein sequence does not change, and the nucleotide sequence of optimized sequence and wild type agrobacterium AS sequence have 94% homogeneity (Figure 37).Utilize LasergeneEditSeq (DNASTAR, Inc., Madison respectively, WI) and Grail2 (Oak Ridge NationalLaboratory, Oak Ridge, (AATAAA is AATAAT) with hiding intron TN) there is not hiding polyadenylation signal in the optimization nucleotide sequence analysis.Do not find to hide signal.
Use the nucleotide sequence of technology synthetic modification well known in the art or provide by supplier, Egea Biosciencesces for example, Inc. (San Diego, CA).The nucleotide that obtains is cloned in the suitable expression vector, and utilizes the method for describing among the embodiment of this specification front to be determined at corn, the efficient during soybean and mouse ear mustard belong to.
Table O: relative codon usage frequency in corn and the soya seeds expressing gene 1
Codon AA Corn seed Soya seeds Codon AA Corn seed Soya seeds
TTT TTC TTA TTG TCT TCC TCA TCG TAT TAC TGT TGC TGG CTT CTC CTA CTG CCT CCC CCA CCG CAT CAC CAA CAG CGT CGC CGA CGG ATT ATC F F L L S S S S Y Y C C W L L L L P P P P H H Q Q R R R R I I 0.4211 1.5789 0.4557 0.9494 0.9624 1.3707 0.9107 0.7851 0.2455 1.7545 0.2778 1.7222 1.0000 0.7975 1.0610 0.8544 1.8820 0.6500 0.8520 1.2240 1.2740 0.8438 1.1563 0.8639 1.1361 0.2582 1.0082 0.1957 1.2283 0.9184 1.7143 0.7348 1.2652 0.3875 1.2060 1.4851 1.1249 1.0044 0.3266 0.6861 1.3139 0.7572 1.2428 1.0000 1.6298 1.6301 0.5905 0.5562 1.5822 0.7694 1.5838 0.0645 0.6066 1.3934 1.2162 0.7838 0.5903 1.1159 0.6700 0.3692 1.2783 1.0563 ATC ATA ATG ACT ACC ACA ACG AAT AAC AAA AAG AGT AGC AGA AGG GTT GTC GTA GTG GCT GCC GCA GCG GAT GAC GAA GAG GGT GGC GGA GGG I I M T T T T N N K K S S R R V V V V A A A A D D E E G G G G 1.7143 0.3673 1.0000 0.6153 1.2213 0.8372 1.3262 0.2885 1.7115 0.5333 1.4667 0.2679 1.7032 0.3913 2.9185 0.5714 1.0119 0.3810 2.0357 0.9876 1.1618 0.8011 1.0495 0.8500 1.1500 0.6818 1.3182 1.1268 1.8758 0.3085 0.6889 1.0563 0.6654 1.0000 1.0008 2.1020 0.7146 0.1826 0.5409 1.4591 0.9030 1.0970 0.9714 1.0876 1.9459 1.3087 1.2381 0.6864 0.3472 1.7284 1.3583 1.1283 1.2898 0.2235 0.9523 1.0477 1.0463 0.9537 1.1431 0.6577 1.2759 0.9233
1Represent relative codon frequency with the desired value form.This means,,, expect that then each codon accounts for 25% (0.25) if they are used equally well if the given amino acid of encoding has four codons.Because redundancy, 0.25 is standardized into 1, compares with these amino acid whose all codons of coding, provides the relative scoring of each codon.In actual life, more general if codon is compared to given amino acid whose other selections, then it is the number greater than 1.If it is not preferred that codon is compared with these amino acid whose other codons, then it is the number less than 1.
Table P.The Agro AS codon that does not give full expression to and express the modification of carrying out for improving seed
Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2 Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2 Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2
2 3 9 10 15 16 21 23 26 30 36 46 47 48 49 50 53 55 56 58 GTA ACG GGA GCG ACG AAA GTC CGA CGG TAT AAT GGC GCG GTT TTT TCG TAT TAT CCG CGT V T G A T K V R R Y N G A V F S Y Y P R GTG ACC GGT GCC ACC AAG GTG CGC CGC TAC AAC GGT GCC GTG TTC TCC TAC TAC CCA CGC corn，soy soy corn soy soy corn soy corn soy corn corn，soy soy soy corn corn soy corn corn soy corn 177 179 180 181 185 190 201 209 218 219 238 244 248 276 280 281 282 283 290 293 TCG GCG CGT CCG CGT TTT TAT CGT ACG ACG CCG CGT TAT CGT AAT CCG TCG GCG GCG CCG S A R P R F Y R T T P R Y R N P S A A P TCC GCC CGC CCA CGC TTC TAC CGC ACC ACC CCA CGC TAC CGC AAC CCA TCC GCC GCC CCA soy soy corn soy corn corn corn corn soy soy soy corn corn corn corn，soy soy soy soy soy soy 481 485 489 504 508 520 543 545 546 547 551 553 554 556 559 561 572 578 580 584 GCG AAT CCG ATA CGT CGT ACG GCG AAT TAT ACG GCG ACG TCG AGA CCG CCG TCG GGA CCG A N P I R R T A N Y T A T S R P P S G P GCC AAC CCA ATC CGC CGC ACC GCC AAC TAC ACC GCC ACC TCC AGG CCA CCA TCC GGT CCA soy corn，soy soy corn corn corn soy soy corn，soy corn soy soy soy soy corn soy soy soy corn Soy
Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2 Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2 Codon Codon (wt) Amino acid The codon of modifying In crop, do not give full expression to 2
64 69 70 75 76 85 86 97 102 112 115 123 125 133 136 137 143 150 151 153 155 173 ACG CCG CCG TGT TTT TAT AAT ACG GCG TCG CGG CCG CGT TCG CCG ACG AGA TAT TCG GCG TCG GCG T P P C F Y N T A S R P R S P T R Y S A S A ACC CCA CCA TGC TTC TAC AAC ACC GCC TCC CGC CCA CGC TCC CCA ACC AGG TAC TCC GCC TCC GCC soy soy soy corn corn corn corn，soy soy soy soy soy soy corn soy soy soy corn corn soy soy soy soy 294 296 301 307 312 313 322 328 329 339 352 363 376 378 390 411 442 446 449 460 464 469 TCG TAT AAT TAT TCG CCG CGT CCG ATA CCG TCG TCG CCG TCG TAT TTT CCG TAT GCG AAT ACG CGG S Y N Y S P R P I P S S P S Y F P Y A N T R TCC TAC AAC TAC TCC CCA CGC CCA ATC CCA TCC TCC CCA TCC TAC TTC CCA TAC GCC AAC ACC CGC soy corn corn，soy corn soy soy corn soy corn soy soy soy soy soy corn corn soy corn soy corn，soy soy soy 585 592 602 617 633 652 655 658 667 668 680 690 698 700 703 705 708 711 715 724 729 ACG ACG CCG TAT TCG ACG CGT TCG CCG CGT ACG CCG CCG TCG ACG GGA GCG CGG AAT GCG GCG T T P Y S T R S P R T P P S T G A R N A A ACC ACC CCA TAC TCC ACC CGC TCC CCA CGC ACC CCA CCA TCC ACC GGT GCC CGC AAC GCC GCC Soy Soy Soy Corn Soy Soy Corn Soy Soy Corn Soy Soy Soy Soy Soy Corn Soy Soy corn，soy Soy Soy
Title is that the tabulation of " not giving full expression in crop " is shown in that specific cryptosystem does not give full expression in any crop (corn or soybean)
All publication and patent documentations are hereby incorporated by reference, and are incorporated herein by reference respectively.The present invention is not limited to given and described detail.Should be appreciated that, in the spirit and scope of claims definition, can much change and modify.
Sequence table
＜110〉Monsanto Company
L.M. Wei not
J. beam
R. old
S.S. Zheng
T. Mi Tesiji
S. Si Lateer
W. draw general
＜120〉transgenosis high tryptophan plants
<130>1463.002WO1
<150>US?60/288,904
<151>2001-05-04
<160>103
<170>FastSEQ?for?Windows?Version?4.0
<210>1
<211>2190
<212>DNA
＜213〉Agrobacterium tumefaciens (Agrobacterium tumefaciens)
<400>1
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>2
<211>1815
<212>DNA
＜213〉corn (Zea mays)
<400>2
atggaatccc?tagccgccac?ctccgtgttc?gcgccctccc?gcgtcgccgt?cccggcggcg 60
cgggccctgg?ttagggcggg?gacggtggta?ccaaccaggc?ggacgagcag?ccggagcgga 120
accagcgggg?tgaaatgctc?tgctgccgtg?acgccgcagg?cgagcccagt?gattagcagg 180
agcgctgcgg?cggcgaaggc?ggcggaggag?gacaagaggc?ggttcttcga?ggcggcggcg 240
cgggggagcg?ggaaggggaa?cctggtgccc?atgtgggagt?gcatcgtgtc?ggaccatctc 300
acccccgtgc?tcgcctaccg?ctgcctcgtc?cccgaggaca?acgtcgacgc?ccccagcttc 360
ctcttcgagt?ccgtcgagca?ggggccccag?ggcaccacca?acgtcggccg?ctatagcatg 420
gtgggagccc?acccagtgat?ggagattgtg?gccaaagacc?acaaggttac?gatcatggac 480
cacgagaaga?gccaagtgac?agagcaggta?gtggacgacc?cgatgcagat?cccgaggacc 540
atgatggagg?gatggcaccc?acagcagatc?gacgagctcc?ctgaatcctt?ctccggtgga 600
tgggttgggt?tcttttccta?tgatacggtt?aggtatgttg?agaagaagaa?gctaccgttc 660
tccagtgctc?ctcaggacga?taggaacctt?cctgatgtgc?acttgggact?ctatgatgat 720
gttctagtct?tcgataatgt?tgagaagaaa?gtatatgtta?tccattgggt?caatgtggac 780
cggcatgcat?ctgttgagga?agcataccaa?gatggcaggt?cccgactaaa?catgttgcta 840
tctaaagtgc?acaattccaa?tgtccccaca?ctctctcctg?gatttgtgaa?gctgcacaca 900
cgcaagtttg?gtacaccttt?gaacaagtcg?accatgacaa?gtgatgagta?taagaatgct 960
gttctgcagg?ctaaggaaca?tattatggct?ggggatatct?tccagattgt?tttaagccag 1020
aggttcgaga?gacgaacata?tgccaaccca?tttgaggttt?atcgagcatt?acggattgtg 1080
aatcctagcc?catacatggc?gtatgtacag?gcaagaggct?gtgtattggt?tgcgtctagt 1140
cctgaaattc?ttacacgagt?cagtaagggg?aagattatta?atcgaccact?tgctggaact 1200
gttcgaaggg?gcaagacaga?gaaggaagat?caaatgcaag?agcagcaact?gttaagtgat 1260
gaaaaacagt?gtgccgagca?cataatgctt?gtggacttgg?gaaggaatga?tgttggcaag 1320
gtatccaaac?caggatcagt?gaaggtggag?aagttgatga?acattgagag?atactcccat 1380
gttatgcaca?tcagctcaac?ggttagtgga?cagttggatg?atcatctcca?gagttgggat 1440
gccttgagag?ctgccttgcc?cgttggaaca?gtcagtggtg?caccaaaggt?gaaggccatg 1500
gagttgattg?ataagttgga?agttacgagg?cgaggaccat?atagtggtgg?tctaggagga 1560
atatcgtttg?atggtgacat?gcaaattgca?ctttctctcc?gcaccatcgt?attctcaaca 1620
gcgccgagcc?acaacacgat?gtactcatac?aaagacgcag?ataggcgtcg?ggagtgggtc 1680
gctcatcttc?aggctggtgc?aggcattgtt?gccgacagta?gcccagatga?cgaacaacgt 1740
gaatgcgaga?ataaggctgc?tgcactagct?cgggccatcg?atcttgcaga?gtcagctttt 1800
gtagacaaag?aatag 1815
<210>3
<211>1993
<212>DNA
＜213〉rue (Ruta graveolens)
<400>3
aaaaaatctg?tctgtttttc?gtgtttggac?atttcagcgg?cactgggtgc?catcagttga 60
ttcgactcat?ttgatttatt?ttgtttgttg?gccatgagtg?cagcggcaac?gtcgatgcaa 120
tcccttaaat?tctccaaccg?tctggtccca?cccagtcgcc?gtctgtctcc?ggttccgaac 180
aatgtcacct?gcaataacct?ccccaagtct?gcagctcccg?tccggacagt?caaatgctgc 240
gcttcttcct?ggaacagtac?catcaacggc?gcggccgcca?cgaccaacgg?tgcgtccgcc 300
gccagtaacg?gcgcatccac?gaccaccact?acatatgtta?gtgatgcaac?cagatttatc 360
gactcttcta?aaagggcaaa?tctagtgcca?ttataccgtt?gcatattcgc?ggatcatctc 420
acgccggtgc?ttgcctatag?atgtttggtt?caagaagacg?ataaagagac?tccaagtttt 480
ttattcgaat?cagtagagcc?gggtcggatt?tctactgttg?ggaggtatag?tgtggttgga 540
gctcatcccg?tgatggaagt?tatagctaaa?gataatatgg?ttacggtgat?ggatcatgag 600
aaagggagct?tagttgagga?ggtggtcgat?gatcccatgg?agattcctag?aagaatttcc 660
gaggattgga?agcctcaaat?aatcgatgat?cttcctgaag?ctttttgcgg?tggttgggtt 720
ggtttcttct?catacgatac?agttcgatat?gtggagaaga?aaaagttacc?attctcaaag 780
gcacctcagg?atgataggaa?tcttgcagat?atgcatctag?gtctctataa?cgatgttatt 840
gtgtttgatc?atgtggaaaa?gaaagtatat?gttattcatt?gggtgaggct?aaatcaacag 900
tcttctgaag?aaaaagcata?tgccgagggt?ctggaacact?tggagagact?agtatccaga 960
gtacaggatg?agaacacgcc?aaggctcgcc?ccaggttcca?tagacttaca?cactggtcat 1020
tttggacctc?cattaaaaaa?gtcaaacatg?acatgtgaag?aatacaaaat?ggctgtacta 1080
gcggcaaaag?aacatattca?ggctggggat?atttttcaaa?tcgtactaag?ccaacgtttt 1140
gaacgtcgaa?catttgctga?tccatttgaa?gtttataggg?cactgagagt?tgttaatccg 1200
agtccctata?tgacgtatat?gcaggcaaga?gggtgtgttc?tggtagcttc?aagtccagaa 1260
attcttactc?gagtaaagaa?gaataagatt?gtgaatcgac?ctttggctgg?aacagcccga 1320
agagggagga?ctactgaaga?agatgagatg?ttggaaacac?agttgctaaa?agacgcaaag 1380
caatgtgctg?agcatgttat?gctggtcgat?ttgggacgga?atgatgttgg?caaggtttca 1440
aaatctggtt?ctgtgaaagt?ggaaaagctg?atgaatgttg?aacgatattc?acatgttatg 1500
cacataagct?ctacggtcac?aggtgagttg?caagataatc?tcagttgctg?ggatgccctg 1560
cgtgctgcac?tgcctgtcgg?gactgttagt?ggagcaccaa?aggtgaaggc?aatggagtta 1620
atcgatgaat?tggaggtaaa?tagacgtggc?ccctacagtg?gtgggtttgg?cggtatctcc 1680
ttcaccggag?atatggacat?tgccctggct?ctaaggacca?ttgttttcca?aaccggtaca 1740
cgctatgaca?caatgtactc?gtacaagaat?gctaccaaac?gccggcagtg?ggtggcatac 1800
cttcaagccg?gggctggcat?tgttgctgat?agtgatccag?acgacgagca?tcgtgagtgc 1860
cagaacaaag?ccgccggact?ggcccgtgcc?atcgacctag?ctgagtctgc?ttttgtgaac 1920
aaatcaagta?gctaaagttt?tggatttgga?agtggagttg?agtctcggat?aggatttaga 1980
gtaaaaaaag?agg 1993
<210>4
<211>729
<212>PRT
＜213〉Agrobacterium tumefaciens
<400>4
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>5
<211>604
<212>PRT
＜213〉corn
<400>5
Met?Glu?Ser?Leu?Ala?Ala?Thr?Ser?Val?Phe?Ala?Pro?Ser?Arg?Val?Ala
1 5 10 15
Val?Pro?Ala?Ala?Arg?Ala?Leu?Val?Arg?Ala?Gly?Thr?Val?Val?Pro?Thr
20 25 30
Arg?Arg?Thr?Ser?Ser?Arg?Ser?Gly?Thr?Ser?Gly?Val?Lys?Cys?Ser?Ala
35 40 45
Ala?Val?Thr?Pro?Gln?Ala?Ser?Pro?Val?Ile?Ser?Arg?Ser?Ala?Ala?Ala
50 55 60
Ala?Lys?Ala?Ala?Glu?Glu?Asp?Lys?Arg?Arg?Phe?Phe?Glu?Ala?Ala?Ala
65 70 75 80
Arg?Gly?Ser?Gly?Lys?Gly?Asn?Leu?Val?Pro?Met?Trp?Glu?Cys?Ile?Val
85 90 95
Ser?Asp?His?Leu?Thr?Pro?Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val?Pro?Glu
100 105 110
Asp?Asn?Val?Asp?Ala?Pro?Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu?Gln?Gly
115 120 125
Pro?Gln?Gly?Thr?Thr?Asn?Val?Gly?Arg?Tyr?Ser?Met?Val?Gly?Ala?His
130 135 140
Pro?Val?Met?Glu?Ile?Val?Ala?Lys?Asp?His?Lys?Val?Thr?Ile?Met?Asp
145 150 155 160
His?Glu?Lys?Ser?Gln?Val?Thr?Glu?Gln?Val?Val?Asp?Asp?Pro?Met?Gln
165 170 175
Ile?Pro?Arg?Thr?Met?Met?Glu?Gly?Trp?His?Pro?Gln?Gln?Ile?Asp?Glu
180 185 190
Leu?Pro?Glu?Ser?Phe?Ser?Gly?Gly?Trp?Val?Gly?Phe?Phe?Ser?Tyr?Asp
195 200 205
Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys?Leu?Pro?Phe?Ser?Ser?Ala?Pro
210 215 220
Gln?Asp?Asp?Arg?Asn?Leu?Pro?Asp?Val?His?Leu?Gly?Leu?Tyr?Asp?Asp
225 230 235 240
Val?Leu?Val?Phe?Asp?Asn?Val?Glu?Lys?Lys?Val?Tyr?Val?Ile?His?Trp
245 250 255
Val?Asn?Val?Asp?Arg?His?Ala?Ser?Val?Glu?Glu?Ala?Tyr?Gln?Asp?Gly
260 265 270
Arg?Ser?Arg?Leu?Asn?Met?Leu?Leu?Ser?Lys?Val?His?Asn?Ser?Asn?Val
275 280 285
Pro?Thr?Leu?Ser?Pro?Gly?Phe?Val?Lys?Leu?His?Thr?Arg?Lys?Phe?Gly
290 295 300
Thr?Pro?Leu?Asn?Lys?Ser?Thr?Met?Thr?Ser?Asp?Glu?Tyr?Lys?Asn?Ala
305 310 315 320
Val?Leu?Gln?Ala?Lys?Glu?His?Ile?Met?Ala?Gly?Asp?Ile?Phe?Gln?Ile
325 330 335
Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Arg?Thr?Tyr?Ala?Asn?Pro?Phe?Glu
340 345 350
Val?Tyr?Arg?Ala?Leu?Arg?Ile?Val?Asn?Pro?Ser?Pro?Tyr?Met?Ala?Tyr
355 360 365
Val?Gln?Ala?Arg?Gly?Cys?Val?Leu?Val?Ala?Ser?Ser?Pro?Glu?Ile?Leu
370 375 380
Thr?Arg?Val?Ser?Lys?Gly?Lys?Ile?Ile?Asn?Arg?Pro?Leu?Ala?Gly?Thr
385 390 395 400
Val?Arg?Arg?Gly?Lys?Thr?Glu?Lys?Glu?Asp?Gln?Met?Gln?Glu?Gln?Gln
405 410 415
Leu?Leu?Ser?Asp?Glu?Lys?Gln?Cys?Ala?Glu?His?Ile?Met?Leu?Val?Asp
420 425 430
Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val?Ser?Lys?Pro?Gly?Ser?Val?Lys
435 440 445
Val?Glu?Lys?Leu?Met?Asn?Ile?Glu?Arg?Tyr?Ser?His?Val?Met?His?Ile
450 455 460
Ser?Ser?Thr?Val?Ser?Gly?Gln?Leu?Asp?Asp?His?Leu?Gln?Ser?Trp?Asp
465 470 475 480
Ala?Leu?Arg?Ala?Ala?Leu?Pro?Val?Gly?Thr?Val?Ser?Gly?Ala?Pro?Lys
485 490 495
Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Lys?Leu?Glu?Val?Thr?Arg?Arg?Gly
500 505 510
Pro?Tyr?Ser?Gly?Gly?Leu?Gly?Gly?Ile?Ser?Phe?Asp?Gly?Asp?Met?Gln
515 520 525
Ile?Ala?Leu?Ser?Leu?Arg?Thr?Ile?Val?Phe?Ser?Thr?Ala?Pro?Ser?His
530 535 540
Asn?Thr?Met?Tyr?Ser?Tyr?Lys?Asp?Ala?Asp?Arg?Arg?Arg?Glu?Trp?Val
545 550 555 560
Ala?His?Leu?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala?Asp?Ser?Ser?Pro?Asp
565 570 575
Asp?Glu?Gln?Arg?Glu?Cys?Glu?Asn?Lys?Ala?Ala?Ala?Leu?Ala?Arg?Ala
580 585 590
Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Val?Asp?Lys?Glu
595 600
<210>6
<211>613
<212>PRT
＜213〉rue
<400>6
Met?Ser?Ala?Ala?Ala?Thr?Ser?Met?Gln?Ser?Leu?Lys?Phe?Ser?Asn?Arg
1 5 10 15
Leu?Val?Pro?Pro?Ser?Arg?Arg?Leu?Ser?Pro?Val?Pro?Asn?Asn?Val?Thr
20 25 30
Cys?Asn?Asn?Leu?Pro?Lys?Ser?Ala?Ala?Pro?Val?Arg?Thr?Val?Lys?Cys
35 40 45
Cys?Ala?Ser?Ser?Trp?Asn?Ser?Thr?Ile?Asn?Gly?Ala?Ala?Ala?Thr?Thr
50 55 60
Asn?Gly?Ala?Ser?Ala?Ala?Ser?Asn?Gly?Ala?Ser?Thr?Thr?Thr?Thr?Thr
65 70 75 80
Tyr?Val?Ser?Asp?Ala?Thr?Arg?Phe?Ile?Asp?Ser?Ser?Lys?Arg?Ala?Asn
85 90 95
Leu?Val?Pro?Leu?Tyr?Arg?Cys?Ile?Phe?Ala?Asp?His?Leu?Thr?Pro?Val
100 105 110
Leu?Ala?Tyr?Arg?Cys?Leu?Val?Gln?Glu?Asp?Asp?Lys?Glu?Thr?Pro?Ser
115 120 125
Phe?Leu?Phe?Glu?Ser?Val?Glu?Pro?Gly?Arg?Ile?Ser?Thr?Val?Gly?Arg
130 135 140
Tyr?Ser?Val?Val?Gly?Ala?His?Pro?Val?Met?Glu?Val?Ile?Ala?Lys?Asp
145 150 155 160
Asn?Met?Val?Thr?Val?Met?Asp?His?Glu?Lys?Gly?Ser?Leu?Val?Glu?Glu
165 170 175
Val?Val?Asp?Asp?Pro?Met?Glu?Ile?Pro?Arg?Arg?Ile?Ser?Glu?Asp?Trp
180 185 190
Lys?Pro?Gln?Ile?Ile?Asp?Asp?Leu?Pro?Glu?Ala?Phe?Cys?Gly?Gly?Trp
195 200 205
Val?Gly?Phe?Phe?Ser?Tyr?Asp?Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys
210 215 220
Leu?Pro?Phe?Ser?Lys?Ala?Pro?Gln?Asp?Asp?Arg?Asn?Leu?Ala?Asp?Met
225 230 235 240
His?Leu?Gly?Leu?Tyr?Asn?Asp?Val?Ile?Val?Phe?Asp?His?Val?Glu?Lys
245 250 255
Lys?Val?Tyr?Val?Ile?His?Trp?Val?Arg?Leu?Asn?Gln?Gln?Ser?Ser?Glu
260 265 270
Glu?Lys?Ala?Tyr?Ala?Glu?Gly?Leu?Glu?His?Leu?Glu?Arg?Leu?Val?Ser
275 280 285
Arg?Val?Gln?Asp?Glu?Asn?Thr?Pro?Arg?Leu?Ala?Pro?Gly?Ser?Ile?Asp
290 295 300
Leu?His?Thr?Gly?His?Phe?Gly?Pro?Pro?Leu?Lys?Lys?Ser?Asn?Met?Thr
305 310 315 320
Cys?Glu?Glu?Tyr?Lys?Met?Ala?Val?Leu?Ala?Ala?Lys?Glu?His?Ile?Gln
325 330 335
Ala?Gly?Asp?Ile?Phe?Gln?Ile?Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Arg
340 345 350
Thr?Phe?Ala?Asp?Pro?Phe?Glu?Val?Tyr?Arg?Ala?Leu?Arg?Val?Val?Asn
355 360 365
Pro?Ser?Pro?Tyr?Met?Thr?Tyr?Met?Gln?Ala?Arg?Gly?Cys?Val?Leu?Val
370 375 380
Ala?Ser?Ser?Pro?Glu?Ile?Leu?Thr?Arg?Val?Lys?Lys?Asn?Lys?Ile?Val
385 390 395 400
Asn?Arg?Pro?Leu?Ala?Gly?Thr?Ala?Arg?Arg?Gly?Arg?Thr?Thr?Glu?Glu
405 410 415
Asp?Glu?Met?Leu?Glu?Thr?Gln?Leu?Leu?Lys?Asp?Ala?Lys?Gln?Cys?Ala
420 425 430
Glu?His?Val?Met?Leu?Val?Asp?Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val
435 440 445
Ser?Lys?Ser?Gly?Ser?Val?Lys?Val?Glu?Lys?Leu?Met?Asn?Val?Glu?Arg
450 455 460
Tyr?Ser?His?Val?Met?His?Ile?Ser?Ser?Thr?Val?Thr?Gly?Glu?Leu?Gln
465 470 475 480
Asp?Asn?Leu?Ser?Cys?Trp?Asp?Ala?Leu?Arg?Ala?Ala?Leu?Pro?Val?Gly
485 490 495
Thr?Val?Ser?Gly?Ala?Pro?Lys?Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Glu
500 505 510
Leu?Glu?Val?Asn?Arg?Arg?Gly?Pro?Tyr?Ser?Gly?Gly?Phe?Gly?Gly?Ile
515 520 525
Ser?Phe?Thr?Gly?Asp?Met?Asp?Ile?Ala?Leu?Ala?Leu?Arg?Thr?Ile?Val
530 535 540
Phe?Gln?Thr?Gly?Thr?Arg?Tyr?Asp?Thr?Met?Tyr?Ser?Tyr?Lys?Asn?Ala
545 550 555 560
Thr?Lys?Arg?Arg?Gln?Trp?Val?Ala?Tyr?Leu?Gln?Ala?Gly?Ala?Gly?Ile
565 570 575
Val?Ala?Asp?Ser?Asp?Pro?Asp?Asp?Glu?His?Arg?Glu?Cys?Gln?Asn?Lys
580 585 590
Ala?Ala?Gly?Leu?Ala?Arg?Ala?Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Val
595 600 605
Asn?Lys?Ser?Ser?Ser
610
<210>7
<211>729
<212>PRT
＜213〉rhizobium melioti (Rhizobium meliloti)
<400>7
Met?Ala?Ala?Val?Ile?Leu?Glu?Asp?Gly?Ala?Glu?Ser?Tyr?Thr?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Val?Val?Thr?Arg?Arg?Arg?Arg?Glu?Ala?Ser?Tyr?Ser?Asp
20 25 30
Ala?Ile?Ala?Gly?Tyr?Val?Asp?Arg?Leu?Asp?Glu?Arg?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Val?Val?Asp?Pro?Pro?Leu?Ala?Ile?Ser?Ser?Phe?Gly?Arg?Ser?Leu
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Glu?Arg?Gly?Glu?Val?Leu?Leu?Ala?Leu?Ile
85 90 95
Ala?Glu?Asp?Leu?Lys?Ser?Val?Ala?Asp?Ile?Thr?Leu?Gly?Ser?Leu?Ala
100 105 110
Ala?Arg?Arg?Leu?Asp?Leu?Thr?Ile?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Met?Pro?Thr?Val?Phe?Thr?Val?Leu?Arg?Ala
130 135 140
Val?Thr?Asn?Leu?Phe?His?Ser?Glu?Glu?Asp?Ser?Asn?Leu?Gly?Leu?Tyr
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Glu?Leu
165 170 175
Lys?Leu?Ser?Arg?Pro?Asp?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ala?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Ala?Arg?Glu?Asn?Leu?Ser?Thr?Glu?Gly?Lys?Ala?Ala
210 215 220
Asp?Ile?Ala?Pro?Glu?Pro?Phe?Arg?Ser?Val?Asp?Ser?Ile?Pro?Pro?His
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ala?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Tyr?Glu?Arg?Cys?Glu?Ser?Arg?Pro?Ser?Glu?Ile?Ser?Asn?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asn
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Val?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Ser?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Tyr?Asp?Ser?Asn?Pro?Glu?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ala?Ala?Ile?Arg?Asp?Ala?Lys?Ser
500 505 510
Ala?Asn?Ser?Ala?Lys?Ser?Ala?Arg?Asp?Val?Ala?Ala?Val?Gly?Ala?Gly
515 520 525
Val?Ser?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Ser?Val?Thr?Thr?Val?Arg?Thr
545 550 555 560
Pro?Val?Ala?Glu?Glu?Ile?Phe?Asp?Arg?Val?Lys?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Thr?Pro?Lys?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Lys?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Asp?Leu?Arg?Gln?Leu
610 615 620
Ala?Ile?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Ile?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ser?Asn?Leu?Pro?Arg?Glu?Phe?Val?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ser?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gly?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Ala?His?Leu
705 710 715 720
Ala?Lys?Arg?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>8
<211>421
<212>PRT
＜213〉sulfolobus solfataricus (sulfolobus solfataricus)
<400>8
Met?Glu?Val?His?Pro?Ile?Ser?Glu?Phe?Ala?Ser?Pro?Phe?Glu?Val?Phe
1 5 10 15
Lys?Cys?Ile?Glu?Arg?Asp?Phe?Lys?Val?Ala?Gly?Leu?Leu?Glu?Ser?Ile
20 25 30
Gly?Gly?Pro?Gln?Tyr?Lys?Ala?Arg?Tyr?Ser?Val?Ile?Ala?Trp?Ser?Thr
35 40 45
Asn?Gly?Tyr?Leu?Lys?Ile?His?Asp?Asp?Pro?Val?Asn?Ile?Leu?Asn?Gly
50 55 60
Tyr?Leu?Lys?Asp?Leu?Lys?Leu?Ala?Asp?Ile?Pro?Gly?Leu?Phe?Lys?Gly
65 70 75 80
Gly?Met?Ile?Gly?Tyr?Ile?Ser?Tyr?Asp?Ala?Val?Arg?Phe?Trp?Glu?Lys
85 90 95
Ile?Arg?Asp?Leu?Lys?Pro?Ala?Ala?Glu?Asp?Trp?Pro?Tyr?Ala?Glu?Phe
100 105 110
Phe?Thr?Pro?Asp?Asn?Ile?Ile?Ile?Tyr?Asp?His?Asn?Glu?Gly?Lys?Val
115 120 125
Tyr?Val?Asn?Ala?Asp?Leu?Ser?Ser?Val?Gly?Gly?Cys?Gly?Asp?Ile?Gly
130 135 140
Glu?Phe?Lys?Val?Ser?Phe?Tyr?Asp?Glu?Ser?Leu?Asn?Lys?Asn?Ser?Tyr
145 150 155 160
Glu?Arg?Ile?Val?Ser?Glu?Ser?Leu?Glu?Tyr?Ile?Arg?Ser?Gly?Tyr?Ile
165 170 175
Phe?Gln?Val?Val?Leu?Ser?Arg?Phe?Tyr?Arg?Tyr?Ile?Phe?Ser?Gly?Asp
180 185 190
Pro?Leu?Arg?Ile?Tyr?Tyr?Asn?Leu?Arg?Arg?Ile?Asn?Pro?Ser?Pro?Tyr
195 200 205
Met?Phe?Tyr?Leu?Lys?Phe?Asp?Glu?Lys?Tyr?Leu?Ile?Gly?Ser?Ser?Pro
210 215 220
Glu?Leu?Leu?Phe?Arg?Val?Gln?Asp?Asn?Ile?Val?Glu?Thr?Tyr?Pro?Ile
225 230 235 240
Ala?Gly?Thr?Arg?Pro?Arg?Gly?Ala?Asp?Gln?Glu?Glu?Asp?Leu?Lys?Leu
245 250 255
Glu?Leu?Glu?Leu?Met?Asn?Ser?Glu?Lys?Asp?Lys?Ala?Glu?His?Leu?Met
260 265 270
Leu?Val?Asp?Leu?Ala?Arg?Asn?Asp?Leu?Gly?Lys?Val?Cys?Val?Pro?Gly
275 280 285
Thr?Val?Lys?Val?Pro?Glu?Leu?Met?Tyr?Val?Glu?Lys?Tyr?Ser?His?Val
290 295 300
Gln?His?Ile?Val?Ser?Lys?Val?Ile?Gly?Thr?Leu?Lys?Lys?Lys?Tyr?Asn
305 310 315 320
Ala?Leu?Asn?Val?Leu?Ser?Ala?Thr?Phe?Pro?Ala?Gly?Thr?Val?Ser?Gly
325 330 335
Arg?Pro?Lys?Pro?Met?Ala?Met?Asn?Ile?Ile?Glu?Thr?Leu?Glu?Glu?Tyr
340 345 350
Lys?Arg?Gly?Pro?Tyr?Ala?Gly?Ala?Val?Gly?Phe?Ile?Ser?Ala?Asp?Gly
355 360 365
Asn?Ala?Glu?Phe?Ala?Ile?Ala?Ile?Arg?Thr?Ala?Phe?Leu?Asn?Lys?Glu
370 375 380
Leu?Leu?Arg?Ile?His?Ala?Gly?Ala?Gly?Ile?Val?Tyr?Asp?Ser?Asn?Pro
385 390 395 400
Glu?Ser?Glu?Tyr?Phe?Glu?Thr?Glu?His?Lys?Leu?Lys?Ala?Leu?Lys?Thr
405 410 415
Ala?Ile?Gly?Val?Arg
420
<210>9
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>9
ccatcgcggc?gcgttttttt?cgtccaacta?tg 32
<210>10
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>10
catagttgga?cgaaaaaaac?gcgccgcgat?gg 32
<210>11
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>11
ccatcgcggc?gcgtattttt?cgtccaacta?tgaatatcc 39
<210>12
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>12
ggatattcat?agttggacga?aaaatacgcg?ccgcgatgg 39
<210>13
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>13
ccatcgcggc?gcgtggtttt?cgtccaacta?tgaatatcc 39
<210>14
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>14
ggatattcat?agttggacga?aaaccacgcg?ccgcgatgg 39
<210>15
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>15
ccatcgcggc?gcggttttta?agtccaacta?tgaatatcc 39
<210>16
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>16
ggatattcat?agttggactt?aaaaaccgcg?ccgcgatgg 39
<210>17
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>17
gcgcggtttt?ttcgtgcaac?tatgaatatc?cggg 34
<210>18
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>18
cccggatatt?catagttgca?cgaaaaaacc?gcgc 34
<210>19
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>19
cgcggttttt?tcgttcaact?atgaatatcc?gggc 34
<210>20
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>20
gcccggatat?tcatagttga?acgaaaaaac?cgcg 34
<210>21
<211>37
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>21
cggcgcggtt?ttttcgatca?actatgaata?tccgggc 37
<210>22
<211>37
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>22
gcccggatat?tcatagttga?tcgaaaaaac?cgcgccg 37
<210>23
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>23
ggcgcggttt?tttcgctcaa?ctatgaatat?ccgggc 36
<210>24
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>24
gcccggatat?tcatagttga?gcgaaaaaac?cgcgcc 36
<210>25
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>25
cggcgcggtt?ttttcgatga?actatgaata?tccgggccg 39
<210>26
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>26
cggcccggat?attcatagtt?catcgaaaaa?accgcgccg 39
<210>27
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>27
cgcggttttt?tcgaccaact?atgaatatcc?gggc 34
<210>28
<211>34
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>28
gcccggatat?tcatagttgg?tcgaaaaaac?cgcg 34
<210>29
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>29
ggcgcggttt?tttcggtcaa?ctatgaatat?ccgggc 36
<210>30
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>30
gcccggatat?tcatagttga?ccgaaaaaac?cgcgcc 36
<210>31
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>31
gcgcggtttt?ttcgtacaac?tatgaatatc?cgggc 35
<210>32
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>32
gcccggatat?tcatagttgt?acgaaaaaac?cgcgc 35
<210>33
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>33
cggcgcggtt?ttttcgtcct?tctatgaata?tccggg 36
<210>34
<211>36
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>34
cccggatatt?catagaagga?cgaaaaaacc?gcgccg 36
<210>35
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>35
ctgaaggcgatcaacgcgtc?gccctattc 29
<210>36
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>36
gaatagggcg?acgcgttgat?cgccttcag 29
<210>37
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>37
cctgaaggcg?atcaacgggt?cgccctattc?c 31
<210>38
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>38
ggaatagggc?gacccgttga?tcgccttcag?g 31
<210>39
<211>33
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>39
cgtcgcccta?ttccgccttc?atcaatctcg?gcg 33
<210>40
<211>33
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>40
cgccgagatt?gatgaaggcg?gaatagggcg?acg 33
<210>41
<211>33
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>41
cgtcgcccta?ttcctggttc?atcaatctcg?gcg 33
<210>42
<211>33
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>42
cgccgagatt?gatgaaccag?gaatagggcg?acg 33
<210>43
<211>729
<212>PRT
＜213〉rhizobium melioti
<400>43
Met?Ala?Ala?Val?Ile?Leu?Glu?Asp?Gly?Ala?Glu?Ser?Tyr?Thr?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Val?Val?Thr?Arg?Arg?Arg?Arg?Glu?Ala?Ser?Tyr?Ser?Asp
20 25 30
Ala?Ile?Ala?Gly?Tyr?Val?Asp?Arg?Leu?Asp?Glu?Arg?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Val?Val?Asp?Pro?Pro?Leu?Ala?Ile?Ser?Ser?Phe?Gly?Arg?Ser?Leu
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Glu?Arg?Gly?Glu?Val?Leu?Leu?Ala?Leu?Ile
85 90 95
Ala?Glu?Asp?Leu?Lys?Ser?Val?Ala?Asp?Ile?Thr?Leu?Gly?Ser?Leu?Ala
100 105 110
Ala?Arg?Arg?Leu?Asp?Leu?Thr?Ile?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Met?Pro?Thr?Val?Phe?Thr?Val?Leu?Arg?Ala
130 135 140
Val?Thr?Asn?Leu?Phe?His?Ser?Glu?Glu?Asp?Ser?Asn?Leu?Gly?Leu?Tyr
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Glu?Leu
165 170 175
Lys?Leu?Ser?Arg?Pro?Asp?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ala?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Ala?Arg?Glu?Asn?Leu?Ser?Thr?Glu?Gly?Lys?Ala?Ala
210 215 220
Asp?Ile?Ala?Pro?Glu?Pro?Phe?Arg?Ser?Val?Asp?Ser?Ile?Pro?Pro?His
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ala?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Tyr?Glu?Arg?Cys?Glu?Ser?Arg?Pro?Ser?Glu?Ile?Ser?Asn?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asn
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Val?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Ser?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Tyr?Asp?Ser?Asn?Pro?Glu?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ala?Ala?Ile?Arg?Asp?Ala?Lys?Ser
500 505 510
Ala?Asn?Ser?Ala?Lys?Ser?Ala?Arg?Asp?Val?Ala?Ala?Val?Gly?Ala?Gly
515 520 525
Val?Ser?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Ser?Val?Thr?Thr?Val?Arg?Thr
545 550 555 560
Pro?Val?Ala?Glu?Glu?Ile?Phe?Asp?Arg?Val?Lys?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Thr?Pro?Lys?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Lys?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Asp?Leu?Arg?Gln?Leu
610 615 620
Ala?Ile?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Ile?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ser?Asn?Leu?Pro?Arg?Glu?Phe?Val?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ser?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gly?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Ala?His?Leu
705 710 715 720
Ala?Lys?Arg?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>44
<211>616
<212>PRT
＜213〉sulfolobus solfataricus
<400>44
Met?Glu?Val?His?Pro?Ile?Ser?Glu?Phe?Ala?Ser?Pro?Phe?Glu?Val?Phe
1 5 10 15
Lys?Cys?Ile?Glu?Arg?Asp?Phe?Lys?Val?Ala?Gly?Leu?Leu?Glu?Ser?Ile
20 25 30
Gly?Gly?Pro?Gln?Tyr?Lys?Ala?Arg?Tyr?Ser?Val?Ile?Ala?Trp?Ser?Thr
35 40 45
Asn?Gly?Tyr?Leu?Lys?Ile?His?Asp?Asp?Pro?Val?Asn?Ile?Leu?Asn?Gly
50 55 60
Tyr?Leu?Lys?Asp?Leu?Lys?Leu?Ala?Asp?Ile?Pro?Gly?Leu?Phe?Lys?Gly
65 70 75 80
Gly?Met?Ile?Gly?Tyr?Ile?Ser?Tyr?Asp?Ala?Val?Arg?Phe?Trp?Glu?Lys
85 90 95
Ile?Arg?Asp?Leu?Lys?Pro?Ala?Ala?Glu?Asp?Trp?Pro?Tyr?Ala?Glu?Phe
100 105 110
Phe?Thr?Pro?Asp?Asn?Ile?Ile?Ile?Tyr?Asp?His?Asn?Glu?Gly?Lys?Val
115 120 125
Tyr?Val?Asn?Ala?Asp?Leu?Ser?Ser?Val?Gly?Gly?Cys?Gly?Asp?Ile?Gly
130 135 140
Glu?Phe?Lys?Val?Ser?Phe?Tyr?Asp?Glu?Ser?Leu?Asn?Lys?Asn?Ser?Tyr
145 150 155 160
Glu?Arg?Ile?Val?Ser?Glu?Ser?Leu?Glu?Tyr?Ile?Arg?Ser?Gly?Tyr?Ile
165 170 175
Phe?Gln?Val?Val?Leu?Ser?Arg?Phe?Tyr?Arg?Tyr?Ile?Phe?Ser?Gly?Asp
180 185 190
Pro?Leu?Arg?Ile?Tyr?Tyr?Asn?Leu?Arg?Arg?Ile?Asn?Pro?Ser?Pro?Tyr
195 200 205
Met?Phe?Tyr?Leu?Lys?Phe?Asp?Glu?Lys?Tyr?Leu?Ile?Gly?Ser?Ser?Pro
210 215 220
Glu?Leu?Leu?Phe?Arg?Val?Gln?Asp?Asn?Ile?Val?Glu?Thr?Tyr?Pro?Ile
225 230 235 240
Ala?Gly?Thr?Arg?Pro?Arg?Gly?Ala?Asp?Gln?Glu?Glu?Asp?Leu?Lys?Leu
245 250 255
Glu?Leu?Glu?Leu?Met?Asn?Ser?Glu?Lys?Asp?Lys?Ala?Glu?His?Leu?Met
260 265 270
Leu?Val?Asp?Leu?Ala?Arg?Asn?Asp?Leu?Gly?Lys?Val?Cys?Val?Pro?Gly
275 280 285
Thr?Val?Lys?Val?Pro?Glu?Leu?Met?Tyr?Val?Glu?Lys?Tyr?Ser?His?Val
290 295 300
Gln?His?Ile?Val?Ser?Lys?Val?Ile?Gly?Thr?Leu?Lys?Lys?Lys?Tyr?Asn
305 310 315 320
Ala?Leu?Asn?Val?Leu?Ser?Ala?Thr?Phe?Pro?Ala?Gly?Thr?Val?Ser?Gly
325 330 335
Arg?Pro?Lys?Pro?Met?Ala?Met?Asn?Ile?Ile?Glu?Thr?Leu?Glu?Glu?Tyr
340 345 350
Lys?Arg?Gly?Pro?Tyr?Ala?Gly?Ala?Val?Gly?Phe?Ile?Ser?Ala?Asp?Gly
355 360 365
Asn?Ala?Glu?Phe?Ala?Ile?Ala?Ile?Arg?Thr?Ala?Phe?Leu?Asn?Lys?Glu
370 375 380
Leu?Leu?Arg?Ile?His?Ala?Gly?Ala?Gly?Ile?Val?Tyr?Asp?Ser?Asn?Pro
385 390 395 400
Glu?Ser?Glu?Tyr?Phe?Glu?Thr?Glu?His?Lys?Leu?Lys?Ala?Leu?Lys?Thr
405 410 415
Ala?Ile?Gly?Val?Arg?Met?Asp?Leu?Thr?Leu?Ile?Ile?Asp?Asn?Tyr?Asp
420 425 430
Ser?Phe?Val?Tyr?Asn?Ile?Ala?Gln?Ile?Val?Gly?Glu?Leu?Gly?Ser?Tyr
435 440 445
Pro?Ile?Val?Ile?Arg?Asn?Asp?Glu?Ile?Ser?Ile?Lys?Gly?Ile?Glu?Arg
450 455 460
Ile?Asp?Pro?Asp?Arg?Leu?Ile?Ile?Ser?Pro?Gly?Pro?Gly?Thr?Pro?Glu
465 470 475 480
Lys?Arg?Glu?Asp?Ile?Gly?Val?Ser?Leu?Asp?Val?Ile?Lys?Tyr?Leu?Gly
485 490 495
Lys?Arg?Thr?Pro?Ile?Leu?Gly?Val?Cys?Leu?Gly?His?Gln?Ala?Ile?Gly
500 505 510
Tyr?Ala?Phe?Gly?Ala?Lys?Ile?Arg?Arg?Ala?Arg?Lys?Val?Phe?His?Gly
515 520 525
Lys?Ile?Ser?Asn?Ile?Ile?Leu?Val?Asn?Asn?Ser?Pro?Leu?Ser?Leu?Tyr
530 535 540
Tyr?Gly?Ile?Ala?Lys?Glu?Phe?Lys?Ala?Thr?Arg?Tyr?His?Ser?Leu?Val
545 550 555 560
Val?Asp?Glu?Val?His?Arg?Pro?Leu?Ile?Val?Asp?Ala?Ile?Ser?Ala?Glu
565 570 575
Asp?Asn?Glu?Ile?Met?Ala?Ile?His?His?Glu?Glu?Tyr?Pro?Ile?Tyr?Gly
580 585 590
Val?Gln?Phe?His?Pro?Glu?Ser?Val?Gly?Thr?Ser?Leu?Gly?Tyr?Lys?Ile
595 600 605
Leu?Tyr?Asn?Phe?Leu?Asn?Arg?Val
610 615
<210>45
<211>897
<212>PRT
＜213〉mouse ear mustard (Arabidopsis thaliana)
<400>45
Met?Ser?Ala?Val?Ser?Ile?Ser?Ala?Val?Lys?Ser?Asp?Phe?Phe?Thr?Val
1 5 10 15
Glu?Ala?Ile?Ala?Val?Thr?His?His?Arg?Thr?Pro?His?Pro?Pro?His?Phe
20 25 30
Pro?Ser?Leu?Arg?Phe?Pro?Leu?Ser?Leu?Lys?Ser?Pro?Pro?Ala?Thr?Ser
35 40 45
Leu?Asn?Leu?Val?Ala?Gly?Ser?Lys?Leu?Leu?His?Phe?Ser?Arg?Arg?Leu
50 55 60
Pro?Ser?Ile?Lys?Cys?Ser?Tyr?Thr?Pro?Ser?Leu?Asp?Leu?Ser?Glu?Glu
65 70 75 80
Gln?Phe?Thr?Lys?Phe?Lys?Lys?Ala?Ser?Glu?Lys?Gly?Asn?Leu?Val?Pro
85 90 95
Leu?Phe?Arg?Cys?Val?Phe?Ser?Asp?His?Leu?Thr?Pro?Ile?Leu?Ala?Tyr
100 105 110
Arg?Cys?Leu?Val?Lys?Glu?Asp?Asp?Arg?Asp?Ala?Pro?Ser?Phe?Leu?Phe
115 120 125
Glu?Ser?Val?Glu?Pro?Gly?Ser?Gln?Ser?Ser?Asn?Ile?Gly?Arg?Tyr?Ser
130 135 140
Val?Val?Gly?Ala?Gln?Pro?Thr?Ile?Glu?Ile?Val?Ala?Lys?Gly?Asn?Val
145 150 155 160
Val?Thr?Val?Met?Asp?His?Gly?Ala?Ser?Leu?Arg?Thr?Glu?Glu?Glu?Val
165 170 175
Asp?Asp?Pro?Met?Met?Val?Pro?Gln?Lys?Ile?Met?Glu?Glu?Trp?Asn?Pro
180 185 190
Gln?Gly?Ile?Asp?Glu?Leu?Pro?Glu?Ala?Phe?Cys?Gly?Gly?Trp?Val?Gly
195 200 205
Tyr?Phe?Ser?Tyr?Asp?Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys?Leu?Pro
210 215 220
Phe?Ser?Asn?Ala?Pro?Glu?Asp?Asp?Arg?Ser?Leu?Pro?Asp?Val?Asn?Leu
225 230 235 240
Gly?Leu?Tyr?Asp?Asp?Val?Ile?Val?Phe?Asp?His?Val?Glu?Lys?Lys?Ala
245 250 255
Tyr?Val?Ile?His?Trp?Val?Arg?Ile?Asp?Lys?Asp?Arg?Ser?Val?Glu?Glu
260 265 270
Asn?Phe?Arg?Glu?Gly?Met?Asn?Arg?Leu?Glu?Ser?Leu?Thr?Ser?Arg?Ile
275 280 285
Gln?Asp?Gln?Lys?Pro?Pro?Lys?Met?Pro?Thr?Gly?Phe?Ile?Lys?Leu?Arg
290 295 300
Thr?Gln?Leu?Phe?Gly?Pro?Lys?Leu?Glu?Lys?Ser?Thr?Met?Thr?Ser?Glu
305 310 315 320
Ala?Tyr?Lys?Glu?Ala?Val?Val?Glu?Ala?Lys?Glu?His?Ile?Leu?Ala?Gly
325 330 335
Asp?Ile?Phe?Gln?Ile?Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Arg?Thr?Phe
340 345 350
Ala?Asp?Pro?Phe?Glu?Ile?Tyr?Arg?Ala?Leu?Arg?Ile?Val?Asn?Pro?Ser
355 360 365
Pro?Tyr?Met?Ala?Tyr?Leu?Gln?Val?Arg?Gly?Cys?Ile?Leu?Val?Ala?Ser
370 375 380
Ser?Pro?Glu?Ile?Leu?Leu?Arg?Ser?Lys?Asn?Arg?Lys?Ile?Thr?Asn?Arg
385 390 395 400
Pro?Leu?Ala?Gly?Thr?Val?Arg?Arg?Gly?Lys?Thr?Pro?Lys?Glu?Asp?Leu
405 410 415
Met?Leu?Glu?Lys?Glu?Leu?Leu?Ser?Asp?Glu?Lys?Gln?Cys?Ala?Glu?His
420 425 430
Ile?Met?Leu?Val?Asp?Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val?Ser?Lys
435 440 445
Pro?Gly?Ser?Val?Glu?Val?Lys?Lys?Leu?Lys?Asp?Ile?Glu?Trp?Phe?Ser
450 455 460
His?Val?Met?His?Ile?Ser?Ser?Thr?Val?Val?Gly?Glu?Leu?Leu?Asp?His
465 470 475 480
Leu?Thr?Ser?Trp?Asp?Ala?Leu?Arg?Ala?Val?Leu?Pro?Val?Gly?Thr?Val
485 490 495
Ser?Gly?Ala?Pro?Lys?Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Glu?Leu?Glu
500 505 510
Val?Thr?Arg?Arg?Gly?Pro?Tyr?Ser?Gly?Gly?Phe?Gly?Gly?Ile?Ser?Phe
515 520 525
Asn?Gly?Asp?Met?Asp?Ile?Ala?Leu?Ala?Leu?Arg?Thr?Met?Val?Phe?Pro
530 535 540
Thr?Asn?Thr?Arg?Tyr?Asp?Thr?Leu?Tyr?Ser?Tyr?Lys?His?Pro?Gln?Arg
545 550 555 560
Arg?Arg?Glu?Trp?Ile?Ala?His?Ile?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala
565 570 575
Asp?Ser?Asn?Pro?Asp?Asp?Glu?His?Arg?Glu?Cys?Glu?Asn?Lys?Ala?Ala
580 585 590
Ala?Leu?Ala?Arg?Ala?Ile?Asp?Leu?Ala?Glu?Ser?Ser?Phe?Leu?Glu?Ala
595 600 605
Pro?Glu?Phe?Thr?Thr?Ile?Thr?Pro?His?Ile?Asn?Asn?Ile?Met?Ala?Ala
610 615 620
Ser?Thr?Leu?Tyr?Lys?Ser?Cys?Leu?Leu?Gln?Pro?Lys?Ser?Gly?Ser?Thr
625 630 635 640
Thr?Arg?Arg?Leu?Asn?Pro?Ser?Leu?Val?Asn?Pro?Leu?Thr?Asn?Pro?Thr
645 650 655
Arg?Val?Ser?Val?Leu?Gly?Lys?Ser?Arg?Arg?Asp?Val?Phe?Ala?Lys?Ala
660 665 670
Ser?Ile?Glu?Met?Ala?Glu?Ser?Asn?Ser?Ile?Pro?Ser?Val?Val?Val?Asn
675 680 685
Ser?Ser?Lys?Gln?His?Gly?Pro?Ile?Ile?Val?Ile?Asp?Asn?Tyr?Asp?Ser
690 695 700
Phe?Thr?Tyr?Asn?Leu?Cys?Gln?Tyr?Met?Gly?Glu?Leu?Gly?Cys?His?Phe
705 710 715 720
Glu?Val?Tyr?Arg?Asn?Asp?Glu?Leu?Thr?Val?Glu?Glu?Leu?Lys?Lys?Lys
725 730 735
Asn?Pro?Arg?Gly?Val?Leu?Ile?Ser?Pro?Gly?Pro?Gly?Thr?Pro?Gln?Asp
740 745 750
Ser?Gly?Ile?Ser?Leu?Gln?Thr?Val?Leu?Glu?Leu?Gly?Pro?Leu?Val?Pro
755 760 765
Leu?Phe?Gly?Val?Cys?Met?Gly?Leu?Gln?Cys?Ile?Gly?Glu?Ala?Phe?Gly
770 775 780
Gly?Lys?Ile?Val?Arg?Ser?Pro?Phe?Gly?Val?Met?His?Gly?Lys?Ser?Ser
785 790 795 800
Met?Val?His?Tyr?Asp?Glu?Lys?Gly?Glu?Glu?Gly?Leu?Phe?Ser?Gly?Leu
805 810 815
Ser?Asn?Pro?Phe?Ile?Val?Gly?Arg?Tyr?His?Ser?Leu?Val?Ile?Glu?Lys
820 825 830
Asp?Thr?Phe?Pro?Ser?Asp?Glu?Leu?Glu?Val?Thr?Ala?Trp?Thr?Glu?Asp
835 840 845
Gly?Leu?Val?Met?Ala?AlaArg?His?Arg?Lys?Tyr?Lys?His?Ile?Gln?Gly
850 855 860
Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Ile?Thr?Thr?Glu?Gly?Lys?Thr?Ile
865 870 875 880
Val?Arg?Asn?Phe?Ile?Lys?Ile?Val?Glu?Lys?Lys?Glu?Ser?Glu?Lys?Leu
885 890 895
Thr
<210>46
<211>252
<212>DNA
＜213〉artificial sequence
<220>
＜223〉gene of brachymemma
<400>46
atgcaaacac?aaaaaccgac?tctcgaactg?gaattcctgg?tggaaaacgg?tatcgccacc 60
gtgcaagcgg?gtgctggtgt?agtccttgat?tctgttccgc?agtcggaagc?cgacgaaacc 120
cgtaacaaag?cccgcgctgt?actgcgcgct?attgccaccg?cgcatcatgc?acaggagact 180
ttctgatggc?tgacattctg?ctgctcgata?atatcgactc?ttttacgtac?aacctggcag 240
atcagttgcg?ca 252
<210>47
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>47
ttatgccgcc?tgtcatcg 18
<210>48
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>48
ataggcttaa?tggtaaccg 19
<210>49
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>49
ctgaacaaca?gaagtacg 18
<210>50
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>50
taaccgtgtc?atcgagcg 18
<210>51
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>51
aaaaagatct?ccatggtaac?gatcattcag?g 31
<210>52
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>52
aaaagaattc?ttatcacgcg?gccttggtct?tcgcc 35
<210>53
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>53
caaaagctgg?atccccacc 19
<210>54
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>54
cctatccgag?atctctcaac?tcc 23
<210>55
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>55
catcccatgg?atggtaacga?tcattcagga?t 31
<210>56
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>56
gatgtctaga?gacactatag?aatactcaag?c 31
<210>57
<211>719
<212>PRT
＜213〉color Rhodopseudomonas (Rhodopseudomonas palustris)
<400>57
Met?Asn?Arg?Thr?Val?Phe?Ser?Leu?Pro?Ala?Thr?Ser?Asp?Tyr?Lys?Thr
1 5 10 15
Ala?Ala?Gly?Leu?Ala?Val?Thr?Arg?Ser?Ala?Gln?Pro?Phe?Ala?Gly?Gly
20 25 30
Gln?Ala?Leu?Asp?Glu?Leu?Ile?Asp?Leu?Leu?Asp?His?Arg?Arg?Gly?Val
35 40 45
Met?Leu?Ser?Ser?Gly?Thr?Thr?Val?Pro?Gly?Arg?Tyr?Glu?Ser?Phe?Asp
50 55 60
Leu?Gly?Phe?Ala?Asp?Pro?Pro?Leu?Ala?Leu?Thr?Thr?Arg?Ala?Glu?Lys
65 70 75 80
Phe?Thr?Ile?Glu?Ala?Leu?Asn?Pro?Arg?Gly?Arg?Val?Leu?Ile?Ala?Phe
85 90 95
Leu?Ser?Asp?Lys?Leu?Glu?Glu?Pro?Cys?Val?Val?Val?Glu?Gln?Ala?Cys
100 105 110
Ala?Thr?Lys?Ile?Arg?Gly?His?Ile?Val?Arg?Gly?Glu?Ala?Pro?Val?Asp
115 120 125
Glu?Glu?Gln?Arg?Thr?Arg?Arg?Ala?Ser?Ala?Ile?Ser?Leu?Val?Arg?Ala
130 135 140
Val?Ile?Ala?Ala?Phe?Ala?Ser?Pro?Ala?Asp?Pro?Met?Leu?Gly?Leu?Tyr
145 150 155 160
Gly?Ala?Phe?Ala?Tyr?Asp?Leu?Val?Phe?Gln?Phe?Glu?Asp?Leu?Lys?Gln
165 170 175
Lys?Arg?Ala?Arg?Glu?Ala?Asp?Gln?Arg?Asp?Ile?Val?Leu?Tyr?Val?Pro
180 185 190
Asp?Arg?Leu?Leu?Ala?Tyr?Asp?Arg?Ala?Thr?Gly?Arg?Gly?Val?Asp?Ile
195 200 205
Ser?Tyr?Glu?Phe?Ala?Trp?Lys?Gly?Gln?Ser?Thr?Ala?Gly?Leu?Pro?Asn
210 215 220
Glu?Thr?Ala?Glu?Ser?Val?Tyr?Thr?Gln?Thr?Gly?Arg?Gln?Gly?Phe?Ala
225 230 235 240
Asp?His?Ala?Pro?Gly?Asp?Tyr?Pro?Lys?Val?Val?Glu?Lys?Ala?Arg?Ala
245 250 255
Ala?Phe?Ala?Arg?Gly?Asp?Leu?Phe?Glu?Ala?Val?Pro?Gly?Gln?Leu?Phe
260 265 270
Gly?Glu?Pro?Cys?Glu?Arg?Ser?Pro?Ala?Glu?Val?Phe?Lys?Arg?Leu?Cys
275 280 285
Arg?Ile?Asn?Pro?Ser?Pro?Tyr?Gly?Gly?Leu?Leu?Asn?Leu?Gly?Asp?Gly
290 295 300
Glu?Phe?Leu?Val?Ser?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Ser?Asp?Gly
305 310 315 320
Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Ala?Arg?Gly?Val
325 330 335
Asp?Ala?Ile?Ser?Asp?Ala?Glu?Gln?Ile?Gln?Lys?Leu?Leu?Asn?Ser?Glu
340 345 350
Lys?Asp?Glu?Phe?Glu?Leu?Asn?Met?Cys?Thr?Asp?Val?Asp?Arg?Asn?Asp
355 360 365
Lys?Ala?Arg?Val?Cys?Val?Pro?Gly?Thr?Ile?Lys?Val?Leu?Ala?Arg?Arg
370 375 380
Gln?Ile?Glu?Thr?Tyr?Ser?Lys?Leu?Phe?His?Thr?Val?Asp?His?Val?Glu
385 390 395 400
Gly?Met?Leu?Arg?Pro?Gly?Phe?Asp?Ala?Leu?Asp?Ala?Phe?Leu?Thr?His
405 410 415
Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met?Gln
420 425 430
Phe?Val?Glu?Asp?His?Glu?Arg?Ser?Pro?Arg?Arg?Trp?Tyr?Ala?Gly?Ala
435 440 445
Phe?Gly?Val?Val?Gly?Phe?Asp?Gly?Ser?Ile?Asn?Thr?Gly?Leu?Thr?Ile
450 455 460
Arg?Thr?Ile?Arg?Met?Lys?Asp?Gly?Leu?Ala?Glu?Val?Arg?Val?Gly?Ala
465 470 475 480
Thr?Cys?Leu?Phe?Asp?Ser?Asn?Pro?Val?Ala?Glu?Asp?Lys?Glu?Cys?Gln
485 490 495
Val?Lys?Ala?Ala?Ala?Leu?Phe?Gln?Ala?Leu?Arg?Gly?Asp?Pro?Ala?Lys
500 505 5l0
Pro?Leu?Ser?Ala?Val?Ala?Pro?Asp?Ala?Thr?Gly?Ser?Gly?Lys?Lys?Val
515 520 525
Leu?Leu?Val?Asp?His?Asp?Asp?Ser?Phe?Val?His?Met?Leu?Ala?Asp?Tyr
530 535 540
Phe?Arg?Gln?Val?Gly?Ala?Gln?Val?Thr?Val?Val?Arg?Tyr?Val?His?Gly
545 550 555 560
Leu?Lys?Met?Leu?Ala?Glu?Asn?Ser?Tyr?Asp?Leu?Leu?Val?Leu?Ser?Pro
565 570 575
Gly?Pro?Gly?Arg?Pro?Glu?Asp?Phe?Lys?Ile?Lys?Asp?Thr?Ile?Asp?Ala
580 585 590
Ala?Leu?Ala?Lys?Lys?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu?Gly?Val?Gln
595 600 605
Ala?Met?Gly?Glu?Tyr?Phe?Gly?Gly?Thr?Leu?Gly?Gln?Leu?Ala?Gln?Pro
610 615 620
Ala?His?Gly?Arg?Pro?Ser?Arg?Ile?Gln?Val?Arg?Gly?Gly?Ala?Leu?Met
625 630 635 640
Arg?Gly?Leu?Pro?Asn?Glu?Val?Thr?Ile?Gly?Arg?Tyr?His?Ser?Leu?Tyr
645 650 655
Val?Asp?Met?Arg?Asp?Met?Pro?Lys?Glu?Leu?Thr?Val?Thr?Ala?Ser?Thr
660 665 670
Asp?Asp?Gly?Ile?Ala?Met?Ala?Ile?Glu?His?Lys?Thr?Leu?Pro?Val?Gly
675 680 685
Gly?Val?Gln?Phe?His?Pro?Glu?Ser?Leu?Met?Ser?Leu?Gly?Gly?Glu?Val
690 695 700
Gly?Leu?Arg?Ile?Val?Glu?Asn?Ala?Phe?Arg?Leu?Gly?Gln?Ala?Ala
705 710 715
<210>58
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>58
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Phe
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>59
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>59
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Tyr
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>60
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>60
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Phe?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>61
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>61
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Cys?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>62
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>62
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?6lu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Phe?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495 Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>63
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>63
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Ala?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>64
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>64
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Ash?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Gly?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>65
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>65
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Trp?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>66
<211>604
<212>PRT
＜213〉artificial sequence
<220>
＜223〉maize mutant body
<400>66
Met?Glu?Ser?Leu?Ala?Ala?Thr?Ser?Val?Phe?Ala?Pro?Ser?Arg?Val?Ala
1 5 10 15
Val?Pro?Ala?Ala?Arg?Ala?Leu?Val?Arg?Ala?Gly?Thr?Val?Val?Pro?Thr
20 25 30
Arg?Arg?Thr?Ser?Ser?Arg?Ser?Gly?Thr?Ser?Gly?Val?Lys?Cys?Ser?Ala
35 40 45
Ala?Val?Thr?Pro?Gln?Ala?Ser?Pro?Val?Ile?Ser?Arg?Ser?Ala?Ala?Ala
50 55 60
Ala?Lys?Ala?Ala?Glu?Glu?Asp?Lys?Arg?Arg?Phe?Phe?Glu?Ala?Ala?Ala
65 70 75 80
Arg?Gly?Ser?Gly?Lys?Gly?Asn?Leu?Val?Pro?Met?Trp?Glu?Cys?Ile?Val
85 90 95
Ser?Asp?His?Leu?Thr?Pro?Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val?Pro?Glu
100 105 110
Asp?Asn?Val?Asp?Ala?Pro?Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu?Gln?Gly
115 120 125
Pro?Gln?Gly?Thr?Thr?Asn?Val?Gly?Arg?Tyr?Ser?Met?Val?Gly?Ala?His
130 135 140
Pro?Val?Met?Glu?Ile?Val?Ala?Lys?Asp?His?Lys?Val?Thr?Ile?Met?Asp
145 150 155 160
His?Glu?Lys?Ser?Gln?Val?Thr?Glu?Gln?Val?Val?Asp?Asp?Pro?Met?Gln
165 170 175
Ile?Pro?Arg?Thr?Met?Met?Glu?Gly?Trp?His?Pro?Gln?Gln?Ile?Asp?Glu
180 185 190
Leu?Pro?Glu?Ser?Phe?Ser?Gly?Gly?Trp?Val?Gly?Phe?Phe?Ser?Tyr?Asp
195 200 205
Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys?Leu?Pro?Phe?Ser?Ser?Ala?Pro
210 215 220
Gln?Asp?Asp?Arg?Asn?Leu?Pro?Asp?Val?His?Leu?Gly?Leu?Tyr?Asp?Asp
225 230 235 240
Val?Leu?Val?Phe?Asp?Asn?Val?Glu?Lys?Lys?Val?Tyr?Val?Ile?His?Trp
245 250 255
Val?Asn?Val?Asp?Arg?His?Ala?Ser?Val?Glu?Glu?Ala?Tyr?Gln?Asp?Gly
260 265 270
Arg?Ser?Arg?Leu?Asn?Met?Leu?Leu?Ser?Lys?Val?His?Asn?Ser?Asn?Val
275 280 285
Pro?Thr?Leu?Ser?Pro?Gly?Phe?Val?Lys?Leu?His?Thr?Arg?Lys?Phe?Gly
290 295 300
Thr?Pro?Leu?Asn?Lys?Ser?Thr?Met?Thr?Ser?Asp?Glu?Tyr?Lys?Asn?Ala
305 310 315 320
Val?Leu?Gln?Ala?Lys?Glu?His?Ile?Met?Ala?Gly?Asp?Ile?Phe?Gln?Ile
325 330 335
Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Arg?Thr?Tyr?Ala?Asn?Pro?Phe?Glu
340 345 350
Val?Tyr?Arg?Ala?Leu?Arg?Ile?Val?Asn?Pro?Ser?Pro?Tyr?Lys?Ala?Tyr
355 360 365
Val?Gln?Ala?Arg?Gly?Cys?Val?Leu?Val?Ala?Ser?Ser?Pro?Glu?Ile?Leu
370 375 380
Thr?Arg?Val?Ser?Lys?Gly?Lys?Ile?Ile?Asn?Arg?Pro?Leu?Ala?Gly?Thr
385 390 395 400
Val?Arg?Arg?Gly?Lys?Thr?Glu?Lys?Glu?Asp?Gln?Met?Gln?Glu?Gln?Gln
405 410 415
Leu?Leu?Ser?Asp?Glu?Lys?Gln?Cys?Ala?Glu?His?Ile?Met?Leu?Val?Asp
420 425 430
Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val?Ser?Lys?Pro?Gly?Ser?Val?Lys
435 440 445
Val?Glu?Lys?Leu?Met?Asn?Ile?Glu?Arg?Tyr?Ser?His?Val?Met?His?Ile
450 455 460
Ser?Ser?Thr?Val?Ser?Gly?Gln?Leu?Asp?Asp?His?Leu?Gln?Ser?Trp?Asp
465 470 475 480
Ala?Leu?Arg?Ala?Ala?Leu?Pro?Val?Gly?Thr?Val?Ser?Gly?Ala?Pro?Lys
485 490 495
Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Lys?Leu?Glu?Val?Thr?Arg?Arg?Gly
500 505 510
Pro?Tyr?Ser?Gly?Gly?Leu?Gly?Gly?Ile?Ser?Phe?Asp?Gly?Asp?Met?Gln
515 520 525
Ile?Ala?Leu?Ser?Leu?Arg?Thr?Ile?Val?Phe?Ser?Thr?Ala?Pro?Ser?His
530 535 540
Asn?Thr?Met?Tyr?Ser?Tyr?Lys?Asp?Ala?Asp?Arg?Arg?Arg?Glu?Trp?Val
545 550 555 560
Ala?His?Leu?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala?Asp?Ser?Ser?Pro?Asp
565 570 575
Asp?Glu?Gln?Arg?Glu?Cys?Glu?Asn?Lys?Ala?Ala?Ala?Leu?Ala?Arg?Ala
580 585 590
Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Val?Asp?Lys?Glu
595 600
<210>67
<211>1815
<212>DNA
＜213〉artificial sequence
<220>
＜223〉maize mutant body
<400>67
atggaatccc?tagccgccac?ctccgtgttc?gcgccctccc?gcgtcgccgt?cccggcggcg 60
cgggccctgg?ttagggcggg?gacggtggta?ccaaccaggc?ggacgagcag?ccggagcgga 120
accagcgggg?tgaaatgctc?tgctgccgtg?acgccgcagg?cgagcccagt?gattagcagg 180
agcgctgcgg?cggcgaaggc?ggcggaggag?gacaagaggc?ggttcttcga?ggcggcggcg 240
cgggggagcg?ggaaggggaa?cctggtgccc?atgtgggagt?gcatcgtgtc?ggaccatctc 300
acccccgtgc?tcgcctaccg?ctgcctcgtc?cccgaggaca?acgtcgacgc?ccccagcttc 360
ctcttcgagt?ccgtcgagca?ggggccccag?ggcaccacca?acgtcggccg?ctatagcatg 420
gtgggagccc?acccagtgat?ggagattgtg?gccaaagacc?acaaggttac?gatcatggac 480
cacgagaaga?gccaagtgac?agagcaggta?gtggacgacc?cgatgcagat?cccgaggacc 540
atgatggagg?gatggcaccc?acagcagatc?gacgagctcc?ctgaatcctt?ctccggtgga 600
tgggttgggt?tcttttccta?tgatacggtt?aggtatgttg?agaagaagaa?gctaccgttc 660
tccagtgctc?ctcaggacga?taggaacctt?cctgatgtgc?acttgggact?ctatgatgat 720
gttctagtct?tcgataatgt?tgagaagaaa?gtatatgtta?tccattgggt?caatgtggac 780
cggcatgcat?ctgttgagga?agcataccaa?gatggcaggt?cccgactaaa?catgttgcta 840
tctaaagtgc?acaattccaa?tgtccccaca?ctctctcctg?gatttgtgaa?gctgcacaca 900
cgcaagtttg?gtacaccttt?gaacaagtcg?accatgacaa?gtgatgagta?taagaatgct 960
gttctgcagg?ctaaggaaca?tattatggct?ggggatatct?tccagattgt?tttaagccag 1020
aggttcgaga?gacgaacata?tgccaaccca?tttgaggttt?atcgagcatt?acggattgtg 1080
aatcctagcc?catacaaggc?gtatgtacag?gcaagaggct?gtgtattggt?tgcgtctagt 1140
cctgaaattc?ttacacgagt?cagtaagggg?aagattatta?atcgaccact?tgctggaact 1200
gttcgaaggg?gcaagacaga?gaaggaagat?caaatgcaag?agcagcaact?gttaagtgat 1260
gaaaaacagt?gtgccgagca?cataatgctt?gtggacttgg?gaaggaatga?tgttggcaag 1320
gtatccaaac?caggatcagt?gaaggtggag?aagttgatga?acattgagag?atactcccat 1380
gttatgcaca?tcagctcaac?ggttagtgga?cagttggatg?atcatctcca?gagttgggat 1440
gccttgagag?ctgccttgcc?cgttggaaca?gtcagtggtg?caccaaaggt?gaaggccatg 1500
gagttgattg?ataagttgga?agttacgagg?cgaggaccat?atagtggtgg?tctaggagga 1560
atatcgtttg?atggtgacat?gcaaattgca?ctttctctcc?gcaccatcgt?attctcaaca 1620
gcgccgagcc?acaacacgat?gtactcatac?aaagacgcag?ataggcgtcg?ggagtgggtc 1680
gctcatcttc?aggctggtgc?aggcattgtt?gccgacagta?gcccagatga?cgaacaacgt 1740
gaatgcgaga?ataaggctgc?tgcactagct?cgggccatcg?atcttgcaga?gtcagctttt 1800
gtagacaaag?aatag 1815
<210>68
<211>2204
<212>DNA
＜213〉artificial sequence
<220>
＜223〉maize mutant body
<400>68
atggaatccc?tagccgccac?ctccgtgttc?gcgccctccc?gcgtcgccgt?cccggcggcg 60
cgggccctgg?ttagggcggg?gacggtggta?ccaaccaggc?ggacgagcag?ccggagcgga 120
accagcgggg?tgaaatgctc?tgctgccgtg?acgccgcagg?cgagcccagt?gattagcagg 180
agcgctgcgg?cggcgaaggc?ggcggaggag?gacaagaggc?ggttcttcga?ggcggcggcg 240
cgggggagcg?ggaaggggaa?cctggtgccc?atgtgggagt?gcatcgtgtc?ggaccatctc 300
acccccgtgc?tcgcctaccg?ctgcctcgtc?cccgaggaca?acgtcgacgc?ccccagcttc 360
ctcttcgagt?ccgtcgagca?ggggccccag?ggcaccacca?acgtcggccg?ctatagcatg 420
gtgggagccc?acccagtgat?ggagattgtg?gccaaagacc?acaaggttac?gatcatggac 480
cacgagaaga?gccaagtgac?agagcaggta?gtggacgacc?cgatgcagat?cccgaggacc 540
atgatggagg?gatggcaccc?acagcagatc?gacgagctcc?ctgaatcctt?ctccggtgga 600
tgggttgggt?tcttttccta?tgatacggtt?aggtatgttg?agaagaagaa?gctaccgttc 660
tccagtgctc?ctcaggacga?taggaacctt?cctgatgtgc?acttgggact?ctatgatgat 720
gttctagtct?tcgataatgt?tgagaagaaa?gtatatgtta?tccattgggt?caatgtggac 780
cggcatgcat?ctgttgagga?agcataccaa?gatggcaggt?cccgactaaa?catgttgcta 840
tctaaagtgc?acaattccaa?tgtccccaca?ctctctcctg?gatttgtgaa?gctgcacaca 900
cgcaagtttg?gtacaccttt?gaacaagtcg?accatgacaa?gtgatgagta?taagaatgct 960
gttctgcagg?ctaaggaaca?tattatggct?ggggatatct?tccagattgt?tttaagccag 1020
aggttcgaga?gacgaacata?tgccaaccca?tttgaggttt?atcgagcatt?acggattgtg 1080
aatcctagcc?catacaaggc?gtatgtacag?gcaagaggct?gtgtattggt?tgcgtctagt 1140
cctgaaattc?ttacacgagt?cagtaagggg?aagattatta?atcgaccact?tgctggaact 1200
gttcgaaggg?gcaagacaga?gaaggaagat?caaatgcaag?agcagcaact?gttaagtgat 1260
gaaaaacagt?gtgccgagca?cataatgctt?gtggacttgg?gaaggaatga?tgttggcaag 1320
gtatccaaac?caggatcagt?gaaggtggag?aagttgatga?acattgagag?atactcccat 1380
gttatgcaca?tcagctcaac?ggttagtgga?cagttggatg?atcatctcca?gagttgggat 1440
gccttgagag?ctgccttgcc?cgttggaaca?gtcagtggtg?caccaaaggt?gaaggccatg 1500
gagttgattg?ataagttgga?agttacgagg?cgaggaccat?atagtggtgg?tctaggagga 1560
atatcgtttg?atggtgacat?gcaaattgca?ctttctctcc?gcaccatcgt?attctcaaca 1620
gcgccgagcc?acaacacgat?gtactcatac?aaagacgcag?ataggcgtcg?ggagtgggtc 1680
gctcatcttc?aggctggtgc?aggcattgtt?gccgacagta?gcccagatga?cgaacaacgt 1740
gaatgcgaga?ataaggctgc?tgcactagct?cgggccatcg?atcttgcaga?gtcagctttt 1800
gtagacaaag?aatagtgtgc?tatggttatc?gtttagttct?tgttcatgtt?tcttttaccc 1860
actttccgtt?aaaaaaagat?gtcattagtg?ggtggagaaa?agcaataaga?ctgttctcta 1920
gaattcgagc?tcggtaccgg?atccaattcc?cgatcgttca?aacatttggc?aataaagttt 1980
cttaagattg?aatcctgttg?ccggtcttgc?gatgattatc?atataatttc?tgttgaatta 2040
cgttaagcat?gtaataatta?acatgtaatg?catgacgtta?tttatgagat?gggtttttat 2100
gattagagtc?ccgcaattat?acatttaata?cgcgatagaa?aacaaaatat?agcgcgcaaa 2160
ctaggataaa?ttatcgcgcg?cggtgtcatc?tatgttacta?gatc 2204
<210>69
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>69
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Lys?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cy8?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>70
<211>729
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>70
Met?Val?Thr?Ile?Ile?Gln?Asp?Asp?Gly?Ala?Glu?Thr?Tyr?Glu?Thr?Lys
1 5 10 15
Gly?Gly?Ile?Gln?Val?Ser?Arg?Lys?Arg?Arg?Pro?Thr?Asp?Tyr?Ala?Asn
20 25 30
Ala?Ile?Asp?Asn?Tyr?Ile?Glu?Lys?Leu?Asp?Ser?His?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Leu?Gly?Ile?Ser?Cys?Phe?Gly?Arg?Lys?Met
65 70 75 80
Trp?Ile?Glu?Ala?Tyr?Asn?Gly?Arg?Gly?Glu?Val?Leu?Leu?Asp?Phe?Ile
85 90 95
Thr?Glu?Lys?Leu?Lys?Ala?Thr?Pro?Asp?Leu?Thr?Leu?Gly?Ala?Ser?Ser
100 105 110
Thr?Arg?Arg?Leu?Asp?Leu?Thr?Val?Asn?Glu?Pro?Asp?Arg?Val?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Lys?Ile?Pro?Thr?Val?Phe?Thr?Ala?Leu?Arg?Ala
130 135 140
Ile?Val?Asp?Leu?Phe?Tyr?Ser?Ser?Ala?Asp?Ser?Ala?Ile?Gly?Leu?Phe
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Ala?Ile?Lys?Leu
165 170 175
Ser?Leu?Ala?Arg?Pro?Glu?Asp?Gln?Arg?Asp?Met?Val?Leu?Phe?Leu?Pro
180 185 190
Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys?Ala?Trp?Ile?Asp
195 200 205
Arg?Tyr?Asp?Phe?Glu?Lys?Asp?Gly?Met?Thr?Thr?Asp?Gly?Lys?Ser?Ser
210 215 220
Asp?Ile?Thr?Pro?Asp?Pro?Phe?Lys?Thr?Thr?Asp?Thr?Ile?Pro?Pro?Lys
225 230 235 240
Gly?Asp?His?Arg?Pro?Gly?Glu?Tyr?Ser?Glu?Leu?Val?Val?Lys?Ala?Lys
245 250 255
Glu?Ser?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Lys
260 265 270
Phe?Met?Glu?Arg?Cys?Glu?Ser?Asn?Pro?Ser?Ala?Ile?Ser?Arg?Arg?Leu
275 280 285
Lys?Ala?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Ala?Phe?Ile?Asn?Leu?Gly?Asp
290 295 300
Gln?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Ser
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Asp?Asp?Pro?Ile?Ala?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Asp?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 410 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Ile?Glu?Gly?His?Glu?Lys?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Val?Gly?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu?Val?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Asn?Asp?Ser?Asn?Pro?Gln?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ser?Ala?Ile?Arg?Asp?Ala?Lys?Gly
500 505 510
Thr?Asn?Ser?Ala?Ala?Thr?Lys?Arg?Asp?Ala?Ala?Lys?Val?Gly?Thr?Gly
515 520 525
Val?Lys?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Thr?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Ala?Asp?Val?Phe?Asp?Arg?Phe?Gln?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Thr?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Lys?Ala?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu?Leu?Arg?Gln?Leu
610 615 620
Ala?Val?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Leu?Glu?Pro
625 630 635 640
Gly?Leu?Val?Phe?Ser?Gly?Leu?Gly?Lys?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Ala?Thr?Leu?Pro?Arg?Asp?Phe?Ile?Ile
660 665 670
Thr?Ala?Glu?Ser?Glu?Asp?Gly?Thr?Ile?Met?Gly?Ile?Glu?His?Ala?Lys
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?Gln?Asp?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Val?Val?Val?His?Leu
705 710 715 720
Thr?Arg?Lys?Ala?Lys?Thr?Lys?Ala?Ala
725
<210>71
<211>264
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequence of CTP
<400>71
atggcttcct?ctatgctctc?ttccgctact?atggttgcct?ctccggctca?ggccactatg 60
gtcgctcctt?tcaacggact?taagtcctcc?gctgccttcc?cagccacccg?caaggctaac 120
aacgacatta?cttccatcac?aagcaacggc?ggaagagtta?actgcatgca?ggtgtggcct 180
ccgattggaa?agaagaagtt?tgagactctc?tcttaccttc?ctgaccttac?cgattccggt 240
ggtcgcgtca?actgcatgca?ggcc 264
<210>72
<211>88
<212>PRT
＜213〉artificial sequence
<220>
＜223〉sequence of CTP
<400>72
Met?Ala?Ser?Ser?Met?Leu?Ser?Ser?Ala?Thr?Met?Val?Ala?Ser?Pro?Ala
1 5 10 15
Gln?Ala?Thr?Met?Val?Ala?Pro?Phe?Asn?Gly?Leu?Lys?Ser?Ser?Ala?Ala
20 25 30
Phe?Pro?Ala?Thr?Arg?Lys?Ala?Asn?Asn?Asp?Ile?Thr?Ser?Ile?Thr?Ser
35 40 45
Asn?Gly?Gly?Arg?Val?Asn?Cys?Met?Gln?Val?Trp?Pro?Pro?Ile?Gly?Lys
50 55 60
Lys?Lys?Phe?Glu?Thr?Leu?Ser?Tyr?Leu?Pro?Asp?Leu?Thr?Asp?Ser?Gly
65 70 75 80
Gly?Arg?Val?Asn?Cys?Met?Gln?Ala
85
<210>73
<211>264
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequence of CTP
<400>73
atggcttcct?ctatgctctc?ttccgctact?atggttgcct?ctccggctca?ggccactatg 60
gtcgctcctt?tcaacggact?taagtcctcc?gctgccttcc?cagccacccg?caaggctaac 120
aacgacatta?cttccatcac?aagcaacggc?ggaagagtta?actgcatgca?ggtgtggcct 180
ccgattgaaa?agaagaagtt?tgagactctc?tcttaccttc?ctgaccttac?cgattccggt 240
ggtcgcgtca?actgcatgca?ggcc 264
<210>74
<211>88
<212>PRT
＜213〉artificial sequence
<220>
＜223〉sequence of CTP
<400>74
Met?Ala?Ser?Ser?Met?Leu?Ser?Ser?Ala?Thr?Met?Val?Ala?Ser?Pro?Ala
1 5 10 15
Gln?Ala?Thr?Met?Val?Ala?Pro?Phe?Asn?Gly?Leu?Lys?Ser?Ser?Ala?Ala
20 25 30
Phe?Pro?Ala?Thr?Arg?Lys?Ala?Asn?Asn?Asp?Ile?Thr?Ser?Ile?Thr?Ser
35 40 45
Asn?Gly?Gly?Arg?Val?Asn?Cys?Met?Gln?Val?Trp?Pro?Pro?Ile?Glu?Lys
50 55 60
Lys?Lys?Phe?Glu?Thr?Leu?Ser?Tyr?Leu?Pro?Asp?Leu?Thr?Asp?Ser?Gly
65 70 75 80
Gly?Arg?Val?Asn?Cys?Met?Gln?Ala
85
<210>75
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens of You Huaing
<400>75
atggtgacca?tcattcagga?tgacggtgcc?gagacctacg?agaccaaggg?cggcatccag 60
gtgagccgca?agcgccgccc?caccgattac?gccaacgcca?tcgataacta?catcgaaaag 120
cttgattccc?atcgcggtgc?cgtgttctcc?tccaactacg?aatacccagg?ccgctacacc 180
cgctgggata?ccgccatcgt?cgatccacca?ctcggcattt?cctgcttcgg?ccgcaagatg 240
tggatcgaag?cctacaacgg?ccgcggcgaa?gtgctgctcg?atttcattac?cgaaaagctg 300
aaggccacac?ccgatctcac?cctcggcgct?tcctccaccc?gccgcctcga?tcttaccgtc 360
aacgaaccag?accgcgtctt?caccgaagaa?gaacgctcca?aaatcccaac?cgtcttcacc 420
gctctcaggg?ccatcgtcga?cctcttctac?tccagcgccg?attccgccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcca?tcaagctttc?cctggcccgc 540
ccagaagacc?agcgcgacat?ggtgctgttc?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tactccgcca?aggcetggat?cgaccgctac?gatttcgaga?aggacggcat?gaccaccgac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccacccaag 720
ggcgatcacc?gccccggcga?atactccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgctg?cgaaagcaac 840
ccatccgcca?tttcccgccg?cctgaaggcc?atcaacccat?ccccctactc?cttcttcatc 900
aacctcggcg?atcaggaata?cctggtcggc?gcctccccag?aaatgttcgt?gcgcgtctcc 960
ggccgccgca?tcgagacctg?cccaatctca?ggcaccatca?agcgcggcga?cgatccaatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactccaaaa?aggacgaatc?cgaactgacc 1080
atgtgctccg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccagg?ttccgtgaag 1140
gtcattggcc?gccgccagat?cgagatgtac?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?ttcgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccacgcg?cctggtacgg?cggtgccatc?ggcatggtcg?gcttcaacgg?cgacatgaac 1380
accggcctga?ccctgcgcac?catccgcatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gccaccctgc?tcaacgattc?caacccacag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tctcagccat?tcgcgacgca?aaaggcacca?actctgccgc?caccaagcgc 1560
ga?tgccgccaaagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacaccc?tggccaacta?cttccgccag?accggcgcca?ccgtctccac?cgtcaggtca 1680
ccagtcgcag?ccgacgtgtt?cgatcgcttc?cagccagacc?tcgttgtcct?gtcccccggt 1740
cccggcagcc?caaccgattt?cgactgcaag?gcaaccatca?aggccgcccg?cgcccgcgat 1800
ctgccaatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?cggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttccc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcaccgtcg?gtcgctacca?ttccatcttc 1980
gccgatcccg?ccaccctgcc?acgcgatttc?atcatcaccg?cagaaagcga?ggacggcacc 2040
atcatgggca?tcgaacacgc?caaggaacca?gtggccgccg?ttcagttcca?cccagaatcc 2100
atcatgaccc?tcggtcagga?cgccggcatg?cgcatgatcg?agaacgtcgt?ggtgcatctg 2160
acccgcaagg?ccaagaccaa?ggccgcctga 2190
<210>76
<211>2160
<212>DNA
＜213〉color Rhodopseudomonas
(400>76
atgaacagga?ccgttttctc?gcttcccgcg?accagcgact?ataagaccgc?cgcgggcctc 60
gcggtgacgc?gcagcgccca?gccttttgcc?ggcggccagg?cgctcgacga?gctgatcgat 120
ctgctcgacc?accgccgcgg?cgtgatgctg?tcgtccggca?caaccgtgcc?gggccgctac 180
gagagcttcg?acctcggctt?tgccgatccg?ccgctggcgc?tcaccactag?ggccgaaaaa 240
ttcaccatcg?aggcgctcaa?tccgcgcggc?cgggtgctga?tcgcgttcct?gtccgacaag 300
cttgaagagc?cctgcgtggt?ggtggagcag?gcctgcgcca?ccaagatcag?gggccacatc 360
gtccgcggcg?aggccccggt?cgacgaagaa?caacgcaccc?gccgcgccag?cgcgatctcc 420
ctggtgcgcg?cggtgattgc?tgccttcgcc?tcgccggccg?atccgatgct?cgggctgtac 480
ggcgccttcg?cctacgacct?tgtgttccag?ttcgaggatc?tgaagcagaa?gcgtgcccgc 540
gaagccgacc?agcgcgacat?cgtgctgtac?gtgccggatc?gcctgctggc?ctacgatcgc 600
gccaccggcc?gcggcgtcga?catttcctac?gaattcgcct?ggaagggcca?gtccaccgcc 660
ggcctgccga?acgagaccgc?cgagagcgtc?tacacccaga?ccggccggca?gggtttcgcc 720
gaccacgccc?cgggcgacta?tcccaaggtg?gtcgagaagg?cccgcgcggc?gttcgcccgc 780
ggcgacctgt?tcgaggcggt?gccgggccag?ctgttcggcg?agccatgcga?gcggtcgccg 840
gccgaagtgt?tcaagcggtt?gtgccggatc?aacccgtcgc?cctatggcgg?cctgctcaat 900
ctcggcgacg?gcgaattcct?ggtgtcggcc?tcgccggaaa?tgttcgtccg?ctcggacggc 960
cgccggatcg?agacctgccc?gatctccggc?actatcgccc?gcggcgtcga?tgcgatcagc 1020
gatgctgagc?agatccagaa?gctcttgaac?tccgagaagg?acgagttcga?gctgaatatg 1080
tgcaccgacg?tcgaccgcaa?cgacaaggcg?cgggtctgcg?tgccgggcac?gatcaaagtt 1140
ctcgcgcgcc?gccagatcga?gacctattcg?aagctgttcc?acaccgtcga?tcacgtcgag 1200
ggcatgctgc?gaccgggttt?cgacgcgctc?gacgccttcc?tcacccacgc?ctgggcggtc 1260
accgtcaccg?gcgcgccgaa?gctgtgggcg?atgcagttcg?tcgaggatca?cgagcgtagc 1320
ccgcggcgct?ggtatgccgg?cgcgttcggc?gtggtcggct?tcgatggctc?gatcaacacc 1380
ggcctcacca?tccgcaccat?ccggatgaag?gacggcctcg?ccgaagttcg?cgtcggcgcc 1440
acctgcctgt?tcgacagcaa?tccggtcgcc?gaggacaagg?aatgccaggt?caaggccgcg 1500
gcactgttcc?aggcgctgcg?cggcgatccc?gccaagccgc?tgtcggcggt?ggcgccggac 1560
gccactggct?cgggcaagaa?ggtgctgctg?gtcgaccacg?acgacagctt?cgtgcacatg 1620
ctggcggact?atttcaggca?ggtcggcgcc?caggtcaccg?tggtgcgcta?cgttcacggc 1680
ctgaagatgc?tggccgaaaa?cagctatgat?cttctggtgc?tgtcgcccgg?tcccggccgg 1740
ccggaggact?tcaagatcaa?ggatacgatc?gacgccgcgc?tcgccaagaa?gctgccgatc 1800
ttcggcgtct?gcctcggcgt?ccaggcgatg?ggcgaatatt?ttggcggtac?gctcggccag 1860
ctcgcgcagc?cggctcacgg?ccgcccgtcg?cggattcagg?tgcgcggcgg?cgcgctgatg 1920
cgcggtctcc?cgaacgaggt?caccatcggc?cgctaccact?cgctctatgt?cgacatgcgc 1980
gacatgccga?aggagctgac?cgtcaccgcc?tccaccgatg?acggcatcgc?gatggcgatc 2040
gagcacaaga?ccctgccggt?cggcggcgtg?cagttccacc?ccgagtcgct?gatgtcgctc 2100
ggcggcgagg?tcgggctgcg?gatcgtcgaa?aacgccttcc?ggctcggcca?ggcggcctaa 2160
<210>77
<211>733
<212>PRT
<213>Mesorhizobium?loti
<400>77
Met?Glu?Thr?Ala?Met?Thr?Met?Lys?Val?Leu?Glu?Asn?Gly?Ala?Glu?Ser
1 5 10 15
Phe?Val?Thr?Ala?Gly?Gly?Ile?Thr?Ile?Thr?Arg?Glu?Arg?His?Asp?Arg
20 25 30
Pro?Tyr?Ala?Gly?Ala?Ile?Asp?Ala?Tyr?Val?Asp?Gly?Leu?Asn?Ser?Arg
35 40 45
Arg?Gly?Ala?Val?Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr
50 55 60
Arg?Trp?Asp?Thr?Ala?Ile?Ile?Asp?Pro?Pro?Leu?Val?Ile?Ser?Ala?Arg
65 70 75 80
Gly?Arg?Ala?Met?Arg?Ile?Glu?Ala?Leu?Asn?Arg?Arg?Gly?Glu?Ala?Leu
85 90 95
Leu?Pro?Val?Ile?Gly?Lys?Thr?Leu?Gly?Gly?Leu?Ala?Asp?Ile?Thr?Ile
100 105 110
Ala?Glu?Thr?Thr?Lys?Thr?Leu?Ile?Arg?Leu?Asp?Val?Ala?Lys?Pro?Gly
115 120 125
Arg?Val?Phe?Thr?Glu?Glu?Glu?Arg?Ser?Arg?Val?Pro?Ser?Val?Phe?Thr
130 135 140
Val?Leu?Arg?Ala?Ile?Thr?Ala?Leu?Phe?Lys?Thr?Asp?Glu?Asp?Ala?Asn
145 150 155 160
Leu?Gly?Leu?Tyr?Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ser?Phe?Gln?Phe?Asp
165 170 175
Pro?Val?Asp?Tyr?Lys?Leu?Glu?Arg?Lys?Pro?Ser?Gln?Arg?Asp?Leu?Val
180 185 190
Leu?Phe?Leu?Pro?Asp?Glu?Ile?Leu?Val?Val?Asp?His?Tyr?Ser?Ala?Lys
195 200 205
Ala?Trp?Thr?Asp?Arg?Tyr?Asp?Tyr?Ser?Gly?Glu?Gly?Phe?Ser?Thr?Glu
210 215 220
Gly?Leu?Pro?Arg?Asp?Ala?Ile?Ala?Glu?Pro?Phe?Lys?Thr?Ala?Asp?Arg
225 230 235 240
Ile?Pro?Pro?Arg?Gly?Asp?His?Glu?Pro?Gly?Glu?Tyr?Ala?Asn?Leu?Val
245 250 255
Arg?Arg?Ala?Met?Asp?Ser?Phe?Lys?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val
260 265 270
Pro?Gly?Gln?Met?Phe?Tyr?Glu?Arg?Cys?Glu?Thr?Gln?Pro?Ser?Asp?Ile
275 280 285
Ser?Arg?Lys?Leu?Lys?Ser?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile
290 295 300
Asn?Leu?Gly?Glu?Asn?Glu?Tyr?Leu?Ile?Gly?Ala?Ser?Pro?Glu?Met?Phe
305 310 315 320
Val?Arg?Val?Asn?Gly?Arg?Arg?Val?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr
325 330 335
Ile?Lys?Arg?Gly?Asp?Asp?Ala?Ile?Ser?Asp?Ser?Glu?Gln?Ile?Leu?Lys
340 345 350
Leu?Leu?Asn?Ser?Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp
355 360 365
Val?Asp?Arg?Asn?Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Arg
370 375 380
Val?Ile?Gly?Arg?Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr
385 390 395 400
Val?Asp?His?Ile?Glu?Gly?Arg?Leu?Arg?Glu?Gly?Met?Asp?Ala?Phe?Asp
405 410 415
Ala?Phe?Leu?Ser?His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys
420 425 430
Leu?Trp?Ala?Met?Arg?Phe?Ile?Glu?Gln?Asn?Glu?Lys?Ser?Pro?Arg?Ala
435 440 445
Trp?Tyr?Gly?Gly?Ala?Ile?Gly?Met?Val?Asn?Phe?Asn?Gly?Asp?Met?Asn
450 455 460
Thr?Gly?Leu?Thr?Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Ile?Ala?Glu
465 470 475 480
Val?Arg?Ala?Gly?Ala?Thr?Leu?Leu?Phe?Asp?Ser?Ile?Pro?Glu?Glu?Glu
485 490 495
Glu?Ala?Glu?Thr?Glu?Leu?Lys?Ala?Ser?Ala?Met?Leu?Ser?Ala?Ile?Arg
500 505 510
Asp?Ala?Lys?Thr?Gly?Asn?Ser?Ala?Ser?Thr?Glu?Arg?Thr?Thr?Ala?Arg
515 520 525
Val?Gly?Asp?Gly?Val?Asn?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe
530 535 540
Val?His?Thr?Leu?Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Asn?Val?Ser
545 550 555 560
Thr?Val?Arg?Thr?Pro?Val?Pro?Asp?Glu?Val?Phe?Glu?Arg?Leu?Lys?Pro
565 570 575
Asp?Leu?Val?Val?Leu?Ser?Pro?Gly?Pro?Gly?Thr?Pro?Lys?Asp?Phe?Asp
580 585 590
Cys?Ala?Ala?Thr?Ile?Arg?Arg?Ala?Arg?Ala?Arg?Asp?Leu?Pro?Ile?Phe
595 600 605
Gly?Val?Cys?Leu?Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Glu
610 615 620
Leu?Arg?Gln?Leu?His?Ile?Pro?Met?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg
625 630 635 640
Val?Ser?Lys?Pro?Gly?Ile?Ile?Phe?Ser?Gly?Leu?Pro?Lys?Glu?Val?Thr
645 650 655
Val?Gly?Arg?Tyr?His?Ser?Ile?Phe?Ala?Asp?Pro?Val?Arg?Leu?Pro?Asp
660 665 670
Asp?Phe?Ile?Val?Thr?Ala?Glu?Thr?Glu?Asp?Gly?Ile?Ile?Met?Ala?Phe
675 680 685
Glu?His?Arg?Lys?Glu?Pro?Ile?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser
690 695 700
Ile?Met?Thr?Leu?Gly?His?Asn?Ala?Gly?Met?Arg?Ile?Ile?Glu?Asn?Ile
705 710 715 720
Val?Ala?His?Leu?Pro?Arg?Lys?Ala?Lys?Glu?Lys?Ala?Ala
725 730
<210>78
<211>732
<212>PRT
＜213〉Azospirillum brasilense (Azospirillum brasilense)
<400>78
Met?Tyr?Pro?Ala?Asp?Leu?Leu?Ala?Ser?Pro?Asp?Leu?Leu?Glu?Pro?Leu
1 5 10 15
Arg?Phe?Gln?Thr?Arg?Gly?Gly?Val?Thr?Val?Thr?Arg?Arg?Ala?Thr?Ala
20 25 30
Leu?Asp?Pro?Arg?Thr?Ala?Leu?Asp?Pro?Val?Ile?Asp?Ala?Leu?Asp?Arg
35 40 45
Arg?Arg?Gly?Leu?Leu?Leu?Ser?Ser?Gly?Val?Glu?Ala?Pro?Gly?Arg?Tyr
50 55 60
Arg?Arg?His?Ala?Leu?Gly?Phe?Thr?Asp?Pro?Ala?Val?Ala?Leu?Thr?Ala
65 70 75 80
Arg?Gly?Arg?Thr?Leu?Arg?Ile?Asp?Ala?Leu?Asn?Gly?Arg?Gly?Gln?Val
85 90 95
Leu?Leu?Pro?Ala?Val?Ala?Glu?Ala?Leu?Arg?Gly?Leu?Glu?Ala?Leu?Ala
100 105 110
Gly?Leu?Glu?Glu?Ala?Pro?Ser?Arg?Val?Thr?Ala?Ser?Ser?Ala?Ser?Pro
115 120 125
Ala?Pro?Leu?Pro?Gly?Glu?Glu?Arg?Ser?Arg?Gln?Pro?Ser?Val?Phe?Ser
130 135 140
Val?Leu?Arg?Ala?Val?Leu?Asp?Leu?Phe?Ala?Ala?Pro?Asp?Asp?Pro?Leu
145 150 155 160
Leu?Gly?Leu?Tyr?Gly?Ala?Phe?Ala?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Glu
165 170 175
Pro?Ile?Arg?Gln?Arg?Leu?Glu?Arg?Pro?Asp?Asp?Gln?Arg?Asp?Leu?Leu
180 185 190
Leu?Tyr?Leu?Pro?Asp?Arg?Leu?Val?Ala?Leu?Asp?Pro?Ile?Ala?Gly?Leu
195 200 205
Ala?Arg?Leu?Val?Ala?Tyr?Glu?Phe?Ile?Thr?Ala?Ala?Gly?Ser?Thr?Glu
210 215 220
Gly?Leu?Glu?Cys?Gly?Gly?Arg?Asp?His?Pro?Tyr?Arg?Pro?Asp?Thr?Asn
225 230 235 240
Ala?Glu?Ala?Gly?Cys?Asp?His?Ala?Pro?Gly?Asp?Tyr?Gln?Arg?Val?Val
245 250 255
Glu?Ser?Ala?Lys?Ala?Ala?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val
260 265 270
Pro?Gly?Gln?Thr?Phe?Ala?Glu?Pro?Cys?Ala?Asp?Ala?Pro?Ser?Ser?Val
275 280 285
Phe?Arg?Arg?Leu?Arg?Ala?Ala?Asn?Pro?Ala?Pro?Tyr?Glu?Ala?Phe?Val
290 295 300
Asn?Leu?Gly?Arg?Gly?Glu?Phe?Leu?Val?Ala?Ala?Ser?Pro?Glu?Met?Tyr
305 310 315 320
Val?Arg?Val?Ala?Gly?Gly?Arg?Val?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr
325 330 335
Val?Ala?Arg?Gly?Ala?Asp?Ala?Leu?Gly?Asp?Ala?Ala?Gln?Val?Leu?Arg
340 345 350
Leu?Leu?Thr?Ser?Ala?Lys?Asp?Ala?Ala?Glu?Leu?Thr?Met?Cys?Thr?Asp
355 360 365
Val?Asp?Arg?Asn?Asp?Lys?Ala?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Arg
370 375 380
Val?Ile?Gly?Arg?Arg?Met?Ile?Glu?Leu?Tyr?Ser?Arg?Leu?Ile?His?Thr
385 390 395 400
Val?Asp?His?Val?Glu?Gly?Arg?Leu?Arg?Ser?Gly?Met?Asp?Ala?Leu?Asp
405 410 415
Ala?Phe?Leu?Thr?His?Ser?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys
420 425 430
Arg?Trp?Ala?Met?Gln?Phe?Leu?Glu?Asp?Thr?Glu?Gln?Ser?Pro?Arg?Arg
435 440 445
Trp?Tyr?Gly?Gly?Ala?Phe?Gly?Arg?Leu?Gly?Phe?Asp?Gly?Gly?Met?Asp
450 455 460
Thr?Gly?Leu?Thr?Leu?Arg?Thr?Ile?Arg?Met?Ala?Glu?Gly?Val?Ala?Tyr
465 470 475 480
Val?Arg?Ala?Gly?Ala?Thr?Leu?Leu?Ser?Asp?Ser?Asp?Pro?Asp?Ala?Glu
485 490 495
Asp?Ala?Glu?Cys?Arg?Leu?Lys?Ala?Ala?Ala?Phe?Arg?Asp?Ala?Ile?Arg
500 505 510
Gly?Thr?Ala?Ala?Gly?Ala?Ala?Pro?Thr?Leu?Pro?Ala?Ala?Pro?Arg?Gly
515 520 525
Gly?Glu?Gly?Arg?Arg?Val?Leu?Leu?Val?Asp?His?Asp?Asp?Ser?Phe?Val
530 535 540
His?Thr?Leu?Ala?Asp?Tyr?Leu?Arg?Gln?Thr?Gly?Ala?Ser?Val?Thr?Thr
545 550 555 560
Leu?Arg?His?Ser?His?Ala?Arg?Ala?Ala?Leu?Ala?Glu?Arg?Arg?Pro?Asp
565 570 575
Leu?Val?Val?Leu?Ser?Pro?Gly?Pro?Gly?Arg?Pro?Ala?Asp?Phe?Asp?Val
580 585 590
Ala?Gly?Thr?Ile?Asp?Ala?Ala?Leu?Ala?Leu?Gly?Leu?Pro?Val?Phe?Gly
595 600 605
Val?Cys?Leu?Gly?Leu?Gln?Gly?Met?Val?Glu?Arg?Phe?Gly?Gly?Ala?Leu
610 615 620
Asp?Val?Leu?Pro?Glu?Pro?Val?His?Gly?Lys?Ala?Thr?Glu?Val?Arg?Val
625 630 635 640
Leu?Gly?Gly?Ala?Leu?Phe?Ala?Gly?Leu?Pro?Glu?Arg?Leu?Thr?Val?Gly
645 650 655
Arg?Tyr?His?Ser?Leu?Val?Ala?Arg?Arg?Asp?Arg?Leu?Pro?Ala?Asp?Leu
660 665 670
Thr?Val?Thr?Ala?Glu?Thr?Ala?Asp?Gly?Leu?Val?Met?Ala?Val?Glu?His
675 680 685
Arg?Arg?Leu?Pro?Leu?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Leu
690 695 700
Ser?Leu?Asp?Gly?Gly?Ala?Gly?Leu?Ala?Leu?Leu?Gly?Asn?Val?Met?Asp
705 710 715 720
Arg?Leu?Ala?Ala?Gly?Ala?Leu?Thr?Asp?Ala?Ala?Ala
725 730
<210>79
<211>731
<212>PRT
＜213〉alcaligenes melitensis (Brucella melitensis)
<400>79
Met?Asn?Ala?Lys?Thr?Ala?Asp?Ser?Glu?Ile?Phe?Gln?His?Glu?Thr?Ala
1 5 10 15
Gly?Gly?Ile?Ile?Val?Glu?Arg?Val?Arg?His?Leu?Thr?Ala?Tyr?Lys?Gly
20 25 30
Ala?Ile?Glu?Ser?Tyr?Ile?Asp?Val?Leu?Asn?Glu?Trp?Arg?Gly?Ala?Val
35 40 45
Phe?Ser?Ser?Asn?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Thr?Arg?Trp?Asp?Thr
50 55 60
Ala?Ile?Val?Asp?Pro?Pro?Val?Val?Ile?Thr?Ser?Arg?Ala?Arg?Thr?Met
65 70 75 80
Arg?Ile?Glu?Ala?Leu?Asn?Ala?Arg?Gly?Val?Ile?Leu?Leu?Arg?Pro?Ile
85 90 95
Leu?Asp?Thr?Val?Lys?Ala?Leu?Ser?Glu?Val?Lys?Ile?Asp?Gln?Ser?Gly
100 105 110
Glu?Asn?Arg?Ile?Asp?Leu?Thr?Ile?Val?Glu?Pro?Val?Gly?Thr?Phe?Thr
115 120 125
Glu?Glu?Glu?Arg?Ser?Arg?Met?Pro?Ser?Val?Phe?Thr?Val?Leu?Arg?Ala
130 135 140
Ile?Val?Gly?Leu?Phe?Phe?Ser?Glu?Glu?Asp?Ala?Asn?Leu?Gly?Leu?Tyr
145 150 155 160
Gly?Ala?Phe?Gly?Tyr?Asp?Leu?Ala?Phe?Gln?Phe?Asp?Pro?Ile?Gln?Tyr
165 170 175
Lys?Leu?Lys?Arg?Pro?Asp?Asp?Gln?Arg?Asp?Leu?Val?Leu?Phe?Ile?Pro
180 185 190
Asp?Glu?Ile?Phe?Val?Ala?Asp?His?Tyr?Ala?Ala?Arg?Ala?Trp?Val?Asp
195 200 205
Arg?Tyr?Glu?Phe?Arg?Cys?Gly?Gly?Ser?Ser?Thr?His?Gly?Leu?Asp?Arg
210 215 220
Ala?Thr?Pro?Val?Val?Pro?Phe?Lys?Pro?Ser?Glu?Arg?Lys?Leu?Ala?Arg
225 230 235 240
Gly?Asp?His?Asn?Pro?Gly?Glu?Tyr?Ala?Arg?Leu?Val?Glu?Arg?Ala?Lys
245 250 255
Glu?Ser?Phe?Lys?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Gly?Gln?Thr
260 265 270
Phe?Tyr?Glu?Arg?Cys?His?Thr?Ala?Pro?Ser?Glu?Ile?Phe?Arg?Arg?Leu
275 280 285
Lys?Ser?Ile?Asn?Pro?Ser?Pro?Tyr?Ser?Phe?Phe?Ile?Asn?Leu?Gly?Glu
290 295 300
Ser?Glu?Tyr?Leu?Val?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Asn
305 310 315 320
Gly?Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Lys?Arg?Gly
325 330 335
Glu?Asp?Ala?Ile?Ser?Asp?Ser?Glu?Gln?Ile?Leu?Lys?Leu?Leu?Asn?Ser
340 345 350
Lys?Lys?Asp?Glu?Ser?Glu?Leu?Thr?Met?Cys?Ser?Asp?Val?Asp?Arg?Asn
355 360 365
Asp?Lys?Ser?Arg?Val?Cys?Glu?Pro?Gly?Ser?Val?Arg?Val?Ile?Gly?Arg
370 375 380
Arg?Gln?Ile?Glu?Met?Tyr?Ser?Arg?Leu?Ile?His?Thr?Val?Asp?His?Ile
385 390 395 400
Glu?Gly?Arg?Leu?Arg?Asp?Gly?Met?Asp?Ala?Phe?Asp?Gly?Phe?Leu?Ser
405 4l0 415
His?Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met
420 425 430
Arg?Phe?Leu?Glu?Glu?Asn?Glu?Arg?Ser?Pro?Arg?Ala?Trp?Tyr?Gly?Gly
435 440 445
Ala?Ile?Gly?Met?Met?His?Phe?Asn?Gly?Asp?Met?Asn?Thr?Gly?Leu?Thr
450 455 460
Leu?Arg?Thr?Ile?Arg?Ile?Lys?Asp?Gly?Val?Ala?Glu?Ile?Arg?Ala?Gly
465 470 475 480
Ala?Thr?Leu?Leu?Phe?Asp?Ser?Asn?Pro?Asp?Glu?Glu?Glu?Ala?Glu?Thr
485 490 495
Glu?Leu?Lys?Ala?Ser?Ala?Met?Ile?Ala?Ala?Val?Arg?Asp?Ala?Gln?Lys
500 505 510
Ser?Asn?Gln?Ile?Ala?Glu?Glu?Ser?Val?Ala?Ala?Lys?Val?Gly?Glu?Gly
515 520 525
Val?Ser?Ile?Leu?Leu?Val?Asp?His?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
530 535 540
Ala?Asn?Tyr?Phe?Arg?Gln?Thr?Gly?Ala?Lys?Val?Ser?Thr?Val?Arg?Ser
545 550 555 560
Pro?Val?Ala?Glu?Glu?Ile?Phe?Asp?Arg?Val?Asn?Pro?Asp?Leu?Val?Val
565 570 575
Leu?Ser?Pro?Gly?Pro?Gly?Ser?Pro?Gln?Asp?Phe?Asp?Cys?Lys?Ala?Thr
580 585 590
Ile?Asp?Lys?Ala?Arg?Lys?Arg?Gln?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu
595 600 605
Gly?Leu?Gln?Ala?Leu?Ala?Glu?Ala?Tyr?Gly?Gly?Ala?Leu?Arg?Gln?Leu
610 615 620
Arg?Val?Pro?Val?His?Gly?Lys?Pro?Ser?Arg?Ile?Arg?Val?Ser?Lys?Pro
625 630 635 640
Glu?Arg?Ile?Phe?Ser?Gly?Leu?Pro?Glu?Glu?Val?Thr?Val?Gly?Arg?Tyr
645 650 655
His?Ser?Ile?Phe?Ala?Asp?Pro?Glu?Arg?Leu?Pro?Asp?Asp?Phe?Leu?Val
660 665 670
Thr?Ala?Glu?Thr?Glu?Asp?Gly?Ile?Ile?Met?Ala?Phe?Glu?His?Lys?His
675 680 685
Glu?Pro?Val?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr?Leu
690 695 700
Gly?His?Asn?Ala?Gly?Met?Arg?Met?Ile?Glu?Asn?Ile?Val?Thr?His?Leu
705 710 715 720
Ala?Gly?Lys?His?Lys?Ala?Arg?Arg?Thr?Asn?Tyr
725 730
<210>80
<211>735
<212>PRT
＜213〉beads cyanobacteria (Nostoc sp.)
<400>80
Met?Ile?Ala?Asp?Ser?His?Ser?Tyr?Arg?Thr?Asn?Gly?Asn?Val?Arg?Val
1 5 10 15
Ser?Arg?Ser?Ile?Thr?Gln?Val?Lys?Met?Glu?Thr?Ala?Leu?Glu?Glu?Ile
20 25 30
Leu?Phe?Tyr?Leu?Asn?Ser?Gln?Arg?Gly?Gly?Leu?Leu?Thr?Ser?Ser?Tyr
35 40 45
Glu?Tyr?Pro?Gly?Arg?Tyr?Lys?Arg?Trp?Ala?Ile?Gly?Phe?Val?Asn?Pro
50 55 60
Pro?Val?Glu?Leu?Ser?Thr?Ser?Gly?Asn?Thr?Phe?Thr?Leu?Thr?Ala?Leu
65 70 75 80
Asn?Glu?Arg?Gly?Tyr?Val?Leu?Leu?Pro?Val?Ile?Phe?Glu?Cys?Leu?Ser
85 90 95
Lys?Ser?Glu?Gln?Leu?Gln?Lys?Leu?Thr?Glu?His?His?His?Lys?Ile?Thr
100 105 110
Gly?Leu?Val?Lys?Ser?Thr?Pro?Glu?Phe?Phe?Ala?Glu?Glu?Glu?Arg?Ser
115 120 125
Lys?Gln?Pro?Ser?Thr?Phe?Thr?Val?Ile?Arg?Glu?Ile?Leu?His?Ile?Phe
130 135 140
Ser?Ser?Gln?Glu?Asp?Glu?His?Leu?Gly?Leu?Tyr?Gly?Ala?Phe?Gly?Tyr
145 150 155 160
Asp?Leu?Val?Phe?Gln?Phe?Glu?Gln?Ile?Thr?Gln?Cys?Leu?Glu?Arg?Pro
165 170 175
Gln?Asp?Gln?Arg?Asp?Leu?Val?Leu?Tyr?Leu?Pro?Asp?Glu?Leu?Ile?Val
180 185 190
Val?Asp?Tyr?Tyr?Gln?Gln?Gln?Ala?Phe?Arg?Leu?Glu?Tyr?Asp?Phe?Ile
195 200 205
Thr?Ala?His?Gly?Ser?Thr?Tyr?Asp?Leu?Pro?Arg?Thr?Gly?Glu?Ser?Val
210 215 220
Asp?Tyr?Arg?Gly?Gln?Cys?Leu?Thr?Pro?Pro?Gln?Asn?Ala?Asp?His?Lys
225 230 235 240
Ile?Gly?Glu?Tyr?Ala?Lys?Leu?Val?Glu?Phe?Ala?Leu?Asp?Tyr?Phe?Arg
245 250 255
Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Ser?Gln?Asn?Phe?Phe?Thr?Ala
260 265 270
Cys?Glu?Ala?Pro?Pro?Ser?Gln?Leu?Phe?Glu?Thr?Leu?Lys?Gln?Ile?Asn
275 280 285
Pro?Ser?Pro?Tyr?Gly?Phe?Ile?Phe?Asn?Leu?Gly?Gly?Glu?Tyr?Ile?Ile
290 295 300
Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Glu?Gly?Arg?Arg?Val?Glu
305 310 315 320
Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Thr?Arg?Gly?His?Asp?Ala?Ile?Asp
325 330 335
Asp?Ala?Val?Gln?Ile?Arg?Gln?Leu?Leu?Asn?Ser?His?Lys?Asp?Glu?Ala
340 345 350
Glu?Leu?Thr?Met?Cys?Thr?Asp?Val?Asp?Arg?Asn?Asp?Lys?Ser?Arg?Ile
355 360 365
Cys?Glu?Pro?Gly?Ser?Val?Lys?Val?Ile?Gly?Arg?Arg?Gln?Ile?Glu?Leu
370 375 380
Tyr?Ser?His?Leu?Ile?His?Thr?Val?Asp?His?Val?Glu?Gly?Ile?Leu?Arg
385 390 395 400
Pro?Glu?Phe?Asp?Ala?Leu?Asp?Ala?Phe?Leu?Ser?His?Thr?Trp?Ala?Val
405 410 415
Thr?Val?Thr?Gly?Ala?Pro?Lys?Arg?Ala?Ala?Ile?Gln?Phe?Ile?Glu?Lys
420 425 430
Asn?Glu?Arg?Ser?Val?Arg?Arg?Trp?Tyr?Gly?Gly?Ala?Val?Gly?Tyr?Leu
435 440 445
Asn?Phe?Asn?Gly?Asn?Leu?Asn?Thr?Gly?Leu?Ile?Leu?Arg?Thr?Ile?Arg
450 455 460
Leu?Gln?Asp?Ser?Ile?Ala?Glu?Val?Arg?Val?Gly?Ala?Thr?Leu?Leu?Tyr
465 470 475 480
Asp?Ser?Ile?Pro?Gln?Ala?Glu?Glu?Gln?Glu?Thr?Ile?Thr?Lys?Ala?Ala
485 490 495
Ala?Ala?Phe?Glu?Thr?Ile?Arg?Arg?Ala?Lys?Gln?Ile?Asp?Pro?Gln?Ile
500 505 510
Glu?Glu?Ser?Ser?Thr?Arg?Lys?Leu?Ser?Lys?Tyr?Leu?Pro?Asp?Gly?Gln
515 520 525
Ser?Gly?Lys?His?Ile?Leu?Leu?Ile?Asp?His?Glu?Asp?Ser?Phe?Val?His
530 535 540
Thr?Leu?Ala?Asn?Tyr?Ile?Arg?Ser?Thr?Gly?Ala?Thr?Val?Thr?Thr?Leu
545 550 555 560
Arg?His?Gly?Phe?Ser?Glu?Ser?Leu?Phe?Asp?Thr?Glu?Arg?Pro?Asp?Leu
565 570 575
Val?Val?Leu?Ser?Pro?Gly?Pro?Gly?Arg?Pro?Ser?Glu?Phe?Lys?Val?Gln
580 585 590
Glu?Thr?Val?Ala?Ala?Cys?Val?Arg?Arg?Gln?Ile?Pro?Leu?Phe?Gly?Val
595 600 605
Cys?Leu?Gly?Leu?Gln?Gly?Ile?Val?Glu?Ala?Phe?Gly?Gly?Glu?Leu?Gly
610 615 620
Val?Leu?Asn?Tyr?Pro?Gln?His?Gly?Lys?Ser?Ser?Arg?Ile?Phe?Val?Thr
625 630 635 640
Ala?Pro?Asp?Ser?Val?Met?Phe?Gln?Asp?Leu?Pro?Glu?Ser?Phe?Thr?Val
645 650 655
Gly?Arg?Tyr?His?Ser?Leu?Phe?Ala?Leu?Ser?Gln?Arg?Leu?Pro?Lys?Glu
660 665 670
Leu?Lys?Val?Thr?Ala?Ile?Ser?Asp?Asp?Glu?Val?Ile?Met?Ala?Ile?Glu
675 680 685
His?Gln?Thr?Leu?Pro?Ile?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile
690 695 700
Met?Thr?Leu?Ala?Gly?Glu?Val?Gly?Leu?Met?Met?Ile?Lys?Asn?Val?Val
705 710 715 720
Gln?Lys?Tyr?Thr?Gln?Ser?Gln?Gln?Ser?Thr?Val?Pro?Ile?Tyr?Asp
725 730 735
<210>81
<211>715
<212>PRT
＜213〉beads cyanobacteria
<400>81
Met?Arg?Val?Ser?Arg?Ser?Thr?Thr?Glu?Val?Lys?Met?Asp?Thr?Ala?Leu
1 5 10 15
Asp?Glu?Ile?Leu?Phe?His?Leu?Asn?Gln?Val?Arg?Gly?Gly?Leu?Leu?Thr
20 25 30
Ser?Ser?Tyr?Glu?Tyr?Pro?Gly?Arg?Tyr?Lys?Arg?Trp?Ala?Ile?Gly?Phe
35 40 45
Ile?Asn?Pro?Pro?Leu?Gln?Leu?Thr?Thr?Arg?Glu?Asn?Ala?Phe?Thr?Ile
50 55 60
Ser?Ser?Leu?Asn?Pro?Arg?Gly?Gln?Val?Leu?Leu?Pro?Thr?Leu?Phe?Gln
65 70 75 80
His?Leu?Ser?Ala?Gln?Ser?Gln?Leu?Gln?Gln?Ile?Ser?Leu?Asn?His?Asp
85 90 95
Tyr?Ile?Thr?Gly?Glu?Ile?Arg?Pro?Thr?Lys?Gln?Leu?Phe?Thr?Glu?Glu
100 105 110
Gln?Arg?Ser?Lys?Gln?Pro?Ser?Ala?Phe?Thr?Val?Ile?Arg?Glu?Ile?Leu
115 120 125
Gln?Ile?Phe?Ala?Ser?Asp?Glu?Asp?Glu?His?Leu?Gly?Leu?Tyr?Gly?Ala
130 135 140
Phe?Gly?Tyr?Asp?Leu?Val?Phe?Gln?Phe?Glu?Pro?Ile?Pro?Gln?Lys?Ile
145 150 155 160
Ala?Arg?Pro?Ala?Asp?Gln?Arg?Asp?Leu?Val?Leu?Tyr?Leu?Pro?Asp?Glu
165 170 175
Leu?Ile?Val?Val?Asp?Tyr?Tyr?Leu?Gln?Lys?Ala?Tyr?Arg?His?Gln?Tyr
180 185 190
Glu?Phe?Ala?Thr?Glu?His?Gly?Asn?Thr?Glu?His?Leu?Pro?Arg?Thr?Gly
195 200 205
Gln?Ser?Ile?Asp?Tyr?Gln?Gly?Lys?His?Leu?Leu?Pro?Asn?Gln?Thr?Ala
210 215 220
Asp?His?Gln?Pro?Gly?Glu?Tyr?Ala?Asn?Leu?Val?Glu?Gln?Ala?Leu?Asp
225 230 235 240
Tyr?Phe?Arg?Arg?Gly?Asp?Leu?Phe?Glu?Val?Val?Pro?Ser?Gln?Asn?Phe
245 250 255
Phe?Thr?Ala?Cys?Glu?Gln?Ser?Pro?Ser?Gln?Leu?Phe?Gln?Thr?Leu?Arg
260 265 270
Gln?Ile?Asn?Pro?Ser?Pro?Tyr?Gly?Phe?Leu?Leu?Asn?Leu?Gly?Gly?Glu
275 280 285
Tyr?Leu?Ile?Gly?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Val?Asp?Gly?Arg
290 295 300
Arg?Val?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Arg?Arg?Gly?Glu?Asp
305 310 315 320
Ala?Leu?Gly?Asp?Ala?Val?Gln?Ile?Arg?Gln?Leu?Leu?Asn?Ser?His?Lys
325 330 335
Asp?Glu?Ala?Glu?Leu?Thr?Met?Cys?Thr?Asp?Val?Asp?Arg?Asn?Asp?Lys
340 345 350
Ser?Arg?Ile?Cys?Glu?Pro?Gly?Ser?Val?Arg?Val?Ile?Gly?Arg?Arg?Gln
355 360 365
Ile?Glu?Leu?Tyr?Ser?His?Leu?Ile?His?Thr?Val?Asp?His?Val?Glu?Gly
370 375 380
Ile?Leu?Arg?Pro?Glu?Phe?Asp?Ala?Leu?Asp?Ala?Phe?Leu?Ser?His?Thr
385 390 395 400
Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Arg?Ala?Ala?Met?Gln?Phe
405 410 415
Ile?Glu?Gln?His?Glu?Arg?Ser?Ala?Arg?Arg?Trp?Tyr?Gly?Gly?Ala?Val
420 425 430
Gly?Tyr?Leu?Gly?Phe?Asn?Gly?Asn?Leu?Asn?Thr?Gly?Leu?Thr?Leu?Arg
435 440 445
Thr?Ile?Arg?Leu?Gln?Asp?Ser?Ile?Ala?Glu?Val?Arg?Val?Gly?Ala?Thr
450 455 460
Val?Leu?Tyr?Asp?Ser?Ile?Pro?Ser?Ala?Glu?Glu?Glu?Glu?Thr?Ile?Thr
465 470 475 480
Lys?Ala?Thr?Ala?Leu?Phe?Glu?Thr?Ile?Arg?Arg?His?Thr?Thr?Ala?Asn
485 490 495
Lys?Thr?Gln?Gly?Asn?Asp?Ser?His?Arg?Pro?Gly?Asp?Ile?Ala?His?Asn
500 505 510
Lys?Arg?Ile?Leu?Leu?Ile?Asp?Tyr?Glu?Asp?Ser?Phe?Val?His?Thr?Leu
515 520 525
Ala?Asn?Tyr?Ile?Arg?Thr?Thr?Gly?Ala?Thr?Val?Thr?Thr?Leu?Arg?His
530 535 540
Gly?Phe?Ala?Glu?Ser?Tyr?Phe?Asp?Ala?Glu?Arg?Pro?Asp?Leu?Val?Val
545 550 555 560
Leu?Ser?Pro?Gly?Pro?Gly?Arg?Pro?Ser?Asp?Phe?Arg?Val?Pro?Gln?Thr
565 570 575
Val?Ala?Ala?Leu?Val?Gly?Arg?Glu?Ile?Pro?Ile?Phe?Gly?Val?Cys?Leu
580 585 590
Gly?Leu?Gln?Gly?Ile?Val?Glu?Ala?Phe?Gly?Gly?Glu?Leu?Gly?Val?Leu
595 600 605
Asp?Tyr?Pro?Gln?His?Gly?Lys?Pro?Ala?Arg?Ile?Ser?Val?Thr?Ala?Pro
610 615 620
Asp?Ser?Val?Leu?Phe?Gln?Asn?Leu?Pro?Ala?Ser?Phe?Ile?Val?Gly?Arg
625 630 635 640
Tyr?His?Ser?Leu?Phe?Ala?Gln?Pro?Gln?Thr?Ile?Pro?Gly?Glu?Leu?Lys
645 650 655
ValThr?Ala?Ile?Ser?Glu?Asp?Asn?Val?Ile?Met?Ala?Ile?Glu?His?Gln
660 665 670
Thr?Leu?Pro?Ile?Ala?Ala?Val?Gln?Phe?His?Pro?Glu?Ser?Ile?Met?Thr
675 680 685
Leu?Ala?Gly?Glu?Val?Gly?Gln?Thr?Ile?Ile?Lys?Asn?Val?Val?Gln?Thr
690 695 700
Tyr?Thr?Gln?Thr?Leu?Glu?Thr?Ser?Ile?Tyr?Ser
705 710 715
<210>82
<211>719
<212>PRT
＜213〉color Rhodopseudomonas
<400>82
Met?Asn?Arg?Thr?Val?Phe?Ser?Leu?Pro?Ala?Thr?Ser?Asp?Tyr?Lys?Thr
1 5 10 15
Ala?Ala?Gly?Leu?Ala?Val?Thr?Arg?Ser?Ala?Gln?Pro?Phe?Ala?Gly?Gly
20 25 30
Gln?Ala?Leu?Asp?Glu?Leu?Ile?Asp?Leu?Leu?Asp?His?Arg?Arg?Gly?Val
35 40 45
Met?Leu?Ser?Ser?Gly?Thr?Thr?Val?Pro?Gly?Arg?Tyr?Glu?Ser?Phe?Asp
50 55 60
Leu?Gly?Phe?Ala?Asp?Pro?Pro?Leu?Ala?Leu?Thr?Thr?Arg?Ala?Glu?Lys
65 70 75 80
Phe?Thr?Ile?Glu?Ala?Leu?Asn?Pro?Arg?Gly?Arg?Val?Leu?Ile?Ala?Phe
85 90 95
Leu?Ser?Asp?Lys?Leu?Glu?Glu?Pro?Cys?Val?Val?Val?Glu?Gln?Ala?Cys
100 105 110
Ala?Thr?Lys?Ile?Arg?Gly?His?Ile?Val?Arg?Gly?Glu?Ala?Pro?Val?Asp
115 120 125
Glu?Glu?Gln?Arg?Thr?Arg?Arg?Ala?Ser?Ala?Ile?Ser?Leu?Val?Arg?Ala
130 135 140
Val?Ile?Ala?Ala?Phe?Ala?Ser?Pro?Ala?Asp?Pro?Met?Leu?Gly?Leu?Tyr
145 150 155 160
Gly?Ala?Phe?Ala?Tyr?Asp?Leu?Val?Phe?Gln?Phe?Glu?Asp?Leu?Lys?Gln
165 170 175
Lys?Arg?Ala?Arg?Glu?Ala?Asp?Gln?Arg?Asp?Ile?Val?Leu?Tyr?Val?Pro
180 185 190
Asp?Arg?Leu?Leu?Ala?Tyr?Asp?Arg?Ala?Thr?Gly?Arg?Gly?Val?Asp?Ile
195 200 205
Ser?Tyr?Glu?Phe?Ala?Trp?Lys?Gly?Gln?Ser?Thr?Ala?Gly?Leu?Pro?Asn
210 215 220
Glu?Thr?Ala?Glu?Ser?Val?Tyr?Thr?Gln?Thr?Gly?Arg?Gln?Gly?Phe?Ala
225 230 235 240
Asp?His?Ala?Pro?Gly?Asp?Tyr?Pro?Lys?Val?Val?Glu?Lys?Ala?Arg?Ala
245 250 255
Ala?Phe?Ala?Arg?Gly?Asp?Leu?Phe?Glu?Ala?Val?Pro?Gly?Gln?Leu?Phe
260 265 270
Gly?Glu?Pro?Cys?Glu?Arg?Ser?Pro?Ala?Glu?Val?Phe?Lys?Arg?Leu?Cys
275 280 285
Arg?Ile?Asn?Pro?Ser?Pro?Tyr?Gly?Gly?Leu?Leu?Asn?Leu?Gly?Asp?Gly
290 295 300
Glu?Phe?Leu?Val?Ser?Ala?Ser?Pro?Glu?Met?Phe?Val?Arg?Ser?Asp?Gly
305 310 315 320
Arg?Arg?Ile?Glu?Thr?Cys?Pro?Ile?Ser?Gly?Thr?Ile?Ala?Arg?Gly?Val
325 330 335
Asp?Ala?Ile?Ser?Asp?Ala?Glu?Gln?Ile?Gln?Lys?Leu?Leu?Asn?Ser?Glu
340 345 350
Lys?Asp?Glu?Phe?Glu?Leu?Asn?Met?Cys?Thr?Asp?Val?Asp?Arg?Asn?Asp
355 360 365
Lys?Ala?Arg?Val?Cys?Val?Pro?Gly?Thr?Ile?Lys?Val?Leu?Ala?Arg?Arg
370 375 380
Gln?Ile?Glu?Thr?Tyr?Ser?Lys?Leu?Phe?His?Thr?Val?Asp?His?Val?Glu
385 390 395 400
Gly?Met?Leu?Arg?Pro?Gly?Phe?Asp?Ala?Leu?Asp?Ala?Phe?Leu?Thr?His
405 410 415
Ala?Trp?Ala?Val?Thr?Val?Thr?Gly?Ala?Pro?Lys?Leu?Trp?Ala?Met?Gln
420 425 430
Phe?Val?Glu?Asp?His?Glu?Arg?Ser?Pro?Arg?Arg?Trp?Tyr?Ala?Gly?Ala
435 440 445
Phe?Gly?Val?Val?Gly?Phe?Asp?Gly?Ser?Ile?Asn?Thr?Gly?Leu?Thr?Ile
450 455 460
Arg?Thr?Ile?Arg?Met?Lys?Asp?Gly?Leu?Ala?Glu?Val?Arg?Val?Gly?Ala
465 470 475 480
Thr?Cys?Leu?Phe?Asp?Ser?Asn?Pro?Val?Ala?Glu?Asp?Lys?Glu?Cys?Gln
485 490 495
Val?Lys?Ala?Ala?Ala?Leu?Phe?Gln?Ala?Leu?Arg?Gly?Asp?Pro?Ala?Lys
500 505 510
Pro?Leu?Ser?Ala?Val?Ala?Pro?Asp?Ala?Thr?Gly?Ser?Gly?Lys?Lys?Val
515 520 525
Leu?Leu?Val?Asp?His?Asp?Asp?Ser?Phe?Val?His?Met?Leu?Ala?Asp?Tyr
530 535 540
Phe?Arg?Gln?Val?Gly?Ala?Gln?Val?Thr?Val?Val?Arg?Tyr?Val?His?Gly
545 550 555 560
Leu?Lys?Met?Leu?Ala?Glu?Asn?Ser?Tyr?Asp?Leu?Leu?Val?Leu?Ser?Pro
565 570 575
Gly?Pro?Gly?Arg?Pro?Glu?Asp?Phe?Lys?Ile?Lys?Asp?Thr?Ile?Asp?Ala
580 585 590
Ala?Leu?Ala?Lys?Lys?Leu?Pro?Ile?Phe?Gly?Val?Cys?Leu?Gly?Val?Gln
595 600 605
Ala?Met?Gly?Glu?Tyr?Phe?Gly?Gly?Thr?Leu?Gly?Gln?Leu?Ala?Gln?Pro
610 615 620
Ala?His?Gly?Arg?Pro?Ser?Arg?Ile?Gln?Val?Arg?Gly?Gly?Ala?Leu?Met
625 630 635 640
Arg?Gly?Leu?Pro?Asn?Glu?Val?Thr?Ile?Gly?Arg?Tyr?His?Ser?Leu?Tyr
645 650 655
Val?Asp?Met?Arg?Asp?Met?Pro?Lys?Glu?Leu?Thr?Val?Thr?Ala?Ser?Thr
660 665 670
Asp?Asp?Gly?Ile?Ala?Met?Ala?Ile?Glu?His?Lys?Thr?Leu?Pro?Val?Gly
675 680 685
Gly?Val?Gln?Phe?His?Pro?Glu?Ser?Leu?Met?Ser?Leu?Gly?Gly?Glu?Val
690 695 700
Gly?Leu?Arg?Ile?Val?Glu?Asn?Ala?Phe?Arg?Leu?Gly?Gln?Ala?Ala
705 710 715
<210>83
<211>2160
<212>DNA
＜213〉color Rhodopseudomonas
<400>83
atgaacagga?ccgttttctc?gcttcccgcg?accagcgact?ataagaccgc?cgcgggcctc 60
gcggtgacgc?gcagcgccca?gccttttgcc?ggcggccagg?cgctcgacga?gctgatcgat 120
ctgctcgacc?accgccgcgg?cgtgatgctg?tcgtccggca?caaccgtgcc?gggccgctac 180
gagagcttcg?acctcggctt?tgccgatccg?ccgctggcgc?tcaccactag?ggccgaaaaa 240
ttcaccatcg?aggcgctcaa?tccgcgcggc?cgggtgctga?tcgcgttcct?gtccgacaag 300
cttgaagagc?cctgcgtggt?ggtggagcag?gcctgcgcca?ccaagatcag?gggccacatc 360
gtccgcggcg?aggccccggt?cgacgaagaa?caacgcaccc?gccgcgccag?cgcgatctcc 420
ctggtgcgcg?cggtgattgc?tgccttcgcc?tcgccggccg?atccgatgct?cgggctgtac 480
ggcgccttcg?cctacgacct?tgtgttccag?ttcgaggatc?tgaagcagaa?gcgtgcccgc 540
gaagccgacc?agcgcgacat?cgtgctgtac?gtgccggatc?gcctgctggc?ctacgatcgc 600
gccaccggcc?gcggcgtcga?catttcctac?gaattcgcct?ggaagggcca?gtccaccgcc 660
ggcctgccga?acgagaccgc?cgagagcgtc?tacacccaga?ccggccggca?gggtttcgcc 720
gaccacgccc?cgggcgacta?tcccaaggtg?gtcgagaagg?cccgcgcggc?gttcgcccgc 780
ggcgacctgt?tcgaggcggt?gccgggccag?ctgttcggcg?agccatgcga?gcggtcgccg 840
gccgaagtgt?tcaagcggtt?gtgccggatc?aacccgtcgc?cctatggcgg?cctgctcaat 900
ctcggcgacg?gcgaattcct?ggtgtcggcc?tcgccggaaa?tgttcgtccg?ctcggacggc 960
cgccggatcg?agacctgccc?gatctccggc?actatcgccc?gcggcgtcga?tgcgatcagc 1020
gatgctgagc?agatccagaa?gctcttgaac?tccgagaagg?acgagttcga?gctgaatatg 1080
tgcaccgacg?tcgaccgcaa?cgacaaggcg?cgggtctgcg?tgccgggcac?gatcaaagtt 1140
ctcgcgcgcc?gccagatcga?gacctattcg?aagctgttcc?acaccgtcga?tcacgtcgag 1200
ggcatgctgc?gaccgggttt?cgacgcgctc?gacgccttcc?tcacccacgc?ctgggcggtc 1260
accgtcaccg?gcgcgccgaa?gctgtgggcg?atgcagttcg?tcgaggatca?cgagcgtagc 1320
ccgcggcgct?ggtatgccgg?cgcgttcggc?gtggtcggct?tcgatggctc?gatcaacacc 1380
ggcctcacca?tccgcaccat?ccggatgaag?gacggcctcg?ccgaagttcg?cgtcggcgcc 1440
acctgcctgt?tcgacagcaa?tccggtcgcc?gaggacaagg?aatgccaggt?caaggccgcg 1500
gcactgttcc?aggcgctgcg?cggcgatccc?gccaagccgc?tgtcggcggt?ggcgccggac 1560
gccactggct?cgggcaagaa?ggtgctgctg?gtcgaccacg?acgacagctt?cgtgcacatg 1620
ctggcggact?atttcaggca?ggtcggcgcc?caggtcaccg?tggtgcgcta?cgttcacggc 1680
ctgaagatgc?tggccgaaaa?cagctatgat?cttctggtgc?tgtcgcccgg?tcccggccgg 1740
ccggaggact?tcaagatcaa?ggatacgatc?gacgccgcgc?tcgccaagaa?gctgccgatc 1800
ttcggcgtct?gcctcggcgt?ccaggcgatg?ggcgaatatt?ttggcggtac?gctcggccag 1860
ctcgcgcagc?cggctcacgg?ccgcccgtcg?cggattcagg?tgcgcggcgg?cgcgctgatg 1920
cgcggtctcc?cgaacgaggt?caccatcggc?cgctaccact?cgctctatgt?cgacatgcgc 1980
gacatgccga?aggagctgac?cgtcaccgcc?tccaccgatg?acggcatcgc?gatggcgatc 2040
gagcacaaga?ccctgccggt?cggcggcgtg?cagttccacc?ccgagtcgct?gatgtcgctc 2100
ggcggcgagg?tcgggctgcg?gatcgtcgaa?aacgccttcc?ggctcggcca?ggcggcctaa 2160
<210>84
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>84
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?gtttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcgat?ttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1?140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>85
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>85
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?gtatttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>86
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>86
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?ttcaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>87
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>87
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tgcaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>88
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>88
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccttctatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>89
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>89
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacgcgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>90
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>90
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacgggt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>91
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>91
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?ctggttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>92
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>92
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggtttttaag?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cttcttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>93
<211>2190
<212>DNA
＜213〉artificial sequence
<220>
＜223〉Agrobacterium tumefaciens mutant
<400>93
atggtaacga?tcattcagga?tgacggagcg?gagacctacg?agacgaaagg?cggcatccag 60
gtcagccgaa?agcgccggcc?caccgattat?gccaacgcca?tcgataatta?catcgaaaag 120
cttgattccc?atcgcggcgc?ggttttttcg?tccaactatg?aatatccggg?ccgttacacc 180
cgctgggata?cggccatcgt?cgatccgccg?ctcggcattt?cctgttttgg?ccgcaagatg 240
tggatcgaag?cctataatgg?ccgcggcgaa?gtgctgctcg?atttcattac?ggaaaagctg 300
aaggcgacac?ccgatctcac?cctcggcgct?tcctcgaccc?gccggctcga?tcttaccgtc 360
aacgaaccgg?accgtgtctt?caccgaagaa?gaacgctcga?aaatcccgac?ggtcttcacc 420
gctctcagag?ccatcgtcga?cctcttctat?tcgagcgcgg?attcggccat?cggcctgttc 480
ggtgccttcg?gttacgatct?cgccttccag?ttcgacgcga?tcaagctttc?gctggcgcgt 540
ccggaagacc?agcgtgacat?ggtgctgttt?ctgcccgatg?aaatcctcgt?cgttgatcac 600
tattccgcca?aggcctggat?cgaccgttac?gatttcgaga?aggacggcat?gacgacggac 660
ggcaaatcct?ccgacattac?ccccgatccc?ttcaagacca?ccgataccat?cccgcccaag 720
ggcgatcacc?gtcccggcga?atattccgag?cttgtggtga?aggccaagga?aagcttccgc 780
cgcggcgacc?tgttcgaggt?cgttcccggc?cagaaattca?tggagcgttg?cgaaagcaat 840
ccgtcggcga?tttcccgccg?cctgaaggcg?atcaacccgt?cgccctattc?cgccttcatc 900
aatctcggcg?atcaggaata?tctggtcggc?gcctcgccgg?aaatgttcgt?gcgcgtctcc 960
ggccgtcgca?tcgagacctg?cccgatatca?ggcaccatca?agcgcggcga?cgatccgatt 1020
gccgacagcg?agcagatttt?gaaactgctc?aactcgaaaa?aggacgaatc?cgaactgacc 1080
atgtgctcgg?acgtggaccg?caacgacaag?agccgcgtct?gcgagccggg?ttcggtgaag 1140
gtcattggcc?gccgccagat?cgagatgtat?tcacgcctca?tccacaccgt?cgatcacatc 1200
gaaggccgcc?tgcgcgacga?tatggacgcc?tttgacggtt?tcctcagcca?cgcctgggcc 1260
gtcaccgtca?ccggtgcacc?aaagctgtgg?gccatgcgct?tcatcgaagg?tcatgaaaag 1320
agcccgcgcg?cctggtatgg?cggtgcgatc?ggcatggtcg?gcttcaacgg?cgacatgaat 1380
accggcctga?cgctgcgcac?catccggatc?aaggacggta?ttgccgaagt?gcgcgccggc 1440
gcgaccctgc?tcaatgattc?caacccgcag?gaagaagaag?ccgaaaccga?actgaaggcc 1500
tccgccatga?tatcagccat?tcgtgacgca?aaaggcacca?actctgccgc?caccaagcgt 1560
gatgccgcca?aagtcggcac?cggcgtcaag?atcctgctcg?tcgaccacga?agacagcttc 1620
gtgcacacgc?tggcgaatta?tttccgccag?acgggcgcga?cggtctcgac?cgtcagatca 1680
ccggtcgcag?ccgacgtgtt?cgatcgcttc?cagccggacc?tcgttgtcct?gtcgcccgga 1740
cccggcagcc?cgacggattt?cgactgcaag?gcaacgatca?aggccgcccg?cgcccgcgat 1800
ctgccgatct?tcggcgtttg?cctcggtctg?caggcattgg?cagaagccta?tggcggcgag 1860
ctgcgccagc?ttgctgtgcc?catgcacggc?aagccttcgc?gcatccgcgt?gctggaaccc 1920
ggcctcgtct?tctccggtct?cggcaaggaa?gtcacggtcg?gtcgttacca?ttcgatcttc 1980
gccgatcccg?ccaccctgcc?gcgtgatttc?atcatcaccg?cagaaagcga?ggacggcacg 2040
atcatgggca?tcgaacacgc?caaggaaccg?gtggccgccg?ttcagttcca?cccggaatcg 2100
atcatgacgc?tcggacagga?cgcgggcatg?cggatgatcg?agaatgtcgt?ggtgcatctg 2160
acccgcaagg?cgaagaccaa?ggccgcgtga 2190
<210>94
<211>1821
<212>DNA
＜213〉rice (Oryza sativa)
<400>94
atggagtcca?tcgccgccgc?cacgttcacg?ccctcgcgcc?tcgccgcccg?ccccgccact 60
ccggcggcgg?cggcggcccc?ggttagagcg?agggcggcgg?tagcggcagg?agggaggagg 120
aggacgagta?ggcgcggcgg?cgtgaggtgc?tccgcgggga?agccagaggc?aagcgcggtg 180
atcaacggga?gcgcggcggc?gcgggcggcg?gaggaggaca?ggaggcgctt?cttcgaggcg 240
gcggagcgtg?ggagcgggaa?gggcaacctg?gtgcccatgt?gggagtgcat?cgtctccgac 300
cacctcaccc?ccgtgctcgc?ctaccgctgc?ctcgtccccg?aggacaacat?ggagacgccc 360
agcttcctct?tcgagtccgt?cgagcagggg?cccgagggca?ccaccaacgt?cggtcgctat 420
agcatggtgg?gagcccaccc?agtgatggag?gtcgtggcaa?aggagcacaa?ggtcacaatc 480
atggaccacg?agaagggcaa?ggtgacggag?caggtcgtgg?atgatcctat?gcagatcccc 540
aggagcatga?tggaaggatg?gcacccgcag?cagatcgatc?agctccccga?ttccttcacc 600
ggtggatggg?tcgggttctt?ttcctatgat?acagtccgtt?atgttgaaaa?gaagaagctg 660
cccttctccg?gtgctcccca?ggacgatagg?aaccttcctg?atgttcacct?tgggctttat 720
gatgatgttc?tcgtcttcga?caatgtcgag?aagaaagtat?atgtcatcca?ttgggtaaat 780
cttgatcggc?atgcaaccac?cgaggatgca?ttccaagatg?gcaagtcccg?gctgaacctg 840
ttgctatcta?aagtgcacaa?ttcaaatgta?cccaagcttt?ctccaggatt?tgtaaagtta 900
cacactcggc?agtttggtac?acctttgaac?aaatcaacca?tgacaagtga?tgagtacaag 960
aatgctgtta?tgcaggctaa?ggagcatatt?atggctggtg?atattttcca?gattgtttta 1020
agccagaggt?ttgagaggca?gacatacgcc?aatccatttg?aagtctatcg?agctttacga 1080
attgtgaacc?caagtccata?catggcatat?gtacaggcaa?gaggctgtgt?cctggtagca 1140
tctagtccag?aaattcttac?tcgtgtgagg?aagggtaaaa?ttattaaccg?tccacttgct 1200
gggactgttc?gaaggggcaa?gacagagaag?gaagatgaaa?tgcaagagca?acaactacta 1260
agtgatgaaa?aacagtgtgc?tgaacatatt?atgcttgtag?atttgggaag?gaatgatgtt 1320
ggaaaggtct?ccaaacctgg?atctgtgaag?gtggagaaat?taatgaacat?tgaacgctac 1380
tcccatgtca?tgcacatcag?ttccacggtg?agtggagagt?tggatgatca?tctccaaagt 1440
tgggatgccc?tgcgagccgc?gttgcctgtt?ggaacagtta?gtggagcacc?aaaggtgaaa 1500
gccatggagc?tgatagacga?gctagaggtc?acaagacgag?gaccatacag?tggcggcctt 1560
ggagggatat?catttgacgg?ggacatgctt?atcgctcttg?cactccgcac?cattgtgttc 1620
tcaacagcgc?caagccacaa?cacgatgtac?tcatacaaag?acaccgagag?gcgccgggag 1680
tgggtcgctc?accttcaggc?tggtgctggc?attgtcgctg?atagcagccc?agacgacgag 1740
caacgtgaat?gcgagaacaa?ggcagccgct?ctggctcgag?ccatcgatct?tgctgaatca 1800
gctttcgtag?acaaggaata?g 1821
<210>95
<211>1498
<212>DNA
＜213〉rice
<400>95
gaattcaaat?tttttatata?gagtatttct?atacatgaat?ttttctaact?ttttgttttt 60
taaaaaaaat?ttgtgtggtg?tactgtaata?ggaagagaag?aaggggagga?ggaaggaggg 120
agaagaggga?ggagtatatg?gggagggggg?gatgaactga?tcgcccagcg?tgatagctgg 180
cgatcgagca?cccattagaa?gggcccaata?aaccctggat?aattgtcatt?gagtggcacc 240
tttcattgag?aagacgttat?taggaattgt?agaagtggat?aattatgcta?tctgttgtat 300
tgagtgtcac?tgtcaccgat?aaagctttgc?tggttaatgc?attgtatttc?tccatcaacg 360
cttcatgata?caatggtatt?tggacgtgtt?tataaaataa?tatacgtata?atgtgggtgg 420
cctagcggcg?gccggttaca?catagcagcg?atcggtccga?tgctagtctt?cattcattca 480
ggtatgtatt?caggtatcag?tgtgtgggtg?atagtttttt?tttttcgttt?ttctagttac 540
gatatctcat?atctcatagt?tgtgatctta?taaacttttt?catgtttatc?aatataaatt 600
tcgtgttatc?tagtcgttaa?aagaaccgta?taatgtggca?aaaaaaatgt?ataatgtgtc 660
agagtttgca?cgtgtttatc?ttgctgcccc?gaaacgatta?attcagtgat?ttggcaacaa 720
caaaatgtcg?tggcggataa?gcatatccgt?cccaaaagga?aaaaaagaaa?aggaaaaata 780
atctttagaa?ataaagccct?tactttttcc?aagaagcaga?ggtaaccgta?gctggtattc 840
cgcggctaac?tcaatccctt?tctctggagt?cttggagcgg?cacggcggct?gcgcacccga 900
cctcgcccac?cacctgctcg?gcgaaacgcc?cggctcggcc?gcgacgtgtc?ccaccgcacc 960
gcgcgcgcac?ccgcgcgccc?cgagcccctc?gccgcctccg?cgcgggcgcc?gcacctattt 1020
aaatgcggcc?ccgatcccgc?attctctcaa?ctgcactagt?ccccaccaac?ggctcggtcc 1080
agtagagttt?atcccccacc?tatggccagc?ctcgtgctct?ccctgcgcat?cgcccgttcc 1140
acgccgccgc?tggggctggg?cggggggcga?ttccgcggcc?gacgaggggc?cgtcgcctgc 1200
cgcgccgcca?cgttccagca?gctcgacgcc?gtcggtgagt?ctccgtatca?aatgtggggg 1260
ggcatgtctt?ggtttgcgga?ttggtgggtt?gatttgaatg?tgtgttctcg?tggccgcagc 1320
ggtgagggag?gaggagtcca?agttcaaggc?gggggcggcg?gagggttgca?acatcctgcc 1380
gctcaagcga?tgcatcttct?ccgaccacct?cacgccggtg?ctcgcgtacc?gctgcctcgt 1440
cagggaggac?gaccgcgagg?cgcccagctt?cctgtttgag?tccgtcgagc?agggatcc 1498
<210>96
<211>2073
<212>DNA
＜213〉corn
<400>96
gaattccgcc?aaatcgggct?atagatcaaa?cgctgcactg?tagggagcgt?gaagccagcg 60
gcgaatggaa?tccctagccg?ccacctccgt?gttcgcgccc?tcccgcgtcg?ccgtcccggc 120
ggcgcgggcc?ctggttaggg?cggggacggt?ggtaccaacc?aggcggacga?gcagccggag 180
cggaaccagc?ggggtgaaat?gctctgctgc?cgtgacgccg?caggcgagcc?cagtgattag 240
caggagcgct?gcggcggcga?aggcggcgga?ggaggacaag?aggcggttct?tcgaggcggc 300
ggcgcggggg?agcgggaagg?ggaacctggt?gcccatgtgg?gagtgcatca?aggggaacct 360
ggtgcccatg?tgggagtgca?tcgtgtcgga?ccatctcacc?cccgtgctcg?cctaccgctg 420
cctcgtcccc?gaggacaacg?tcgacgcccc?cagcttcctc?ttcgagtccg?tcgagcaggg 480
gccccagggc?accaccaacg?tcggccgcta?tagcatggtg?ggagcccacc?cagtgatgga 540
gattgtggcc?aaagaccaca?aggttacgat?catggaccac?gagaagagcc?aagtgacaga 600
gcaggtagtg?gacgacccga?tgcagatccc?gaggaccatg?atggagggat?ggcacccaca 660
gcagatcgac?gagctccctg?aatccttctc?cggtggatgg?gttgggttct?tttcctatga 720
tacggttagg?tatgttgaga?agaagaagct?accgttctcc?agtgctcctc?aggacgatag 780
gaaccttcct?gatgtgcact?tgggactcta?tgatgatgtt?ctagtcttcg?ataatgttga 840
gaagaaagta?tatgttatcc?attgggtcaa?tgtggaccgg?catgcatctg?ttgaggaagc 900
ataccaagat?ggcaggtccc?gactaaacat?gttgctatct?aaagtgcaca?attccaatgt 960
ccccacactc?tctcctggat?ttgtgaagct?gcacacacgc?aagtttggta?cacctttgaa 1020
caagtcgacc?atgacaagtg?atgagtataa?gaatgctgtt?ctgcaggcta?aggaacatat 1080
tatggctggg?gatatcttcc?agattgtttt?aagccagagg?ttcgagagac?gaacatatgc 1140
caacccattt?gaggtttatc?gagcattacg?gattgtgaat?cctagcccat?acatggcgta 1200
tgtacaggca?agaggctgtg?tattggttgc?gtctagtcct?gaaattctta?cacgagtcag 1260
taaggggaag?attattaatc?gaccacttgc?tggaactgtt?cgaaggggca?agacagagaa 1320
ggaagatcaa?atgcaagagc?agcaactgtt?aagtgatgaa?aaacagtgtg?ccgagcacat 1380
aatgcttgtg?gacttgggaa?ggaatgatgt?tggcaaggta?tccaaaccag?gaggatcagt 1440
gaaggtggag?aagttgatta?ttgagagata?ctcccatgtt?atgcacataa?gctcaacggt 1500
tagtggacag?ttggatgatc?atctccagag?ttgggatgcc?ttgagagctg?ccttgcccgt 1560
tggaacagtc?agtggtgcac?caaaggtgaa?ggccatggag?ttgattgata?agttggaagt 1620
tacgaggcga?ggaccatata?gtggtggtct?aggaggaata?tcgtttgatg?gtgacatgca 1680
aattgcactt?tctctccgca?ccatcgtatt?ctcaacagcg?ccgagccaca?acacgatgta 1740
ctcatacaaa?gacgcagata?ggcgtcggga?gtgggtcgct?catcttcagg?ctggtgcagg 1800
cattgttgcc?gacagtagcc?cagatgacga?acaacgtgaa?tgcgagaata?aggctgctgc 1860
actagctcgg?gccatcgatc?ttgcagagtc?agcttttgtg?aacaaagaat?agtgtgctat 1920
ggttatcgtt?tagttcttgt?tcatgtttct?tttacccact?ttccgttaaa?aaaagatgtc 1980
attagtgggt?ggagaaaagc?aataagactg?ttctctagag?aaccgaagaa?atatggaaat 2040
tgaggttatg?gccggaattc?ctgcagcccg?ggg 2073
<210>97
<211>504
<212>DNA
＜213〉wheat (Triticum aestivum)
<400>97
cccaaacagt?ggtggcttag?gagggatatc?atttgatggt?gacatgctta?tcgctcttgc 60
tctccgcacc?attgtgtttt?caacagctcc?aagccccaat?aggatgtact?catacaaaag 120
ctcagatagg?ccccgagagt?gggttgctca?tcttcaggct?ggtgcgggca?ttgttgctga 180
tagtatccca?gacgatgagc?aaaaagaatt?tgagaataag?gcggctgccc?tagctcgggc 240
aattgatctt?gcagagtcgg?cttttttaga?caaagaatag?agtgtctatt?aaattatttt 300
ttttagttgt?tcatcatttt?tcacccagtt?cattttggaa?agttgttcat?cgttttttca 360
ccgagttcat?attggggaaa?aaaagcaata?ccgttttgtt?gtcctttgaa?atgaataaat 420
ttgagctata?ataagatgta?ttttgctcat?cgggcaaaaa?aaaaaaaaaa?aatataaaaa 480
aaaaaaaaaa?aaaaaaaaaa?aata 504
<210>98
<211>2161
<212>DNA
＜213〉tobacco (Nicotiana tabacum)
<400>98
gtcaaaaatc?cccatttcac?cgtttcctcg?tttctcctcc?tcactaattt?tgtctctttc 60
tcttggtttg?ctattgtgct?cttgtaggaa?tgcagtcgtt?acctatctca?taccggttgt 120
ttccggccac?ccaccggaaa?gttctgccat?tcgccgtcat?ttctagccgg?agctcaactt 180
ctgcacttgc?gcttcgtgtc?cgtacactac?aatgccgctg?ccttcactct?tcatctctag 240
ttatggatga?ggacaggttc?attgaagctt?ctaaaagcgg?gaacttgatt?ccgctgcaca 300
aaaccatttt?ttctgatcat?ctgactccgg?tgctggctta?ccggtgtttg?gtgaaagaag 360
acgaccgtga?agctccaagc?tttctctttg?aatccgttga?acctggtttt?cgaggttcta 420
gtgttggtcg?ctacagcgtg?gtgggggctc?aaccatctat?ggaaattgtg?gctaaggaac 480
acaatgtgac?tatattggac?caccacactg?gaaaattgac?ccagaagact?gtccaagatc 540
ccatgacgat?tccgaggagt?atttctgagg?gatggaagcc?cagactcatt?gatgaacttc 600
ctgatacctt?ttgtggtgga?tgggttggtt?atttctcata?tgacacagtt?cggtatgtag 660
agaacaggaa?gttgccattc?ctaagggctc?cagaggatga?ccggaacctt?gcagatattc 720
aattaggact?atacgaagat?gtcattgtgt?ttgatcatgt?tgagaagaaa?gcacatgtga 780
ttcactgggt?gcagttggat?cagtattcat?ctcttcctga?ggcatatctt?gatgggaaga 840
aacgcttgga?aatattagtg?tctagagtac?aaggaattga?gtctccaagg?ttatctcccg 900
gttctgtgga?tttctgtact?catgcttttg?gaccttcatt?aaccaaggga?aacatgacaa 960
gtgaggagta?caagaatgct?gtcttacaag?caaaggagca?cattgctgca?ggagacatat 1020
ttcaaatcgt?tttaagtcaa?cgctttgaga?gaagaacatt?tgctgaccca?tttgaagtgt 1080
acagagcatt?aagaattgtg?aatccaagcc?catatatgac?ttacatacaa?gccagaggct 1140
gtattttagt?tgcatcgagc?ccagaaattt?tgacacgtgt?gaagaagaga?agaattgtta 1200
atcgaccact?ggctgggaca?agcagaagag?ggaagacacc?tgatgaggat?gtgatgttgg 1260
aaatgcagat?gttaaaagat?gagaaacaac?gcgcagagca?catcatgctg?gttgatttag 1320
gacgaaatga?tgtaggaaag?gtgtcaaaac?ctggttctgt?gaatgtcgaa?aagctcatga 1380
gcgttgagcg?gtattcccat?gtgatgcaca?taagctccac?ggtctctgga?gagttgcttg 1440
atcatttaac?ctgttgggat?gcactacgtg?ctgcattgcc?tgttgggacc?gtcagtggag 1500
caccaaaggt?aaaggccatg?gagttgattg?atcagctaga?agtagctcgg?agagggcctt 1560
acagtggtgg?gtttggaggc?atttcctttt?caggtgacat?ggacatcgca?ctagctctaa 1620
ggacgatggt?attcctcaat?ggagctcgtt?atgacacaat?gtattcatat?acagatgcca 1680
gcaagcgtca?ggaatgggtt?gctcatctcc?aatccggggc?tggaattgtg?gctgatagta 1740
atcctgatga?ggaacagata?gaatgcgaga?ataaagtagc?cggtctgtgc?cgagccattg 1800
acttggccga?gtcagctttt?gtaaagggaa?gacacaaacc?gtcagtcaag?ataaatggtt 1860
ctgtgccaaa?tctattttca?agggtacaac?gtcaaacatc?tgttatgtcg?aaggacagag 1920
tacatgagaa?aagaaactag?cgaatatgaa?gatgtacata?aattctaaag?tggttttctt 1980
gttcagttta?atcttttact?ggattgagac?tgtagttgct?gaagatagtt?gtttagaatg 2040
accttcattt?tggtgttcct?gaaaggacag?tgcacatata?tagcaaattg?atcaaatgtt 2100
taatccttgt?atgcgggtga?gaatcaatgc?catcagcaat?ttggaaaaaa?aaaaaaaaaa 2160
a 2161
<210>99
<211>606
<212>PRT
＜213〉rice
<400>99
Met?Glu?Ser?Ile?Ala?Ala?Ala?Thr?Phe?Thr?Pro?Ser?Arg?Leu?Ala?Ala
1 5 10 15
Arg?Pro?Ala?Thr?Pro?Ala?Ala?Ala?Ala?Ala?Pro?Val?Arg?Ala?Arg?Ala
20 25 30
Ala?Val?Ala?Ala?Gly?Gly?Arg?Arg?Arg?Thr?Ser?Arg?Arg?Gly?Gly?Val
35 40 45
Arg?Cys?Ser?Ala?Gly?Lys?Pro?Glu?Ala?Ser?Ala?Val?Ile?Asn?Gly?Ser
50 55 60
Ala?Ala?Ala?Arg?Ala?Ala?Glu?Glu?Asp?Arg?Arg?Arg?Phe?Phe?Glu?Ala
65 70 75 80
Ala?Glu?Arg?Gly?Ser?Gly?Lys?Gly?Asn?Leu?Val?Pro?Met?Trp?Glu?Cys
85 90 95
Ile?Val?Ser?Asp?His?Leu?Thr?Pro?Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val
100 105 110
Pro?Glu?Asp?Asn?Met?Glu?Thr?Pro?Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu
115 120 125
Gln?Gly?Pro?Glu?Gly?Thr?Thr?Asn?Val?Gly?Arg?Tyr?Ser?Met?Val?Gly
130 135 140
Ala?His?Pro?Val?Met?Glu?Val?Val?Ala?Lys?Glu?His?Lys?Val?Thr?Ile
145 150 155 160
Met?Asp?His?Glu?Lys?Gly?Lys?Val?Thr?Glu?Gln?Val?Val?Asp?Asp?Pro
165 170 175
Met?Gln?Ile?Pro?Arg?Ser?Met?Met?Glu?Gly?Trp?His?Pro?Gln?Gln?Ile
180 185 190
Asp?Gln?Leu?Pro?Asp?Ser?Phe?Thr?Gly?Gly?Trp?Val?Gly?Phe?Phe?Ser
195 200 205
Tyr?Asp?Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys?Leu?Pro?Phe?Ser?Gly
210 215 220
Ala?Pro?Gln?Asp?Asp?Arg?Asn?Leu?Pro?Asp?Val?His?Leu?Gly?Leu?Tyr
225 230 235 240
Asp?Asp?Val?Leu?Val?Phe?Asp?Asn?Val?Glu?Lys?Lys?Val?Tyr?Val?Ile
245 250 255
His?Trp?Val?Asn?Leu?Asp?Arg?His?Ala?Thr?Thr?Glu?Asp?Ala?Phe?Gln
260 265 270
Asp?Gly?Lys?Ser?Arg?Leu?Asn?Leu?Leu?Leu?Ser?Lys?Val?His?Asn?Ser
275 280 285
Asn?Val?Pro?Lys?Leu?Ser?Pro?Gly?Phe?Val?Lys?Leu?His?Thr?Arg?Gln
290 295 300
Phe?Gly?Thr?Pro?Leu?Asn?Lys?Ser?Thr?Met?Thr?Ser?Asp?Glu?Tyr?Lys
305 310 315 320
Asn?Ala?Val?Met?Gln?Ala?Lys?Glu?His?Ile?Met?Ala?Gly?Asp?Ile?Phe
325 330 335
Gln?Ile?Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Gln?Thr?Tyr?Ala?Asn?Pro
340 345 350
Phe?Glu?Val?Tyr?Arg?Ala?Leu?Arg?Ile?Val?Asn?Pro?Ser?Pro?Tyr?Met
355 360 365
Ala?Tyr?Val?Gln?Ala?Arg?Gly?Cys?Val?Leu?Val?Ala?Ser?Ser?Pro?Glu
370 375 380
Ile?Leu?Thr?Arg?Val?Arg?Lys?Gly?Lys?Ile?Ile?Asn?Arg?Pro?Leu?Ala
385 390 395 400
Gly?Thr?Val?Arg?Arg?Gly?Lys?Thr?Glu?Lys?Glu?Asp?Glu?Met?Gln?Glu
405 410 415
Gln?Gln?Leu?Leu?Ser?Asp?Glu?Lys?Gln?Cys?Ala?Glu?His?Ile?Met?Leu
420 425 430
Val?Asp?Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val?Ser?Lys?Pro?Gly?Ser
435 440 445
Val?Lys?Val?Glu?Lys?Leu?Met?Asn?Ile?Glu?Arg?Tyr?Ser?His?Val?Met
450 455 460
His?Ile?Ser?Ser?Thr?Val?Ser?Gly?Glu?Leu?Asp?Asp?His?Leu?Gln?Ser
465 470 475 480
Trp?Asp?Ala?Leu?Arg?Ala?Ala?Leu?Pro?Val?Gly?Thr?Val?Ser?Gly?Ala
485 490 495
Pro?Lys?Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Glu?Leu?Glu?Val?Thr?Arg
500 505 510
Arg?Gly?Pro?Tyr?Ser?Gly?Gly?Leu?Gly?Gly?Ile?Ser?Phe?Asp?Gly?Asp
515 520 525
Met?Leu?Ile?Ala?Leu?Ala?Leu?Arg?Thr?Ile?Val?Phe?Ser?Thr?Ala?Pro
530 535 540
Ser?His?Asn?Thr?Met?Tyr?Ser?Tyr?Lys?Asp?Thr?Glu?Arg?Arg?Arg?Glu
545 550 555 560
Trp?Val?Ala?His?Leu?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala?Asp?Ser?Ser
565 570 575
Pro?Asp?Asp?Glu?Gln?Arg?Glu?Cys?Glu?Asn?Lys?Ala?Ala?Ala?Leu?Ala
580 585 590
Arg?Ala?Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Val?Asp?Lys?Glu
595 600 605
<210>100
<211>67
<212>PRT
＜213〉rice
<400>100
Met?Cys?Val?Leu?Val?Ala?Ala?Ala?Val?Arg?Glu?Glu?Glu?Ser?Lys?Phe
1 5 10 15
Lys?Ala?Gly?Ala?Ala?Glu?Gly?Cys?Asn?Ile?Leu?Pro?Leu?Lys?Arg?Cys
20 25 30
Ile?Phe?Ser?Asp?His?Leu?Thr?Pro?Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val
35 40 45
Arg?Glu?Asp?Asp?Arg?Glu?Ala?Pro?Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu
50 55 60
Gln?Gly?Ser
65
<210>101
<211>525
<212>PRT
＜213〉corn
<400>101
Met?Trp?Glu?Cys?Ile?Lys?Gly?Asn?Leu?Val?Pro?Met?Trp?Glu?Cys?Ile
1 5 10 15
Val?Ser?Asp?His?Leu?Thr?Pro?Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val?Pro
20 25 30
Glu?Asp?Asn?Val?Asp?Ala?Pro?Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu?Gln
35 40 45
Gly?Pro?Gln?Gly?Thr?Thr?Asn?Val?Gly?Arg?Tyr?Ser?Met?Val?Gly?Ala
50 55 60
His?Pro?Val?Met?Glu?Ile?Val?Ala?Lys?Asp?His?Lys?Val?Thr?Ile?Met
65 70 75 80
Asp?His?Glu?Lys?Ser?Gln?Val?Thr?Glu?Gln?Val?Val?Asp?Asp?Pro?Met
85 90 95
Gln?Ile?Pro?Arg?Thr?Met?Met?Glu?Gly?Trp?His?Pro?Gln?Gln?Ile?Asp
100 105 110
Glu?Leu?Pro?Glu?Ser?Phe?Ser?Gly?Gly?Trp?Val?Gly?Phe?Phe?Ser?Tyr
115 120 125
Asp?Thr?Val?Arg?Tyr?Val?Glu?Lys?Lys?Lys?Leu?Pro?Phe?Ser?Ser?Ala
130 135 140
Pro?Gln?Asp?Asp?Arg?Asn?Leu?Pro?Asp?Val?His?Leu?Gly?Leu?Tyr?Asp
145 150 155 160
Asp?Val?Leu?Val?Phe?Asp?Asn?Val?Glu?Lys?Lys?Val?Tyr?Val?Ile?His
165 170 175
Trp?Val?Asn?Val?Asp?Arg?His?Ala?Ser?Val?Glu?Glu?Ala?Tyr?Gln?Asp
180 185 190
Gly?Arg?Ser?Arg?Leu?Asn?Met?Leu?Leu?Ser?Lys?Val?His?Asn?Ser?Asn
195 200 205
Val?Pro?Thr?Leu?Ser?Pro?Gly?Phe?Val?Lys?Leu?His?Thr?Arg?Lys?Phe
210 215 220
Gly?Thr?Pro?Leu?Asn?Lys?Ser?Thr?Met?Thr?Ser?Asp?Glu?Tyr?Lys?Asn
225 230 235 240
Ala?Va1?Leu?Gln?Ala?Lys?Glu?His?Ile?Met?Ala?Gly?Asp?Ile?Phe?Gln
245 250 255
Ile?Val?Leu?Ser?Gln?Arg?Phe?Glu?Arg?Arg?Thr?Tyr?Ala?Asn?Pro?Phe
260 265 270
Glu?Val?Tyr?Arg?Ala?Leu?Arg?Ile?Val?Asn?Pro?Ser?Pro?Tyr?Met?Ala
275 280 285
Tyr?Val?Gln?Ala?Arg?Gly?Cys?Val?Leu?Val?Ala?Ser?Ser?Pro?Glu?Ile
290 295 300
Leu?Thr?Arg?Val?Ser?Lys?Gly?Lys?Ile?Ile?Asn?Arg?Pro?Leu?Ala?Gly
305 310 315 320
Thr?Val?Arg?Arg?Gly?Lys?Thr?Glu?Lys?Glu?Asp?Gln?Met?Gln?Glu?Gln
325 330 335
Gln?Leu?Leu?Ser?Asp?Glu?Lys?Gln?Cys?Ala?Glu?His?Ile?Met?Leu?Val
340 345 350
Asp?Leu?Gly?Arg?Asn?Asp?Val?Gly?Lys?Val?Ser?Lys?Pro?Gly?Gly?Ser
355 360 365
Val?Lys?Val?Glu?Lys?Leu?Ile?Ile?Glu?Arg?Tyr?Ser?His?Val?Met?His
370 375 380
Ile?Ser?Ser?Thr?Val?Ser?Gly?Gln?Leu?Asp?Asp?His?Leu?Gln?Ser?Trp
385 390 395 400
Asp?Ala?Leu?Arg?Ala?Ala?Leu?Pro?Val?Gly?Thr?Val?Ser?Gly?Ala?Pro
405 410 415
Lys?Val?Lys?Ala?Met?Glu?Leu?Ile?Asp?Lys?Leu?Glu?Val?Thr?Arg?Arg
420 425 430
Gly?Pro?Tyr?Ser?Gly?Gly?Leu?Gly?Gly?Ile?Ser?Phe?Asp?Gly?Asp?Met
435 440 445
Gln?Ile?Ala?Leu?Ser?Leu?Arg?Thr?Ile?Val?Phe?Ser?Thr?Ala?Pro?Ser
450 455 460
His?Asn?Thr?Met?Tyr?Ser?Tyr?Lys?Asp?Ala?Asp?Arg?Arg?Arg?Glu?Trp
465 470 475 480
Val?Ala?His?Leu?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala?Asp?Ser?Ser?Pro
485 490 495
Asp?Asp?Glu?Gln?Arg?Glu?Cys?Glu?Asn?Lys?Ala?Ala?Ala?Leu?Ala?Arg
500 505 510
Ala?Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Val?Asn?Lys?Glu
515 520 525
<210>102
<211>92
<212>PRT
＜213〉wheat
<400>102
Pro?Asn?Ser?Gly?Gly?Leu?Gly?Gly?Ile?Ser?Phe?Asp?Gly?Asp?Met?Leu
1 5 10 15
Ile?Ala?Leu?Ala?Leu?Arg?Thr?Ile?Val?Phe?Ser?Thr?Ala?Pro?Ser?Pro
20 25 30
Asn?Arg?Met?Tyr?Ser?Tyr?Lys?Ser?Ser?Asp?Arg?Pro?Arg?Glu?Trp?Val
35 40 45
Ala?His?Leu?Gln?Ala?Gly?Ala?Gly?Ile?Val?Ala?Asp?Ser?Ile?Pro?Asp
50 55 60
Asp?Glu?Gln?Lys?Glu?Phe?Glu?Asn?Lys?Ala?Ala?Ala?Leu?Ala?Arg?Ala
65 70 75 80
Ile?Asp?Leu?Ala?Glu?Ser?Ala?Phe?Leu?Asp?Lys?Glu
85 90
<210>103
<211>616
<212>PRT
＜213〉tobacco
<400>103
Met?Gln?Ser?Leu?Pro?Ile?Ser?Tyr?Arg?Leu?Phe?Pro?Ala?Thr?His?Arg
1 5 10 15
Lys?Val?Leu?Pro?Phe?Ala?Val?Ile?Ser?Ser?Arg?Ser?Ser?Thr?Ser?Ala
20 25 30
Leu?Ala?Leu?Arg?Val?Arg?Thr?Leu?Gln?Cys?Arg?Cys?Leu?His?Ser?Ser
35 40 45
Ser?Leu?Val?Met?Asp?Glu?Asp?Arg?Phe?Ile?Glu?Ala?Ser?Lys?Ser?Gly
50 55 60
Asn?Leu?Ile?Pro?Leu?His?Lys?Thr?Ile?Phe?Ser?Asp?His?Leu?Thr?Pro
65 70 75 80
Val?Leu?Ala?Tyr?Arg?Cys?Leu?Val?Lys?Glu?Asp?Asp?Arg?Glu?Ala?Pro
85 90 95
Ser?Phe?Leu?Phe?Glu?Ser?Val?Glu?Pro?Gly?Phe?Arg?Gly?Ser?Ser?Val
100 105 110
Gly?Arg?Tyr?Ser?Val?Val?Gly?Ala?Gln?Pro?Ser?Met?Glu?Ile?Val?Ala
115 120 125
Lys?Glu?His?Asn?Val?Thr?Ile?Leu?Asp?His?His?Thr?Gly?Lys?Leu?Thr
130 135 140
Gln?Lys?Thr?Val?Gln?Asp?Pro?Met?Thr?Ile?Pro?Arg?Ser?Ile?Ser?Glu
145 150 155 160
Gly?Trp?Lys?Pro?Arg?Leu?Ile?Asp?Glu?Leu?Pro?Asp?Thr?Phe?Cys?Gly
165 170 175
Gly?Trp?Val?Gly?Tyr?Phe?Ser?Tyr?Asp?Thr?Val?Arg?Tyr?Val?Glu?Asn
180 185 190
Arg?Lys?Leu?Pro?Phe?Leu?Arg?Ala?Pro?Glu?Asp?Asp?Arg?Asn?Leu?Ala
195 200 205
Asp?Ile?Gln?Leu?Gly?Leu?Tyr?Glu?Asp?Val?Ile?Val?Phe?Asp?His?Val
210 215 220
Glu?Lys?Lys?Ala?His?Val?Ile?His?Trp?Val?Gln?Leu?Asp?Gln?Tyr?Ser
225 230 235 240
Ser?Leu?Pro?Glu?Ala?Tyr?Leu?Asp?Gly?Lys?Lys?Arg?Leu?Glu?Ile?Leu
245 250 255
Val?Ser?Arg?Val?Gln?Gly?Ile?Glu?Ser?Pro?Arg?Leu?Ser?Pro?Gly?Ser
260 265 270
Val?Asp?Phe?Cys?Thr?His?Ala?Phe?Gly?Pro?Ser?Leu?Thr?Lys?Gly?Asn
275 280 285
Met?Thr?Ser?Glu?Glu?Tyr?Lys?Asn?Ala?Val?Leu?Gln?Ala?Lys?Glu?His
290 295 300
Ile?Ala?Ala?Gly?Asp?Ile?Phe?Gln?Ile?Val?Leu?Ser?Gln?Arg?Phe?Glu
305 310 315 320
Arg?Arg?Thr?Phe?Ala?Asp?Pro?Phe?Glu?Val?Tyr?Arg?Ala?Leu?Arg?Ile
325 330 335
Val?Asn?Pro?Ser?Pro?Tyr?Met?Thr?Tyr?Ile?Gln?Ala?Arg?Gly?Cys?Ile
340 345 350
Leu?Val?Ala?Ser?Ser?Pro?Glu?Ile?Leu?Thr?Arg?Val?Lys?Lys?Arg?Arg
355 360 365
Ile?Val?Asn?Arg?Pro?Leu?Ala?Gly?Thr?Ser?Arg?Arg?Gly?Lys?Thr?Pro
370 375 380
Asp?Glu?Asp?Val?Met?Leu?Glu?Met?Gln?Met?Leu?Lys?Asp?Glu?Lys?Gln
385 390 395 400
Arg?Ala?Glu?His?Ile?Met?Leu?Val?Asp?Leu?Gly?Arg?Asn?Asp?Val?Gly
405 410 415
Lys?Val?Ser?Lys?Pro?Gly?Ser?Val?Asn?Val?Glu?Lys?Leu?Met?Ser?Val
420 425 430
Glu?Arg?Tyr?Ser?His?Val?Met?His?Ile?Ser?Ser?Thr?Val?Ser?Gly?Glu
435 440 445
Leu?Leu?Asp?His?Leu?Thr?Cys?Trp?Asp?Ala?Leu?Arg?Ala?Ala?Leu?Pro
450 455 460
Val?Gly?Thr?Val?Ser?Gly?Ala?Pro?Lys?Val?Lys?Ala?Met?Glu?Leu?Ile
465 470 475 480
Asp?Gln?Leu?Glu?Val?Ala?Arg?Arg?Gly?Pro?Tyr?Ser?Gly?Gly?Phe?Gly
485 490 495
Gly?Ile?Ser?Phe?Ser?Gly?Asp?Met?Asp?Ile?Ala?Leu?Ala?Leu?Arg?Thr
500 505 510
Met?Val?Phe?Leu?Asn?Gly?Ala?Arg?Tyr?Asp?Thr?Met?Tyr?Ser?Tyr?Thr
515 520 525
Asp?Ala?Ser?Lys?Arg?Gln?Glu?Trp?Val?Ala?His?Leu?Gln?Ser?Gly?Ala
530 535 540
Gly?Ile?Val?Ala?Asp?Ser?Asn?Pro?Asp?Glu?Glu?Gln?Ile?Glu?Cys?Glu
545 550 555 560
Asn?Lys?Val?Ala?Gly?Leu?Cys?Arg?Ala?Ile?Asp?Leu?Ala?Glu?Ser?Ala
565 570 575
Phe?Val?Lys?Gly?Arg?His?Lys?Pro?Ser?Val?Lys?Ile?Asn?Gly?Ser?Val
580 585 590
Pro?Asn?Leu?Phe?Ser?Arg?Val?Gln?Arg?Gln?Thr?Ser?Val?Met?Ser?Lys
595 600 605
Asp?Arg?Val?His?Glu?Lys?Arg?Asn
610 615
12

Claims (210)

1. separated DNA of monomer Anthranilate synzyme of encoding, wherein said monomer Anthranilate synzyme comprises the single polypeptide that comprises Anthranilate synthetase alpha-domain and Anthranilate enzyme beta-domain, and wherein monomer Anthranilate synzyme is expressed in plant.
2. the unconverted plant that the separated DNA of claim 1, the expression of wherein said monomer Anthranilate synzyme have identical genetic background is relatively improved the level of L-tryptophan in the plant.
3. the separated DNA of claim 1, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
4. the separated DNA of claim 1, wherein said monomer Anthranilate synzyme comprises SEQ ID NO:4,7,43,58,59,60,61,62,63,64,65,69,70,77,78,79,80, any of 81 or 82.
5. the separated DNA of claim 1, wherein said separated DNA comprises SEQ ID NO:1,75,83,84,85,86,87,88,89, any of 90,91,92 or 93.
6. the separated DNA of claim 1, wherein said separated DNA coding comprise from the Anthranilate synthetase alpha domain of first species with from the chimeric monomer Anthranilate synzyme of the fusion of the Anthranilate enzyme beta domain of second species.
7. the separated DNA of claim 1, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglenagracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, cotton, rice, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
8. the separated DNA of claim 1, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,7980,81,82,99,100,101,102 or 103 any one at least a portion.
9. the separated DNA of claim 1, wherein said Anthranilate synzyme comprise and improve the Anthranilate synthase activity or reduce the sudden change of Anthranilate synzyme to the inhibiting susceptibility of tryptophan or its analog.
10. the separated DNA of claim 9, wherein said sudden change is in the tryptophan binding pocket.
11. the separated DNA of claim 9, wherein when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, described sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
12. the separated DNA of claim 9, wherein said sudden change is:
A) at about 48, Phe replaces Val;
B) at about 48, Tyr replaces Val;
C) at about 51, Phe replaces Ser;
D) at about 51, Cys replaces Ser;
E) at about 52, Phe replaces Asn;
F) at about 293, Ala replaces Pro;
G) at about 293, Gly replaces Pro; Perhaps
H) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
13. the separated DNA of claim 9, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
14. the separated DNA of claim 12, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
The plastid transit peptides 15. the separated DNA of claim 1, wherein said separated DNA are further encoded.
16. the separated DNA of claim 15, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
17. the separated DNA of claim 1, selectable marker gene or reporter but wherein said separated DNA is further encoded.
18. the separated DNA of claim 17, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
19. the separated DNA of claim 17, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
20. the separated DNA of claim 1, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
21. the separated DNA of claim 1, wherein said plant is a dicotyledon.
22. the separated DNA of claim 21, wherein said plant are soybean or canola.
23. the separated DNA of claim 1, wherein said plant is a monocotyledon.
24. the separated DNA of claim 23, wherein said plant is a corn, rice, wheat, barley or jowar.
25. the separated DNA of claim 1, the DNA of wherein said separated coding Anthranilate synzyme comprises the promotor that is connected with its operability.
26. comprise each the carrier of separated DNA of claim 1-25.
27. comprise each the seed of separated DNA of claim 1-25.
28. comprise the separated DNA genetically modified plants of the coding monomer Anthranilate synzyme that is connected with the promotor operability, wherein said monomer Anthranilate synzyme comprises Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, and wherein monomer Anthranilate synzyme is expressed in plant.
29. the genetically modified plants of claim 28, the expression of wherein said monomer Anthranilate synzyme have the level that the unconverted plant of identical genetic background is improved L-tryptophan in the plant relatively.
30. the genetically modified plants of claim 28, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
31. the genetically modified plants of claim 28, wherein said monomer Anthranilate synzyme is rhizobium melioti (Rhizobium meliloti) (Genbank registration number No.GI95177), Mesorhizobium loti (Genbank registration number No.GI 13472468), Bacterium melitense (Brucella melitensis) (Genbank registration number No.GI17982357), beads cyanobacteria (Nostoc sp.) PCC7120 (Genbank registration number No.GI17227910, GI17230725), Azospirillum brasilense (Azospirillum brasilense) (Genbank registration number No.GI1174156), or fish raw meat cyanobacteria (Anabaena) M22983 (Genbank registration number No.GI 152445) Anthranilate synzyme.
32. the genetically modified plants of claim 28, wherein said monomer Anthranilate synzyme are the chimeric monomer Anthranilate synzyme that comprises the fusion that is connected with Anthranilate enzyme beta domain from second species from the Anthranilate synthetase alpha domain of first species.
33. the genetically modified plants of claim 28, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglena gracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, cotton, rice, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
34. the genetically modified plants of claim 28, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,7980,81,82,99,100,101,102 or 103 any one at least a portion.
Improve the Anthranilate synthase activity or reduce of the sudden change of Anthranilate synzyme 35. the genetically modified plants of claim 28, wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
36. the genetically modified plants of claim 35, wherein said sudden change are in the tryptophan binding pocket.
37. the genetically modified plants of claim 35, when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, wherein said sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
38. the genetically modified plants of claim 35, wherein said sudden change is:
A) at about 48, Phe replaces Val;
B) at about 48, Tyr replaces Val;
C) at about 51, Phe replaces Ser;
D) at about 51, Cys replaces Ser;
E) at about 52, Phe replaces Asn;
F) at about 293, Ala replaces Pro;
G) at about 293, Gly replaces Pro; Perhaps
H) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
39. the genetically modified plants of claim 35, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
40. the genetically modified plants of claim 38, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
The plastid transit peptides 41. the genetically modified plants of claim 28, wherein said separated DNA are further encoded.
42. the genetically modified plants of claim 41, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
43. the genetically modified plants of claim 28, selectable marker gene or reporter but wherein said separated DNA is further encoded.
44. the genetically modified plants of claim 43, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
45. the genetically modified plants of claim 44, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
46. the genetically modified plants of claim 28, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when expressing.
47. the genetically modified plants of claim 28, wherein said plant is a dicotyledon.
48. the genetically modified plants of claim 47, wherein said plant are soybean or canola.
49. the genetically modified plants of claim 28, wherein said plant is a monocotyledon.
50. the genetically modified plants of claim 49, wherein said plant is a corn, rice, wheat, barley or jowar.
51. the seed of the genetically modified plants of claim 28.
52. comprise the genetically modified plants of the separated DNA of the coding Agrobacterium tumefaciens Anthranilate synzyme that is connected with the promotor operability or its domain.
53. the genetically modified plants of claim 52 are wherein expressed Agrobacterium tumefaciens Anthranilate synzyme or its domain, the feasible level that improves L-tryptophan in the described plant.
54. the genetically modified plants of claim 52, wherein said Agrobacterium tumefaciens Anthranilate synzyme comprises SEQ ID NO:4,58,59,60,61,62,63,64,65,69 or 70.
55. the genetically modified plants of claim 52, wherein said separated DNA comprise SEQ ID NO:1,75,84,85,86,87,88,89,90,91,92 or 93.
56. comprise the genetically modified plants of the separated DNA of the coding chimeric monomer Anthranilate synzyme that is connected with the promotor operability, wherein said monomer Anthranilate synzyme is from the Anthranilate synthetase alpha domain of first species with from the fusion of the Anthranilate enzyme beta domain of second species.
57. the genetically modified plants of claim 56 are wherein expressed chimeric monomer Agrobacterium tumefaciens Anthranilate synzyme, the feasible level that improves L-tryptophan in the described plant.
58. the genetically modified plants of claim 56, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglena gracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, rice, cotton, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
59. the genetically modified plants of claim 56, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,7980,81,82,99,100,101,102 or 103 any one at least a portion.
Improve the Anthranilate synthase activity or reduce of the sudden change of Anthranilate synzyme 60. the genetically modified plants of claim 52 or 56, wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
61. the genetically modified plants of claim 60, when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, wherein said sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
62. the genetically modified plants of claim 60, wherein said sudden change is in the tryptophan binding pocket.
63. the genetically modified plants of claim 60, wherein said sudden change is:
(a) at about 48, Phe replaces Val;
(b) at about 48, Tyr replaces Val;
(c) at about 51, Phe replaces Ser;
(d) at about 51, Cys replaces Ser;
(e) at about 52, Phe replaces Asn;
(f) at about 293, Ala replaces Pro;
(g) at about 293, Gly replaces Pro; Perhaps
(h) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
64. the genetically modified plants of claim 60, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
65. the genetically modified plants of claim 63, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
The plastid transit peptides 66. the genetically modified plants of claim 52 or 56, wherein said separated DNA are further encoded.
67. the genetically modified plants of claim 66, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
68. the genetically modified plants of claim 52 or 56, selectable marker gene or reporter but wherein said separated DNA is further encoded.
69. the genetically modified plants of claim 68, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
70. the genetically modified plants of claim 69, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
71. the genetically modified plants of claim 52 or 56, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when expressing.
72. the genetically modified plants of claim 52 or 56, wherein said plant is a dicotyledon.
73. the genetically modified plants of claim 72, wherein said plant are soybean or canola.
74. the genetically modified plants of claim 52 or 56, wherein said plant is a monocotyledon.
75. the genetically modified plants of claim 72, wherein said plant is a corn, rice, wheat, barley or jowar.
76. the seed of the genetically modified plants of claim 52 or 56.
77. comprise the genetically modified plants that comprise SEQ ID NO:5 or SEQ ID NO:66 that are connected with the promotor operability from the separated DNA of the αJie Gouyu of the coding Anthranilate synzyme of corn.
78. the genetically modified plants of claim 77, wherein said separated DNA comprise the SEQ ID NO:2 that is connected with the promotor operability, SEQ ID NO:67 or SEQ ID NO:68.
79. the genetically modified plants of claim 77 are wherein expressed the αJie Gouyu of monomer Anthranilate synzyme, make the level that improves L-tryptophan in the described plant.
Improve the Anthranilate synthase activity or reduce at least one sudden change of Anthranilate synzyme 80. the genetically modified plants of claim 77, wherein said domain comprise the inhibiting susceptibility of tryptophan or its analog.
81. the genetically modified plants of claim 77, wherein said sudden change is in the tryptophan binding pocket.
The plastid transit peptides 82. the genetically modified plants of claim 77, wherein said separated DNA are further encoded.
83. the genetically modified plants of claim 82, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
84. the genetically modified plants of claim 77, selectable marker gene or reporter but wherein said separated DNA is further encoded.
85. the genetically modified plants of claim 84, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
86. the genetically modified plants of claim 85, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
87. the genetically modified plants of claim 77, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when expressing.
88. the genetically modified plants of claim 77, wherein said plant is a dicotyledon.
89. the genetically modified plants of claim 88, wherein said plant are soybean or canola.
90. the genetically modified plants of claim 77, wherein said plant is a monocotyledon.
91. the genetically modified plants of claim 90, wherein said plant is a corn, rice, wheat, barley or jowar.
92. the seed of the genetically modified plants of claim 77.
93. a method that changes tryptophane in the plant comprises:
(a) in the plant regenerable cell, import and comprising that coding comprises the transgenosis of separated DNA of the monomer Anthranilate synzyme of Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, wherein said separated DNA operability is connected in the promotor that function is arranged in plant cell, obtain the plant transformed cell; With
(b) from described transformed plant cells regeneration plant, wherein said plant cell reaches the monomer Anthranilate synzyme that separated DNA is encoded with the scale that does not have effectively to improve tryptophane in the plant transformed the tryptophane in described plant with respect to identical genetic background.
94. the method for claim 93, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
95. the method for claim 93, wherein said monomer Anthranilate synzyme comprises SEQ ID NO:4,7,43,58,59,60,61,62,63,64,65,69,70,77,78,79,80, any of 81 or 82.
96. the method for claim 93, wherein said separated DNA comprise SEQ ID NO:1,75,83,84,85,86,87,88,89, and any of 90,91,92 or 93.
97. the method for claim 93, wherein said separated DNA coding comprise from the Anthranilate synthetase alpha domain of first species with from the chimeric monomer Anthranilate synzyme of the fusion of the Anthranilate enzyme beta domain of second species.
98. the method for claim 93, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglenagracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, cotton, rice, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
99. the method for claim 97, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,7980,81,82,99,100,101,102 or 103 any one at least a portion.
The plastid transit peptides 100. the method for claim 93, wherein said separated DNA are further encoded.
101. the method for claim 100, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
102. the method for claim 93, selectable marker gene or reporter but wherein said separated DNA is further encoded.
103. the method for claim 102, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
104. the method for claim 103, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
105. the method for claim 93, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
Improve the Anthranilate synthase activity or reduce of the sudden change of Anthranilate synzyme 106. the method for claim 93, wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
107. the method for claim 106, when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, wherein said sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
108. the method for claim 106, wherein said sudden change are in the tryptophan binding pocket.
109. the method for claim 106, wherein said sudden change is:
A) at about 48, Phe replaces Val;
B) at about 48, Tyr replaces Val;
C) at about 51, Phe replaces Ser;
D) at about 51, Cys replaces Ser;
E) at about 52, Phe replaces Asn;
F) at about 293, Ala replaces Pro;
G) at about 293, Gly replaces Pro; Perhaps
H) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
110. the method for claim 109, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
111. the method for claim 109, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
112. the method for claim 93, wherein said plant is a dicotyledon.
113. the method for claim 112, wherein said plant are soybean or canola.
114. the method for claim 93, wherein said plant is a monocotyledon.
115. the method for claim 114, wherein said plant is a corn, rice, wheat, barley or jowar.
116. a method that changes tryptophane in the plant comprises:
(a) in the plant regenerable cell, import comprise the coding that is connected with the promotor operability that function is arranged transgenosis in plant cell, obtain the plant transformed cell from the separated DNA of the Anthranilate synthetase alpha domain with SEQ ID NO:5 or SEQ ID NO:66 of corn; With
(b) from described transformed plant cells regeneration plant, wherein said plant cell reaches the Anthranilate synzyme that separated DNA is encoded with the scale that does not have effectively to improve tryptophane in the plant transformed the tryptophane in described plant with respect to identical genetic background.
Improve the Anthranilate synthase activity or reduce of the sudden change of this domain 117. the method for claim 116, the αJie Gouyu of wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
118. the method for claim 116, wherein said sudden change are in the tryptophan binding pocket.
119. the method for claim 116, wherein said plant is a dicotyledon.
120. the method for claim 119, wherein said plant are soybean or canola.
121. the method for claim 116, wherein said plant is a monocotyledon.
122. the method for claim 121, wherein said plant is a corn, rice, wheat, barley or jowar.
123. the method for claim 116, selectable marker gene or reporter but wherein said separated DNA is further encoded.
124. the method for claim 123, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
125. the method for claim 124, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
126. the method for claim 116, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
127. a method for preparing animal feed or human food comprises:
(a) in the plant regenerable cell, import and comprising that coding comprises the transgenosis of separated DNA of the monomer Anthranilate synzyme of Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, wherein said separated DNA operability is connected in the promotor that function is arranged in plant cell, obtain the plant transformed cell; With
(b) from described transformed plant cells regeneration plant, wherein said plant cell reaches the monomer Anthranilate synzyme that separated DNA is encoded with the scale that does not have effectively to improve tryptophane in the plant transformed the tryptophane in described plant with respect to identical genetic background.
128. the method for claim 127, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
129. the method for claim 127, wherein said monomer Anthranilate synzyme comprises SEQ ID NO:4,7,43,58,59,60,61,62,63,64,65,69,70,77,78,79,80, any of 81 or 82.
130. the method for claim 127, wherein said separated DNA comprise SEQ ID NO:1,75,83,84,85,86,87,88,89, and any of 90,91,92 or 93.
131. the method for claim 127, wherein said separated DNA coding comprise from the Anthranilate synthetase alpha domain of first species with from the chimeric monomer Anthranilate synzyme of the fusion of the Anthranilate enzyme beta domain of second species.
132. the method for claim 127, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglenagracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, cotton, rice, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
133. the method for claim 127, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,79 80,81,82,99,100,101,102 or 103 any one at least a portion.
Improve the Anthranilate synthase activity or reduce of the sudden change of Anthranilate synzyme 134. the method for claim 127, wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
135. the method for claim 134, wherein said sudden change are in the tryptophan binding pocket.
136. the method for claim 134, wherein said sudden change is:
A) at about 48, Phe replaces Val;
B) at about 48, Tyr replaces Val;
C) at about 51, Phe replaces Ser;
D) at about 51, Cys replaces Ser;
E) at about 52, Phe replaces Asn;
F) at about 293, Ala replaces Pro;
G) at about 293, Gly replaces Pro; Perhaps
H) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
137. the method for claim 136, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
138. the method for claim 134, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
The plastid transit peptides 139. the method for claim 127, wherein said separated DNA are further encoded.
140. the method for claim 139, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
141. the method for claim 127, selectable marker gene or reporter but wherein said separated DNA is further encoded.
142. the method for claim 141, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
143. the method for claim 142, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
144. the method for claim 127, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
145. the method for claim 127, wherein said plant is a dicotyledon.
146. the method for claim 145, wherein said plant are soybean or canola.
147. the method for claim 127, wherein said plant is a monocotyledon.
148. the method for claim 147, wherein said plant is a corn, rice, wheat, barley or jowar.
149. animal feed or human food, at least a portion of the plant of the separated DNA of the monomer Anthranilate synzyme that comprising encodes comprises Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, wherein said plant cell can be expressed the monomer Anthranilate synzyme of separated DNA coding.
150. the animal feed of claim 149 or human food, wherein said plant cell can reach the monomer Anthranilate synzyme that separated DNA is encoded with the scale that does not have effectively to improve tryptophane in the plant transformed the tryptophane in described plant with respect to identical genetic background.
151. the animal feed of claim 149 or human food, wherein said plant part comprises seed, leaf, stem, root, stem tuber, or fruit.
152. the animal feed of claim 149 or human food, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
153. the animal feed of claim 149 or human food, wherein said monomer Anthranilate synzyme comprises SEQ ID NO:4,7,43,58,59,60,61,62,63,64,65,69,70,77,78,79,80, any of 81 or 82.
154. the animal feed of claim 149 or human food, wherein said separated DNA comprises SEQ ID NO:1,75,83,84,85,86,87,88,89, and any of 90,91,92 or 93.
155. the animal feed of claim 149 or human food, wherein said separated DNA coding comprises from the Anthranilate synthetase alpha domain of first species with from the chimeric monomer Anthranilate synzyme of the fusion of the Anthranilate enzyme beta domain of second species.
156. the animal feed of claim 155 or human food, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglena gracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, rice, cotton, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
157. the animal feed of claim 149 or human food, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,79 80,81,82,99,100,101,102 or 103 any one at least a portion.
158. the animal feed of claim 149 or human food, wherein said Anthranilate synzyme comprises raising Anthranilate synthase activity or reduces the sudden change of Anthranilate synzyme to the inhibiting susceptibility of tryptophan or its analog.
159. the animal feed of claim 158 or human food, when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, wherein said sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
160. the animal feed of claim 158 or human food, wherein said sudden change is in the tryptophan binding pocket.
161. the animal feed of claim 158 or human food, wherein said sudden change is:
(a) at about 48, Phe replaces Val;
(b) at about 48, Tyr replaces Val;
(c) at about 51, Phe replaces Ser;
(d) at about 51, Cys replaces Ser;
(e) at about 52, Phe replaces Asn;
(f) at about 293, Ala replaces Pro;
(g) at about 293, Gly replaces Pro; Perhaps
(h) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
162. the animal feed of claim 149 or human food, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
163. the animal feed of claim 161 or human food, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
164. the animal feed of claim 149 or human food, the wherein said separated DNA plastid transit peptides of further encoding.
165. the animal feed of claim 164 or human food, wherein said plastid transit peptides comprises SEQ ID NO:72 or 74.
166. the animal feed of claim 149 or human food, selectable marker gene or reporter but wherein said separated DNA is further encoded.
167. the animal feed of claim 166 or human food, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
168. the animal feed of claim 167 or human food, wherein said Herbicid resistant comprises glyphosate, the resistance of glufosinate or dalapon.
169. the animal feed of claim 149 or human food, wherein said separated DNA is further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
170. the animal feed of claim 149 or human food, wherein said plant is a dicotyledon.
171. the animal feed of claim 170 or human food, wherein said plant is soybean or canola.
172. the animal feed of claim 149 or human food, wherein said plant is a monocotyledon.
173. the animal feed of claim 172 or human food, wherein said plant is a corn, rice, wheat, barley or jowar.
174. coding comprises the separated DNA of Anthranilate synzyme that has the polypeptide of 90% sequence homogeneity with SEQ ID NO:4 at least.
175. the separated DNA of coding Anthranilate synzyme comprises the DNA that has 60% sequence homogeneity at least with SEQ ID NO:1.
176. the separated DNA of claim 174 or 175, wherein said separated DNA comprise at least 20 nucleotide and under rigorous hybridization conditions with have the complementary sequence hybridization of the DNA of SEQ ID NO:1.
177. the separated DNA of claim 176, wherein said rigorous hybridization conditions comprise 42 ℃ down with 0.2x SSC washing.
178. the separated DNA of claim 176, wherein said separated DNA comprises any of SEQ IDNO:9-42 or 46-56.
179. coding is from the separated DNA of the αJie Gouyu with SEQ ID NO:5 or SEQ ID NO:66 amino acid sequence of the Anthranilate synzyme of corn.
180. coding has SEQID NO:2, the separated DNA of the nucleotide sequence of SEQ ID NO:67 or SEQ ID NO:68 from the αJie Gouyu of the Anthranilate synzyme of corn.
181. the separated DNA of claim 179 or 180, the αJie Gouyu of wherein said Anthranilate synzyme is expressed in plant, the feasible level that improves L-tryptophan in the plant.
182. having, the separated DNA of claim 179 or 180, wherein said domain reduce at least one sudden change of this domain to the inhibiting susceptibility of tryptophan or its analog.
183. the separated DNA of claim 179 or 180, wherein said sudden change are in the tryptophan binding pocket.
184. the separated DNA of claim 179 or 180, selectable marker gene or reporter but wherein said separated DNA is further encoded.
185. the separated DNA of claim 184, but wherein when described selectable marker gene is expressed, give described plant cell Herbicid resistant in plant.
186. the separated DNA of claim 185, wherein said Herbicid resistant comprise glyphosate, the resistance of glufosinate or dalapon.
187. the separated DNA of claim 179 or 180, wherein said separated DNA are further encoded and give the thuringiensis protein of plant insect-resistant in plant when being expressed.
188. the separated DNA of claim 179 or 180, wherein said plant is a dicotyledon.
189. the separated DNA of claim 188, wherein said plant are soybean or canola.
190. the separated DNA of claim 179 or 180, wherein said plant is a monocotyledon.
191. the separated DNA of claim 190, wherein said plant is a corn, rice, wheat, barley or jowar.
192. the separated DNA of claim 179 or 180, the separated DNA of the Anthranilate synzyme of wherein encoding comprises the promotor that is connected with its operability.
193. comprise the promotor of the separated DNA of claim 179 or 180.
194. the separated DNA of coding Anthranilate synthase mutant, wherein said sudden change comprises:
(a) at about 48, Phe replaces Val;
(b) at about 48, Tyr replaces Val;
(c) at about 51, Phe replaces Ser;
(d) at about 51, Cys replaces Ser;
(e) at about 52, Phe replaces Asn;
(f) at about 293, Ala replaces Pro;
(g) at about 293, Gly replaces Pro; Perhaps
(h) at about 298, Trp replaces Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
195. the separated DNA of claim 194, wherein said Anthranilate synzyme comprises any among the SEQ ID NO:58-65.
196. the separated DNA of claim 194, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
197. method for preparing tryptophan, comprise: under the condition of the monomer Anthranilate synzyme that is enough to express the separated DNA coding, cultivate protokaryon or the eukaryotic host cell that comprises separated DNA, wherein monomer Anthranilate synzyme comprises Anthranilate synthetase alpha domain and Anthranilate enzyme beta domain, and the condition that wherein is enough to express monomer Anthranilate synzyme comprises enough nutrition and precursors for host cell utilizes monomer Anthranilate synzyme secondary colour propylhomoserin.
198. further comprising, the method for claim 197, wherein said method produce phenyl propanoids, flavonoids, quasi-isoflavone, indoles, indole alkaloid, or indoles glucosinolates.
199. the method for claim 197, wherein said monomer Anthranilate synzyme is Agrobacterium tumefaciens, rhizobium melioti, Mesorhizobium loti, Bacterium melitense, beads cyanobacteria PCC7120, Azospirillum brasilense or fish raw meat cyanobacteria M22983 Anthranilate synzyme.
200. the method for claim 197, wherein said monomer Anthranilate synzyme comprises SEQ ID NO:4,7,43,58,59,60,61,62,63,64,65,69,70,77,78,79,80, any of 81 or 82.
201. the method for claim 197, wherein said separated DNA comprise SEQ ID NO:1,75,83,84,85,86,87,88,89, and any of 90,91,92 or 93.
202. the method for claim 197, wherein said separated DNA coding comprise from the Anthranilate synthetase alpha domain of first species with from the chimeric monomer Anthranilate synzyme of the fusion of the Anthranilate enzyme beta domain of second species.
203. the method for claim 197, wherein from Agrobacterium tumefaciens, fish raw meat cyanobacteria M22983, mouse ear mustard, Azospirillum brasilense, Bacterium melitense, Escherichia coli, Euglenagracilis, Mesorhizobium loti, beads cyanobacteria PCC7120, rhizobium melioti, rue, the color Rhodopseudomonas, salmonella typhimurium, serratia marcescens, sulfolobus solfataricus, soybean, cotton, rice, wheat, tobacco or corn obtain the DNA in coding for alpha domain or beta structure territory.
204. the method for claim 197, wherein said αJie Gouyu or beta structure territory are amino acid sequence SEQ ID NO:4,5,6,7,8,43,44,45,58,59,60,61,62,63,64,65,66,69,70,77,78,7980,81,82,99,100,101,102 or 103 any one at least a portion.
Improve the Anthranilate synthase activity or reduce of the sudden change of Anthranilate synzyme 205. the method for claim 197, wherein said Anthranilate synzyme comprise the inhibiting susceptibility of tryptophan or its analog.
206. the method for claim 205, when Anthranilate synzyme amino acid sequence was compared with the monomer Agrobacterium tumefaciens Anthranilate synzyme with SEQ ID NO:4, wherein said sudden change was in amino acid position 25-60 or 200-225 or 290-300 or 370-375.
207. the method for claim 205, wherein said sudden change are in the tryptophan binding pocket.
208. the method for claim 205, wherein said sudden change is:
(a) at about 48 Phe displacement Val;
(b) at about 48 Tyr displacement Val;
(c) at about 51 Phe displacement Ser;
(d) at about 51 Cys displacement Ser;
(e) at about 52 Phe displacement Asn;
(f) at about 293 Ala displacement Pro;
(g) at about 293 Gly displacement Pro; Perhaps
(h) at about 298 Trp displacement Phe; And
Wherein determine the sudden change position by the amino acid sequence of Anthranilate synzyme and the comparison of Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence.
209. the method for claim 197, wherein said Anthranilate synzyme comprises SEQ ID NO:58-65, any in 69 or 70.
210. the method for claim 197, wherein said Agrobacterium tumefaciens Anthranilate synzyme amino acid sequence is SEQ ID NO:4.
CN028135067A 2001-05-04 2002-05-03 Transgenic high tryptophan plant cell Expired - Lifetime CN1719971B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US28890401P 2001-05-04 2001-05-04
US60/288,904 2001-05-04
PCT/US2002/014207 WO2002090497A2 (en) 2001-05-04 2002-05-03 Transgenic high tryptophan plants

Publications (2)

Publication Number Publication Date
CN1719971A true CN1719971A (en) 2006-01-11
CN1719971B CN1719971B (en) 2011-04-13

Family

ID=23109154

Family Applications (1)

Application Number Title Priority Date Filing Date
CN028135067A Expired - Lifetime CN1719971B (en) 2001-05-04 2002-05-03 Transgenic high tryptophan plant cell

Country Status (9)

Country Link
US (1) US7217865B2 (en)
EP (1) EP1542527B1 (en)
CN (1) CN1719971B (en)
AR (1) AR035965A1 (en)
AT (1) ATE544859T1 (en)
AU (1) AU2002257246A1 (en)
BR (1) BRPI0209437B1 (en)
CA (2) CA2446258C (en)
WO (1) WO2002090497A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101967461A (en) * 2010-10-22 2011-02-09 秦皇岛领先科技发展有限公司 Fermentation method for azospirillum, fermentation liquor prepared by method and application of fermentation liquor
CN102171344A (en) * 2007-05-25 2011-08-31 加拿大国家研究委员会 Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7604976B2 (en) 2001-04-02 2009-10-20 Ceres, Inc. Sequence-determined DNA fragments encoding glutamine amidotransferase proteins
US7714189B2 (en) * 2002-05-03 2010-05-11 Monsanto Technology Llc High tryptophan maize
EP1970442B1 (en) * 2002-05-03 2017-01-18 Monsanto Technology LLC Transgenic high tryptophan plants
CN1728937B (en) 2002-05-03 2011-03-30 孟山都技术公司 Temporal seed promoters for expressing genes in plants
WO2003092363A2 (en) * 2002-05-03 2003-11-13 Monsanto Technology, Llc Transgenic high tryptophan plants
CN101035440B (en) * 2004-01-26 2013-03-27 孟山都技术公司 High protein soybean meal
JP4651410B2 (en) * 2004-04-13 2011-03-16 国立大学法人愛媛大学 Novel modified gene of rice anthranilate synthase gene OASA2 and use thereof
JP4538645B2 (en) * 2004-09-17 2010-09-08 独立行政法人科学技術振興機構 Tryptophan-containing soybean and use thereof
US20080134370A1 (en) * 2005-02-28 2008-06-05 Yuzuru Tozawa Novel Altered Gene from Rice Anthranilic Acid Synthase Gene Oasa2 and Use Thereof
AR054540A1 (en) * 2005-07-08 2007-06-27 Renessen Llc TRIPTOFAN HIGH SOYBEAN
KR101447300B1 (en) * 2006-08-11 2014-10-07 몬산토 테크놀로지 엘엘씨 Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase
CN108179129A (en) * 2018-03-13 2018-06-19 长沙艾格里生物肥料技术开发有限公司 A kind of application of Rhodopseudomonas palustris microbial inoculum in prevention and control false smut
CN113046260B (en) * 2021-02-04 2023-04-25 兴安盟莱绅生物农业有限公司 Microbial mixed microbial agent for promoting soybean growth and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4642411A (en) * 1984-09-04 1987-02-10 Molecular Genetics Research And Development Limited Partnership Tryptophan overproducer mutants of cereal crops
US4581847A (en) * 1984-09-04 1986-04-15 Molecular Genetics Research And Development Tryptophan overproducer mutants of cereal crops
US6118047A (en) 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
AU8682198A (en) * 1997-07-31 1999-02-22 Sanford Scientific, Inc. Transgenic plants using the tdc gene for crop improvement
WO2003092363A2 (en) * 2002-05-03 2003-11-13 Monsanto Technology, Llc Transgenic high tryptophan plants

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105925601A (en) * 2007-05-25 2016-09-07 22世纪有限责任公司 Nucleic Acid Sequences Encoding Transcription Factors Regulating Alkaloid Biosynthesis And Their Use In Modifying Plant Metabolism
US10941410B2 (en) 2007-05-25 2021-03-09 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9175302B2 (en) 2007-05-25 2015-11-03 22Nd Century Limited, Llc Method for increasing a nicotinic alkaloid in a Nicotiana plant by introducing a mutation into the gene encoding the NbTF7 transcription factor and plants and products made by said method
US8624083B2 (en) 2007-05-25 2014-01-07 National Research Council Of Canada Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US8822757B2 (en) 2007-05-25 2014-09-02 National Research Council Of Canada Nucleic acid sequences encoding transcription factors regulating nicotine alkaloid biosynthesis and their use in modifying plant metabolism
US9121030B2 (en) 2007-05-25 2015-09-01 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9133468B2 (en) 2007-05-25 2015-09-15 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9150872B2 (en) 2007-05-25 2015-10-06 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9157089B2 (en) 2007-05-25 2015-10-13 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9157090B2 (en) 2007-05-25 2015-10-13 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US11597941B2 (en) 2007-05-25 2023-03-07 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
CN102171344A (en) * 2007-05-25 2011-08-31 加拿大国家研究委员会 Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9752156B2 (en) 2007-05-25 2017-09-05 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9732350B2 (en) 2007-05-25 2017-08-15 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US10968459B2 (en) 2007-05-25 2021-04-06 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US9976153B2 (en) 2007-05-25 2018-05-22 22Nd Century Limited, Llc Down regulation of auxin response factor NbTF7 to increase nicotine in a plant
US9988640B2 (en) 2007-05-25 2018-06-05 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US10030249B2 (en) 2007-05-25 2018-07-24 22Nd Century Limited, Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US10337020B2 (en) 2007-05-25 2019-07-02 22Nd Century Limited Llc Nucleic acid sequences encoding transcription factors regulating alkaloid biosynthesis and their use in modifying plant metabolism
US10669552B2 (en) 2007-05-25 2020-06-02 22Nd Century Limited, Llc Up-regulation of auxin response factor NbTF7 to decrease nicotine in a plant
CN105925601B (en) * 2007-05-25 2021-01-01 22世纪有限责任公司 Nucleic acid sequences encoding transcription factors regulating alkaloid synthesis and their use for improving plant metabolism
CN102171344B (en) * 2007-05-25 2016-03-16 22世纪有限责任公司 The nucleotide sequence of the transcription factor of coding and regulating alkaloid synthesis and the application in improvement plant metabolism thereof
CN101967461A (en) * 2010-10-22 2011-02-09 秦皇岛领先科技发展有限公司 Fermentation method for azospirillum, fermentation liquor prepared by method and application of fermentation liquor
CN101967461B (en) * 2010-10-22 2012-06-27 领先生物农业股份有限公司 Fermentation method for azospirillum, fermentation liquor prepared by method and application of fermentation liquor

Also Published As

Publication number Publication date
ATE544859T1 (en) 2012-02-15
US20030097677A1 (en) 2003-05-22
AR035965A1 (en) 2004-07-28
BRPI0209437B1 (en) 2019-02-26
EP1542527A4 (en) 2006-03-08
CA2446258C (en) 2013-02-12
EP1542527A2 (en) 2005-06-22
CN1719971B (en) 2011-04-13
WO2002090497A2 (en) 2002-11-14
BR0209437A (en) 2011-07-05
AU2002257246A1 (en) 2002-11-18
US7217865B2 (en) 2007-05-15
CA2709843A1 (en) 2002-11-14
CA2446258A1 (en) 2002-11-14
EP1542527B1 (en) 2012-02-08
WO2002090497A3 (en) 2005-04-28
CA2709843C (en) 2014-02-18

Similar Documents

Publication Publication Date Title
CN1263856C (en) Operation of enzymatic vitality of protoporphyrin primary oxidase in eukaryote
CN1049454C (en) Fertile transgenic corn plants
CN1852975A (en) Transgenic high tryptophan plants
CN1024021C (en) Herbicid resistance plant consisting glutathione S-transferase
CN1245516C (en) Gene encoding acetolactic acid sy nthase gene
CN1285875A (en) Mutated hydroxy-phenyl pyruvate dioxygenase, DNA sequence and method for obtaining herbicide-tolerant plants containing such gene
CN1246461C (en) Method for compositions for modifying levels of secondary metabolic compounds in plants
CN1195861C (en) Encapsulation of polypeptides within starch matrix
CN1236394A (en) Herbicide resistant plants
CN1201012C (en) Alteration of flowering time in plants
CN1950509A (en) High lysine maize compositions and methods for detection thereof
CN1933723A (en) Corn plant mon88017 and compositions and methods for detection thereof
CN1705748A (en) Method for increasing total oil levels in plants
CN1719971A (en) Transgenic high tryptophan plants
CN1252098A (en) Soybean plant producing seeds with reduced levels of raffinose saccharides and phytic acid
CN1191357C (en) Orally immunogenic bacterial enterotoxins expressed in transgenic plants
CN1193097C (en) Improved integration of exogenous DNA delivered to eukaryoltic cells
US9090882B2 (en) Compositions and methods for enhanced amino acid levels in plants conferred by lysine and/or threonine feedback insensitive aspartate kinase proteins
CN1406282A (en) Transgenic plants with increased seed yield, biomass and harvest index
CN1252097A (en) Selection for transgenic plants
CN1822763A (en) Method of constructing plant showing improved growtn under regulation of nitrogen
CN1685040A (en) Seed specific USP promoters for expressing genes in plants
CN1810977A (en) Nucleic acids that enhance the synthesis of 2-acetyl-1-pyrroline in plants and fungi
CN101044153A (en) Eukaryotic translation initiation factor gene regulatory elements for use in plants
CN1198921C (en) Raffinose synthetase gene, process for producing, same, and transformed plant

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CX01 Expiry of patent term

Granted publication date: 20110413

CX01 Expiry of patent term