CN1839206A - RNA interferases and methods of use thereof - Google Patents

Abstract

The present invention is directed to the discovery of a novel family of enzymes designated herein as mRNA interferases that exhibit endoribonuclease activity. The novel finding of the present inventors, therefore, presents new applications for which mRNA interferase nucleic and amino acid sequences, and compositions thereof may be used to advantage. The invention also encompasses screening methods to identify compounds/agents capable of modulating mRNA interferase activity and methods for using such compounds/agents. Also provided is a kit comprising mRNA interferase nucleic and/or amino acid sequences, mRNA interferase activity compatible buffers, and instruction materials.

Description

RNA interferases and using method thereof

Invention field

What [0001] the present invention relates to is biology field, the particularly active discovery of novel enzyme.What the present invention relates to especially, is to the evaluation of a novel protein family of called after mRNA interferases (interferase) here.The example member of family described herein comprises MazF and PemK, and their homologue and directly to homologue (ortholog).What more particularly the present invention relates to is to characterizing as the MazF of endoribonuclease or mRNA interferases and the biochemical property of PemK polypeptide.Invention has also comprised the analysis to associated protein, and these proteic effects are the activity that suppress the mRNA interferases.Especially, described here to the MazE protein function and to the sign of MazF activity influence, and to the PemI protein function and to the sign of PemK activity influence.Here also provide for novel mRNA interferases MazF and PemK and MazF and the active conditioning agent of the PemK using method of MazE and PemI for example for example, they can be used for research and therapeutic application.

Background of invention

[0002] in intestinal bacteria, apoptosis is by by two genomic constitutions " habit-forming assembly " mediation, the toxic protein (toxin) that one of them genes encoding is stable, toxinicide (the Engelberg-Kulka and Glaser that another genes encoding is short-lived, AnnuRev Microbiol 53,43-70 (1999)).Toxin and toxinicide are by an operon co expression, and interacting forms a stabilized complex, and their expression is by oxin-antitoxin mixture or the automatic adjusting of toxinicide self.For example when adverse environmental factor had suppressed their coexpression, toxinicide was made detoxifying function in its target by proteasome degradation.The genetic system of this bacterial cell programmed death is reported in many escherichia coli chromosome external components to some extent, kills effect (Tsuchimoto et al., J Bacteriol 170,1461-6 (1988) after the promptly so-called separation; Roberts and Helinski, J Bacteriol 174,8119-32 (1992)).When bacterium had been lost plasmid or other extra-chromosomal elements, cell was optionally killed, because unsettled toxinicide is degraded sooner with respect to its relevant ST.Therefore the short-lived toxinicide of cell hobby is because their de novo synthesis is essential for the survival of cell.

[1003] (Gotfredsen and Gerdes, Mol Microbiol 29,1065-76 (1998) in the known habit-forming assembly (addiction module) on escherichia coli chromosome; Mittenhuber, J Mol Microbiol Biotechnol 1,295-302 (1999)), intestinal bacteria MazEF system is habit-forming assembly (the Aizenmanet al. of first known protokaryon karyomit(e), Proc Natl AcadSci USA 93,6059-63 (1996)).The mazEF assembly is made up of two eclipsed gene mazE and mazF, and they are positioned at the downstream of relA gene.MazF is a stable toxin, and MazE is a unsettled toxinicide, is easy to the ClpPA serine stretch protein enzyme liberating (Aizenman et al., Proc NatlAcad Sci USA 93,6059-63 (1996)) that is relied on by ATP in vivo.The expression of mazEF by guanosine-3 ', 5 '-dipyrophosphoric acid (ppGpp) negative regulation, ppGpp is by RelA synthetic (Aizenman et al., Proc Natl Acad Sci USA 93,6059-63 (1996)) under serious amino acid starvation condition.And the necrocytosis of mazEF mediation can be comprised that rifomycin, paraxin and spectinomycin (Sat et al., J Bacteriol 183,2041-5 (2001)) cause by some microbiotic.Use experimental result prompting MazF in the body that Bacillus coli cells carries out to suppress duplicate (Pedersen et al., Mol Microbiol45, the 501-10 (2002)) of proteinic synthetic and DNA.The death of having reported the athymia pyrimidine recently is by mazEF assembly mediation (B.Sat, M.Reches, H.Engelberg-Kulka, J Bacteriol185,1803-7 (2003)).

[1004] in intestinal bacteria, known more extrachromosomal elements contain habit-forming assembly, and by killing the apoptosis that effect causes bacterium after the so-called separation.Study the habit-forming assembly of the most thorough karyomit(e) outward and comprise phd-doc system (Lehnherret al. (1993) J Mol Biol 233,414-428 on the phage P1; Gazit and Sauer. (1999) J Biol Chem 274,16813-16818; Magnuson et al. (1996) J Biol Chem271,18705-18710; Lehnherr and Yarmolinsky. (1995) Proc NatlAcad Sci USA 92,32743277), the ccdA-ccdB system on the F-factor (Tam andKline. (1989) J Bacteriol 171,2353-2360; Bahassi et al. (1999) JBiol Chem 274,10936-10944; Afif et al. (2001) Mol Microbiol41,73-82; Dao-Thi et al. (2002) J Biol Chem 277,3733-3742), the kis-kid system on the plasmid R1 (Ruiz-Echevarria et al. (1991) MolMicrobiol 5,2685-2693; Hargreaves et al. (2002) Structure (Camb) 10,1425-1433; Ruiz-Echevarria et al. (1995) J Mol Biol247,568-577; Santos-Sierra et al. (2003) Plasmid 50,120-130) and (Tsuchimoto et al. (1992) JBacteriol 174,42054211 of the pemI-pemK system on the plasmid R100; Tsuchimoto et al. (1988) J Bacteriol170,1461-1466; Tsuchimoto and Ohtsubo. (1993) Mol Gen Genet237,81-88; Tsuchimoto and Ohtsubo. (1989) Mol Gen Genet215,463-468).What is interesting is that escherichia coli chromosome also contains some habit-forming component systems, for example relBE system (Gotfredsen and Gerdes. (1998) Mol Microbiol29,1065-1076; Christensen et al. (2001) Proc Natl Acad Sci USA98,14328-14333; Christensen and Gerdes. (2003) Mol Microbiol48,1389-1400; Pedersen et al. (2003) Cell 112,131-140), mazEF system (Aizenman et al. (1996) Proc Natl Acad Sci USA93,6059-6063; Marianovsky et al. (2001) J Biol Chem 276,5975-5984; Kamada et al. (2003) Mol Cell 11,875-884; Zhang etal. (2003) J Biol Chem 278,32300-32306) and chpB system (SantosSierra et al. (1998) FEMS Microbiol Lett 168,51-58; Masuda etal. (1993) J Bacteriol 175,6850-6856; Christensen et al. (2003) J Mol Biol 332,809-819).

[1005] cytosis of the toxin relevant with habit-forming assembly is furtherd investigate.Toxin ccdB in the ccdA-ccdB system and dna helicase interact and have stoped that DNA's duplicate that (Bahassi et al. (1999) is the same; Kampranis et al. (1999) J MolBiol 293,733-744), toxin RelE in the relBE system still can not degrade RNA (Pedersen et al. (2003), the same) freely with the mRNA in the codon specificity cutting rrna A site of height.But show recently, the mRNA in A site cutting can not have to occur under the situation of RelE (Hayes and Sauer. (2003) Mol Cell 12,903-911).Therefore, A site mRNA cuts really cutter system and does not also know.The toxin MazF (ChpAK) of mazEF system coding and the toxin C hpBK of chpB system coding are considered to by an effect similar mechanism with RelE, suppress translation (Christensen et al. (2003), the same) by rrna dependence and the special mode of codon.It is a sequence-specific endoribonuclease that but inventor of the present invention proves MazF recently, it only works to single stranded RNA, the mRNA at preferential cutting ACA sequence place, cutting mode does not rely on rrna and codon, therefore different with RelE on function (Zhang et al. (2003) Mol Cell 12,913-923).

[1006] to have participated in the low copy of two closely-related incFII plasmid respectively be that (Tsuchimoto et al. (1992) is the same for plasmid R100 for pemI-pemK system and kis-kid system; Tsuchimoto et al. (1988) is the same) and R1 (Ruiz-Echevarria etal. (1991) is the same; Bravo et al. (1987) Mol Gen Genet 210, stable maintenance 101-110).These two systems that it is now know that are identical (Engelberg-Kulka andGlaser. (1999), the same).Proved that Kid (PemK) has suppressed duplicating of ColE1 plasmid, it works when the DNA synthetic is initial, but does not suppress the replication in vitro (Ruiz-Echevarria et al. (1995) is the same) of P4 DNA.Up to now, also there is not evidence to show that Kid (PemK) suppresses duplicating of chromosomal DNA.Toxin Kid (PemK) and toxinicide Kis (PemI) not only work in bacterium, and useful effect in many eukaryotes.Kid (PemK) suppresses the propagation of yeast, Africa xenopus (Xenopus laevis) and people's cell, wherein Kis (PemI) removed this inhibition (de la Cueva-Mendez et al. (2003) Embo J 22,246-251).Proved that Kid (PemK) has caused the apoptosis of people's cell (de laCueva-Mendez et al. (2003) is the same).These results suggest Kid (PemK) has a common target in protokaryon and eukaryote.

[1007] document of quoting here should not be understood that to admit that they are prior aries of the present invention.

[1008] other characteristics of the present invention and advantage can become clear and definite from detailed Description Of The Invention, accompanying drawing and claim.

Summary of the invention

[1009] in first aspect, what the present invention relates to is the discovery of a novel enzyme family, and this enzyme is also referred to as " RNA interferases " here.As described herein-in, exemplary endoribonuclease comprises MazF and PemK and homologue thereof and directly to homologue in the mRNA interferases family.Therefore the present invention includes the endoribonuclease that has with the sequence and/or the homologous structure of MazF or PemK homologous peptide.

[0010] it should be noted that before discovery of the present invention, the cell target of MazF also is not found.And, the invention still further relates to following discovery, promptly PemK is by synthesizing with sequence-specific mode incising cell mRNA blocking protein.Therefore inventor's of the present invention new discovery has proposed the new application of mRNA interferases (for example MazF and/or PemK), and wherein the nucleic acid of mRNA interferases and aminoacid sequence and composition thereof can advantageously be used.This use includes, but are not limited to, and multiple different research and therapeutic are used, as described below here.Also provide comprise mRNA interferases (for example MazF and/or PemK) nucleic acid and/or aminoacid sequence, with the damping fluid and the directions for use material of mRNA interferases activity compatible.

[0011] the present invention also provides detection mRNA interferases or the active method of its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) nucleotide sequence in expression (a) step; (c) nucleotide sequence and the endoribonuclease substrate of expressing in the step (b) are hatched jointly; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provides the active positive of endoribonuclease of detection means or mRNA interferases or its functional fragment to indicate.

[0012] the present invention has comprised that also identify can the regulating mRNA interferases or the screening method of its functional fragment active factor, wherein said activity is the endoribonuclease activity, and described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) nucleotide sequence in expression (a) step; (c) under can promoting the active condition of endoribonuclease, the nucleotide sequence and the endoribonuclease substrate of expressing in the step (b) are hatched jointly; (d) the active factor of endoribonuclease of at least a possible regulating mRNA interferases of adding or its functional fragment; And the cutting of (e) measuring described substrate, the cutting of wherein said substrate shown that endoribonuclease is active and the positive that detects the active means of endoribonuclease or mRNA interferases or its functional fragment indication is provided, wherein at least a can the regulating mRNA interferases or the change that is cut amount of substrate when existing of the active factor of its functional fragment endoribonuclease identified a kind of can the regulating mRNA interferases or the active factor of its functional fragment endoribonuclease.These methods are external or carry out in cell.

[0013] factor determined of this use method of the present invention can the regulating mRNA interferases or the endoribonuclease activity of its functional fragment, can cause that the substrate cutting increases or reduces.The present invention has also comprised the factor of using method of the present invention to identify.

[0014] on the other hand, regulating mRNA interferases or the active method of its functional fragment have been proposed, wherein said activity is the endoribonuclease activity, and described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) nucleotide sequence in expression (a) step; (c) under can promoting the active condition of endoribonuclease, the nucleotide sequence and the endoribonuclease substrate of expressing in the step (b) are hatched jointly; (d) adding can the regulating mRNA interferases or the active factor of its functional fragment endoribonuclease; And the cutting of (e) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and the positive that detects the active means of endoribonuclease or mRNA interferases or its functional fragment indication is provided that the change that wherein is cut amount of substrate when this factor exists provides regulating mRNA interferases or the active means of its functional fragment endoribonuclease.

[0015] nucleotide sequence of exemplary coding mRNA interferases includes, but are not limited to, SEQ ID NO:1 or 3 and coding SEQ ID NO:2 or 4 nucleotide sequence, and its homologue described below here and directly to homologue.An one exemplary homologue/be MazF-mtl directly to homologue, comprise the nucleic acid and the aminoacid sequence that comprise SEQ ID NO:69 and 74 respectively.

[0016] in another embodiment, provide detection mRNA interferases or the active method of its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the aminoacid sequence that comprises the mRNA interferases (a) is provided; (b) under the active condition of endoribonuclease the aminoacid sequence and the endoribonuclease substrate of step (a) are hatched jointly can promoting; And the cutting of (c) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provides the active positive of endoribonuclease of detection means or mRNA interferases or its functional fragment to indicate.

[0017] the present invention has comprised that also identify can the regulating mRNA interferases or the screening method of its function fragment active factor, wherein said activity is the endoribonuclease activity, and described method comprises: the aminoacid sequence that comprises the mRNA interferases (a) is provided; (b) under the active condition of endoribonuclease the aminoacid sequence and the endoribonuclease substrate of step (a) are hatched jointly can promoting; (c) the active factor of endoribonuclease of at least a possible regulating mRNA interferases of adding or its functional fragment; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate shown that endoribonuclease is active and the active means of endoribonuclease that detect mRNA interferases or its functional fragment is provided, and the change that wherein is cut amount of substrate when the described at least a factor exists has been determined can the regulating mRNA interferases or the active factor of its functional fragment endoribonuclease.These methods can be for example external or carry out in cell.

[0018] factor of using these methods to determine can the regulating mRNA interferases or the endoribonuclease activity of its functional fragment, can realize the increase or the minimizing of substrate cutting.This modulability factor is in category of the present invention.Be to be understood that this factor is passable, for example by acting on mRNA interferases (toxin) or its toxinicide (PemI separately for example, MazE, perhaps in the two one functional and/or structural homologue or directly to the toxinicide of homologue), perhaps by changing self-control Feedback mechanism (the oxin-antitoxin mixture is reduced toxin and toxinicide expression of gene whereby), the endoribonuclease of regulating mRNA interferases (PemK for example, MazF or functional and/or structural homologue or directly to homologue) activity.The factor that can change self-control Feedback mechanism (the oxin-antitoxin mixture is reduced toxin and toxinicide expression of gene whereby) can change the coordination regulation and control of these genes.In the one side of this embodiment, the factor that can reduce the formation of oxin-antitoxin mixture has suppressed antitoxic effect, causes the active increase of toxin, finally causes necrocytosis.On the other hand, related to the factor that can block toxinicide and toxin gene expression, wherein this factor causes the stability property of toxin level owing to toxin, with respect to the increase of toxinicide level.This imbalance also can cause cytotoxicity.

[0019] therefore, this factor can be advantageously used in the study subject that treatment has infectation of bacteria, and particularly those are have the study subject of bacterial isolateses infection of resistance to antibiosis.This factor belongs in the category of the present invention and can use or unite use separately.

[0020] also provide regulating mRNA interferases or the active method of its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the aminoacid sequence that the mRNA interferases (a) is provided; (b) under the active condition of endoribonuclease the aminoacid sequence and the endoribonuclease substrate of step (a) are hatched jointly can promoting; (c) adding can the regulating mRNA interferases or the active factor of endoribonuclease of its functional fragment; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and the positive that detects the active means of endoribonuclease or mRNA interferases or its functional fragment indication is provided that the change that wherein is cut amount of substrate when this factor exists provides regulating mRNA interferases or the active means of its functional fragment endoribonuclease.These methods can be in detection for example based on cell (in cultivation or in study subject such as inhuman animal or human patients) or in external use.

[0021] according to the present invention, the exemplary amino acid sequence that comprises the mRNA interferases includes, but not limited to SEQ ID NO:2 or 4 and its homologue of being described below and directly to homologue here.Its exemplary homologue/be MazF-mt1 directly to homologue, it comprises the aminoacid sequence of SEQ IDNO:74.

[0022] the present invention also is included in and detects mRNA interferases or the active method of its functional fragment in the cell, wherein said activity is the endoribonuclease activity, described method comprises: the cell that comprises expression vector (a) is provided, this carrier comprises the nucleotide sequence of coding mRNA interferases, and/or coding comprises the aminoacid sequence of mRNA interferases, and this carrier selectively comprises at least one regulating and controlling sequence; (b) cell in the incubation step (a) under promoting the active condition of at least a cell substrate endoribonuclease; And the cutting of (c) measuring described at least a cell substrate, the cutting of wherein said at least a cell substrate has shown that endoribonuclease is active and the active means of endoribonuclease that detect mRNA interferases in the cell or its functional fragment is provided.

[0023] on the one hand, regulating mRNA interferases or the active method of its functional fragment in cell have been proposed, wherein said activity is the endoribonuclease activity, described method comprises: the cell that comprises expression vector (a) is provided, this carrier comprises the nucleotide sequence of coding mRNA interferases, and/or coding comprises the aminoacid sequence of mRNA interferases, and this carrier selectively comprises at least one regulating and controlling sequence; (b) cell in the incubation step (a) under promoting the active condition of at least a cell substrate endoribonuclease; (c) adding can the regulating mRNA interferases or the active factor of its functional fragment endoribonuclease; And the cutting of (d) measuring described at least a cell substrate, the cutting of wherein said at least a cell substrate shown that endoribonuclease is active and the active means of endoribonuclease that detect mRNA interferases in the cell or its functional fragment is provided, and wherein under the situation that this factor exists at least a change that is cut amount of substrate the endoribonuclease active means of regulating mRNA interferases or its functional fragment are provided.

What [0024] also propose is screening method, can the regulating mRNA interferases or the active factor of its function fragment to identify in cell, wherein said activity is the endoribonuclease activity, described method comprises: the cell that comprises expression vector (a) is provided, this carrier comprises the nucleotide sequence of coding mRNA interferases, and/or coding comprises the aminoacid sequence of mRNA interferases, and this carrier selectively comprises at least one regulating and controlling sequence; (b) cell in the incubation step (a) under promoting the active condition of at least a cell substrate endoribonuclease; (c) add at least a possible regulating mRNA interferases or the active factor of its functional fragment; And the cutting of (d) measuring described at least a cell substrate, the cutting of wherein said at least a cell substrate shown that endoribonuclease is active and the active means of endoribonuclease that detect mRNA interferases in the cell or its functional fragment is provided, and wherein under the situation that this factor exists at least a change that is cut amount of substrate identified can the regulating mRNA interferases or the active factor of its functional fragment.

[0025], comprises the nucleotide sequence that the cell of expression vector (expression vector comprises the nucleic acid of coding mRNA interferases) comprises and include, but are not limited to, SEQ ID NO:1 or 3, and its homologue described herein and directly to homologue according to the present invention; And coding SEQ ID NO:2 and 4 nucleotide sequence and its homologue described herein and directly to homologue.Its exemplary homologue and be MazF-mt1 to homologue directly comprises the nucleic acid and the aminoacid sequence that contain SEQ ID NO:69 and 74 respectively.

[0026] also provides composition, composition comprises at least a mRNA interferases or its functional fragment, the nucleotide sequence of the mRNA interferases of encoding, and/or the mRNA interferases modulability factor of using method of the present invention to determine, and acceptable buffer reagent on the medicine.

[0027] on the one hand, provide the method that is used for the treatment of the patient with disease, described method comprises the present composition of significant quantity on described patient's administering therapeutic, to alleviate the symptom of described disease.Composition comprises at least a factor that can increase or reduce the cutting of endoribonuclease substrate, and this depends on the puzzlement disease of patient, to alleviate the symptom of disease.

[0028] therefore, the nucleotide sequence or the mRNA interferases modulability factor that the present invention includes the mRNA interferases that uses the treatment significant quantity or its functional fragment, coding mRNA interferases prepare medicine, be used for the treatment of have disease the patient to alleviate the symptom of described disease.This medicine can also further comprise acceptable buffer reagent on the medicine.

[0029] disease for example infectation of bacteria can be treated by use the composition that comprises at least a molecule for the treatment of significant quantity or the factor to the patient, the described molecule or the factor can increase the cutting of endoribonuclease substrate, alleviate the symptom of infectation of bacteria by the number that reduces bacterium in patient's body.When infectation of bacteria comprises at least a antibiotic-resistant bacteria bacterial strain, make and have special advantage in this way.

[0030] method of the present invention also is useful in the hyperplasia treatment of diseases, wherein will comprise at least a molecule for the treatment of significant quantity or the present composition of the factor (can increase cutting) and be administered to the patient the endoribonuclease substrate, with by reducing the hyperplasia sexual cell among the patient, alleviate the symptom of hyperplasia disease.Can use the hyperplasia disease (it is characterized in that the imbalance of cell proliferation) of the compositions and methods of the invention treatment, comprise, but be not limited to restenosis behind the heteroplasia of different tissues and metaplasia, inflammatory conditions, autoimmune disorders, hyperproliferative skin disease, psoriasis, allergy/asthma, atherosclerosis, the angioplasty and cancer.

[0031] the present invention comprises that also treatment has the patient's of disease method, described method comprises the present composition to patient's administering therapeutic significant quantity, wherein the factor of at least a described composition has realized the reduction to the cutting of endoribonuclease substrate, to alleviate the symptom of described disease.

[0032] also is included in the method for preparing polypeptide in the cell, described method comprises: the described cell of nucleotide sequence transfection of (a) using coding said polypeptide, wherein the nucleotide sequence of coding said polypeptide is suddenlyd change, use other triplet codon to replace mRNA interferases recognition sequence, wherein the described amino acid sequence of polypeptide by described mutant nucleic acid sequence encoding does not change because of described sudden change; (b) the described cell of nucleotide sequence transfection of use coding mRNA interferases, wherein said mRNA interferases is discerned described mRNA interferases recognition sequence; And (c) in described cell, express step (a) and nucleotide sequence (b), wherein in described cell, express step (a) and nucleotide sequence (b) method for preparing polypeptide in described cell is provided.

[0033] according to the present invention, the nucleotide sequence of coded polypeptide or mRNA interferases can be included in respectively in first and second expression vectors.And step (a) and transfection step (b) can be separated or the while (for example passing through cotransfection) carries out.As above indicated here, mRNA interferases recognition sequence sports different triplet sequences or codon and can not change amino acid sequence of polypeptide by the mutant nucleic acid sequence encoding in the nucleotide sequence.Therefore, with regard to the amino acid sequence of polypeptide that is encoded, sudden change is silent mutation.The purpose of mutant nucleic acid sequence is significantly to reduce mRNA that this transcribed nucleic acid the goes out susceptibility for the endoribonuclease active degradation of the mRNA interferases of being discussed.The expression of the nucleic acid of step (b) (homologue of for example encode PemK polypeptide for example or its functional fragment or MazF polypeptide or its functional fragment or MazF or PemK or directly to the nucleotide sequence of homologue) reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises mRNA interferases recognition sequence.Therefore, this method has produced the required polypeptide that does not almost have cell protein, and the rna transcription of described cell protein originally comprises by the mRNA interferases recognition sequence of expressed mRNA interferases identification.Therefore this method provides the method for preparation " purifying " polypeptide in cell.For some application, this method also be included in step (c) before or in the middle of, cell is hatched in comprising the isotopic substratum of at least a radio-labeling.These application comprise, still are not limited to, and the polypeptide of preparation mark is used to use nucleus magnetic resonance (NMR) technology to carry out ensuing analysis.

[0034] in a special embodiment, in cell, prepares mRNA interferases MazF or its functional fragment that the method for polypeptide has been used mRNA recognition sequence ACA (ACA) and comprised SEQ ID NO:2.In this embodiment, the expression of nucleic acids of coding MazF or its functional fragment reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises the ACA sequence.

[0035] in another embodiment, the method for preparing polypeptide in cell has been used mRNA recognition sequence uridylic-VITAMIN B4-X (UAX), and wherein X is cytosine(Cyt) (C), A, or U, and the mRNA interferases PemK or its functional fragment that comprise SEQ ID NO:4.In this embodiment, the expression of nucleic acids of coding PemK or its functional fragment reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises the UAX sequence.

[0036] in another embodiment, the method for preparing polypeptide in cell has been used mRNA recognition sequence uridylic-VITAMIN B4-C (UAC), and the mRNA interferases MazF-mtl or its functional fragment that comprise SEQ ID NO:74.In this embodiment, the expression of nucleic acids of coding MazF-mtl or its functional fragment reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises the UAC sequence.

[0037] in one aspect of the invention, proposed to prepare the method for polypeptide, comprise: the nucleotide sequence that coding said polypeptide (a) is provided, wherein the nucleotide sequence of coding said polypeptide is suddenlyd change, to substitute the recognition sequence of mRNA interferases with other triplet codon, wherein the described amino acid sequence of polypeptide by described mutant nucleic acid sequence encoding does not have owing to described sudden change is changed; (b) provide coding mRNA the nucleotide sequence of interferases, wherein said mRNA interferases is discerned described mRNA interferases recognition sequence; And (c) express step (a) and nucleotide sequence (b), wherein express step (a) and nucleotide sequence (b) means that prepare polypeptide are provided.This method can be carried out external, for example in vitro or similarly carries out.Known suitable in-vitro transcription/translation system or acellular expression system in this area and in the following description.MRNA interferases or its fragment can selectively provide as expressing protein, rather than the nucleotide sequence form of expressing with needs.

[0038] in a special embodiment, prepares mRNA interferases MazF or its functional fragment that the method for polypeptide has been used mRNA recognition sequence ACA and comprised SEQ ID NO:2.

[0039] in another embodiment, prepare mRNA interferases PemK or its functional fragment that the method for polypeptide has been used mRNA recognition sequence UAX and comprised SEQ ID NO:4, wherein X is C, A or U.

[0040] in another embodiment, prepare mRNA interferases MazF-mt1 or its functional fragment that the method for polypeptide has been used mRNA recognition sequence UAC and comprised SEQ ID NO:74.

[0041] the invention still further relates to the method that use mRNA interferases of the present invention prepares a plurality of polyribonucleotide sequences.This method comprises: first and second nucleotide sequences (a) are provided, a zone of wherein said first nucleotide sequence and a regional complementarity of described second nucleotide sequence, and the complementary region of described first and second nucleotide sequences does not comprise and mRNA interferases recognition site complementary sequence, and described first and second nucleotide sequences at their 5 ' end all by phosphorylation; (b) complementary region by described first and second nucleotide sequences makes described first and second nucleotide sequences annealing, form double-stranded nucleotide sequence, it comprises the complementary region that flank is the strand overhang, wherein each strand overhang comprises at least one and mRNA interferases recognition site complementary sequence, and described strand overhang is complementary mutually; (c) connect annealed first and second nucleotide sequences by complementary strand overhang, form the series connection multiple concatermer (concatamer) that comprises a plurality of annealed first and second nucleotide sequences; (d) use first primer (comprise T7 promotor and with the zone of described first nucleic acid array complementation) and second primer (with described second nucleic acid array complementation) the described concatermer that increases, a plurality of concatermers that comprise the T7 promotor of wherein said amplification generation; (e) use the T7 RNA polymerase to transcribe out the RNA molecule from described a plurality of concatermers, wherein each described RNA molecule comprises the series connection repetition that a plurality of flanks are the polyribonucleotide sequence of mRNA interferases recognition site; And (f) use and can digest described RNA molecule at the mRNA interferases of described interferases recognition site place cutting RNA, wherein said digestion produces a plurality of described polyribonucleotide sequences.

[0042] of method of a plurality of polyribonucleotide sequences of preparation special aspect, the mRNA recognition sequence is the ACA sequence, and the mRNA interferases is MazF or its functional fragment that comprises SEQ ID NO:2.

[0043] aspect another of method of a plurality of polyribonucleotide sequences of preparation, the mRNA recognition sequence is the UAX sequence, and wherein X is C, A or U, and the mRNA interferases is PemK or its functional fragment that comprises SEQ ID NO:4.

[0044] aspect another of method of a plurality of polyribonucleotide sequences of preparation, the mRNA recognition sequence is the UAC sequence, and the mRNA interferases is MazF-mt1 or its functional fragment that comprises SEQ ID NO:74.

[0045] the invention still further relates to isolated nucleic acid sequences, its encoded polypeptides and SEQ IDNO:2 or SEQ ID NO:4 or its functional fragment have sequence and/or structural homology, and wherein said polypeptide can show the endoribonuclease activity.In one embodiment, have polypeptide with SEQ ID NO:2 or its functional fragment sequence and/or structural homology and be MazF directly to homologue, it can show the endoribonuclease activity.Can show the active polypeptide of endoribonuclease comprises, but be not limited to, salt tolerant genus bacillus (Bacillus halodurans) MazF (NP_244588.1), staphylococcus epidermidis (Staphylococcus epidermidis) MazF (AAG23809.1), streptococcus aureus (Staphylococcus aureus) MazF (NP_372592.1), subtilis (Bacillus subtilis) MazF (1NE8_A), Neisseria meningitidis (Neisseria meningitides) MazF (NP_266040.1), morganella morganii strain (Morganella morgani) MazF (AAC82516.1) and mycobacterium tuberculosis (Mycobacterium tuberculosis) MazF (NP_217317.1).

[0046] in another embodiment, having polypeptide with SEQ ID NO:4 or its functional fragment sequence and/or structural homology is PemK homologue or directly to homologue, it can show the endoribonuclease activity.Can show the active polypeptide of endoribonuclease and comprise, but be not limited to, 73 known members of PemK protein families comprise MazF (ChpAK), ChpBK and other class PemK albumen.Inventory (the http://pfam.wustl.edu/cgi-bin/getdesc of these protein names that on the website, find below? acc=PF02452): Q9RX98; Q8F5A3; Q9K6K8; CHPA_ECOLI; Q7NPF9; Q88TP7; Q7WWW1; Q8YS80; Q8DW95; Q82YR2; Q7X3Y1; Q93S64; Q8PRN1; Q8GFY1; O52205; PEMK_ECOLIQ7N4H2; Q88PS7; Q8XCF2 CHPB_ECOLI; Q82VU0; Q8UGU5; Q9RWK4; Q9PHH8; Q7TXU4; P71650; Q7U1Y5; P96295; Q9JWF2; Q9JXI1; Q8E882; Q82VB5; Q8KJS3; Q7NMY4; Q9KFF7; P96622; Q81IT4; Q81VF4; Q8ESK5; Q92DC7; Q8Y8L0; Q97LR0; Q8XNN7; Q8R861; Q88Z43; O07123; Q837I9; Q9F7V5; Q8CRQ1; O05341; P95840; Q9FCV0; Q837L1; Q93M89; Q99IU9; Q82UB5; Q93MT8; YJ91_MYCTU; Q97MV8; Q7NHWO; Q7NI95; Q8YML2; Q7NHR3; YE95_MYCTU; Q9PCB9; Q8YZW8; Q7TZ90; P95272; Q8VJR1; Q7UON2; O53450; O06780; And Q7U1I8.

[0047] the present invention has also comprised expression vector, they have comprised isolated nucleic acid sequences, its encoded polypeptides have SEQ ID NO:2 4 or the sequence of its functional fragment and/or with SEQ ID NO:2 4 or its functional fragment have structural homology, wherein said polypeptide can show the endoribonuclease activity.Also comprise cell that comprises these expression vectors and the transgenic animal that comprise separated nucleic acid sequence of the present invention, wherein nucleotide sequence is expressed at least one cell of transgenic animal.

[0048] in another aspect of this invention, isolating aminoacid sequence has been proposed, its polypeptide that comprises have SEQ ID NO:2 4 or the sequence of its functional fragment and/or with SEQ IDNO:2 4 or its functional fragment have structural homology, wherein said polypeptide can show the endoribonuclease activity.The expression vector that has also comprised code book invention aminoacid sequence, wherein the expression of aminoacid sequence is controlled by the regulating and controlling sequence in the expression vector, also comprise cell that comprises this expression vector and the transgenic animal that comprise aminoacid sequence of the present invention, wherein express in aminoacid sequence at least one cell in transgenic animal.

[0049] in another aspect of this invention, provide the separated nucleic acid sequence that comprises SEQ ID NO:1 or SEQID NO:3.Nucleic acid sequence encoding wherein can show the active mRNA interferases of endoribonuclease or its functional fragment.

[0050] the present invention has also described the expression vector of the nucleotide sequence that comprises SEQ ID NO:1 or SEQ ID NO:3, nucleic acid sequence encoding wherein can show the active mRNA interferases of endoribonuclease or its functional fragment, and SEQ ID NO:1 or SEQ IDNO:3 effectively are connected with regulating and controlling sequence.And the cell that comprises this expression vector also belongs to category of the present invention.

[0052] [0051] on the other hand, transgenic animal have been proposed, its nucleotide sequence comprises SEQID NO:1 or SEQ ID NO:3, nucleic acid sequence encoding wherein can show the active mRNA interferases of endoribonuclease or its functional fragment, and wherein expresses in nucleotide sequence at least one cell in transgenic animal.

[0053] also provide coding to comprise the isolated nucleic acid sequences of the polypeptide of SEQ ID NO:2 or SEQ ID NO:4, polypeptide wherein is mRNA interferases or its functional fragment, can show the endoribonuclease activity.

[0054] on the other hand, the expression vector that comprises separated nucleic acid sequence is provided, described nucleic acid sequence encoding comprises the polypeptide of SEQ ID NO:2 or SEQ ID NO:4, polypeptide wherein is to show the active mRNA interferases of endoribonuclease or its functional fragment, and nucleotide sequence effectively is connected with regulating and controlling sequence.The present invention has also comprised the cell that comprises these expression vectors.

[0055] on the other hand, transgenic animal have been proposed, its separated nucleic acid sequence that comprises coding comprises the polypeptide of SEQ ID NO:2 or SEQ ID NO:4, wherein polypeptide is to show the active mRNA interferases of endoribonuclease or its functional fragment, and expresses in nucleotide sequence at least one cell in transgenic animal.

[0056] in one embodiment of the invention, the amino acid separation sequence that comprises SEQ ID NO:2 or SEQ ID NO:4 is provided, aminoacid sequence wherein is mRNA interferases or its functional fragment, and mRNA interferases or its functional fragment can show the endoribonuclease activity.

[0057] the present invention has also described expression vector, the amino acid separation sequence of its coding comprises SEQ ID NO:2 or SEQ ID NO:4, aminoacid sequence wherein is mRNA interferases or its functional fragment, and mRNA interferases or its functional fragment can show the endoribonuclease activity, and the expression of aminoacid sequence is subjected to the control of regulating and controlling sequence in the expression vector.The present invention also comprises the cell that comprises this expression vector.

[0058] on the other hand, the transgenic animal of isolated polypeptide have been proposed to comprise, described polypeptide comprises SEQ ID NO:2 or SEQ ID NO:4, wherein polypeptide is to show the active mRNA interferases of endoribonuclease or its functional fragment, and expresses in polypeptide at least one cell in transgenic animal.

[0059] the present invention also comprises test kit, and it comprises following ingredients: isolated nucleic acid sequences, described nucleotide sequence comprise SEQ ID NO:1 or SEQ ID NO:3, nucleic acid sequence encoding mRNA interferases wherein or its functional fragment; The amino acid separation sequence that comprises SEQ ID NO:2 or SEQ IDNO:4, aminoacid sequence wherein are mRNA interferases or its functional fragment; Buffer reagent with mRNA interferases activity compatible; And directions for use material.

[0060] the present invention has comprised that also mRNA interferases among the present invention is in the application that relates to aspect the gene therapy.Also can make the cell expressing molecule by through engineering approaches, this molecule is defectiveness or shortage in study subject (for example people's study subject), make the self-destruction of this cell, but the expression of mRNA interferases is subjected to the control of induction regulating controlling element by integrating mRNA interferases of the present invention.The integration of the induced means of using in gene therapy is used that are used for the cell self-destruction provides a kind of automatic anti-fault mechanism, can be after study subject brings favourable influence and/or be eliminated before they cause harmful effect at this cell like this.

Brief description of the drawings:

[0061] Figure 1A and 1B are presented at the cell proliferation on the different solid mediums and the sequence alignment of MazFRNA interferases family different members.Figure 1A has shown and has transformed pBAD-MazF respectively, the growth properties of intestinal bacteria BW25113 (Δ araBAD) cell of pBAD-MazF R29S or pBAD-MazF R86G plasmid.Figure 1B has described from colibacillary MazF (GenBank Accession No.NP_289336.1) and from salt tolerant genus bacillus (GenBank login numbering NP_244588.1), staphylococcus epidermidis (GenBank login numbering AAG23809.1), streptococcus aureus (GenBank login numbering NP_372592.1), subtilis (GenBank login numbering 1NE8_A), Neisseria meningitidis (GenBank login numbering NP_266040.1), the sequence alignment of the MazF of morganella morganii strain (GenBank login numbering AAC82516.1) and mycobacterium tuberculosis (GenBank login numbering NP_217317.1).

[0062] Fig. 2 A-E has shown graphic representation, has described the Bacillus coli cells of MazF for O for toluene ³⁵The mixing of S-Met (Fig.2A), [α- ³²P] the mixing of dTTP (Fig.2B) and [α- ³²P] UTP mixes the influence of (Fig.2C); And MazF is in the body ³⁵S-Met is incorporated into the influence of (Fig.2D) in the Bacillus coli cells; And SDS-PAGE analyzes synthetic (Fig.2E) that MazF induces back body internal protein.

[0063] Fig. 3 A-C has shown linear spike (line trace), has described the photodensitometry (Fig. 3 A) of polysome character, and it has shown the influence of MazF for polysome character, and has shown protein gel, shows MazF (His) ₆Cell-free protein synthetic influence for protokaryon (Fig. 3 B) and eucaryon (Fig. 3 C).

[0064] Fig. 4 A-D shows that MazF influences the mRNA synthetic.The toe line analysis of mazG mRNA when Fig. 4 A is presented at MazF and exists.Fig. 4 B has shown the toe line analysis with mazG mRNA after the phenol extracting.Fig. 4 C has shown that MazE is for the influence of MazF to mazG mRNA cutting.After Fig. 4 D show to add pectinose (as shown) from the intestinal bacteria BW25113 cell that contains pBAD-MazF, extract the result that total cell mRNA is carried out the Northern engram analysis constantly in difference, use radiolabeled ompA and lpp ORF DNA as probe.

[0065] Fig. 5 A and B show linear spike, have shown the photodensitometry of polysome character when there be not (Fig. 5 A) in kasugamycin and have (Fig. 5 B).The ribosomal position of 70S, 50S and 30S as shown.

[0066] Fig. 6 has shown the analysis of toe line, has shown that rrna is to the inhibition of MazF to mazG mRNA cutting.

[0067] Fig. 7 has shown the analysis of toe line, has shown that the Shine-Dalgarno sequence of mazG mRNA sports the influence of UUUG to the MazF function by GGAG.

[0068] Fig. 8 has shown the analysis of toe line, has shown the influence of the sudden change of mazG mRNA initiator codon for the MazF function.

[0069] Fig. 9 has shown the analysis of toe line, has shown at the cutting sequence UACAU (U of place ₁A ₂C ₃A ₄U ₅) sudden change to the influence of MazF function.

[0070] Figure 10 has shown acrylamide gel, has shown MazF and the MazE influence for 16S and 23S rRNA cutting.

[0071] Figure 11 has shown the MazE-MazF (His) for purifying ₆Mixture, MazF and (His) ₆The proteic analysis of MazE uses tricine SDS-PAGE protein isolate and coomassie brilliant blue staining to observe.

[0072] Figure 12 A and 12B have shown natural polyacrylamide gel, have shown at (His) ₆The mixture that stoichiometry forms between MazE and the MazF.

[0073] Figure 13 has shown the figure line of protein molecular weight standard curve, illustrates MazF and MazE-MazF (His) ₆The molecular weight of determining of mixture.

[0074] Figure 14 A, 14B and 14C have shown the EMSA gel, illustrate (His) ₆MazE and/or MazF combine with the mazEF promoter DNA.

[0075] Figure 15 has shown the comparison of MazE homologue aminoacid sequence.The sequence alignment that has shown 8 MazE family proteins.

[0076] Figure 16 A and 16B have shown the EMSA gel, illustrate the interaction of protein and DNA.Shown in Figure 16 A and 16B, the N end structure territory of MazE mediated DNA respectively with MazE-MazF (His) ₆Mixture and (His) ₆The MazE combination of proteins.

[0077] Figure 17 illustrates MazE and blocks product, and the result of yeast two-hybrid test, has shown that MazF and MazE or its block product/segmental interaction.

[0078] Figure 18 A and 18B have shown non-denaturing polyacrylamide gel respectively, illustrate protein interaction; And the EMSA gel that illustrates protein-DNA interaction.

[0079] Figure 19 illustrates the x-ray structure of MazE-MazF mixture.

[0080] Figure 20 A and 20B have shown nucleic acid and the aminoacid sequence of intestinal bacteria MazF.

[0081] Figure 21 A and 21B have shown nucleic acid and the aminoacid sequence of intestinal bacteria MazE.

[0082] Figure 22 A-22H has shown that intestinal bacteria MazF is directly to the nucleotide sequence of homologue.

[0083] Figure 23 A-23H has shown that intestinal bacteria MazF is directly to the aminoacid sequence of homologue.

[0084] Figure 24 A-24G has shown that intestinal bacteria MazE is directly to the nucleotide sequence of homologue.

[0085] Figure 25 A-25G has shown that intestinal bacteria MazE is directly to the aminoacid sequence of homologue.

[0086] Figure 26 A-C has shown the influence of PemK for DNA and protein synthesis.Figure 26 A and 26B are graphic representations, illustrate PemK for DNA in the body (A) and the influence of protein (B) synthetic.Figure 26 C has shown that the SDS-PAGE of total cell protein after PemK induces analyzes.

[0087] Figure 27 A-C has shown the isolating proteinic radioactive automatic developing of SDS-PAGE.The result has shown that PemK and PemI influence for the cell-free protein synthetic.

[0088] Figure 28 A-E has shown the result of polyacrylamide gel (A) or polyacrylamide gel radioactive automatic developing (B-E), shows the endoribonuclease activity of PemK mediation.

[0089] Figure 29 A-B has shown the result of polyacrylamide sequencing gel (A) and polyacrylamide gel radioactive automatic developing (B), shows the specificity of the endoribonuclease activity of PemK mediation to single stranded RNA.

[0090] Figure 30 A-D has shown the result of Northern engram analysis (A) or polyacrylamide gel radioactive automatic developing (B-D), illustrates PemK and has mediated endonuclease enzymic activity to various mRNA in vivo.

[0091] Figure 31 A and 31B have shown nucleic acid and the aminoacid sequence of intestinal bacteria PemK.

[0092] Figure 32 A and 32B have shown nucleic acid and the aminoacid sequence of intestinal bacteria PemI.

[0093] Figure 33 has shown the sequence alignment of PemK, ChpBK and MazF polypeptide.

[0094] Figure 34 has shown PemK, ChpBK, MazF and from hiding mycobacterium (Mycobacterium celatum), three proteic sequence alignments of class PemK of pseudomonas putida (Pseudomonas putida) KT2440 and shigella flexneri (Shigella flexneri) 2a str.301.

[0095] Figure 35 has shown the nucleic acid and the aminoacid sequence (being respectively SEQ ID NO:67 and 68) of one-tenth acquaintance eosinophilic granulocyte chemotactic protein (eotaxin).

[0096] Figure 36 is the synoptic diagram of pCold I carrier.

[0097] Figure 37 has shown the result of polyacrylamide gel radioactive automatic developing, has shown the generation that becomes acquaintance's eosinophilic granulocyte chemotactic protein under the situation that does not have the background protein synthesis.

[0098] Figure 38 A-F is a microphotograph, has shown by abduction delivering MazF toxin (D-F) and does not induce the form of people's cell of (A-C).

[0099] Figure 39 A-B has shown that (A) holds the aminoacid sequence that extends with MazF (E24A) the mutant N that pET28a expresses; And (B) photo of polyacrylamide gel, shown corresponding to the band (swimming lane 1) of the MazF mutant fusion protein of cutting and the MazF mutant fusion protein (swimming lane 2) of zymoplasm cutting.

[0100] Figure 40 has shown the active primer extension analysis of MazF-mt1 mRNA interferases.Figure 41 A-B has shown the sequence alignment of (A) intestinal bacteria MazF and the homologue in mycobacterium tuberculosis thereof and (B) sequence alignment of intestinal bacteria MazF and the homologue in subtilis, Bacillus anthracis (B.anthracis) and streptococcus aureus thereof.

[0101] Figure 42 has shown the RNA sequence of mazF open reading frame (ORF).All ACA sequences show with grey, have replaced the ACA sequence and the sequence change that do not have to change by the MazF aminoacid sequence of its coding shows above the RNA sequence.

[0102] Figure 43 A-E has shown the nucleotide sequence of the intestinal bacteria MazF homologue in mycobacterium tuberculosis.

[0103] Figure 44 A-E has shown the aminoacid sequence of the intestinal bacteria MazF homologue in mycobacterium tuberculosis.

[0104] Figure 45 A-D has shown from hiding mycobacterium, three the class PemK of pseudomonas putida KT2440 and shigella flexneri 2a str.301 and the nucleotide sequence of ChpBK.

[0105] Figure 46 A-D has shown from hiding mycobacterium, three the class PemK albumen of pseudomonas putida KT2440 and shigella flexneri 2a str.301 and the aminoacid sequence of ChpBK.

Detailed Description Of The Invention

[0106] before the discovery and using method thereof described here, be to be understood that the present invention is not limited to special test method described herein, perhaps test compound and experimental condition are because these methods and compound may be various. It should also be understood that term purpose used herein only is to describe specific embodiment, rather than will limit, because category of the present invention only only limits to appended claim.

[0107] therefore, the endoribonuclease of the existing general type that the term that uses in specification and claim " MazF " or " PemK " refer to has the certain enzyme of specific names in addition, comprises the enzyme that has structure and sequence homology with it. Similarly, the enzyme family that the present invention includes is referred to herein as " RNA interferases ", and this is the new family that the inventor here finds. And the present invention has also comprised the molecule of the 26S Proteasome Structure and Function similitude consistent with its role in the present invention.

[0108] and, the MazE of the existing general type that the term that uses in specification and claim " MazE " or " PemI " refer to (perhaps MazF modulability molecule) or PemI (perhaps PemK modulability molecule), the specific molecular that has in addition this title comprises the MazE (perhaps MazF modulability molecule) or the PemI (perhaps PemK modulability molecule) that have structure and/or sequence homology with SEQ ID NO:6 or SEQ ID NO:8. Really, the present invention has also comprised the molecule with 26S Proteasome Structure and Function similitude consistent with its role in the present invention.

[0109] death of bacterial cell and growth inhibition are to be caused for the response of some pressure condition by the endogenous toxin gene in the bacterial genomes. MazF is an endogenous toxin, and it causes the death of cell, by the operon coding that is called as " MazEF be addicted assembly " in the Escherichia coli. MazE is the unsettled antitoxin of an antagonism MazF. As described herein-in, check that in the cell of penetratingization MazF is to DNA, RNA and the synthetic effect of protein. In brief, after MazF induces 10 minutes, ATP relied on³⁵Mixing of S-methionine suppressed fully, and [α-³²P] dTTP and [α-³²P] mixing of UTP do not have suppressedly, shows that MazF is the synthetic special inhibiting factor of protein. And, the MazF of purifying CKIs matter synthetic all in the cell free system of protokaryon and eucaryon, and be blocked in this MazE of the being suppressed at situation about existing. When using SDGC to analyze, MazF induces the formation of having blocked polysome, increased simultaneously the ribosomal component of 70S, and 50S and 30S ribosomes component is not subject to the impact that MazF expresses.

[0110] be significantly, the analysis of toe line shows that MazF is a sequence-specific endoribonuclease, and its identification ACA sequence is independent of ribosomes and works. And the Northern engram analysis shows that total cell mRNA is degraded after MazF induces. Therefore inventor of the present invention has had a wonderful discovery, and MazF is novel endoribonuclease first member who is determined of family, considers the ability of its interference cell mRNA effect, and it is named as " mRNA interferases " here. As what show here, the cutting that the function of interferases is located at distinguished sequence (ACA) by the mRNA transcript produces, and this causes stopping rapidly and/or cell death of Growth of Cells. As what show, has widely connotation in the damaged cell physiology that acts on normal cell physiological and/or induced by pressure condition of mRNA interferases here.

[0111] inventor of the present invention finds that also the PemK (by the toxin of " pemI-pemK be addicted assembly " coding) of purifying has suppressed the synthetic of in Escherichia coli cell free system protein, and add the antitoxin PemI of anti-PemK, recovered the synthetic of protein. Described herein other studies show that PemK is the endoribonuclease of a sequence-specific cutting mRNA, has therefore suppressed the synthetic of protein. PemI has blocked the endoribonuclease activity of PemK mediation, has recovered like this synthetic of protein. PemK cutting single-chain RNA is preferably in 5 of the A residue of " UAX (X is C, A or U) " recognition site ' or 3 ' one sides cutting. After inducing, PemK incising cell mRNA blocks the synthetic of protein in the Escherichia coli effectively. The homologue of pemK is found in the genome of a lot of bacteriums, and inventor of the present invention proposes PemK here and homologue has formed a new endoribonuclease family, and this family is by having disturbed the function of mRNA with sequence-specific mode incising cell mRNA.

[0112] in order more clearly to provide parameter of the present invention, use following definition:

[0113] phrase " flank nucleotide sequence " refer to those be positioned at endonuclease cleavage site 5 ' and 3 ' the continuous kernel acid sequence. As employed in this specification and appended claim, unless in context, clearly indicate, singulative " a ", " an " and " the " comprised that plural number refers to. Therefore for example, " the method " comprises a kind of or more method, and/or step type described herein and/or those skilled in the art can be clear and definite after reading disclosure material step etc.

[0114] refer to can be at the enzyme of inner cutting DNA for term " endonuclease ".

[0115] term " endoribonuclease " refers to the enzyme that can cut in inside RNA.

[0116] term " complementation " refers to two DNA chains that show substantially normal base pairing character. But complementary DNA can contain one or more mispairing.

[0117] term " hybridization " refers to the hydrogen bond connection that occurs between the DNA of two complementations chain.

[0118] " nucleic acid " or " nucleic acid molecules " here uses, and refers to any strand or double-stranded DNA or RNA molecule, if strand, the molecule of the complementary series of nucleic acid molecules can be linear or annular form. When nucleic acid molecules is discussed, when the sequence of certain nucleic acid molecules or structure here are described can according to routine according to from 5 ' to 3 ' direction provide its sequence. When mentioning nucleic acid of the present invention, use sometimes term " nucleic acid of separation ". This term when being used for DNA, the dna molecular of indication with the naturally occurring genome of the organism in its source on the sequence that is close to separate. For example, " nucleic acid of separation " may comprise and is inserted into for example dna molecular in plasmid or the viral vectors of carrier, perhaps be incorporated into the dna molecular in protokaryon or eukaryotic or the organism genomic DNA.

[0119] when being used for RNA, term " nucleic acid of separation " mainly refers to the RNA molecule according to above definite DNA isolation molecule encoding. Perhaps the RNA molecule of this term indication lower other nucleic acid that links together with this RNA molecule of native state (namely in cell or tissue) that coexisted has been separated fully. The nucleic acid (DNA or RNA) that separates can also represent the molecule that directly produces by biology or synthesis mode and separate with other components that exist in its production process.

[0120] " the natural allelic variant " of some nucleotide sequence, " mutant " and " derivative " refer to this sequence has close ties, still may have the sequence of natural or artificial design or the sequence of structural change. Have the meaning that is closely connected be in the sequence determine on the length at least 65% but the nucleotides 85% or more and with a specific SEQ ID NO normally: the nucleotide sequence of expression is complementary. The change of nucleotide sequence or difference may represent in the normal reproduction process of certain nucleotide sequence or the change of the consecutive nucleotides that produces in the natural repetition between the nucleotide sequence that is closely connected. Other change can be according to special purpose, for example change amino acid code in the nucleic acid or the sequence in regulation and control zone, carries out special design and is incorporated in the sequence. This species specific change can be carried out at the multiple different induced-mutation technique of external use, perhaps carries out in the host organisms under being placed in specific alternative condition (this condition is induced or selected these to change). The sequence variant of this special generation can be known as initiation sequence " mutant " or " derivative ".

[0121] when mentioning certain particular sequence, uses term " percentage similitude ", " percentage uniformity " and " percentage homology ", as mentioning in the University of Wisconsin GCG software program, this is known in this area.

The present invention also comprises active part, fragment, derivative and the functional or non-functional analogies of MazF polypeptide of the present invention or protein. The meaning of " active part " of MazF polypeptide is less than MazF polypeptide total length, can measure bioactive peptide but still kept.

" fragment " of mRNA interferases or the meaning of " part " are the fragments of one section amino acid residue, has about 5-7 continuous amino acid at least, generally has about 7-9 continuous amino acid at least, usually has about 9-13 continuous amino acid at least, most preferably about at least 20-30 or how continuous amino acid. " derivative " of mRNA interferases or the meaning of its fragment are by changing the amino acid sequence of protein, for example the nucleic acid of coded protein are operated or change protein self and the modified polypeptide that forms. The derivative of this natural acid sequence may relate to one or more amino acid and insert, adds, deletes or replace, and may or may not change the primary activity of original mRNA interferases.

There is different mRNA interferases " variant " at occurring in nature. These variants may be allele, it is characterized in that the difference of nucleotide sequence of the gene of coded protein, perhaps may relate to different RNA processing or the modification after the translation. The technical staff can prepare the variant with single or a plurality of amino acid replacements, deletion, interpolation or replacement. In addition, these variants may comprise: (a) one of them or more the amino acids residue guarded or the variant of nonconservative amino acid replacement, (b) one of them or more the amino acids residue be added into variant in the mRNA interferases, (c) one of them or more amino acids comprised the variant of substituted radical, and (d) mRNA interferases and another one peptide or polypeptide (for example fusion partner, albumen label or other chemical parts wherein, they may make the mRNA interferases have useful character, for example the epi-position of antibody, poly histidine sequence, biotin moiety etc.) variant that merges. Other mRNA interferases of the present invention comprise variant, and wherein the amino acid residue from species is substituted by the corresponding residue of another one species in conservative or nonconservative position. In another embodiment, the amino acid residue of non-conservative position is guarded or nonconservative residue substitutes. Obtaining the technology of these variants, comprise genetic (inhibition, deletion, sudden change etc.), technology chemistry and zymetology, is known for the personnel that have ordinary skill in this area.

This allelic variation, analog, fragment, derivative, mutant and modification, comprise that variable nucleic acid form processing and variable posttranslational modification form produce the mRNA interferases derivative that has kept any biological property of mRNA interferases, they are included in the category of the present invention.

Term used herein " straight homologues " or " homologue " refer to the nuclease by nucleic acid sequence encoding, the polypeptide product of these sequences and MazF code sequence are shown the sequence identity greater than 60%, and/or the gene outcome of these sequences has similar three-dimensional structure and/or biochemical activity to MazF. Exemplary straight homologues/homologue comprises, but be not limited to, the MazF of salt tolerant bacillus (GenBank login numbering NP_244588.1), the MazF of MRSE (GenBank login numbering AAG23809.1), the MazF of staphylococcus aureus (GenBank login numbering NP_372592.1), the MazF of bacillus subtilis (GenBank login numbering 1NE8_A), the MazF of Neisseria meningitidis (GenBank login numbering NP_266040.1), morganella morganii strain (GenBank login numbering AAC82516.1) and Much's bacillus (GenBank login numbering NP_217317.1). Referring to Figure 22 and 23. Term " straight homologues " and " homologue " can be used to refer to the MazF nucleic acid of any species or the straight homologues/homologue of amino acid sequence. These species comprise, but be not limited to Escherichia coli, salt tolerant bacillus, MRSE, staphylococcus aureus, bacillus subtilis, Neisseria meningitidis, morganella morganii strain, Much's bacillus, mouse (Mus musculus), and homo sapiens (Homo sapiens). Here related to the nuclease that uses in the method for the invention these straight homologuess/homologue coding.

[0122] as used herein, term " straight homologues " or " homologue " also refer to the nuclease by some nucleic acid sequence encodings, the polypeptide product of these sequences and PemK code sequence are shown the sequence identity greater than 60%, and/or the gene outcome of these sequences has similar three-dimensional structure and/or biochemical activity to PemK. Term " straight homologues " and " homologue " can be used to refer to the PemK nucleic acid of any species or the straight homologues/homologue of amino acid sequence.

[0123] related to the nuclease that straight homologues/homologue is encoded that uses in the method for the invention these PemK here. Exemplary homologue and straight homologues include, but not limited to 73 known members in the PemK protein families, comprise MazF (ChpAK), ChpBK and other classes PemK albumen. Be below (http://pfam.wustl. edu/cgi-bin/getdesc in the website? the name inventory of these protein that acc=PF02452) find: Q9RX98; Q8F5A3; Q9K6K8; CHPA_ECOLI; Q7NPF9; Q88TP7; Q7WWW1; Q8YS80; Q8DW95; Q82YR2; Q7X3Y1; Q93S64; Q8PRN1; Q8GFY1; O52205; PEMK_ECOLI Q7N4H2; Q88PS7; Q8XCF2 CHPB_ECOLI; Q82VU0; Q8UGU5; Q9RWK4; Q9PHH8; Q7TXU4; P71650; Q7U1Y5; P96295; Q9JWF2; Q9JXI1; Q8E882; Q82VB5; Q8KJS3; Q7NMY4; Q9KFF7; P96622; Q81IT4; Q81VF4; Q8ESK5; Q92DC7; Q8Y8L0; Q97LR0; Q8XNN7; Q8R861; Q88Z43; O07123; Q837I9; Q9F7V5; Q8CRQ1; O05341; P95840; Q9FCV0; Q837L1; Q93M89; Q99IU9; Q82UB5; Q93MT8; YJ91_MYCTU; Q97MV8; Q7NHW0; Q7NI95; Q8YML2; Q7NHR3; YE95_MYCTU; Q9PCB9; Q8YZW8; Q7TZ90; P95272; Q8VJR1; Q7UON2; O53450; O06780; And Q7U1I8. Referring to Figure 33 and 34.

[0124] after the Swiss-Protein numbering is the NCBI numbering.

[0125]Q9RX98 NP_294140 Q8F5A3 NP_711962 Q9K6K8 NP_244588 CHPA_ECOLI NP_417262 Q7NPF9 NP_923042 Q88TP7 NP_786238 Q7WWW1 NP_943016 Q8YS80 NP_487251 Q8DW95 NP_720642 Q82YR2 NP_816992 Q7X3Y1 NP_857606 Q93S64 NP_862570 Q8PRN1 NP_644713 Q8GFY1AAN87626.O52205 AAC82516 PEMK_ECOLI NP_957647 Q7N4H2 NP_929611 Q88PS7 NP_742932 Q8XCF2 NP_290857 CHPB_ECOLI D49339 Q82VU0 NP_841047 Q8UGU5 NP_531638 Q9RWK4 AAF10240 Q9PHH8 NP_061683 Q7TXU4 NP_856470 P71650 NP_217317 Q7U1Y5 NP_854128 P96295 CAB03645 Q9JWF2 NP_283229 Q9JXI1 AAF42359 Q8E882 NP_720377 Q82VB5 NP_841237 Q8KJS3 CAA70141 Q7NMY4 NP_923577 Q9KFF7 NP_241388 P96622 NP_388347 Q81IT4 NP_830134 Q81VF4 NP_842807 Q8ESK5 NP_691544 Q92DC7 NP_470228 Q8Y8L0 NP_464414 Q97LR0 NP_347134 Q8XNN7 NP_561211 Q8R861NP_623721 Q88Z43 NP_784302 O07123 CAA70141 Q837I9 NP_814592 Q9F7V5 NP_765227 Q8CRQ1 AAO05271 O05341 NP_646809 P95840 BAB95857 Q9FCV0 CAC03499 Q837L1 NP_814568 Q93M89 NP_150051 Q82UB5 NP_841618 Q93MT8 NP_713024 YJ91_MYCTU NP_216507 Q99IU9 P_856470 Q97MV8 NP_346728 Q7NHW0 NP_925371 Q7NI95 NP_925234 Q8YML2 NP_488961 Q7NHR3 NP_925418 YE95_MYCTU CAA17218 Q9PCB9 NP_299148 Q8YZW8 NP_484381 Q7TZ90 NP_855627 P95272 NP_216458 Q8VJR1 NP_336589Q7U0N2 NP_854788 O53450 NP_216458 O06780 NP_215173 Q7U1I8 NP_854336.

[0126] term used herein " straight homologues " or " homologue " also refer to the binding partners by the nuclease (conditioning agent of antitoxin or nuclease) of nucleic acid sequence encoding, the code sequence of its polypeptide product and MazE is shown the uniformity greater than 60%, and/or its gene outcome has the three-dimensional structure similar to MazE and/or biochemical activity. Exemplary straight homologues/homologue includes, but are not limited to, MazE, Deinococcus radiodurans (Deinococcus radiodurans) (GenBank accession number NP_294139); MazE, salt tolerant bacillus (GenBank accession number NP_244587); PemI, plasmid R100 (GenBank accession number NP_052993); PemI, plasmid R466b (GenBank accession number AAC82515); ChpS, Escherichia coli (GenBank accession number NP_290856); MazE, pseudomonas putida KT2440 (GenBank accession number NP_742931); MazE, Photobacterium profundum (AAG34554). Referring to Figure 24 and 25. Term " straight homologues " or " homologue " can also refer to the nucleic acid of MazE of any species or the straight homologues/homologue of amino acid sequence. These species comprise, but are not limited to Escherichia coli, Deinococcus radiodurans, salt tolerant bacillus, pseudomonas putida, Photobacterium profundum, MRSE, staphylococcus aureus, bacillus subtilis, Neisseria meningitidis, morganella morganii strain, Much's bacillus, mouse (Mus musculus), and homo sapiens. Here also relate to nuclease modulability molecule (antitoxin) use in the methods of the invention by these straight homologuess/homologue coding.

[0127] as used herein, term " straight homologues " or " homologue " also refer to by the nuclease binding partners of nucleic acid sequence encoding (conditioning agent of antitoxin or nuclease), its polypeptide product and PemI code sequence are shown the sequence identity greater than 60%, and/or its gene outcome has similar three-dimensional structure and/or biochemical activity to PemI. Straight homologues/homologue of exemplary PemI comprises, but is not limited to, and the known member in MazE (antitoxin) protein families comprises MazE (ChpAI), the homologue of ChpBI and other MazE. Term " straight homologues " and " homologue " can be used to refer to the PemI nucleic acid of any species or the straight homologues/homologue of amino acid sequence. Here related to the nuclease modulability molecule that uses in the method for the invention these homologue codings. Here related to the nuclease modulability molecule (antitoxin) that uses in the method for the invention these homologues/straight homologues coding.

[0128] just as used herein, term " functional " means that nucleic acid or amino acid sequence have function for described test or purpose.

[0129] just as used herein, term " functional fragment " means that nucleic acid or amino acid sequence are a part or the subdomains of full-length polypeptide, and for described test or purpose function is arranged.

[0130] when referring to a specific nucleotides or amino acid, phrase " substantially by ... form " the meaning be to have given SEQ ID NO: the sequence of sequence character. For example when being used to refer to an amino acid sequence, this phrase has comprised this sequence itself and the molecular modification that can not affect this sequence fundamental property and new property.

[0131] " replicon " is any genetic elements that can mainly copy under the control of self, for example plasmid, clay, rod granule, bacteriophage or virus. Replicon can be RNA or DNA, can be strand or two strands.

[0132] " carrier " is a replicon, for example plasmid, clay, rod granule, bacteriophage or virus, and other genetic sequence or element (DNA or RNA) can be coupled, so that also reproducible of the sequence that connects or element.

[0133] " expression vector " or " expression operon " refers to and may have the nucleic acid fragment of transcribing and translate control sequence (for example promoter, enhancer, translation initiation signal (for example ATG or AUG codon), polyadenylation signal, terminator etc.), and it helps the expression of polypeptid coding sequence in host cell or organism.

[0134] as used herein, term " effectively connection " refers to and can mediate the regulating and controlling sequence that coded sequence is expressed, it is placed in the dna molecular (for example expression vector) on the suitable position with respect to coded sequence, so that coded sequence is expressed. Same definition is applied in the arrangement of coded sequence in the expression vector and transcriptional control element (for example promoter, enhancer and termination element) sometimes. When having produced the heterozygosis nucleic acid molecules, this definition also is applied in the arrangement of the nucleotide sequence of first second nucleotide sequence in the hybrid molecule sometimes.

[0135] as used herein, term " oligonucleotides " refers to primer of the present invention and probe, and it is defined as by two or more multinuclear sugar or deoxyribonucleotide, three nucleic acid molecules that above nucleotides forms preferably. The accurate size of oligonucleotides depends on various factor, specifically uses and the use of oligonucleotides.

[0136] as used herein, term " probe " refers to oligonucleotides, polynucleotides or nucleic acid, can be RNA or DNA, can naturally occurring (as obtaining from Restriction Enzyme digestion product purifying) or synthetic the generation, can with nucleic acid annealing or the specific hybridization of sequence with the probe complementation. Probe can be strand or two strands. The exact length of probe depends on many factors, comprises source and the using method of temperature, probe. For example for diagnostic application, according to the complexity of target sequence, oligonucleotide probe contains 15-25 or more nucleotides usually, although it may contain nucleotides still less. , select probe here, make itself and specifically different chains " substantially " complementation of target nucleic acid sequence. This means that probe must be fully complementary, can be under a series of conditions that set in advance and they target chain " specific hybridization " or annealing separately. Therefore, the sequence of probe needs not be the accurate complementary series of target. For example, non-complementary nucleotide fragments can be connected to 5 of probe ' or 3 ' end, the remainder of probe sequence and the complementation of target chain. In addition, have under the condition of abundant complementarity with the target nucleic acid sequence with the special annealing of probe at probe sequence, incomplementarity base or longer sequence can be distributed in the probe.

[0137] term " specific hybridization " refer between two single stranded nucleic acid molecules of abundant complementary series combination so that in this area under the predefined condition of normal operation this hybridization can carry out (being sometimes referred to as " substantially complementary "). Especially, this term refers to the hybridization between the basic complementary series that oligonucleotides and single stranded DNA of the present invention or RNA inside contains, and has substantially got rid of the hybridization between oligonucleotides and the incomplementarity sequence single-chain nucleic acid.

[0138] as used herein, term " primer " refers to oligonucleotides, can be RNA or DNA, strand or two strands, can derive from biosystem, produced or synthetic the generation by restriction enzyme digestion, when described oligonucleotides places suitable environment, just can carry out the synthetic starting material of nucleic acid and work as depending on template. When the suitable nucleoside triphosphate precursors that correct nucleic acid-templated, nucleic acid is provided, polymerase, suitable confactor and condition (such as suitable temperature and pH), primer just can be at its 3 ' end by the effect of polymerase or similarly active, obtain extending by adding nucleotides, produce the product that primer extends. The length of primer can be different according to the needs of specific condition and application. For example, in diagnostic application, the length of Oligonucleolide primers is 15-25 or more nucleotides normally. Primer must be fully complementary with desired template, could cause the synthetic of required extension products, be that primer should be able to be annealed with desired template strand, the mode of annealing is enough to 3 ' hydroxylic moiety of primer is placed correct close position, is used for causing under polymerase or similar enzyme effect synthetic. The sequence that does not need primer is the fully-complementary sequence that will seek template. For example, non-complementary nucleotide sequence can be connected to 5 of complementary primer ' end. In addition, at primer sequence and desired template strand abundant complementarity is arranged, can have provides a template-primer complex to be used for the incomplementarity base to be distributed in the Oligonucleolide primers sequence under the synthetic prerequisite of extension products functionally.

[0139] primer can carry out fluorescence labeling with 6-Fluoresceincarboxylic acid (6-FAM). Perhaps primer can be with 4,7,2 ', 7 '-tetrachloro-6-Fluoresceincarboxylic acid (TET) carries out mark. Other DNA labeling method is known in this area and is considered to be in the category of the present invention.

[0140] sometimes uses term " protein of separation " or " protein of separation and purifying " here. This term mainly refers to by expressing the protein of isolated nucleic acid molecule generation of the present invention. Perhaps the protein of this term indication protein that links together with this protein under the native state that coexisted is separated fully, has existed with the form of " substantially pure ". " separation " also do not mean that eliminating and other compounds or material form artificial or synthetic mixture, and the existence of not disturbing the foreign body of primary activity, these materials may or be configured as such as acceptable preparation on immunogenic formulation or the medicine owing to the adding of for example incomplete purifying, stabilizing agent and exist.

[0141] term " substantially pure " refers to a kind of preparation and comprises at least given material of 50-60% weight (for example nucleic acid, oligonucleotides, protein etc.). More preferably, preparation comprises at least 75% weight, most preferably the given compound of 90-95% weight. Purity is (for example chromatography, agarose or polyacrylamide gel electrophoresis, HPLC analyze etc.) measured by the method that is suitable for given compound. The polypeptide of " ripe protein " or " ripe polypeptide " indication is to have any processing event peptide sequence afterwards, and these processing events just occur in the process that polypeptide produces usually, for example the protease hydrolytic process of polypeptide precursor. When the sequence of determining mature protein or boundary, first amino acid of mature protein sequence is called as amino acid residue 1.

[0142] term " label ", " sequence label " or " protein tag " refer to chemical part, can be nucleotides, oligonucleotides, polynucleotides or amino acid, peptide or protein or other chemical substances, when these materials join in another sequence, extra use then is provided or has made sequence have useful character, particularly about detecting or separate the useful quality of the method for this sequence. Therefore, for example same polynucleic acid sequence or the nucleotide sequence with the capture oligo complementation can be added on primer or the probe sequence, promote next the separation to extension products or hybridization product. If protein tag, histidine residues (for example 4-8 continuous histidine residues) can be added in amino or the c-terminus of protein, promote the separation of protein by metal chelate chromatography. Perhaps will represent with the epi-position of specific antibody molecule or other responding property of molecule or in conjunction with amino acid sequence, peptide, protein or the fusion partner (for example flag epi-position, c-myc epi-position, influenza A virus hemagglutinin cross-film epi-position, albumin A, cellulose binding domain, caldesmon, maltose-binding protein, chitin binding structural domain, glutathione S-transferase etc.) of determinant and be added on the protein, promote that protein is separated by the step of affine or immunoaffinity chromatography. The chemical tags molecule comprises the molecule such as biotin, and they can be added on nucleic acid or the protein, helps to carry out separation and detection by interaction partners nucleic acid and protein with avidin reagent etc. Trained technical staff knows and it is contemplated that out many other tag molecule that they also are considered in this definition category.

[0143] term " conversion ", " transfection ", " transduction " nucleic acid that refers to are incorporated into method or means in cell or the host organisms, can exchange to use to express identical implication. These methods comprise, but are not limited to transfection, electroporation, microinjection, PEG fusion etc.

[0144] nucleic acid that is introduced into can be integrated (covalently bound) or unconformity in the nucleic acid of recipient cell or organism. For example in bacterium, yeast, plant and mammalian cell, the nucleic acid of introducing can be used as the form of episome element or independently duplicated son such as plasmid and keeps. The nucleic acid that perhaps is introduced into can be incorporated in the nucleic acid of recipient cell or organism, stably maintains in that cell or the organism, further transmits or is genetic in the daughter cell or organism of recipient cell or organism. In other were used, the nucleic acid of introducing is only of short duration existence in recipient cell or host organisms.

[0145] " clone " or " clone cell group " cell that to be a group form by mitosis from single cell or common ancestor.

[0146] " clone " is can be the primary cell in external stable growth many generations or the clone of cell mass.

[0147] composition that contains molecule of the present invention or compound can carry out administration, is used for the treatment of preventing and/or treating property. In therapeutic is used, for example, composition is administered to suffer from the hyperplasia disease patient of (for example cancer), the amount of using is enough to cure or at least part of symptom that stops disease and complication thereof. The amount that is enough to finish this purpose is confirmed as " in the treatment effectively amount or dosage ". Depend on the seriousness of disease and patient's body weight and general status for the effective amount of this purposes.

[0148] as used herein, term " cancer " refers to because the misgrowth of the tissue that cell uncontrollable lasting propagation causes. The example of the cancer of can the method according to this invention treating comprises, but is not limited to sarcoma, blastoma and cancer be for example: fibrosarcoma, myxosarcoma, embryonal-cell lipoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangioendothelial sarcoma, lymphangioendothelial sarcoma, synovialoma, celiothelioma, ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, colorectal cancer, cancer of the stomach, cancer of pancreas, breast cancer, MC (the most common mammary gland or lung cancer with diffusion accompanies), oophoroma, prostate cancer, squamous cell carcinoma, basal-cell carcinoma, gland cancer, syringocarcinoma, carcinoma of sebaceous glands, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, cephaloma, lung cancer, clear-cell carcinoma, liver cancer, hepatoma Metastasis, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, thyroid cancer is undifferentiated thyroid carcinoma for example, the nephroblastoma, cervical carcinoma, carcinoma of testis, lung cancer is ED-SCLC and non-small cell lung cancer for example, carcinoma of urinary bladder, cell carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neurinoma, oligodendroglioma, meningoma, melanoma, mother cell born of the same parents knurl and retinoblastoma.

The example of the hematologic malignancies of [0149] can the method according to this invention treating comprises: acute myeloid leukaemia (AML), chronic myelogenous leukemia (CML), ALL (ALL), chronic lymphocytic leukemia (CLL), Huppert's disease, non-Hodgkin's lymphoma (NHL), He Jiejin disease and lymthoma (HD), prolymphocytic leukemia (PLL), and myelodysplastic syndrome (MDS).

[0150] " immune response " expression is for example reaction that produces in having the immune host of normal function of proteantigen of any antigen. Immune response can be body fluid, relate to the generation of immunoglobulin (Ig) or antibody, or cell, relate to the B of number of different types and T lymphocyte, BMDC, macrophage, antigen presenting cell etc., perhaps existing humoral immunity has again cellular immunity. Immune response also may relate to generation and the modification of multiple different effector molecule, such as cell factor, lymphokine etc. Immune response can be external and measure in various cell or animal system.

[0151] " antibody " or " antibody molecule " is any immunoglobulin (Ig) of being combined with specific antigen, comprises antibody and antibody fragment. This term has comprised polyclone, monoclonal, chimeric and bispecific antibody. As used herein, the immunologic competence part that antibody or antibody molecule relate to intact immunoglobulin molecules and immunoglobulin molecules for example those in part known in the art, such as Fab, Fab ', F (ab ') 2 and F (v).

[0152] term " cell substrate " refers to intracellular molecule, and it is the enzymatic target of enzyme or relevant enzyme family.With regard to the mRNA interferases, " cell substrate " comprised in the cell by polybribonucleotide endogenous or that exogenous nucleic acid sequences is expressed.

[0153] just as used herein, phrase " under promoting the active condition of endoribonuclease " has comprised in the cell any condition of (in cell cultures or in vivo) or external (in test tube or in other similar containers), and mRNA interferases wherein of the present invention shows the endoribonuclease activity.Describe to some extent among the embodiment that these conditions here propose.Similarly, " buffer reagent compatible with the mRNA interferases " is a kind of buffer reagent, and mRNA interferases of the present invention shows the endoribonuclease activity therein.

[0154] just as used herein, term " mRNA interferases conditioning agent " refers to a kind of factor of endoribonuclease activity (for example improve or reduce) that can the regulating mRNA interferases.Screening or the method for differentiating this factor are in following proposition.Exemplary endogenous mRNA interferases conditioning agent comprises MazE (activity that suppresses MazF) and PemI (activity that suppresses PemK).Here also described the functional fragment of MazE and PemI, they can suppress the activity of MazF and PemK respectively.

[0155] unless otherwise defined, the implication of a personnel's common sense with ordinary skill is identical in the field under the implication of all technology used herein and scientific terminology and the present invention.Though in practice of the present invention or test, can use similar or identical method any and described herein and material, describe preferable methods and material now.Here all publications of mentioning here are cited, the publication method and the material relevant with it that is cited with disclosure and description.

[0156] nucleic acid molecule of I. coding mRNA interferases and the preparation of mRNA interferases

[0157] nucleic acid molecule

The nucleic acid molecule that can prepare code book invention endoribonuclease (for example MazF or PemK) by two kinds of general methods: (1) is synthetic from suitable Nucleotide triphosphoric acid; Perhaps separate from biogenetic derivation (2), and the testing program of two kinds of method uses is well-known in this area.

[0158] nucleotide sequence information, for example SEQ ID NO:1 or 3 full-length cDNA (seeing Figure 20 A and 31A), making becomes possibility by the synthetic preparation of oligonucleotide isolated nucleic acid molecule of the present invention.The synthetic oligonucleotide can use Applied Biosystems 380A dna synthesizer or similar device by the preparation of phosphoramidite method.The construct that produces can according to the method known in the art for example high performance liquid chromatography (HPLC) carry out purifying.Since inherent size restriction in the present oligonucleotide synthesis method, long double-stranded polynucleotide, and dna molecular for example of the present invention must stepwise synthesis.Then, the synthetic dna molecule that makes up by this method can be cloned and the appropriate carriers that increases in.Use the method known in the art, can from suitable biogenetic derivation, separate the nucleotide sequence of coding mRNA interferases.In a preferred embodiment, from the cDNA expression library of a bacterial origin, isolate the cDNA clone.In another embodiment, the sequence information that uses this cDNA sequence to provide can be isolated the genomic clone of coding mRNA interferases.Perhaps, the oligonucleotide probe of the inner predetermined sequence correspondence of mRNA interferases gene be can use, the cDNA or the genomic clone that have homology with the mRNA interferases from other species, isolated.

[0159] according to the present invention, can use the hybridization and the rinsing condition of suitable preciseness, identify the nucleic acid that has suitable homology level with the encoding histone zone of SEQ ID NO:1 or 3.For example, can use to comprise following hybridization solution and hybridize: 5XSSC, 5XDenhardt ' s reagent, 0.5-1.0%SDS, the salmon sperm DNA of the fragmentation of 100 mcg/ml sex change, 0.05% trisodium phosphate and 50% methane amide at the most.Generally hybridize at least 6 hours at 37-42 degree centigrade.After the hybridization, rinsing filter membrane according to the following steps: (1) 2XSSC, rinsing 5 minutes under the room temperature among the 0.5-1%SDS; (2) at 2XSSC, rinsing 15 minutes under the room temperature among the 0.1%SDS; (3) at 1XSSC, 37 degrees centigrade of following rinsings are 30 minutes to 1 hour among the 1%SDS; (4) at 1XSSC, 42-65 degree centigrade of following rinsing is 2 hours among the 1%SDS, changes a solution in per 30 minutes.

Calculating at the general formula (Sambrook et al., 1989) of the required preciseness condition of hybridization between two nucleic acid molecule with particular sequence homology is: Tm=81.5 ℃ of 16.6Log[Na+]+base pair number in-600/ two strands of 0.41 (%G+C)-0.63 (% methane amide).

For above formula is described, use the methane amide of [Na+]=[0.368] and 50%, GC content is 42%, average probe size is 200bp, then T _mIt is 57 degrees centigrade.The every reduction by 1% of homology, the T of dna double chain _mReduce 1-1.5 degree centigrade.Like this, use 42 degrees centigrade hybridization temperature can observe the target that has greater than about 75% sequence identity.A sequence like this is considered to have significant homology with nucleotide sequence of the present invention.

From as can be seen last, the preciseness of hybridization and rinsing depends primarily on the salt concn and the temperature of solution.Usually, in order to make the annealing ratio maximization of two nucleic acid molecule, common T at the hybrid molecule that calculates _mHybridize under the following 20-25 of value degree centigrade.For the conforming degree of target, rinsing condition should be rigorous as much as possible for probe.Usually, rinsing condition should select to be lower than hybrid molecule T _mApproximately 12-20 degree centigrade.With regard to nucleic acid of the present invention, the preciseness hybridization conditions of moderate is defined as: 6XSSC, 5XDenhardt ' s solution, 0.5%SDS, the salmon sperm DNA of 100 mcg/ml sex change, 42 degrees centigrade of hybridization down.Rinsing condition is 2XSSC, 0.5%SDS, 55 degrees centigrade 15 minutes.The preciseness hybridization conditions of height is defined as: 6XSSC, 5XDenhardt ' s solution, 0.5%SDS, the salmon sperm DNA of 100 mcg/ml sex change, 42 degrees centigrade.Rinsing condition is 1XSSC, 0.5%SDS, 65 degrees centigrade 15 minutes.Very high preciseness hybridization conditions is defined as: 6XSSC, 5XDenhardt ' s solution, 0.5%SDS, the salmon sperm DNA of 100 mcg/ml sex change, 42 degrees centigrade.Rinsing condition is 0.1XSSC, 0.5%SDS, 65 degrees centigrade 15 minutes.

Nucleic acid of the present invention can be used as DNA, in office how the preservation in the cloning vector easily.In a preferred embodiment, be cloned in plasmid clone/expression vector and preserve, for example pBluescript (Stratagene, La Jolla, Calif.) in, it can be bred in suitable e. coli host cell.The genomic clone of coding mRNA interferases gene can be preserved in lambda phage FIX II (Stratagene) among the present invention.

The nucleic acid molecule of coding mRNA interferases comprises cDNA, genomic dna, RNA and fragment thereof among the present invention, and they can be strand or two strands.Like this, the invention provides oligonucleotide (DNA have justice or nonsense strand or RNA), the sequence that they have can be hybridized with at least one sequence of nucleic acid molecules of the present invention (for example fragment of selecting among SEQ ID NO:1 or 3 the cDNA).This oligonucleotide is useful when the probe of detection or separating mRNA interferases gene.

Those skilled in the art are to be understood that the varient (for example allelic variant) that has these sequences in colony of bacterium and/or species, and must consider varient when designing and/or using oligonucleotide of the present invention.Therefore, category of the present invention has also comprised such varient, relates to mRNA interferases sequence disclosed herein or target in gene or rna transcription are originally gone up the oligonucleotide of specific position separately.With regard to the comprising of this varient, use term " natural allelic variant " here, refer to the multiple different specific nucleotide sequence and the varient thereof that in a given DNA colony, may occur.In the albumen that is encoded, cause conservative or neutral amino acids alternate genetic polymorphism is the example of this varient.

In addition, term " basic complementary " refers to the oligonucleotide that not exclusively mates with target sequence, but these mispairing substantially do not influence the ability that this oligonucleotide is hybridized with its target sequence under the condition of describing.

Like this, encoding sequence may be in SEQ ID NO:1 or 3 for example, show or may be one mutant, varient, derivative or allelotrope in these two sequences.This sequence may with shown in sequence different, one of sequence or more Nucleotide shown in difference is occur one or more add, insert, deletion and substituting.The change of nucleotide sequence may cause on the protein level the amino acid whose change determined by genetic code or constant.

Therefore, may comprise and the different sequence of sequence shown in SEQ ID NO:1 or 3 according to nucleic acid of the present invention, but its encoded polypeptides has identical aminoacid sequence with SEQ ID NO:1 or 3 encoded polypeptides.

On the other hand, the aminoacid sequence that comprises of encoded polypeptides may have one or the difference of amino acids residue more with the aminoacid sequence shown in SEQ ID NO:2 or 4.Referring to Figure 20 B and 31B.The present invention also provides the nucleic acid encoding sequence, and described polypeptide is mutant, varient, derivative or the allelotrope of aminoacid sequence shown in SEQ ID NO:2 or 4.The encode nucleic acid of this peptide species and the encoding sequence shown in SEQ ID NO:1 or 3 has consistence greater than 60%, the consistence greater than about 70%, the consistence greater than about 80%, the consistence greater than about 90% or greater than about 95% consistence.

The invention provides the method that obtains target nucleic acid, this method comprises having the probe and the target nucleic acid hybridization of sequence shown in some or all of SEQ ID NO:1 or 3 or its complementary sequence.Successful hybridization can make with probe hybridization on nucleic acid be separated, this may relate to one or more polymerase chain reaction (PCR) amplification step.

This oligonucleotide probe or primer, and the sequence of total length (and mutant, allelotrope, varient and derivative) is useful when whether having the allelotrope, mutant of mRNA interferases or varient in screening contains the test sample of nucleic acid, the target sequence hybridization probe and the sample that obtains from cell to be measured, tissue or organism.Can control the condition of hybridization, non-specific combination is minimized.Preferably use rigorous to the rigorous hybridization conditions of moderate.At textbook for example under the help of Sambrook et al (1989) and Ausubel et al (1992), the technician can easily design the hybridization condition of this probe, mark they and appropriate design.

In some preferred embodiments, according to oligonucleotide of the present invention (being the fragment or the active relevant allelotrope of any and endoribonuclease of sequence shown in SEQ ID NO:1 or 3), about at least 10 Nucleotide of its length, more preferably at least 15 Nucleotide are long, and more preferably about at least 20 Nucleotide are long.These fragments have been represented aspect of the present invention separately.Fragment and other oligonucleotide can be used as primer or the probe of being discussed, but also can by with definite test sample in whether have the homologue of coding mRNA interferases or directly produce (for example passing through PCR) to the relevant method of homologue sequence.

B. protein

MazF is that first is found the nuclease of locating to cut RNA with high degree of specificity at special nucleotide sequence (being ACA).PemK is that first is found the nuclease of locating to cut RNA with high degree of specificity at special nucleotide sequence (be UAX, wherein X is C, A or U).Full length mRNA interferases albumen of the present invention (for example MazF or PemK) can prepare with multitude of different ways according to known method.Protein can be from suitable source purifying.But this is not a preferable methods, and reason is that the protein content that exists in given cell at any time may be seldom.The availability of the nucleic acid molecule of coding MazF and PemK makes that producing these two albumen with vivoexpression method known in the art becomes possibility.For example can be with cDNA or gene clone to suitable in-vitro transcription carrier for example among pSP64 or the pSP65, be used for in-vitro transcription, in suitable cell free translation system (for example wheatgerm or rabbit reticulocyte lysate), carry out cell free translation afterwards.In-vitro transcription and translation system are commercial, can be from for example Promega Biotech, and Madison, Wis. or BRL, Rockville, Md obtains.

Perhaps, according to an embodiment preferred, can produce a large amount of mRNA interferases by in suitable protokaryon or eukaryotic system, expressing.For example, dna molecular some or all of, for example SEQ ID NO:1 or 3 cDNA can be inserted in the plasmid vector that is suitable for expressing in bacterial cell such as Bacillus coli cells.This carrier comprises DNA and express required controlling element in host cell (as intestinal bacteria), and the position of controlling element allows DNA to express in host cell.The required controlling element of this expression comprises promoter sequence, transcriptional initiation sequence and selectively, enhancer sequence.

The mRNA interferases that genetic expression produces in reorganization protokaryon or eukaryotic system can carry out purifying according to the method known in the art.In a preferred embodiment, expression/excretory system that can commodity in useization, by after its expression of recombinant proteins from host cell secretion come out, easily from around substratum purifying come out.If do not use expression/secretion vector, another mode relates to affine separation and purification recombinant protein, for example with the antibody of specific combination recombinant protein immunity taking place and interact or use the nickel chromatography column, is used to be separated in the recombinant protein of the label of N end or 6-8 Histidine of C end interpolation.Other label may comprise FLAG epi-position or hemagglutinin epi-position.These methods are that the technician is normally used.

By the mRNA interferases of the present invention of above-mentioned method preparation, can analyze according to the step of standard.For example, can carry out amino acid sequence analysis to these albumen according to known method.

It is the polypeptide of variant amino acid sequence body, allelotrope, derivative or mutant that the present invention also provides.The polypeptide that belongs to varient, allelotrope, derivative or mutant may have the different sequence of sequence that provides with SEQ ID NO:2, and one or more one or more interpolations, replacement, deletion and the insertion of amino acids are arranged.Preferred these polypeptide have the function of MazF, promptly have one or how following character: the ability of cutting ACA sequence in RNA; With the cross reactivity of antibody, this antibody with have SEQ ID NO:2 polypeptide of sequence and have reactivity; And the polypeptide shown in the sequence that SEQ ID NO:2 provides has common epitope (determining according to for example immunological cross-reaction between two polypeptide).

[0160] or the polypeptide that belongs to varient, allelotrope, derivative or mutant may have the different aminoacid sequence of sequence that provides with SEQ ID NO:4, one or more one or more interpolations, replacement, deletion and the insertion of amino acids are arranged.Preferred these polypeptide have the function of PemK, promptly have one or how following character: the ability of cutting UAX sequence (wherein X is C, A or U) in RNA; With the cross reactivity of antibody, this antibody with have SEQ ID NO:4 polypeptide of sequence and have reactivity; And the polypeptide shown in the sequence that SEQ ID NO:4 provides has common epitope (determining according to for example immunological cross-reaction between two polypeptide).

[0161] belongs to the variant amino acid sequence body of aminoacid sequence shown in SEQ ID NO:2 or 4, allelotrope, the aminoacid sequence that the polypeptide of derivative or mutant may comprise with shown in sequence about sequence identity more than 35% is arranged, about consistence more than 40%, about consistence more than 50%, about consistence more than 60%, about consistence more than 70%, about consistence more than 80%, about consistence or about consistence more than 95% more than 90%.Between specific the variant amino acid sequence body and the sequence shown in SEQ ID NO:2 or 4, by inserting, add, replace or delete 1 amino acid, 2,3,4,5-10,10-20,20-30,30-40,40-50,50-100,100-150, the perhaps amino acid more than 150 and have difference.Amino acid whose " homology " can be understood that consistence or similarity (according to the amino acid similarity principle of determining, for example, use algorithm GAP (GeneticsComputer Group, Madison, Wis.) definite similarity principle).GAP uses Needleman and two complete sequence of Wunsch algorithm comparison, makes the number maximization of coupling, and the breach number is minimized.Usually, use default parameter: breach produces point penalty=12 and breach extends point penalty=4.Use GAP preferably still also can use other algorithms, comprise, but be not limited to, BLAST (Altschul et al. (1990 J.Mol.Biol.215:405-410); FASTA (Pearson and Lipman (1998) PNAS USA85:2444-2448) or Smith Waterman algorithm (Smith and Waterman (1981) J.Mol.Biol.147:195-197) generally use default parameter.Use term " homology " or " homologous " here and do not mean that any inevitable evolutionary relationship is arranged between two sequences that compared.The use of the use of these two terms and phrase " homologous recombination " is similar, and it is fully similar that promptly term only requires two nucleotide sequences, with reorganization under suitable condition.

Can be used to screen influence or regulate the molecule of its activity or function according to polypeptide of the present invention.These molecules can be used for research purpose.

The present invention also provide can immunologic opsonin in conjunction with the proteinic antibody of the present invention.Polyclonal antibody at mRNA interferases (for example MazF or PemK) can prepare according to standard method.In a preferred embodiment, prepared monoclonal antibody, immune specific reaction takes place in the various epi-position of they and mRNA interferases.Can use the standard test scheme to prepare monoclonal antibody according to the general method of Kohler and Milstein.Polyclone or monoclonal antibody that immune specific reaction takes place with the mRNA interferases can be used for identifying and these protein of purifying.For example, antibody can be used for affine separation and the special interacting proteins of its generation immunity.Can also use antibody from the sample that contains protein and other biological molecule mixture, the protein immunoprecipitation to be come out.Other purposes of the antibody of anti-mRNA interferases have below been described.

Can modify in several ways according to antibody of the present invention.Really term " antibody " is appreciated that any associativity material with required specific binding domains.Therefore, present invention includes derivative, functional equivalents and the homologue of antibody fragment, antibody, comprise synthetic molecule and simulating shape antibody make it can conjugated antigen or the molecule of epi-position.

Exemplary can conjugated antigen or the antibody fragment of other binding partners have: by VL, VH, the Fab fragment that C1 and CH1 structural domain are formed; The Fd fragment of forming by VH and CH1 structural domain; The Fv fragment of forming by the VL and the VH structural domain of a single armed of antibody; The dAb fragment of forming by the VH structural domain; Isolating CDR zone and F (ab ') 2 fragments, it is to have comprised segmental pair of valency fragment of two Fab, these two Fab fragments at hinge area by a disulfide bridge connects.The Fv fragment that has also comprised strand.

The use of nucleic acid, mRNA interferases and the antibody thereof of II coding mRNA interferases

For example MazF and PemK are the RNA endonucleases, can be used for reducing or suppressing cell, tissue or biological intravital protein synthesis.And, mRNA interferases of the present invention specifically target in the particular organization of study subject, with special reduction or be suppressed at protein synthesis in the target tissue.Use for some, advantageously the special rna transcription product of target is used for the endonuclease cutting of MazF.This sequence may comprise the ACA sequence of rising frequency, is the active natural preferred target of MazF therefore.Perhaps can by change the MazF polypeptide make its specifically or preferential in conjunction with and/or the cutting transcription product that is used to cut, thereby the targeted rna transcription product is used for the cutting of MazF.Perhaps, maybe advantageously the special rna transcription product of target is used for the endonuclease cutting of PemK.This sequence may comprise the UAX sequence (wherein X is C, A or U) of rising frequency, is the active natural preferred target of PemK therefore.Perhaps can by change the PemK polypeptide make its specifically or preferential in conjunction with and/or the cutting transcription product that is used to cut, thereby the targeted rna transcription product is used for the cutting of PemK.

[0162] especially, mRNA interferases molecule (for example MazF and PemK) and composition of the present invention can be advantageously used in the patient that treatment has the hyperplasia disease.These diseases comprise, but be not limited to restenosis behind the heteroplasia of different tissues and metaplasia, inflammatory conditions, autoimmune disorders, hyperproliferative skin disease, psoriasis, allergy/asthma, atherosclerosis, the angioplasty and cancer.MRNA interferases molecule (for example MazF and PemK) and composition of the present invention can be advantageously used in the patient that treatment has infectation of bacteria.

[0163] in addition,, can be used as research tool, identify that other participate in the protein of RNA identification and cleavage reaction closely according to mRNA interferase nucleic of the present invention, protein and antibody thereof.

[0164] nucleic acid of A. coding mRNA interferases

The nucleic acid of coding MazF and PemK can be used for according to various purpose of the present invention.DNA, RNA or its fragment of coding MazF and PemK can be used as probe, to detect existing and/or expressing of encode class MazF and the proteinic gene of class PemK.The method that the nucleic acid of coding MazF and PemK can be used for the probe of this detection comprises, but is not limited to (1) in situ hybridization; (2) Southern hybridization; (3) northern hybridization; And (4) various amplified reactions PCR for example.

[0165] nucleic acid of coding mRNA interferases of the present invention can also be used as probe, identifies the genes involved from other bacteriums, plant or animal species.Well-knownly in this area be, can adjust the hybridization preciseness, make nucleic acid probe and have between the complementary sequence of homology in various degree and hybridize.Therefore, the nucleic acid of coding MazF and PemK can be used to identify and characterize other and MazF and/or PemK the gene of dependency in various degree, makes the character that further characterizes the RNA degeneration system become possibility like this.In addition, they can be used for the gene (for example by " interaction trap " technology) of identification code and MazF and/or PemK interacting proteins, and this should be able to further accelerate the evaluation to the component that participates in the RNA cutting.

[0166] coding MazF or the nucleic acid molecule of PemK or the production that its fragment can also be used to control MazF or PemK, regulation and control participate in the proteinic amount of RNA cleavage reaction like this.The proteic activity that changes other rho factors of possibility remarkably influenced participation RNA cutting of the MazF of physiological amount or PemK.

[0167] B.mRNA interferases and antibody thereof

Invent the purified mRNA interferases of the expression of nucleic acids preparation of MazF or PemK by code book, for example isolated M azF or PemK albumen, perhaps its fragment, can be used to prepare polyclone or monoclonal antibody, described antibody can be in checking bacterial cell when the existence of MazF (mixture that perhaps contains MazF) or PemK (mixture that perhaps contains PemK) and accumulation as the detection reagent of sensitivity.Recombinant technology makes that expression contains some or all of MazF or the proteinic fusion rotein of PemK becomes possibility.Whole length protein or protein fragments can be used to produce a series of for the special monoclonal antibody of protein epitope, and higher susceptibility so just is provided during the protein in detecting cell.

[0168] can be used for multiple different detection for special polyclone or the monoclonal antibody of mRNA interferases (for example MazF or PemK) immunity, protein is detected with quantitative.These detections comprise, but are not limited to: (1) flow cytometry analysis; (2) immunochemistry of mRNA interferases location in bacterial cell for example; And the immunoblotting assay of the extract of (3) various cells (for example, dot blotting, Western trace).In addition, as top description, for example anti-MazF and anti-PemK antibody can be used for purifying MazF and directly to homologue or PemK and directly to homologue (for example affinity column purifying, immunoprecipitation).

[0169] mRNA interferases, for example MazF or PemK albumen can also be used for reducing or to suppress cell, tissue or organism proteinic synthetic, as discussed above.

[0170] from the discussion of front, the nucleic acid of coding mRNA interferases, the expression vector of expressing the mRNA interferases and the antibody of anti-mRNA interferases among the present invention as can be seen, can be used to genetic expression for preparing a large amount of mRNA interferases, detects the mRNA interferases and the accumulation that changes the mRNA interferases, purpose is to determine to participate in the heredity and the protein interaction of RNA cutting.

[0171] the wonderful discovery of inventor of the present invention is a kind of endoribonuclease from the ST MazF of bacterium.As described herein-in, MazF is used as first member of the novel enzyme family that is called " RNA interferases ".And MazF is the example of this novel " RNA interferases " family.Importantly, before discovery of the present invention, do not find the cell target of MazF.As shown here, the effect of MazF is highly sequence-specific endoribonuclease, and they are at the mRNA of ACA site incising cell.This active may the interior protein synthesis generation of pair cell the inhibition partly or completely.According to any possibility that is incorporated into each position of three nucleotide positions in four kinds of Nucleotide is identical principle, and according to the calculating of standard, the predict frequency that the ACA sequence appears in the rna transcription product is 1/64.Should be appreciated that with predict frequency and compare, comprise the ACA sequence of lower or upper frequency in some rna transcription products.Therefore, special rna transcription product or the relevant rna transcription product family susceptibility of being cut by the MazF endoribonuclease depends on ACA sequence or the frequency of MazF target sequence in transcription product.And the personnel that have ordinary skill in this area can be according to the sequence prediction transcription product of the rna transcription product susceptibility for the cutting of MazF mediation.

[0172] inventor of the present invention finds that also PemK is a member who is called as the novel enzyme family of " RNA interferases " here.As shown here, the effect of PemK is highly sequence-specific endoribonuclease, and they are at the mRNA of UAX site incising cell, and wherein X is C, A or U.This active may the interior protein synthesis generation of pair cell the inhibition partly or completely.According to any possibility that is incorporated into each position of three nucleotide positions in four kinds of Nucleotide is identical principle, and according to the calculating of standard, the predict frequency that UAX sequence (wherein X is C, A or U) appears in the rna transcription product is 3/64.Should be appreciated that with predict frequency and compare, comprise the UAX sequence of lower or upper frequency in some rna transcription products.Therefore, special rna transcription product or the relevant rna transcription product family susceptibility of being cut by the PemK endoribonuclease depends on UAX sequence (wherein X is C, A or U) or the frequency of PemK target sequence in transcription product.And the personnel that have ordinary skill in this area can be according to the sequence prediction transcription product of the rna transcription product susceptibility for the cutting of PemK mediation.

[0173] thus inventor's of the present invention new discovery nucleic acid and the aminoacid sequence and the new application of composition thereof of mRNA interferases (for example MazF and PemK) have been proposed.These application comprise, still are not limited to, and use as various research described herein and therapeutic.The test kit that comprises MazF and PemK nucleic acid and/or aminoacid sequence, MazF and/or PemK activity compatible buffer reagent and directions for use material also is provided.

[0174] nucleic acid molecule of III. coding mRNA interferases inhibitor and the preparation of mRNA interferases inhibitor protein matter

The nucleic acid molecule of coding MazE and PemI and MazE and PemI polypeptide and functional fragment thereof produce according to the nucleic acid molecule of above-described preparation coding MazF and PemK and the method for MazF and PemK polypeptide basically.According to the present invention, coding MazE protein is provided, has comprised the nucleotide sequence of SEQ ID NO:5.Referring to Figure 21 A.The aminoacid sequence and the functional fragment thereof that comprise SEQ ID NO:6 also are provided.Referring to Figure 21 B.Coding PemI albumen correspondingly is provided, has comprised the nucleotide sequence of SEQ ID NO:7.Referring to Figure 32 A.The aminoacid sequence and the functional fragment thereof that comprise SEQID NO:8 also are provided.Referring to Figure 32 B.

[0175] nucleic acid of IV. coding mRNA interferases inhibitor and the use of mRNA interferases inhibitor protein matter

[0176] present invention includes the MazE polypeptide of SEQ ID NO:5 coding, nucleotide sequence and the functional fragment thereof that coding comprises the MazE polypeptide of SEQ ID NO:6, and the MazE polypeptide and the functional fragment thereof that comprise SEQID NO:6.As described herein, MazE polypeptide and functional fragment thereof show the active ability of MazF of regulating.Referring to EXAMPLE III and following summary.

[0177] in brief, as indicated here, (His) of purifying ₆MazE strengthens with combining by MazF of mazEF promoter DNA.Conservative amino acid residues rite-directed mutagenesis (K7A, R8A, S12A and R16A) at MazE N end regions has destroyed (His) ₆MazE and MazE-MazF (His) ₆The DNA binding ability of mixture, prompting MazE combines with the mazEF promoter DNA by N end structure territory.In solution, MazE-MazF (His) ₆In the mixture, MazE and MazF (His) ₆Ratio be about 1: 2.Because MazE and MazF (His) ₆All exist, so prediction MazE-MazF (His) with the homodimer form ₆Mixture (76.9kDa) is by a MazE dimer and two MazF (His) ₆Dimer is formed.Also use yeast two-hybrid system to study interaction between MazE and the MazF.Residue 38 to 75 zones of finding MazE are for being essential with combining of MazF.This regional site-directed mutagenesis shows Leu55 and Leu58 in the formation of MazE-MazF mixture, rather than plays an important role in the combining of MazE and mazEF promoter DNA.Present result proves that MazE is that a N end DNA binding domains and a C end MazF interaction domain are formed by two structural domains.

[0178] therefore in one embodiment, MazE polypeptide of the present invention and MazE functional fragment have suppressed the activity of MazF.In a special aspects, MazE polypeptide of the present invention or MazE functional fragment have suppressed the active of MazF endoribonuclease or the activity of endoribonuclease are reduced.Really, MazE and functional fragment thereof are the molecules that the present invention at first studies, and prove that here it can realize the active reduction of endoribonuclease, thereby realize the decline of endoribonuclease substrate cutting.The exemplary MazE functional fragment that the cutting of endoribonuclease substrate descends of can realizing comprises, but only is limited to C end MazF interaction domain.In a specific embodiment, C end MazF interaction domain comprises the 38-75 residue zone of MazE.As described herein, comprise Leu55 and Leu58 in the Key residues of this area discover.In another embodiment, C holds the Key residues that the MazF interaction domain comprises the Hp-Box of MazE molecule and wherein finds.

[0179] in a particular aspects of the present invention, two C end peptides of MazE can be by chemosynthesis, and a peptide is T54-K77 (24 amino-acid residues; TLAELVNDITPENLHENIDWGEPK; SEQ ID NO:9), another is N60-K77 (18 amino-acid residues; NDITPENLHENIDWGEPK; SEQ ID NO:10).According to the x-ray structure of MazE-MazF mixture, these polypeptide are estimated to form stable inhibition mixture with the MazF dimer.Previous peptide contains the acidic tail of spiral 2 and C end, and a back peptide does not have spiral 2.Use synthetic 30 base RNA (5 '-UAAGAAGGAGAUAUACAUAUGAAUCAAAUC-3 '; SEQ ID NO:11), checks that these peptides suppress the active ability of MazF mRNA interferases as substrate.Use intact MazE in contrast, relatively their inhibition activity.

[0180] in another embodiment, MazE polypeptide of the present invention and MazE functional fragment increase or improve the activity of MazF.One special aspect, MazE polypeptide of the present invention or MazE functional fragment improve the active of MazF endoribonuclease or realize the active rising of endoribonuclease.Really, MazE polypeptide mutant and functional fragment thereof are that first the present invention characterizes out the molecule that can realize the active increase of endoribonuclease and realize endoribonuclease substrate cutting increase.The exemplary MazE polypeptide that the cutting of endoribonuclease substrate increases of can realizing comprises, but be not limited to, comprise the MazE polypeptide of sudden change at C end MazF interaction domain, MazE 38 to No. 75 residues, Hp-Box or Leu55 or Leu68 (perhaps its same source position), wherein such sudden change reduces or has suppressed the ability of MazE in conjunction with MazF.The exemplary MazE fragment that can realize that the cutting of endoribonuclease substrate improves comprises, but is not limited to, and comprises the MazE fragment of sudden change, and described sudden change reduces or suppressed the ability of MazE fragment in conjunction with MazF.These MazE fragments that comprise this sudden change comprise, but are not limited to the 38-75 residue zone of C end MazF interaction domain or MazE.Known reduction or inhibition MazE fragment are included in the sudden change of Leu55 and Leu58 in conjunction with the exemplary residue sudden change of MazF ability.This MazE mutant polypeptide and fragment here can be called as and have the dominant activity.Usually, the dominant polypeptide is used to reduce or suppress the activity of corresponding wild type peptide because they still can in conjunction with and therefore compete substrate and/or interaction protein or molecule, but the function of its wild-type has been subjected to partly weakening at least.

[0181] the present invention has also comprised the nucleotide sequence of the PemI polypeptide of SEQ ID NO:7 coding, PemI polypeptide that coding comprises SEQ ID NO:8 and their functional fragment, and the PemI polypeptide and the functional fragment thereof that comprise SEQ ID NO:8.As described herein-in, PemI polypeptide and functional fragment thereof have shown the active ability of adjusting PemK.The active exemplary PemI functional fragment of PemI activity and PemK be can regulate and N end DNA binding domains and C end PemK interaction domain comprised.Referring to the following examples IV here.

[0182] therefore, in one embodiment, PemI polypeptide of the present invention and PemI functional fragment have suppressed the activity of PemK.One special aspect, it is active or realized the active reduction of endoribonuclease that PemI polypeptide of the present invention or PemI functional fragment have suppressed the PemK endoribonuclease.Really, PemI and functional fragment thereof are the molecules that the present invention at first studies, and show that here it can realize the active reduction of endoribonuclease, thereby have realized the reduction of endoribonuclease substrate cutting.

[0183] in another embodiment, related to PemI polypeptide or its derivative or its fragment that can suppress the active mutant form of PemI.This PemI mutant polypeptide and fragment can here be called as and have the dominant activity.Usually, the dominant polypeptide is used to reduce or suppress the activity of corresponding wild type peptide, because they still can weaken but the function of its wild-type is subjected to part at least in conjunction with also therefore competing substrate and/or interaction protein or molecule.Because PemI combines with PemK usually, therefore suppressed its toxic action, stop the inhibition to PemK of PemI mediation PemK can be discharged from this negative regulation.Therefore, suppress the PemI activity and cause the active increase of PemK.

[0184] C. identifies the general method that can regulate the active compound of MazF

[0185] structure of the habit-forming assembly of escherichia coli chromosome MazE/MazF is determined to the resolving power (Kamada et al., Mol Cell 11,875-884 (2003)) of 1.7 dusts.As described herein-in, habit-forming assembly is made up of the stable toxin and the unsettled toxinicide albumen of the death of control bacterial cell.MazE (toxinicide) and MazF (toxin) form linear different six aggressiveness, alternately form (MazF2-MazE by toxin and toxinicide homodimer ₂-MazF ₂).Kamada et al. shows that the MazE homodimer contains a β bucket, extends two C ends from the β bucket, with the MazF homodimer interaction of both sides.This interaction is similar to plasmid-encoded toxin C cdB and the interaction between the Kid.The different six aggressiveness structures of MazE/MazF have proved that the habit-forming assembly that karyomit(e) and plasmid carry has common toxinicide-toxin recognition mechanism, and the contratoxin effect, the degraded and the toxinicide/toxin complex of toxinicide do not provide general molecular recognition with combining of promoter DNA when having toxin.

[0186] according to the information that proposes here, peptide target suitable among the MazE comprises, but is not limited to residue that those are listed below and zone.Peptide target suitable among the MazE comprises N-box, the conservative N end regions of MazE camber (it from residue 7 to residue 18, mediation combines with DNA), and Key residues wherein.Key residues among the N-box of MazE comprises K7A, R8A, and S12A and R16A, the sudden change of these residues has destroyed the DNA binding ability of MazE and MazE-MazF mixture.From the conservative C end regions Hp-Box of residue 53 to 64, being rich in hydrophobic residue among the MazE, also is the target based on the therapeutics of peptide of being used for that suits.The Hp-box zone has participated in seeming the most stable interface between MazE and the MazF.Cluster hydrophobic residue in side chain of hydrophobic amino acid residue among the Hp-box (Leu55, Leu58, Val59 and Ile62) and the MazF homodimer interacts.

[0187] according to the information that proposes here, peptide target suitable among the MazF comprises, but is not limited to residue that those are listed below and zone.Peptide target suitable among the MazF comprises R29S, N40D, T52K, Q77H, R86G, I110N, E24A and K79A residue and the little peptide (for example comprise these residues with and the peptide of 5-10 residue of flank residue) that comprises these Key residues.

[0188] in one embodiment of the invention, crystalline structure (the Kamada et al. of 2: 4 MazE/MazF mixtures and structural constituent thereof, the same), and the interface of between MazE and MazF, finding, be used as target, in a virtual aglucon screening step, to the method for refuting, identifying from a huge library of compounds can be with the candidate compound of high affinity in conjunction with target site by computer.

[0189] in another embodiment, MazE/MazF mixture (Kamada et al., the same) and the structural information of component and the interface of between MazE and MazF, finding, be used to design compound, these compound expectations combine with the interface of MazF and/or MazE/MazF, and detect these compounds and whether have high affine associativity.

[0190] in specific embodiment, selects the candidate compound that is combined with regulating effect and " compound of design " to MazF and RNA.These compounds can improve or suppress combining of MazF and RNA.This compound can be realized the increase or the minimizing of substrate (being RNA) cutting.Then to derive from any one method and to refute the highest compound of scoring in the step carry out based on cell with acellular test (being described below), regulate the active effectiveness of MazF to determine it.

[0191] then with any compound and MazF cocrystallization of rendeing a service that in biological test, show, to find binding site.In another embodiment of the invention, can be modified by the method known in the art in conjunction with the candidate compound of MazF, further improve specific physique, for example improve effectiveness and/or specificity and/or solubility.The demonstration of selecting is closed the compound that needs character most and is designated as lead compound, further detects its effectiveness in the animal model that for example has the hyperplasia disease.

[0192] D. identifies the general method that can regulate the active compound of PemK

[0193] according to the information that proposes here, peptide target suitable among the PemI comprises, but is not limited to residue that those are listed below and zone.Suitable peptide target is included in the zone of guarding among the member of PemI peptide family among the PemI.

[0194] according to the information that proposes here, peptide target suitable among the PemK comprises, but is not limited to residue that those are listed below and zone.Conservative ring between β chain S1 and S2 (called after S1-S2 ring) and residue wherein are the peptide targets that suits.Obtain the aminoacid sequence comparison and the aminoacid sequence wherein of conservative region referring to Figure 33 and 34.

[0195] in one embodiment of the invention, the crystalline structure (Kamada et al., the same) of 2: 4 MazE/MazF mixtures and structural constituent thereof, and the interface of finding between MazE and MazF can be used to check the PemI/PemK mixture.Therefore, these deductions can be in a virtual aglucon screening step, and to the method for refuting, identifying from a huge library of compounds can be with the candidate compound of high affinity in conjunction with target site by computer.

[0196] in another embodiment, MazE/MazF mixture (Kamada et al., the same) and the structural information of component and the interface of finding between MazE and MazF can be used to check the PemI/PemK mixture.Therefore, these deductions can be used to design compound, and these compound expectations combine with PemK and/or PemI/PemK interface, and detect these compounds and whether have high affine associativity.

[0197] in specific embodiment, selects the candidate compound that is combined with regulating effect and " compound of design " to PemK and RNA.These compounds can improve or suppress combining of PemK and RNA.This compound can be realized the increase or the minimizing of substrate (being RNA) cutting.Then to derive from any one method and to refute the highest compound of scoring in the step carry out based on cell with acellular test (being described below), regulate the active effectiveness of PemK to determine it.

[0198] then can be with any compound and PemK cocrystallization of rendeing a service that in biological test, show, to identify binding site.In another embodiment of the invention, can be modified by the method known in the art in conjunction with the candidate compound of PemK, further improve specific physique, for example improve effectiveness and/or specificity and/or solubility.The demonstration of selecting is closed the compound that needs character most and is designated as lead compound, further detects its effectiveness in the animal model that for example has the hyperplasia disease.

[0199] the virtual aglucon screening of the technology of refuting (Flexible Docking Technology) being carried out by elasticity

[0200] at present can use a special protein structure from big library of compounds, to select a small amount of possible guide candidate aglucon to refuting with screening method.This method is described in for example Abagyan and Totrov (2001) Current Opinion Chemical Biology 5:375-382 to some extent, here it is all quoted as a reference.

[0201] based on high-throughput elasticity to the virtual aglucon screening (VLS) of refuting in design with identify can be with certain specific protein structure bonded compound the time it is useful.VLS can be used for not needing synthetic from a large amount of chemical molecular samplings virtually and detect each chemical molecular experiment.Usually, this method is from the polypeptide modeling, and it uses by conventional methods for example protein structure of X ray crystalline diffraction, NMR, homology modeling selection.Use then any existing to the program of refuting, MCDOCK (Liu et al. (1999) J.Comput.AidedMol.Des.13:435-451) for example, SEED (Majeux et al. (1999) Proteins 37:88-105; DARWIN (Taylor et al. (2000) Proteins 41:173-191; MM (David et al. (2001) J.Comput.Aided Mol.Des.15:157-171, with one group of compound and/or molecule fragment to refuting in the binding site of selecting.Compound is marked according to aglucon, produce a series of expectations and have the candidate compound of high binding affinity, be used for further detecting in vitro and in vivo and/or chemically modified.

[0202] in a kind of method of VLS, before chemical preparation, with molecule " construction " in the binding pocket of selecting.Designed a large amount of programs be used for an atom then an atom " growth " aglucon [referring to for example GENSTAR (Pearlman et al.L (1993) J.Comput.Chem.14:1184), LEGEND (Nishibata et al. (1993) J.Med.Chem.36:2921-2928), MCDNLG (Rotstein et al. (1993) J.Comput-AidedMol.Des.7:23-43), CONCEPTS (Gehlhaar et al. (1995) J.MedChem 38:466-472] or fragment then a fragment " growth " aglucon [referring to for example GROUPBUILD (Rotsein et al. (1993) J.Med.Chem.36:1700-1710), SPROUT (Gillet et al. (1993) J.Comput.Aided Mol.Des.7:127-153), LUDI (Bohm (1992) J.Comput.Aided Mol.Des.6:61-78), BUILDER (Roe (1995) J.Comput.Aided Mol.Des.9:269-282), and SMOG (DeWitte et al. (1996) J.Am.Chem.Soc.118:11733-11744].

[0203] methods of marking for the aglucon of a specific protein is known, its can with a spot of can the conjugated protein structure molecule and a large amount of non-binding thing differences come.Referring to, for example, Agagyan et al. (2001) is the same, about by virtual aglucon to refuting the report of a large amount of successful aglucons that identify with screening method.

[0204] for example, Nishibata et al. (1993) J.Med.Chem 36:2921-2928 has described a structure construction program produces the inhibition molecule according to the three-dimensional structure of a molecule (Tetrahydrofolate dehydrogenase) avtive spot ability.This program can be predicted the molecule that has with four known enzyme inhibitors analog structures, and strong support is provided, and is the knowledge of using the target three-dimensional structure and obtains novel lead compound and provide and provide powerful support for.Similarly, Gilletet al. (1993) J.Computer Aided Mol.Design 7:127-153 has described the structure that produces by the artificial intelligence technology (SPROUT) based on space constraint.

[0205] factor of identifying by screening method of the present invention

[0206] the invention provides the method for evaluation with high affinity and the mRNA interferases (for example MazF or PemK) or mRNA interferases inhibitor (for example MazE or PemI) the bonded factor (for example candidate compound or test compounds).The factor that identifies by method of the present invention can be used as candidate's factor of anti-hyperplasia disease and antibacterium methods of treatment.

[0207] example of the factor, candidate compound or test compounds comprises, but is not limited to nucleic acid (for example DNA and RNA), sugar, fat, protein, peptide, peptide mimics, small molecules and other drug.Can use that any method in the several different methods obtains the factor in the combinatorial libraries known in the art, comprising: parallel solid phase or liquid phase library can be located in biological library, space; Need carry out the synthetic library method of deconvolution; " pearl one compound (one-head one-compound) " library method; And the synthetic library method of using affinity chromatography to select.Biological library method is limited to peptide library, and other four kinds of methods can be used for peptide, non-peptide oligomer or micromolecular compound library (Lam (1997) Anticancer Drug Des.12:145; United States Patent (USP) numbering 5,738,996; With United States Patent (USP) numbering 5,807,683, here quote as a reference with its integral body respectively)

[0208] example of the method in synthetic molecules library can find in this area, for example at DeWitt et al. (1993) Proc.Natl.Acad.Sci.USA 90:6909; Erbet al. (1994) Proc.Natl.Acad.Sci.USA 91:11422; Zuckermannet al. (1994) J.Med.Chem.37:2678; Cho et al. (1993) Science261:1303; Carrell et al. (1994) Angew.Chem.Int.Ed.Engl.33:2059; Carell et al. (1994) Angew.Chem.Int.Ed.Engl.33:2061; And among Gallop et al. (1994) J.Med.Chem.37:1233, each document is here quoted as a reference with its integral body.

[0209] library of compounds for example may reside in the solution (for example Houghten (1992) Bio/Techniques 13:412-421), or be present in (Lam (1991) Nature354:82-84) on the pearl, be present in (Fodor (1993) Nature 364:555-556) on the chip, be present in the bacterium (United States Patent (USP) numbering 5,223,409), be present in (United States Patent (USP) numbering 5 in the spore, 571,698; 5,403,484; With 5,223,409), be present in the plasmid (Cull et al. (1992) Proc.Natl.Acad.Sci.USA 89:1865-1869) or be present in (Scott and Smith (19900 Science249:386-390 in the phage; Devlin (1990) Science 249:404-406; Cwirla et al. (1990) Proc.Natl.Acad.Sci.USA 87:6378-6382; And Felici (1991) J.Mol.Biol.222:301-310), each document is here quoted as a reference with its integral body.

[0210] shaker test

[0211] by above-described virtual aglucon to refuting the small molecules of identifying with screening method, further carry out external and in vivo test.In one embodiment, identify the interact factor of (promptly combining) by detection system with mRNA interferases (for example MazF or PemK) or mRNA interferases inhibitor such as MazE or PemI based on cell.Purpose for clarity and brevity, use MazF and MazF fragment to describe the remainder of these detections, but be to be understood that these detection/methods can also be applied to other mRNA interferases and fragment thereof, for example MazE and MazE fragment, PemK and PemK fragment, and PemI and PemI fragment.

[0212] according to this embodiment, the cell of expressing MazF or its functional fragment contacts with candidate compound or control compound, measures candidate compound and the interactional ability of MazF.If desired, can screen the candidate compound in a plurality of (for example libraries) with this detection.Cell can be (for example intestinal bacteria) in protokaryon source or (for example yeast or the Mammals) in eucaryon source.And cell can endogenous expression MazF or its fragment, the perhaps genetic engineering modified expression MazF of process or its fragment.In some cases, MazF or MazF fragment are labeled, and for example use radio-labeling (for example ³²P, ³⁵S or ¹²⁵I), perhaps use fluorescent mark (for example fluorescein isothiocyanate, rhodamine, phycoerythrobilin, algocyan, allophycocyanin, Phthalyldicarboxaldehyde or fluorescamine), make that the interaction between MazF and the candidate compound can be detected.The interaction of candidate compound and MazF uses the known method of those skilled in that art to measure.For example the interaction of candidate compound and MazF can be used cell streaming instrument, flicker detection method, immunoprecipitation or Western engram analysis.

[0213] in another embodiment, use acellular detection system, the interact factor of (promptly combining) of evaluation and MazF or its associated clip.According to this embodiment, MazF or its fragment natural or reorganization contact with candidate compound or control compound, measure candidate compound and the interactional ability of MazF.If desired, can screen a plurality of (for example library) candidate compound with this detection.In one embodiment, at first with MazF or its fragment immobilization (by for example contacting with specific recognition and in conjunction with MazF or its segmental immobilized antibody, perhaps the MazF by making purifying or its segmental prepared product are designed for protein-bonded surface and contact with one).MazF or its fragment be purifying (promptly partly or completely not having other polypeptide) or cell lysate partly or completely.In addition, MazF or its fragment can be fusion roteins, and this fusion rotein comprises for example glutathione-S-transferase of MazF or its biologically-active moiety and structural domain.Perhaps MazF or its biologically-active moiety can use the well-known method of those skilled in that art to carry out biotinylation (biological example elementization test kit, Pierce Chemicals; Rockford, IL).Candidate compound uses the known method of those skilled in that art to measure in conjunction with the ability of MazF.

[0214] in another embodiment, in animal model, identify the active factor of adjusting MazF.The example of suitable animal comprises, but is not limited to mouse, rat, rabbit, monkey, cavy, dog and cat.Preferably, the animal of use is represented the model of hyperplasia disease.According to this embodiment, give to wait upon to suitable animal and survey compound or control compound (for example oral, rectal administration, parenterai administration be intraperitoneal or intravenously for example), measure effect to activity level.

[0215] E. can be in conjunction with the factor of mRNA interferases or the therapeutic use of mRNA interferases inhibitor

[0216] the invention provides by using the therapeutic compound of method evaluation described above, treatment hyperplasia disease.This compound comprises, but is not limited to the derivative of protein, peptide, protein or peptide or analogue, antibody, nucleic acid and small molecules.

[0217] the invention provides the method that treatment is subjected to the patient of transition hyperplasia puzzlement, this method comprises the method compounds identified of the present invention of passing through from significant quantity to study subject that use.One preferred aspect, compound is basic purifying (for example the effect of this compound or produce the material of undesirable side effect) substantially without limits.Study subject is animal preferably, but comprises and being not limited to, milk cow, pig, horse, chicken, cat, dog or the like, and preferably Mammals most preferably is the people.In a specific embodiment, inhuman Mammals is a study subject.

[0218] when compound comprises nucleic acid operable preparation and medication such as above description; Other appropriate formulations and route of administration are described below.

[0219] known various delivery system can be used to use compound of the present invention, for example be wrapped in liposome, particulate, the microcapsule, can express the reconstitution cell of compound, receptor-mediated endocytosis (referring to for example Wu and Wu (1987) J.Biol.Chem.262:4429-4432), and be the part of retrovirus or other carriers with nucleic acid construct.Introduction method can be in the intestines or parenteral approach, but comprises and being not limited to, in intracutaneous, intramuscular, intraperitoneal, intravenously, subcutaneous, the nose, epidural and oral route.Compound can be used by any approach easily, for example perfusion or bullet formula injection, by absorption, also can together use with other biologically active factors through epithelium or mucous layer (for example oral mucosa, mucous membrane of rectum and mucous membrane of small intestine etc.).Administration can be a whole body or partial.In addition, may need pharmaceutical composition of the present invention is introduced in the central nervous system by any suitable approach, comprise in the ventricle and intrathecal injection; Can help injection in the ventricle by the ventricle inner catheter that for example links to each other with a storage (as the Ommaya storage).Also can use pulmonary administration, the preparation that for example passes through to use sucker or spraying gun and have aerosolized reagent.

[0220] in a specific embodiment, may need pharmaceutical composition topical of the present invention, for example by the regional perfusion in operation, topical application is for example by injection, by means of conduit, by means of graft, described graft is the material of porous, non-porous or gelatin-like, comprises film such as sialastic film, perhaps fiber).In one embodiment, administration can be by being injected directly among the CSF or at tumor locus (for example, in the CNS tissue).

[0221] in another embodiment, can use carrier, particularly the liposome delivery compound is (referring to Langer (1990) Science 249:1527-1533; People such as Treat, Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp.353-365 (1989); Lopez-Berestein, the same, pp.317-327; Referring to general, the same)

[0222] in another embodiment, compound can be sent in controlled release system.In one embodiment, can use pump (, to see before referring to Langer; Sefton (1987) CRC Crit.Ref.Biomed.Eng.14:201; People such as Buchwald (1980) Surgery 88:507; People such as Saudek, 1989, N.Engl.J.Med.321:574).In another embodiment, can use polymer materials (referring to MedicalApplications of Controlled Release, Langer and Wise (eds.), CRCPres., Boca Raton, Florida (1974); Controlled DrugBioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983, Macromol.Sci.Rev.Macromol.Chem.23:61; Also referring to people such as Levy (1985) Science 228:190; People such as During (1989) Ann.Neurol.25:351; People such as Howard (1989) J.Neurosurg.71:105).In another embodiment, controlled release system can be placed near the treatment target (being target tissue or tumour), the dosage of Xu Yaoing is that the part of body dose is (referring to for example Goodson like this, MedicalApplications of Controlled Release, see before, vol.2, pp.115-138 (1984)).Other controlled release system has discussion in the summary (1990, Science 249:1527-1533) of Langer.

[0223] F. pharmaceutical composition

[0224] the present invention also provides pharmaceutical composition.This composition comprises acceptable carrier on the factor for the treatment of significant quantity and the medicine.In a special embodiment, term " acceptable on the medicine " meaning is by administration's approval of federation or state government or lists in American Pharmacopeia or other accepted pharmacopeia and be used for animal, is used for the mankind more especially.Term " carrier " refers to thinner, adjuvant, vehicle or the carrier of together using with medicine (Vehide).These pharmaceutical carriers can be aseptic liquid, and for example water or oil comprise oil, animal oil, vegetables oil or synthetic oil of originating, as peanut oil, soybean oil, mineral oil, sesame oil or the like.When pharmaceutical composition was used by intravenously, water was preferred carrier.Salts solution and aqueous glucose and glycerine solution also can be used as liquid vehicle, particularly for the solution of injection.

[0225] the appropriate drug vehicle comprises starch, glucose, lactose, sucrose, gelatin, Fructus Hordei Germinatus, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talcum powder, sodium-chlor, dried skimmed milk, glycerine, propylene, glycol, water, ethanol or the like.If necessary, composition can also contain a spot of wetting agent or emulsifying agent or pH buffer reagent.The form of these compositions can be solution, suspension, emulsion, tablet, pill, capsule, pulvis, sustained release preparation or the like.Composition can also be formulated as suppository, has traditional tackiness agent and carrier such as Witepsol W-S 55.Oral preparations can comprise the carrier of standard, for example the N.F,USP MANNITOL of pharmaceutically grade, lactose, starch, Magnesium Stearate, soluble saccharin, Mierocrystalline cellulose, magnesiumcarbonate or the like.The example of appropriate drug carrier is described in " Remington ' s PharmaceuticalSciences " of E.W.Martin to some extent, here quotes as a reference with its integral body.These compositions contain the composition of medicine effective quantity, preferably with the form of purifying, and the carrier of sufficient quantity, to be provided for form to the correct administration of study subject.Preparation should be suitable for the mode of administration.

[0226] in a preferred embodiment, composition is formulated as according to the step of routine and is suitable for carrying out intravenous pharmaceutical composition to the people.The composition that is generally used for intravenously administrable is the solution in the sterile isotonic aqueous buffer.When being necessary, composition can also comprise that solubilizing agent and local anesthetic such as lignocaine are to alleviate the pain of injection site.General, these compositions are separately supplied or are mixed with the unit dosage form supply, for example with the dry lyophilized powder of the airproof container (as ampoule or sachet (sachette)) that is sealed in lined out activity factor amount or there is not the form of aqueous concentrate.If when composition passes through the perfusion administration, can use the water or the brinish infusion bottle that contain aseptic pharmaceutically grade to make up a prescription.When if composition passes through drug administration by injection, can provide the Injectable sterile water or the salt solution of an ampoule, before administration so that composition can mix.

[0227] compound of the present invention can be mixed with the form of neutrality or salt.Acceptable salt comprises the salt that those are formed by the free amine group group on the medicine, for example hydrochloride, phosphoric acid salt, acetate, oxalate, tartrate or the like, and those salt that form by the free carboxy group, it is for example for being derived from sodium, potassium, ammonium, calcium, ironic hydroxide, Isopropylamine, triethylamine, the salt of 2-ethyl amido alcohol, Histidine, PROCAINE HCL, PHARMA GRADE or the like.

[0228] can be by determines amount based on the standard clinical techniques of this description for the effective The compounds of this invention of treatment hyperplasia disease (for example cancer).In addition, can also carry out external test alternatively, help to determine best dosage range.The exact dosage desired that uses in preparation also depends on the severity of route of administration and disease or illness, should determine according to doctor's the judgement and the situation of each study subject.But the suitable dosage range that is used for intravenous administration generally is the active compound of the about 20-500 microgram of every kg body weight.The suitable dosage range that is used for intranasal administration generally is about 0.01 pik-1 of every kg body weight milligram.The scope of the activeconstituents that suppository contains generally is 0.5 weight %-10 weight %; Oral preparations preferably contains the activeconstituents of 10%-95%.Can be according to from the extrapolated effective dosage of dose-response curve external or the animal model test macro.

[0229] nucleic acid

[0230] the invention provides the method that evaluation can increase with the endoribonuclease activity that realizes the mRNA interferases in conjunction with the factor of mRNA interferases (for example MazF or PemK).Therefore, the present invention includes administration of nucleic acid, this nucleic acid encoding mRNA interferases or its are directly to the peptide or the protein activator of homologue, and the antisense sequences or the catalytic RNA that can disturb mRNA interferases (for example MazE or PemI) or its directly to express to the endogenous inhibitor of homologue.

[0231] in one embodiment, the sequence encoding that the nucleic acid of being used comprises can be competed in conjunction with the peptide of mRNA interferases or protein.Available any proper method that is used for administration of nucleic acid sequence can be used according to the present invention in this area.

[0232] method of using with the express nucleic acid sequence generally is known in field of gene.For the generality summary of gene therapy method, referring to Goldspiel et al. (1993) Clinical Pharmacy 12:488-505; Wu and Wu (1991) Biotherapy 3:87-95; Tolstoshev (1993) Ann.Rev.Pharmacol.Toxicol.32:573-596; Mulligan (1993) Science 260:926-932; And Morgan andAnderson (1993) Ann.Rev.Biochem.62:191-217; May (1993) TIBTECH 11 (5): known usually in the 155-215. recombinant DNA technology field, can be used for method of the present invention at Ausubel et al. (eds.), 1993, CurrentProtocols in Molecular Biology, John Wiley ﹠amp; Sons, NY; And Kriegler (1990) Gene Transfer and Expression, A LaboratoryManual, Stockton Press, NY, in described.

[0233] a special aspects, the nucleic acid encoding that compound comprises can be in conjunction with the mRNA interferases realizing active peptide or the protein that increases of mRNA interferases endoribonuclease, and this nucleic acid is the part of expression of peptides or protein expression carrier in suitable host.Especially, this nucleic acid has the promotor that effectively is connected with coding region, and described promotor is derivable or composing type (and optionally, tissue-specific).In another special embodiment, used nucleic acid molecule, encoding sequence wherein and any other required sequence are promoted the zone of the required site generation homologous recombination in karyomit(e) to surround, and intrachromosomal expression (Koller and Smithies (1989) the Proc.Natl.Acad.Sci.USA 86:8932-8935 of nucleic acid is provided like this; Zijlstra et al. (1989) Nature 342:435-438).

[0234] can be directly with delivery of nucleic acids in the body of study subject, at this moment study subject and nucleic acid or the carrier that carries nucleic acid directly contact, this mode is called as vivo gene and treats.Selectively, delivery of nucleic acids is indirect in the body of study subject, at this moment at first at external use nucleic acid transformant, then cell is transplanted in the study subject body, and this is called as " gene therapy of exsomatizing ".

[0235] in another embodiment, nucleic acid is directly used in vivo, and it expresses the product that produces coding in vivo.This can be by any realization the in the several different methods known in the art, for example by being the part of suitable nucleic acid expression vector with nucleic acid construct and using it, nucleic acid just becomes intracellular like this, for example by using retrovirus defective or attenuation or other viral vector infections (referring to U.S. Patent number 4,980,286); By using exposed dna direct to infect; By using microparticle bombardment (particle gun for example; Biolistic, Dupont); By using lipid, cell surface receptor or transfection agents bag quilt; By using liposome, particulate or microcapsule parcel; By nucleic acid being connected known entering on the endonuclear peptide; Perhaps nucleic acid is connected with aglucon, this aglucon can experience receptor mediated endocytosis (referring to for example Wu and Wu, 1987, J.Biol.Chem.262:4429-4432), this can be used for the cell type of target specifically expressing this receptor.

[0236] in another embodiment, can form nucleic acid-aglucon mixture, aglucon wherein comprises the fusion viral peptide, to destroy endosome, makes nucleic acid avoid being degraded by lysosome.In another embodiment, can pass through special acceptor of target, make in vivo nucleic acid can reach the picked-up of cell-specific and expression (referring to for example PCT publication WO 92/06180,1992-4-16 (Wu et al.); WO92/22635,1992-12-23 (Wilson et al.); WO92/20316,1992-11-26 (Findeis et al.); WO93/14188,1993-7-22 (Clarke et al.), WO93/20221,1993-10-14 (Young)).Selectively, nucleic acid is introduced in the cell, be incorporated in the host cell DNA to be used for expressing (Koller and Smithies, 1989, Proc.Natl.Acad.Sci.USA86:8932-8935 by homologous recombination; Zijlstra et al. (1989) Nature 342:435-438).

[0237] in another embodiment, can use retroviral vector (referring to Miller et al. (1993) Meth.Enzymol.217:581-599).These retroviral vectors are modified, deleted the viral genome packing and be integrated into retroviral sequence unessential in the host cell DNA.The nucleic acid of the mRNA interferases that coding will use in gene therapy is cloned in the carrier, and this helps gene delivery in study subject.More details about retroviral vector can find in Boesen et al. (1994) Biotherapy 6:291-302, it described the use retroviral vector with the mdr1 gene delivery in hemopoietic stem cell, purpose is to make stem cell to chemotherapy resistibility be arranged more.Other reference of the purposes of explaination retroviral vector in gene therapy have Clowes et al. (1994) J.Clin.Invest.93:644-651; Kiem et al. (1994) Blood83:1467-1473; Salmons and Gunzberg (1993) Human Gene Therapy 4:129-141; And Grossman and Wilson (1993) Curr.Opin.in Geneticsand Devel.3:110-114.

[0238] can also in gene therapy, use adenovirus effectively.Adenovirus with gene delivery to being that attractive especially carrier is arranged aspect the airway epithelial.Adenovirus natural infection airway epithelial also causes slight disease.Other targets based on the delivery system of adenovirus have liver, central nervous system, epithelial cell and muscle.The advantage of adenovirus is to infect Unseparated Cell.Kozarsky and Wilson (1993) Current Opinion in Genetics andDevelopment 3:499-503 has summarized the gene therapy based on adenovirus.Bout et al. (1994) Human Gene Therapy 5:3-10 has proved that adenovirus carrier is for the purposes of transgenosis in the airway epithelial of rhesus monkey.In gene therapy, use other examples of adenovirus in following document, to find: Rosenfeld et al. (1991) Science 252:431-434; Rosenfeld et al. (1992) Cell 68:143-155; Mastrangeliet al. (1993) J.Clin.Invest.91:225-234; PCT publication WO94/12649; And Wang, et al. (1995) Gene Therapy 2:775-783.The someone advises adeno associated virus (AAV) is used for gene therapy (Walsh et al. (1993) Proc.Soc.Exp.Biol.Med.204:289-300; U.S. Patent number 5,436,146).

[0239] suitable way of another gene therapy comprises by transferring in the cell of tissue culture such as electroporation, fat transfection, the transfection of calcium phosphate mediation or the method for virus infection.Usually, the method for transfer comprises selective marker is transferred in the cell.Then cell is placed under the selective pressure, to separate those picked-ups and to have expressed the cell of the gene that shifts.Then those cell deliveries are delivered in the study subject.

[0240] in this embodiment, nucleic acid is incorporated in the cell, then the reconstitution cell that obtains is carried out using in the body.The introducing of this nucleic acid can be undertaken by any known method in the art, but comprise being not limited to that transfection, electroporation, microinjection, use contain the virus of nucleotide sequence or phage vector infection, cytogamy, the transgenosis of karyomit(e) mediation, the transgenosis of minicell mediation, spheroplast merges or the like.For foreign gene is introduced in the cell, many technology are arranged (referring to for example Loeffler and Behr (1993) Meth.Enzymol.217:599-618 known in the art; Cohen et al. (1993) Meth.Enzymol.217:618-644; Cline (1985) Pharmac.Ther.29:69-92), they can be used according to the invention, and condition is that essential growth of recipient cell and physiological function are not damaged.This technology should be transferred to nucleic acid stability in the cell, and nucleic acid can preferably, can be inherited by the offspring of this cell and express by cell expressing like this.

[0241] can the reconstitution cell that produce be delivered in the study subject by various different methods known in the art.In a preferred embodiment, for example by the subcutaneous injection epithelial cell.In another embodiment, the skin cells of will recombinating is applied on the study subject as skin graft; Reorganization hemocyte (for example hemopoietic stem cell or progenitor cell) is preferably used by intravenously.Estimate that the cell concentration that uses depends on situation of required effect, study subject or the like, and can determine by those skilled in the art.

[0242] can comprise the nucleic acid introducing any required with the cell that is used for gene therapy, obtainable cell type, but comprise and be not limited to neuronal cell, neurogliocyte (for example oligodendrocyte, astroglia cell), epithelial cell, endotheliocyte, keratinocyte, inoblast, muscle cell, liver cell; Hemocyte is T lymphocyte, bone-marrow-derived lymphocyte, monocyte, scavenger cell, neutrophilic granulocyte, eosinophile granulocyte, megalokaryocyte, granulocyte for example; Various stem cell or progenitor cell, particularly hemopoietic stem cell or progenitor cell, for example those that from marrow, Cord blood, peripheral blood or fetus liver, obtain.In a preferred embodiment, the cell that is used for gene therapy is the autogenous cell of the study subject of receiving treatment.

[0243] in another embodiment, the nucleic acid that will introduce to be used for gene therapy can comprise the inducible promoters that effectively is connected with coding region, makes expression of nucleic acids to control by adjusting the suitable concentration of transcribing inductor.

[0244] direct injection coding can or (for example can disturb the mRNA interferases in conjunction with the peptide or the protein DNA of mRNA interferases, MazE or PemI, or it is directly to homologue) the factor expressed of endogenous inhibitor, can be according to for example U.S. Patent number 5, the technology of describing in 589,466 is carried out.These technology comprise injection " exposed DNA ", promptly do not have the isolated DNA molecule of liposome, cell or any other material except suitable carrier.Injection coded protein and the DNA that effectively is connected with the promotor that suits produce this protein in the cell of contiguous injection site.

[0245] G. test kit

[0246] the present invention also provides pharmaceutical pack or test kit, and this pharmaceutical pack or test kit comprise one or more container, and one or more compositions of pharmaceutical composition of the present invention are housed in the container.This container is incidental alternatively can be the announcement of government organs' regulation of production, use or the sale of management medicine or biological products, show (a) mechanism's approval in the announcement through producing, use and selling, be used for human body and use, (b) operation instruction, or both.

[0247] following embodiment is proposed, for the personnel that have ordinary skill in this area provide about how preparing and use the complete disclosure and description of detection of the present invention, screening and methods of treatment, be not their scope of invention that will limit that the inventor thinks.Drop into strength and guaranteed the accuracy of used number (for example measuring temperature or the like), but should explain some reasons that experiment is wrong and deviation occurs.Unless other explanations are arranged, part be weight part, molecular weight is a molecular-weight average, and temperature is degree centigrade, and pressure is normal atmosphere or near normal atmosphere.

[0248] provides following experimental program, to help enforcement of the present invention.

Example I

[0249] as described herein, use O for toluene to make penetratingization of Bacillus coli cells, and these cells are used to prove MazF inhibition translation, but the synthetic or not inhibition of dna replication dna to RNA.And demonstrate, MazF between the A of ACA sequence and C residue not rely on the special cutting of ribosomal mode mRNA.Therefore, the present invention has proved that MazF is by disturbing the function of mRNA at specific site cutting mRNA.Therefore, inventor of the present invention finds that MazF is novel endoribonuclease, here with its called after " mRNA interferases ".

[0250] material and method

[0251] bacterial strain and plasmid.E. coli bl21 (DE3), BW25113 (Datsenko and Wanner have been used, Proc Natl Acad Sci USA 97,6640-5 (2000)) and MRE600 (Swaney et al., Antimicrob Agents Chemother 42,3251-5 (1998)).Make up plasmid pET-21cc-MazEF from plasmid pET-21cc (Novagen), it is modified to and expresses MazE and MazF (His) under the control of T7 promotor ₆But Shine-Dalgarno (SD) sequence is from the mazEF operon.Use pET-28a (Novagen) to make up plasmid pET-28a-MazE, to express (His) ₆MazE.Use pBAD (Guzman et al., J Bacteriol 177,4121-30 (1995)) to make up pBAD-MazF, after adding 0.2% pectinose, to regulate and control the expression of mazF scrupulously.

[0252] protein in the cell of O for toluene, DNA and RNA synthetic detect.50 milliliters of intestinal bacteria BW25113 cultures that contain plasmid pBAD-MazF in glycerine-M9 substratum in 37 degrees centigrade of growths.OD when culture ₆₀₀Reach at 0.6 o'clock, it is 0.2% that the adding pectinose makes final concentration.In 37 degrees centigrade hatch 10 minutes after, with 1% O for toluene cell (Halegoua et al., Eur J Biochem 69,163-7 (1976)).Used according to former description ³⁵The S-methionine(Met) carries out protein synthesis (Halegoua et al., JBacteriol 126,183-91 (1976)).The cell of O for toluene at room temperature uses 0.05M potassium phosphate buffer (pH 7.4) to wash once, be resuspended in then in the same damping fluid, with according to former description with [α- ³²P] dTTP checks synthetic (Moses and Richardson, ProcNatl Acad Sci USA 67, the 674-81 (1970)) of DNA.Detect for the RNA synthetic, the cell of O for toluene at room temperature uses 0.05M Tris-HCl damping fluid (pH 7.5) to wash once, be resuspended in then in the same damping fluid, with measured according to former description [α- ³²P] UTP mixing in RNA (Peterson et al., J Bacteriol 107,585-8 (1971)).

[0253] body internal protein synthetic detects.The intestinal bacteria BW25113 cell that contains pBAD-MazF is grown in glycerine-M9 substratum.OD when culture ₆₀₀Reach at 0.6 o'clock, be divided into two equal portions.Adding pectinose to final concentration in a copy of it is to add entry in 0.2%, the second part.With at the different time shown in Fig. 2 D at interval, the culture that takes out 1 milliliter is to containing 2 μ Ci ³⁵In the test tube of S-methionine(Met), mixture was hatched 1 minute at 37 degrees centigrade.50 microlitre reaction mixtures are put on the filter paper disk (Whatman 3mm, 2.3 cm diameters) then.According to former description (Hirashima and Inouye, Nature 242,405-7 (1973)) with 5%TCA solution-treated filter paper, and with liquid flashing counting device quantitative assay radioactivity.Remaining 500 microlitre reaction mixtures join in the refrigerative test tube that contains 25 microlitre 100%TCA solution and 100 mcg/ml on-radiation methionine(Met)s.Mixture was hatched on ice bath 60 minutes.Centrifugal back collecting precipitation is by hatching mixture in the SDS-PAGE sample-loading buffer that was dissolved in 50 microlitres in 30 minutes in boiling water bath.Remove after the insoluble material, supernatant liquor (10 microlitre) is analyzed by SDS-PAGE.

[0254] MazF (His) ₆(His) ₆The proteic purifying of MazE.The MazF (His) of purifying C-terminal mark from the bacterial strain BL21 (DE3) that carries pET-21cc-MazEF ₆At first use Ni-NTA resin purification MazF (His) ₆With the MazE mixture.With the 6M Guanidinium hydrochloride with MazE from MazF (His) ₆On disintegrate down after, purifying again on the Ni-NTA resin, and make protein refolding by progressively dialysing.From the bacterial strain BL21 (DE3) that carries pET-28a-MazE (His) of purifying N end mark ₆MazE.

[0255] MazF is for the influence of protein synthesis in protokaryon and the eucaryon cell free system.

[0256] using intestinal bacteria T7 S30 extract systems (Promega) to carry out the protokaryon cell-free protein synthesizes.Reaction mixture is by the aminoacid mixture (except that methionine(Met), every seed amino acid 1mM) of 10 microlitre S30 premixtures, 7.5 microlitre S30 extracts and 2.5 microlitres.1 microlitre ³⁵The MazF (His) of S-methionine(Met) and different amounts ₆(His) ₆MazE forms, and final volume is 24 microlitres.Reaction mixture was hatched 10 minutes at 37 degrees centigrade, began to detect (Zhang and Inouye, J Bacteriol 184,5323-9 (2002)) by adding 1 microlitre pET-11a-MazG plasmid-DNA (0.16 microgram/microlitre).Be reflected at 37 degrees centigrade and carried out 1 hour, use acetone precipitation albumen, and analyze by SDS-PAGE.Use is used for the PCR DNA rabbit reticulocyte lysate TNT  T7 Quick of system (Promega), and to carry out the eucaryon cell-free protein synthetic.The template of using coding people's albumen and the dna fragmentation under the control of T7 promotor to transcribe as mRNA.Be reflected at 37 degrees centigrade and carried out 1 hour, use acetone precipitation albumen, and analyze by SDS-PAGE.

[0257] polysome distribution plan.The overnight culture that contains the intestinal bacteria BW25113 of pBAD-MazF plasmid is diluted 50 times with fresh glycerine-M9 substratum.37 degrees centigrade hatch 5 hours after, adding pectinose to final concentration is 0.2%.Induce after MazF10 minute that to add paraxin to final concentration be 100 mcg/ml.The centrifugal collecting cell precipitation is resuspended in and contains 10mM MgCl ₂, 60mM NH ₄Among 1 milliliter of 10mM Tris-HCl (pH 7.8) of Cl, 1mM DTT and 1 mg/ml N,O-Diacetylmuramidase.Behind twice of the frozen-thawed, in Beckman TLA100.3 rotor with 24000rpm with centrifugal 20 minutes of lysate.Supernatant liquor (300 microlitre) joins in the 5-40% saccharose gradient to obtain the polysome distribution plan.Do not carry out similar experiment with pectinose.Pass through OD ₂₈₀Check rrna collection of illustrative plates (pattern), gradient from a left side (40%) to the right side (5%).It is 500 mcg/ml that indicated place adds kasugamycin to final concentration.

[0258] the ribosomal preparation of intestinal bacteria 70S.According to former description (Aoki etal., Antimicrob Agents Chemother 46,1080-5 (2002); Du and Babitzke, J Biol Chem 273,20494-503 (1998); Hesterkamp et al., JBiol Chem 272,21865-71 (1997)) preparation 70S rrna from intestinal bacteria MRE 600, a small amount of change is arranged.[10mM Tris-HCl (pH 7.4) contains 10mM MgCl to bacterial cell (2 gram) to be suspended in buffer A ₂, 60mM NH ₄Cl and 6mM 2 mercapto ethanol] in.Use the French press lysing cell.Hatch (0 degree centigrade 30 minutes) with the DNA enzyme of no RNA enzyme afterwards, in Beckman 50Ti rotor with 30000rpm in 4 degrees centigrade centrifugal 30 minutes twice to remove cell debris.Supernatant liquor (top 3/4) joins isopyknic buffer B and (contains 0.5M NH ₄The buffer A of Cl) in the 1.1M sucrose in, centrifugal 15 hours with 45000rpm in the Beckman50Ti rotor in 4 degrees centigrade.The rrna precipitation is resuspended in the buffer A with after the buffer A rinsing, and is applied in the linear saccharose gradient of 10-30% (weight/volume) of buffer A preparation, and is centrifugal 15 hours in 4 degrees centigrade with 20000rpm in Beckman SW40Ti rotor.Gradient is separated by level, mixes 70S rrna fraction, and in Beckman 50Ti rotor with 45000rpm in 4 degrees centigrade centrifugal 20 hours so that its precipitation.70S rrna precipitation is resuspended in the buffer A-80 degrees centigrade of storages.

[0259] primer extension suppresses (toeprinting) detection.(Moll and Blasi, Biochem Biophys Res Commun 297,1021-1026 (2002)) carried out toeprinting according to former description, and little adjustment is arranged.The mixture that is used for the primer template annealing contain mazG mRNA and ³²The end-labelled dna primer of P-, the 65-85 base complementrity of it and mazG mRNA.This mixture was hatched 5 minutes at 65 degrees centigrade, slowly cool to room temperature then.The rrna binding mixture contains 2 microlitres, 10 * damping fluid, and [100mM Tris-HCl (pH 7.8) contains 100mM MgCl ₂, 600mM NH ₄Cl and 10mM DTT], the MazF (His) of different amounts ₆, 0.375mMdNTP, 0.5 μ M 70S ribosomal subunit, 2.5 μ M tRNA ^FMetWith the annealing mixture of 2 microlitres, final volume is 20 microlitres.Final mRNA concentration is 0.05 μ M.The rrna binding mixture was hatched 10 minutes at 37 degrees centigrade, added the 2U reversed transcriptive enzyme then.Synthesizing in 37 degrees centigrade of cDNA carried out 15 minutes.Add 12 microlitres order-checking sample-loading buffer and come termination reaction.Sample was hatched 5 minutes at 90 degrees centigrade, carried out electrophoresis then on 6% polyacrylamide sequencing gel.Use T7 RNA polymerase external synthetic mazGmRNA from the 173-bp dna fragmentation that contains the T7 promotor.The dna fragmentation that is made of the mazG mRNA of T7 promotor and from+1 to+153 obtains as the pcr amplification of dna profiling by using the pET-11a-MazG plasmid.

[0260] toeprinting of the mazG mRNA after the phenol extracting.The method of experiment as described above is carried out, and unique difference is to have saved 70S rrna and tRNA ^FMetBefore primer extension, use phenol extractive reaction mixture to remove deproteinize.

[0261] structure of mutant plasmid.Use the pET-11a-MazG plasmid to carry out site-directed mutagenesis as dna profiling.By dna sequence analysis sudden change is proved conclusively.

[0262] RNA separates and the Northern engram analysis.The intestinal bacteria BW25113 that contains pBAD-MazF in glycerine-M9 substratum in 37 degrees centigrade of growths.OD ₆₀₀Value reaches at 0.8 o'clock, and adding pectinose to final concentration is 0.2%.Take a sample with the different interval shown in Fig. 4 D.According to former description (Sarmientos et al., Cell 32,1337-46 (1983)), use hot phenol method to separate total RNA.(Baker and Mackie, MolMicrobiol 47,75-88 (2003)) carried out the Northern engram analysis according to former description.

[0263] the concrete methodology details of relevant accompanying drawing

[0264] shown in Figure 1A, the toxic effect of expression pair cell of MazF.Use plasmid pBAD-MazF, pBAD-MazF R29S or pBAD-MazF R86G be transformed into escherichia coli BW25113 (Δ araBAD) cell respectively.Cell is coated on the glycerine-M9 flat board that contains and do not have pectinose (0.2%), and the flat board of having inoculated was hatched 24 hours at 37 degrees centigrade.Figure 1B shown intestinal bacteria (Escherichi coli) (NP_289336.1) MazF and salt tolerant genus bacillus (Bacillus halodurans) (NP_244588.1), staphylococcus epidermidis (Staphylococcus epidermidis) (AAG23809.1), streptococcus aureus (Staphylococcus aureus) (NP_372592.1), subtilis (Bacillussubtilis) (1NE8_A), Neisseria meningitidis (Neisseria meningitides) (NP_266040.1), morganella morganii strain (Morganella morgani) is (AAC82516.1) and the sequence alignment of mycobacterium tuberculosis (Mycobacterium tuberculosis) MazF (NP_217317.1).

[0265] Fig. 2 A shows that the expression of MazF is right ³⁵The influence that S-Met mixes in the cell of O for toluene.Particularly, the intestinal bacteria BW25113 that contains pBAD-MazF grows in glycerine-M9 substratum in 37 degrees centigrade.OD when culture ₆₀₀Reach at 0.6 o'clock, adding pectinose to final concentration is 0.2%.37 degrees centigrade hatch 10 minutes after, cell is with O for toluene (Halegoua et al., J Bacteriol 126,183-91 (1976)).According to former description (Halegoua et al., Eur J Biochem 69,163-7 (1976)), use the cell of O for toluene, use ³⁵The S-methionine(Met) carries out protein synthesis.Fig. 2 B shown MazF to [α- ³²P] the dTTP influence (Moses and Richardson, Proc Natl Acad Sci USA 67,674-81 (1970)) of in the cell of O for toluene, mixing.Fig. 2 C shown MazF to [α- ³²P] the UTP influence (Peterson et al., J Bacteriol 107,585-8 (1971)) of in the cell of O for toluene, mixing.Fig. 2 D has shown that MazF is right ³⁵The influence of mixing in the S-Met body.According to the different moment that indicated, after MazF induces, measure ³⁵S-Met mixing in the intestinal bacteria BW25113 cell that contains pBAD-MazF.Fig. 2 E shows that MazF induces back body internal protein synthetic SDS-PAGE to analyze.That uses among the culture that uses in Fig. 2 E and Fig. 2 D is identical.

[0266] Fig. 3 A has shown the influence of MazF to the polysome distribution plan.Pass through OD ₂₆₀Detect the rrna collection of illustrative plates, gradient from a left side (40%) to the right side (5%).70,50 and the ribosomal position of 30S indicated.Fig. 3 B has illustrated MazF (His) ₆To protokaryon cell-free protein synthetic influence, use be intestinal bacteria T7 S30 extract system (Promega).Swimming lane C does not have MazF (His) ₆Swimming lane 1-5: add 77,154,231,308 and the MazF (His) of 384nM respectively ₆Swimming lane 6-10:384nM MazF (His) ₆, (His) ₆MazE and MazF (His) ₆Ratio be respectively 0.1,0.2,0.4,0.8 and 1.2.Fig. 3 C shows MazF (His) ₆To eucaryon cell-free protein synthetic influence, use be the TNT  T7 Quick of rabbit reticulocyte lysate system (Promega) that is used for PCR DNA.Swimming lane 1 does not have (His) ₆MazE and MazF (His) ₆ Swimming lane 2,0.66 μ M MazF (His) ₆ Swimming lane 3,0.9 μ M (His) ₆MazE and 0.66 μ M MazF (His) ₆, (His) ₆MazE and MazF (His) ₆Ratio be 1.2: 1.

[0267] Fig. 4 A shows the toe line analysis of the mazG mRNA when MazF exists.MRNA uses the T7 RNA polymerase external synthetic from containing the 173-bp dna fragmentation of T7 promotor.Use the pET-11a-MazG plasmid DNA to obtain described dna fragmentation (T7 promotor and from+1 to+153 mazG mRNA) through pcr amplification.Swimming lane 1 does not have MazF (His) ₆With the 70S rrna; Swimming lane 2 has 2.6 μ M MazF (His) ₆, do not have the 70S rrna; Swimming lane 3 has 0.5 μ M 70S rrna, does not have MazF (His) ₆Swimming lane 4-8,0.5 μ M 70S rrna and the MazF (His) that contains 0.35 μ M, 0.7 μ M, 1.4 μ M, 2.1 μ M and 2.6 μ M respectively ₆Fig. 4 B has shown the toe line analysis of the mazG mRNA after the phenol extracting.The method of describing in the swimming lane 1 of experimental technique and Fig. 4 A and the swimming lane 2 is identical, and difference is that reaction product uses the phenol extracting, so that removed protein before primer extension.Swimming lane 1 does not have MazF (His) ₆Swimming lane 2 has 2.6 μ M MazF (His) ₆Fig. 4 C has shown the influence that MazE cuts the MazF to mazG mRNA.Swimming lane 1 does not have MazF (His) ₆(His) ₆MazE; Swimming lane 2 has 8.8 μ M (His) ₆MazE; Swimming lane 3 has 2.2 μ M MazF (His) ₆Swimming lane 4-7 has 2.2 μ M MazF (His) ₆, (His) ₆MazE and MazF (His) ₆Ratio be respectively 0.25,0.4,0.8 and 1.0.Fig. 4 D shows the MazF influence of pair cell mRNA in vivo.After adding pectinose different constantly (as indicate) from the intestinal bacteria BW25113 cell that contains pBAD-MazF, extract total cell RNA, and carry out the Northern engram analysis, use radiolabeled ompA and lpp ORF DNA as probe.

[0268] Fig. 5 has shown the influence of kasugamycin to the polysome distribution plan.Experimentize according to above description.Pass through OD ₂₆₀Detect the rrna collection of illustrative plates, gradient from a left side (40%) to the right side (5%).70,50 and the ribosomal position of 30S indicated.

[0269] Fig. 6 shows the inhibition of rrna to the MazF cutting of mazG mRNA.Reaction is carried out according to above description.Swimming lane 1 does not have MazF (His) ₆With the 70S rrna; Swimming lane 2 has 2.6 μ M MazF (His) ₆, but there is not the 70S rrna; Swimming lane 3 has 0.5 μ M 70S rrna, but does not have MazF (His) ₆Swimming lane 4, mazG mRNA and 70S rrna were hatched 10 minutes at 37 degrees centigrade, added 2.2 μ MMazF (His) then in this mixture ₆, and hatched again 10 minutes at 37 degrees centigrade, carry out primer extension afterwards; Swimming lane 5 at first mixes 70S rrna and MazF (His) ₆, and hatched 10 minutes at 37 degrees centigrade, add mazG mRNA afterwards, continue to hatch 10 minutes at 37 degrees centigrade, carry out primer extension afterwards; Swimming lane 6, mazG mRNA and MazF (His) ₆Mix be incorporated in 37 degrees centigrade hatch 10 minutes after, in mixture, add the 70S rrna, continue to hatch 10 minutes at 37 degrees centigrade, carry out primer extension afterwards.FL, the mazG mRNA of total length; TP (s) is because the position that secondary structure is suspended; TP (F) is because the toe line position of MazF cutting; TP (r) is because the toe line position that rrna and combining of mazG mRNA are caused.

[0270] GGAG takes place to the sudden change of the UUUG influence to the MazF function in Fig. 7 Shine-Dalgarno sequence of having illustrated mazG mRNA.Reaction is carried out according to top description.Swimming lane 1-4, wild-type mazG mRNA; Swimming lane 5-8, the sudden change of GGAG to UUUG takes place in the Shine-Dalgarno sequence in mutant mazG mRNA.Swimming lane 1 and 5 does not have MazF (His) ₆With the 70S rrna; Swimming lane 2 and 6,2.6 μ M MazF (His) ₆, but there is not the 70S rrna; Swimming lane 3 and 7,0.5 μ M 70S rrna do not have MazF (His) ₆ Swimming lane 4 and 8,0.5 μ M 70S rrna and 2.2 μ M MazF (His) ₆The note of mark is in the left side, same Fig. 6.

[0271] Fig. 8 shows the influence of the sudden change of mazG mRNA initiator codon to the MazF function.Reaction is carried out according to above description.Swimming lane 1-4, wild-type mazG mRNA; Swimming lane 5-8, mutant mazG mRNA, its initiator codon becomes GUG; Swimming lane 9-12, mutant mazG mRNA, its initiator codon becomes AGG.Swimming lane 1,5 and 9 does not have MazF (His) ₆With the 70S rrna; Swimming lane 2,6 and 10,2.6 μ M MazF (His) ₆, but there is not the 70S rrna; Swimming lane 3,7 and 11,0.5 μ M 70S rrna, but MazF (His) do not had ₆ Swimming lane 4,8 and 12:0.5 μ M 70S rrna and 2.2 μ M MazF (His) ₆The note of mark is in the left side, same Fig. 6.

[0272] Fig. 9 shows UACAU (U ₁A ₂C ₃A ₄U ₅) sudden change of cutting sequence is to the influence of MazF function.Reaction mixture carries out according to above description.Swimming lane 1 and 2 uses wild-type mazGmRNA in contrast.All sudden changes are indicated by arrow.Swimming lane 1,3,5,7,9,11,13,15,17,19,21,23,25,27,29 and 31, there is not MazF (His) ₆ Swimming lane 2,4,6,8,10,12,14,16,18,20,22,24,26,28,30 and 32, the MazF (His) of 2.6 μ M is arranged ₆The note of mark is in the left side, same Fig. 6.

[0273] Figure 10 shows MazF and the MazE influence to the cutting of 16S and 23S rRNA.Be reflected in the following system and carry out: 10mM Tris-HCl (pH 7.8), contain 10mMMgCl ₂, 60mM NH ₄Cl, 1mM DTT, 0.5 microlitre people placenta RNA enzyme inhibitors (Roche), 5.6 μ M MazF (His) ₆And/or 17.6 μ M (His) ₆MazE, cumulative volume are 10 microlitres.37 degrees centigrade hatch 10 minutes after, add 2 microlitre sample-loading buffers with termination reaction.Sample is analyzed on 3.5% acrylamide gel.Swimming lane 1 does not have MazF (His) ₆ Swimming lane 2 has 5.2 μ M MazF (His) ₆ Swimming lane 3 has 17.6 μ M (His) ₆MazE; Swimming lane 4 has 5.2 μ M MazF (His) ₆With 17.6 μ M (His) ₆The position of MazE.23S and 16S rRNA and tRNA is represented with arrow.

[0274] result

[0275] the mazF gene is cloned into and can be used in the pectinose inductive pBAD plasmid (Guzman et al., J Bacteriol 177,4121-30 (1995)).The intestinal bacteria BW25113 that carries pBAD-MazF under the condition that pectinose (0.2%) exists, on glycerine-M9 flat board, do not grow (referring to Figure 1A).After the conservative residue A rg29 of MazF homologue camber or Arg86 are replaced with Ser or Gly respectively (Figure 1B), the susceptibility of pectinose has been eliminated (Figure 1A).The result shows that the inhibition of observed cell growth is because the viability of wild-type MazF becomes.In the liquid medium within, add pectinose after 5 minutes, the viability of cell has reduced by 10 ⁴

[0276] cell function in order to determine to be suppressed by MazF, used cell free system by the intestinal bacteria BW25113 preparation of carrying pBAD-MazF, bacterium is through O for toluene and by penetratingization (Halegoua et al., J Bacteriol 126,183-91 (1976); Halegoua et al., Eur J Biochem 69,163-7 (1976).When before O for toluene, preincubate is in the time of 10 minutes under the condition that pectinose exists for cell, and ATP relies on ³⁵The S_ methionine(Met) mixes and is suppressed (Fig. 2 A) fully.But under similar condition, [α- ³²P] dTTP (Moses and Richardson, Proc Natl Acad Sci USA 67,674-81 (1970)) (Fig. 2 B) and [α- ³²P] mixing but of (Fig. 2 C) of UTP (Peterson et al., J Bacteriol 107,585-8 (1971)) be not affected.These results show that MazF has suppressed protein synthesis, and it is synthetic still not suppress dna replication dna or RNA.Use and do not pass through the cell of O for toluene, after the adding pectinose, ³⁵Mix in the body of S-methionine(Met) (Hirashima and Inouye, Nature 242, and 405-7 (1973) is suppressed (Fig. 2 D) significantly.The synthetic SDS-PAGE analysis of being carried out (Fig. 2 E) shows that MazF is a general inhibitor of protein synthesis to difference to total cell protein constantly after adding pectinose, and it influences all cell proteins basically.What is interesting is that the smaller albumen of bigger albumen is more vulnerable to the murder by poisoning of MazF.

[0277] after pectinose is induced 10 minutes, use sucrose density gradient that the intestinal bacteria BW25113 cell that carries pBAD-MazF is carried out the analysis of polysome collection of illustrative plates.As shown in Figure 3A, in this cell, the polysome completely dissolve, 70S rrna fraction raises simultaneously, and 30S or 50S rrna fraction significantly do not change.When using kasugamycin to handle cell, similar change (Fig. 5) has appearred in the polysome collection of illustrative plates, and kasugamycin is the microbiotic that suppresses translation initiation.These find that prompting MazF is by suppressing translation initiation or causing rrna to discharge from mRNA by degraded mRNA.

[0278] also in the acellular RNA/ protein synthesis system of intestinal bacteria, checked the MazF (His) of purifying ₆Candidate albumen matter MazG synthetic is influenced.From co expression MazE and MazF (His) ₆Cell in be purified into MazF (His) ₆Use intestinal bacteria T7 S30 extract systems (Promega) from synthetic MazG (30kD) (the Hirashimaand Inouye of plasmid pET-11a-MazG, Nature 242,405-7 (1973)), synthesizes and under 37 degrees centigrade, carried out 1 hour, and do not having MazF (His) ₆The MazF (His) that exists or have concentration progressively to raise ₆Under the situation about existing (Fig. 3 B).MazF (His) ₆Concentration is when 231nM is above, and the synthetic quilt of MazG suppresses fully.Studied the MazE toxinicide simultaneously to this observed effect to the inhibition of MazG synthetic by the MazF mediation.What is interesting is, add toxinicide (His) simultaneously ₆MazE has saved in dose-dependent mode MazG synthetic (Fig. 3 B).MazF (His) ₆Can also suppress eucaryon cell-free protein synthesis system (Fig. 3 C, swimming lane 2), proteinic synthetic add at the same time (His) ₆(swimming lane 3) also is restored during MazE.

[0279], the time of suppressing to take place is analyzed because MazF has suppressed MazG synthetic (Fig. 3 B).In order to determine whether inhibition has influenced the translation initiation step, has adopted toe line (TP) technology, it uses 70S rrna and MazG mRNA (Moll and Blasi, BiochemBiophys Res Commun 297,1021-1026 (2002)).Only mazG mRNA is carried out that the analysis of toe line has produced the band (FL) of total length and may be the band TP (s) (Fig. 4 A, swimming lane 1) that the secondary structure owing to 5 of mazG mRNA ' end forms.In the presence of the 70S rrna, detected the toe line band [TP (r)] (swimming lane 3) in initiator codon downstream.As MazF (His) ₆Together add fashionablely with the 70S rrna, a new band TP (F) occurred, its correspondence be zone (swimming lane 4-8) between Shine-Dalgarno (SD) sequence and the initiator codon.Along with MazF (His) ₆The rising of concentration, the intensity of TP (r) band reduces gradually, at MazF (His) ₆When concentration is 3.75 μ M, TP (r) band almost completely disappeared (swimming lane 7).

[0280] surprisingly, even when not having the 70S rrna, also detected TP (F) band (swimming lane 2), this shows that MazF can not rely on the 70S rrna and combines with mRNA, and perhaps MazF is the endoribonuclease (Fig. 4 A) that cuts between A and C residue.

[0281] in order to distinguish these possibilities, the MazF (His) of mazG mRNA and process phenol extrct deproteinize ₆Hatch jointly, be used for the primer extension shown in Fig. 4 B.Even after the phenol extracting, can also observe TP (F) band (swimming lane 2), show MazF (His) ₆Really cut mazG mRNA.When MazE adds fashionablely jointly, the cutting of mazG mRNA is by blocking-up (Fig. 4 C, swimming lane 4-7) once more.Note (His) ₆MazE does not have detectedly to act on (swimming lane 2) for mRNA individually.This result shows that the toxin immunity effect of MazE is because to the active inhibition of MazF endoribonuclease.At MazF (His) ₆Add the 70S rrna before, suppressed MazF (His) ₆To the cutting of mRNA, be likely since among the mazG mRNA SD sequence and ACA sequence location near (Fig. 6).On the contrary, the toxic action of RelE needs rrna (Pedersen et al. sees before, (2003)).

[0282] Table I has shown the MazF cutting sequence in the different mRNA transcripts of checking.Conservative cutting sequence has added underscore.

The gene title	Sequence
																		? yeeW ? ? ? EnvZ ? lacZ ?	? A ? G ? A ? T ?	? A ? T ? T ? C ?	? ?T ? ?C ? ?C ? ?G ?	? ?G ? ?G ? ?T ? ?T ?	? ?A ? ?T ? ?C ? ?T ?	? ?T ? ?T ? ?G ? ?T ?	? ?G ? ?G ? ?A ? ?T ?	? A? A? A? A?	? C? C? C? C	? A? A? A? A?	? ?C ? ?T ? ?C ? ?C	? ?T ? ?T ? ?G ? ?C	? ?G ? ?G ? ?C ? ?C	? ?G ? ?A ? ?A ? ?T ?	? ?A ? ?T ? ?G ? ?T	? ?A ? ?G ? ?C ? ?G ?	? ?G ? ?G ? ?C ? ?A

[0283] (YeeW first row: SEQ ID NO:84; YeeW second row: SEQ ID NO:90; EnvZ:SEQ ID NO:91; LacZ:SEQ ID NO:92) in order to measure the specificity of MazF cutting, with the SD sequence of mazG-mRNA from GGAG sports UUUG, AUG sports with initiator codon GUG or A GG.None influences MazF (His) in these sudden changes ₆Cutting (Fig. 7 and Fig. 8) to mazG mRNA.Work as yeeW, when the mRNA of envZ and lacZ was used as substrate, each all was cut at the ACA sequence place of mRNA transcript of expection, and with SD sequence and initiator codon irrelevant (Table I).In these mRNA, 5 of ACA sequence ' end is G, A or T, and 3 ' end is C or T.Consider that these find that the mazG mRNA that the cleavage site place is had the UACAU sequence suddenlys change, make 5 ' and the U residue of 3 ' end sport G, A or C.None influence cutting (Fig. 9) in these sudden changes.But, when the ACA of central authorities sequence be changed into GCA, CCA, TCA; A GA, A TA, A AA; AC C, AC GOr AC TThe time, do not observe cutting (Fig. 9), show that MazF is highly sequence-specific, as to discern an ACA sequence endoribonuclease.

[0284] in a word, above result shows that MazF works as highly sequence-specific endoribonuclease, and it is at ACA site incising cell mRNA, thereby has blocked in the cell synthetic (Fig. 2 E) of all protein.For further this discovery of test, use total cell RNA of inducing MazF different time afterwards to extract at interval to carry out Northern engram analysis (Baker and Mackie, Mol Microbiol 47,75-88 (2003) with pectinose; Sarmientos et al., Cell 32,1337-46 (1983)).OmpA and lpp mRNA all be degraded (Fig. 4 C).The sum of the ACA sequence that exists among the difference of the half life of observed these two mRNA and the mRNA and the length of mRNA are relevant.For example the lpp mRNA of 322bp (Nakamura and Inouye, Cell 18,1109-17 (1979)) has only an ACA sequence, and the ompA mRNA of 1229bp (Movva et al., J Mol Biol 143,317-28 (1980)) has 21 ACA sequences.The mRNA that the long mRNA of this dependency prompting relatively lacks is more responsive to the cutting of MazF mediation.

[0285] what is interesting is, in mazF ORF, always have 9 ACA sequences, 4 bunches of central authorities that combine in ORF wherein, the expression of this prompting mazF may be by the gene product negative ground of himself from regulation and control.It should be noted that MazF (His) ₆16S and 23S rRNA can be cut into less fragment, and at (His) ₆(Figure 10) can not take place in this cutting when MazE existed.

[0286] conclusion is, MazF is a novel endoribonuclease, and it suppresses the function of mRNA specifically by cutting unique triplet sequence A CA.Because it disturbs the ability of mRNA function, this class endoribonuclease is named as " mRNA interferases " here.As what result given here emphasized, other have different sequence-specific mRNA interferases and also might exist.

[0287] except newfound this class endoribonuclease, known also have some other mechanism that the function of mRNA is had interference.One in these mechanism has related to micRNA (mRNA interference complementary RNA), and it was used as the RNA repressor (Mizuno et al, Proc Natl Acad Sci USA 81,1966-70 (1984)) that specific gene is expressed in the intestinal bacteria originally.More recent for some time has had been found that similar RNA element in eukaryote, (Zeng and Cullen, RNA 9,112-23 (2003) and siRNA (Billy etal., Proc Natl Acad Sci USA 98,14428-33 (2001)) to be called miRNA.The possibility that has the interest that induces one, promptly this new mechanism by mRNA interferases destruction mRNA function (as in this research for intestinal bacteria confirmed) also may be relevant with eukaryote.This will have many meanings for the stechiology of many (if not whole) organism alive.And highly sequence-specific mRNA interferases can be used as treatment tool, is used for the treatment of human diseases, and the structural research of carrying out RNA as biochemical instrument.Attractively be 2: the crystalline structure of 4MazE/MazF mixture has been delivered (Kamada et al., Mol Cell11,875-884 (2003)) recently.The information that stores in the crystalline structure may help to determine how MazF discerns the ACA sequence specifically and cut it.

Example II

[0288] importantly, before discovery of the present invention, the cell target of MazF is not also identified.Just as shown here, MazF works as highly sequence-specific endoribonuclease, and it is at ACA site incising cell mRNA.This activity may realize the some or all of inhibition to protein synthesis in cell.Possibility according to each position of three nucleotide positions in any ACA of the being incorporated into sequence in four kinds of Nucleotide is that identical principle is carried out the calculating of standard, based on the calculating of this standard, the predict frequency that the ACA sequence appears in the rna transcription thing is 1/64.Should be appreciated that with predict frequency and compare, comprise the ACA sequence of lower or upper frequency in some rna transcription things.Therefore, ACA sequence or the frequency of MazF target sequence in transcript are depended on for the susceptibility of being cut by the MazF endoribonuclease in specific rna transcription thing or relevant rna transcription thing family.And the personnel that have ordinary skill in this area can be according to the sequence prediction transcript of the rna transcription thing susceptibility for the cutting of MazF mediation.

EXAMPLE III

[0289] as described above, in intestinal bacteria, apoptosis is considered to mediate by " habit-forming assembly " system, and each of described component system is by the genomic constitution of a pair of co expression, and this is to genes encoding stable toxin and unsettled toxinicide.Their expression is by toxin/toxinicide mixture or only by the toxinicide auto-control.When coexpression was suppressed, toxinicide was degraded rapidly by proteolytic enzyme, made detoxifying function in its target.In intestinal bacteria, extra-chromosomal element is the main genetic system of bacterium apoptosis.Study the habit-forming assembly of maximum karyomit(e) outward and be phd-doc (Lehnherr et al. (1993) J Mol Biol 233,414-428 on the phage P1; Lehnherr and Yarmolinsky (1995) Proc Natl Acad Sci USA 92,3274-3277; Magnuson and Yarmolinsky (1998) J Bacteriol 180,6342-6351; Gazit and Sauer (1999) J BiolChem 274,16813-16818; Gazit and Sauer (1999) J Biol Chem274,2652-2657), the ccdA-ccdB on the F-factor (Tam and Kline (1989) JBacteriol 171,2353-2360; Van Melderen et al. (1994) MolMicrobiol 11,1151-1157; Bahassi et al. (1999) J Biol Chem274,10936-10944; Loris et al. (1999) J Mol Biol 285,1667-1677; Afif et al. (2001) Mol Microbiol 41,73-82; Dao-Thi et al. (2002) J Biol Chem 277,3733-3742; Van Melderen (2002) Int J MedMicrobiol 291,537-544), and the pemI-pemK on the plasmid R100 (Tsuchimotoet al. (1988) J Bacteriol 170,1461-1466; Tsuchimoto and Ohtsubo. (1989) Mol Gen Genet 215,463-468; Tsuchimoto et al. (1992) JBacteriol 174,4205-4211; Tsuchimoto and Ohtsubo. (1993) MolGen Genet 237,81-88).What is interesting is that escherichia coli chromosome also contains several habit-forming component systems, for example relBE system and mazEF system, they are described here to some extent.

[0290] the mazEF system is made up of two adjacent gene mazE and mazF, is positioned at the downstream of relA gene on the escherichia coli chromosome.Sequential analysis show they be positioned at pemI on the plasmid pR100 and pemK Gene Partial homology (Masuda et al. (1993) JBacteriol 175,6850-6856).As top description, the mazEF system shows the character of habit-forming assembly: MazF has toxicity and MazE has toxin immunity; MazF is stable and MazE is the labile protein matter (Aizenman et al. (1996) sees before) of the ClpA serine stretch protein enzyme liberating that relied on by ATP in vivo; MazE and MazF co expression, interacting forms a mixture; The expression of mazEF by MazE and MazE-MazF mixture negative ground from regulation and control (Marianovsky et al. (2001) J Biol Chem 276,5975-5984).As described above here, the necrocytosis of mazEF mediation can be caused (Sat et al. (2003) sees before) by extreme amino acid starvation and thymus pyrimidine hunger, caused (Hazan et al. (2001) J Bacteriol 183 by toxic protein Doc, 2046-2050), and caused by some microbiotic, these microbiotic are general inhibitor of transcribing and/or translating, for example Rifampin, paraxin and spectinomycin (Sat et al. (2001) sees before).

[0291] as described below, the interaction between MazE, MazF and the mazEF promoter DNA is studied, found to be responsible among the MazE in conjunction with mazEF promoter DNA and responsible and the interactional functional structure of MazF territory.Proof, MazE has a DNA binding domains at its N end, and the zone of from 38 to 75 among the MazE is for needing in conjunction with MazF, and wherein Leu55 and Leu58 residue are essential.Data given here also point out the MazE-MazF mixture in the solution can comprise a MazE dimer and two MazF dimers.

[0292] material and method

[0293] reagent and enzyme---Nucleotide, penbritin and kantlex are from Sigma.Restriction enzyme that is used to clone and dna modification enzyme are from New EnglandBiolabs.The Pfu archaeal dna polymerase is from Stratagene.Radioactive Nucleotide is from Amersham Pharmacia Biotech.

[0294] structure of plasmid---use bacillus coli gene group DNA as template, go out mazEF gene (comprising its Shine-Dalgarno sequence area), it is cloned in the XbaI-NheI site of pET11a, produce plasmid pET11a-EF by pcr amplification.Go out mazEF gene (comprising its Shine-Dalgarno sequence area) by pcr amplification, it is cloned in the XbaI-XhoI site of pET21cc, form, one (His) arranged at the C of MazF end according to the translation of reading frame ₆Label.This plasmid called after pET21cc-EF (His) ₆Go out the mazE gene by pcr amplification, it is cloned in the NdeI-Hind III site of pET28a.This plasmid called after pET28a-(His) ₆E.MazE is as an expressing fusion protein, and the N end has one (His) ₆Label (called after (His) ₆MazE), a zymoplasm cleavage site is arranged afterwards.Produce mazE gene and the various mazE gene N end and C end disappearance construct (referring to Figure 17) of total length by PCR, and be cloned in the EcoRI-PstI site of pGAD-C1 carrier, form according to the translation of reading frame with the Gal4 transcriptional activation domain and merge.These plasmids are named as pGAD-MazE, pGAD-MazE Δ (1-13), pGAD-MazE Δ (1-24), pGAD-MazE Δ (1-37), pGAD-MazE Δ (1-46), pGAD-MazE Δ (68-82) and pGAD-MazE Δ (76-82).

[0295] produces total length mazF gene and various mazF gene N end and C end disappearance construct by PCR, and be cloned in the EcoRI-BglII site of pGBD-C1 carrier, form according to the translation of reading frame with the Gal4DNA binding domains and merge.These plasmids are named as pGBD-MazF, pGBD-MazF Δ (1-14), pGBD-MazF Δ (1-25), pGBD-MazF Δ (72-111) and pGBD-MazF Δ (97-111).

[0296] protein purification---pET11a-EF is incorporated in e. coli bl21 (DE3) bacterial strain.Use 1mM isopropyl-(IPTG) to induce the coexpression 4 hours of MazE and MazF.Centrifugal collecting cell also uses the French press cracking.Cell lysate is preserved 30 minutes with the MazE that farthest degrades at 37 degrees centigrade, and centrifugal 10 minutes of 8000g is with sedimentation cell fragment and uncracked cell, and 10000g ultracentrifugation 1 hour is to remove film and insoluble fraction afterwards.Next come purifying MazF by gel-filtration, DEAE-Sepharose and hydroxyapatite column chromatography on ammonium sulfate classification, the Sephadex G-100 post.Mix and concentrate and contain the proteic fraction of MazF.By using Superdux ^TMThe gel-filtration of 200 posts (Pharmacia Biotech) is further purified MazF.

[0297] for (His) ₆The purifying of MazE is with pET28a-(His) ₆E is incorporated in e. coli bl21 (DE3) bacterial strain, and uses 1mM IPTG to induce (His) ₆MazE expressed 4 hours.Use Ni-NTA (QIAGEN) affinitive layer purification (His) immediately ₆MazE albumen.

[0298] also with pET21cc-EF (His) ₆Be incorporated in e. coli bl21 (DE3) bacterial strain.Use 1mM IPTG to induce MazE and MazF (His) ₆ Coexpression 4 hours.MazE-MazF (His) ₆Mixture is used Ni-NTA (QIAGEN) affinitive layer purification immediately, and further uses the gel-filtration purifying.For MazE-MazF (His) from purifying ₆Purifying MazF (His) in the mixture ₆, in the 6M Guanidinium hydrochloride with the MazE-MazF (His) of purifying ₆MazE in the mixture and MazF (His) ₆Dissociate.Again catch MazF (His) by Ni-NTA resin (QIAGEN) ₆, and by substep dialysis carrying out refolding.The productive rate of refolding approximately is 80%.Use intestinal bacteria T7 S30 extract systems (Promega)), suppress with regard to protein synthesis, measure MazF (His) ₆Biochemical activity.

[0299] electrophoretic mobility shift assay (EMSA)---the oligonucleotide of synthetic two strands, 5 '-GCTCGTATCTACAATGTAGATTGATATATACTGTATCTACATATGA TAGC-3 ' (SEQ ID NO:12) and 3 '-CGAGCATAGATGTTACATCTAACTATATATGACATAGATGTATACTATCG-5 ' (SEQ ID NO:13), its annealing is produced the 50-bp double-stranded DNA that contains the mazEF promoter sequence.This 50-bpDNA fragment through the T4 polynucleotide kinase with [γ- ³²P] ATP carries out end mark, is used for detecting combining of protein and DNA at EMSA.Association reaction carried out 30 minutes at 4 degrees centigrade, and reaction system 20 microlitres contain the protein of purifying, and the poly (dI-dC) of 2 microlitres, 100 mcg/ml and the dna fragmentation of 2 microlitre marks, binding buffer liquid are 50mM Tris-HCl (pH 7.5), 5mM MgCl ₂, 1mM dithiothreitol (DTT) and 5% glycerine.In the TAE damping fluid,, in 6% non-denaturing polyacrylamide gel, carry out electrophoresis in 100V.Behind the electrophoresis, desiccant gel exposes to the X-ray sheet.

[0300] non-sex change PAGE---at binding buffer liquid [50mM Tris-HCl (pH 7.5), 5mM MgCl ₂, 1mM DTT and 5% glycerine] in, in 4 degrees centigrade of (His) that mix different amounts ₆MazE and MazF30 minute, add 2 * last sample solution [40mM Tris-HCl (pH7.5), 80mM beta-mercaptoethanol, 0.08% tetrabromophenol sulfonphthalein and 8% glycerine] then and to mixture, be splined on then on the non-sex change glue.The composition that concentrates glue is 5% acrylamide-bisacrylamide (acrylamide-bis) (29: 1), in 62.5mM Tris-HCl (pH 7.5); The composition of separation gel is 10% acrylamide-bisacrylamide (29: 1), in 187.5mMTris-HCl (pH8.9).The damping fluid that loses shape contains 82.6mM Tris-HCl (pH 9.4) and 33mM glycine.Under constant voltage (150V), carry out electrophoresis in 4 degrees centigrade.Manifest protein band by Xylene Brilliant Cyanine G.

[0301] differentiate low-molecular-weight albumen by tricine SDS-PAGE---according to method (Schagger and the von Jagow of former description, G. (1987) Anal Biochem166,368-379) carry out tricine SDS-PAGE, slightly change as follows: concentrate glue, 5% acrylamide-bisacrylamide (48: 1.5), in 0.75M Tris-HCl (pH 8.45), and 0.075%SDS; Spacer gel, 10% acrylamide-bisacrylamide (48: 1.5), in 1.0M Tris-HCl (pH 8.45), and 0.1%SDS; Separation gel, 16.5% acrylamide-bisacrylamide (48: 1.5), in 1.0M Tris-HCl (pH 8.45), and 0.1%SDS.The anode damping fluid that loses shape is 0.2M Tris-HCl (pH 8.9), and the negative electrode damping fluid that loses shape is 0.1M Tris alkali, 0.1M tricine and 0.1%SDS.Under constant current (20 milliamperes), behind the room temperature electrophoresis, present protein band by Xylene Brilliant Cyanine G.

[0302] detecting MazE-MazF in yeast two-hybrid system interacts---use yeast two-hybrid reporting bacterial strain PJ69-4A[MATa trp1-901 leu2-3,112 ura3-52his3-200 gal4 gal80LYS2::GAL1-HIS3 GAL2-ADE2 met::GAL7-lacZ] and carrier pGAD-C1 and pGBD-C1, be used for the double cross analysis (James et al. (1996) Genetics 144,1425-1436).For location MazF calmodulin binding domain CaM in MazE, in pGAD-C1, made up the mazE gene that a series of N end and C end lack, and with pGBD-MazF plasmid cotransformation in the PJ69-4A cell.Referring to Figure 17.For location MazE calmodulin binding domain CaM in MazF, in pGBD-C1, made up the mazF gene that a series of N end and C end lack, and with pGAD-MazE plasmid cotransformation in the PJ69-4A cell.Carry out interactional detection by the growing state of monitoring corotation beggar on synthetic dropout (SD) minimum medium (Clontech) (not having Trp, Leu, His and VITAMIN B4 (Ade)).Add 1mM 3-amino-1,2 in this substratum, 4-triazole (3-AT), and hatched 5 days in 30 degrees centigrade.

0303] the concrete methodology details of relevant accompanying drawing

[0304] in Figure 11, the last sample of swimming lane is as follows: swimming lane 1, protein molecular weight standard; Swimming lane 2, MazE-MazF (His) ₆Mixture; Swimming lane 3, MazF; Swimming lane 4, (His) ₆MazE.

[0305] in Figure 12 A and 12B, (His) ₆MazE and MazF according to shown in mixed in molar ratio.Mixture was hatched 30 minutes at 4 degrees centigrade, carried out non-sex change PAGE then.To scale off corresponding to the gel of mixture, in reductibility damping fluid [20mM Tris-HCl (pH7.5), 100mM NaCl and 50mM beta-mercaptoethanol],, carry out the 15%SDS-PAGE electrophoresis of second dimension then in incubated at room 30 minutes.As shown in the gel among the figure of below, (His) in the mixture ₆MazE and MazF are separated.Protein content is definite by light densitometry relatively in each swimming lane, uses (His) ₆MazE and MazF are in contrast.In Figure 12 A, in 2 μ M MazF solution of 20 microlitres, add (His) of different amounts ₆MazE.Swimming lane 1-5, (His) ₆The ratio of MazE: MazF is respectively 1: 1,2: 1, and 4: 1,6: 1 and 8: 1.In Figure 12 B, to 2 μ M (His) of 20 microlitres ₆The MazF that adds different amounts in the MazE solution.Swimming lane 1-5, (His) ₆The ratio of MazE: MazF is respectively 1: 2,1: 4, and 1: 6 and 1: 8.The figure of Figure 12 A and 12B top has shown the result of non-sex change PAGE.Arrow a has shown (His) ₆The position of MazE-MazF mixture.The figure of Figure 12 A and 12B below has shown the electrophoretic SDS-PAGE result of second dimension.(His) of purifying ₆MazE (40pmol) and MazF (40pmol) are splined on first and second swimming lanes in contrast.

[0306] in Figure 13, MazF and MazE-MazF (His) have been determined by the gel-filtration of using Superdex 200 posts ₆The molecular weight of mixture.The protein molecular weight standard curve has comprised thyroglobulin (669kDa), apoferritin (443kDa), beta-amylase (200kDa), BSA (66kDa), ovalbumin (45kDa) and carbonic anhydrase (29kDa).Vertical arrows on the typical curve has shown MazF and MazE-MazF (His) ₆The position of mixture.

[0307] at Figure 14 A, among 14B and the 14C, will contain the mazEF promoter region [ ³²P]-the 50-bp dna fragmentation and the concentration ever-increasing (His) of mark ₆MazE is hatched (Figure 14 A) jointly, hatches (Figure 14 B) jointly with the ever-increasing MazF of concentration, perhaps with 1: 2 constant (His) ₆MazE/MazF ratio and concentration ever-increasing (His) ₆MazE and MazF are hatched (Figure 14 C) jointly.

[0308] in Figure 15, use the ClustalW program to compare.In 8 different protein, identical residue is represented with black surround.Similar residue shows with grey frame table.Introduced gap (number representing), so that the comparison optimization with dash.Sequence has the MazE (GenBank login numbering NP_294139) of the abnormal cocci of anti-radiation the (Deinococcus radiodurans); The MazE of salt tolerant genus bacillus (Bacillus halodurans) (GenBank accession number NP_244587); PemI on the plasmid R100 (GenBank accession number NP_052993); PemI on the plasmid R466b (GenBank accession number AAC82515); Colibacillary MazE (GenBank accession number NP_289337); Colibacillary ChpB (GenBank accession number NP_290856); The MazE of pseudomonasputida (Pseudomonasputida) KT2440 (GenBank accession number NP_742931); The MazE of Photobacterium profundum (GenBank accession number AAG34554).Numeral is corresponding to the position of amino-acid residue.

[0309] in Figure 16 A and 16B, by EMSA, use 50bp [ ³²P] dna fragmentation that contains the mazEF promoter region of mark measures combining of protein and DNA.In Figure 16 A, each mixture shown in dna fragmentation and the 1 μ M was hatched 30 minutes in 4 degrees centigrade in the mixture of 20 μ l.Swimming lane 1, protein free contrast; Swimming lane 2, MazE-MazF (His) ₆Mixture; Swimming lane 3, MazE (K7A)-MazF (His) ₆Mixture; Swimming lane 4, MazE (R8A)-MazF (His) ₆Mixture; Swimming lane 5, MazE (S12A)-MazF (His) ₆Mixture; Swimming lane 6, MazE (R16A)-MazF (His) ₆Mixture; Swimming lane 7, MazE (I43N)-MazF (His) ₆Mixture; Swimming lane 8, MazE (E57Q)-MazF (His) ₆Mixture.In Figure 16 B, (His) shown in dna fragmentation and the 4 μ M ₆MazE or (His) ₆The MazE mutant was hatched 30 minutes in 4 degrees centigrade in the mixture of 20 μ l.Swimming lane 1, protein free contrast; Swimming lane 2, wild-type (His) ₆MazE albumen; Swimming lane 3, (His) ₆MazE (K7A) mutant; Swimming lane 4, (His) ₆MazE (R8A) mutant; Swimming lane 5, (His) ₆MazE (S12A) mutant; Swimming lane 6, (His) ₆MazE (R16A) mutant.

[0310] in Figure 17, in pGAD-C1, makes up the mazE gene of total length and the mazE gene of brachymemma.Numeral refers to amino acid whose position among the MazE, the common transformed yeast PJ69-4A of these plasmids and pGBD-MazF cell.Go up the detection protein-protein interaction at SD substratum (Clontech) dull and stereotyped (contain 1mM3-AT, do not have Trp, Leu, His and Ade).+, be illustrated in the visible bacterium colony that forms in 5 days;-expression did not form the visible bacterium colony in 5 days.

[0311] in Figure 18 A, measured MazF and (His) by non-sex change PAGE ₆MazE or (His) ₆Interaction between the MazE mutant.Swimming lane 1, wild-type (His) ₆MazE; Swimming lane 2, MazF; Swimming lane 3, wild-type (His) ₆MazE and MazF; Swimming lane 4, (His) ₆MazE L55A/L58A mutant and MazF; Swimming lane 5, (His) ₆MazER48A mutant and MazF; Swimming lane 6, (His) ₆MazE E57Q mutant and MazF; Swimming lane 7, (His) ₆MazE F53A mutant and MazF.

[0312] in Figure 18 B, by EMSA, use 50bp [ ³²P] dna fragmentation that contains the mazEF promoter region of mark measures MazF and (His) ₆MazE or (His) ₆Interaction between the MazE L55A/L58A mutant.Swimming lane 1, protein free contrast; Swimming lane 2,4 μ M wild-types (His) ₆MazE; Swimming lane 3,4 μ M (His) ₆The MazEL55A/L58A mutant; Swimming lane 4,2 μ M wild-types (His) ₆MazE and 4 μ M MazF; Swimming lane 5,2 μ M (His) ₆MazE L55A/L58A mutant and 4 μ M MazF.

[0313] Figure 19 has described the x-ray structure of MazE-MazF mixture, has shown in the figure for the essential conservative amino acid residues of MazE function.Only shown MazF ₂-MazE ₂-MazF ₂The part of mixture, one of them MazE molecule (blueness) interacts with two MazF molecules (purple and redness) of MazF homodimer.In the MazE molecule, N-box and Hp-box represent with green and yellow respectively.Demonstrate the position of Lys7, Arg8, Ser12 and Arg16 among the N-box, and the position of Leu55 among the Hp-box and Leu58.Just as shown here, these substitute the forfeiture that sudden change has caused the MazE function.

[0314] result

[0315] MazE and MazF can form mixture with 1: 2 ratio.The MazE-MazF of purifying (His) ₆, MazF and (His) ₆The tricine SDS-PAGE pattern of MazE shows in the swimming lane 2,3 and 4 of Figure 11 respectively.(His) ₆The size of MazE and MazF conform to 12.0kDa with theoretical molecular 11.4kDa respectively (Figure 11, swimming lane 3 and 4).MazE-MazF (His) ₆Mixture has been separated into the MazE of 9.3kDa and the MazF of 13.2kDa (His) ₆(Figure 11, swimming lane 2) uses the spectrodensitometry instrument to determine MazF (His) ₆Be about 2 with the ratio of MazE.

[0316] with (His) ₆MazE and MazF mix when carrying out non-sex change PAGE, and (position among Figure 12 a) a new band to have occurred in the position near the glue top.To scale off corresponding to the gel of new band, in reduction damping fluid [20mM Tris-HCl (pH 7.5), 100mM NaCl and 50mM beta-mercaptoethanol],, then glue is placed the top of SDS-PAGE gel in incubated at room 30 minutes, carry out the electrophoresis of second dimension, with the analysing protein component.After the use Xylene Brilliant Cyanine G dyes to gel, observe corresponding to (His) ₆Two bands of MazE and MazF are on SDS-PAGE (His) ₆The migration of MazE is slower than the migration of MazF.These results prove that new band is to comprise (His) ₆The mixture of MazE and MazF.If the reduction damping fluid, do not handle from the gel that non-sex change PAGE scales off, then observe 3 protein bands behind the SDS-PAGE, i.e. (His) ₆MazE, MazF and MazF dimer (data not shown).In non-sex change PAGE, purified MazF has three bands, but the MazF albumen that is to use HPLC to detect purifying is only observed a peak (data not shown).

[0317] experiment of carrying out other is to determine in mixture (His) ₆Whether the ratio of MazE and MazF is stable.Shown in Figure 12 A, in the same solution of the MazF that contains constant density (2 μ M), add (His) of different amounts ₆MazE produces a series of solution, wherein (His) ₆The ratio of MazE: MazF is from 1: 1, by 2: 1, by 4: 1, by 6: 1, by 8: 1.Shown in Figure 12 B, to (His) that contain constant density ₆Add the MazF of different amounts in the same solution of MazE (2 μ M), produce a series of solution, wherein (His) ₆The ratio of MazE: MazF is 1: 1,1: 2, and 1: 4,1: 6 and 1: 8.Above mixture was hatched 30 minutes at 4 degrees centigrade, analyzed with non-sex change PAGE.Will (position gel a) scales off, and in incubated at room 30 minutes, carries out 15%SDS-PAGE then in the reduction damping fluid corresponding to new band.The gel of second dimension uses coomassie brilliant blue staining to detect protein band.Relative protein content in each swimming lane makes the optical density instrument measure (His) of purifying ₆MazE and MazF are in contrast.In described mixture (His) ₆When MazE or MazF are excessive, in the mixture MazF with (His) ₆The ratio of MazE almost is held constant at 1.8 (Figure 12).As mentioned above, MazE-MazF (His) ₆Mixture is separated into MazE and MazF (His) by tricine SDS-PAGE ₆, MazF (His) ₆Ratio to MazE is approximately 2 (Figure 11, swimming lanes 2).By using Superdux ^TMThe MazE-MazF (His) of purifying is measured in the gel-filtration of 200 posts (Pharmacia Biotech) ₆The molecular weight of mixture and MazF is 76.9kDa and 27.1kDa (Figure 13).From MazE-MazF (His) ₆Be purified into MazF (His) in the mixture ₆MazF (His) ₆Can suppress intestinal bacteria cell free system (intestinal bacteria T7 S30 extract system, the Promega) protein synthesis in, and proteinic synthetic pass through to add simultaneously (His) ₆MazE and by the rescue (data not shown).Use determination of light scattering MazF (His) ₆Molecular weight be 28.3kDa, the prompting MazF (His) ₆Exist with dimeric forms.The structure of MazE be proved to be dimer (Lah et al. (2003) J Biol Chem278,14101-14111).Therefore, MazE-MazF (His) ₆Mixture (76.9kDa) may be by a MazE dimer (predicted molecular weight is 18.6kDa, because the molecular weight of MazE is 9.3kDa) and two MazF (His) ₆Dimer (56.6kDa) is formed.

[0318] MazF has improved combining of MazE and mazEF promotor---prepare 50b according to the description here ^PThe mazEF promoter fragment, by the T4 polynucleotide kinase with [γ- ³²P] ATP carries out end mark.Use electrophoretic mobility shift assay (EMSA), measure respectively (His) ₆MazE, MazF and MazE-MazF (His) ₆Mixture and mazEF promoter dna fragment bonded ability.(His) of 2 μ M or greater concn ₆MazE can make mazEF promoter fragment be moved (Figure 14 A, swimming lane 7).(His) ₆When MazE concentration is 0.4-1.0 μ M, do not observe the band that discontinuous mobility changes,, show under these concentration, to have formed some unsettled (His) although the signal of dna fragmentation upwards begins to thicken unclear (Figure 14 A, swimming lane 3-6) ₆The MazE-DNA mixture.(His) ₆When MazE concentration is 2-20 μ M, observe the mixture that discontinuous mobility changes, they are at (His) of greater concn ₆MazE moves down more slow (Figure 14 A, swimming lane 7-12), points out in the presence of the MazE of higher concentration and dna fragmentation bonded (His) ₆The number of MazE molecule increases.In the mazEF of 50bp promoter fragment, have probably more than one (His) ₆The MazE binding site.

[0319] in contrast, even when the concentration of 20 μ M, MazF albumen can not be in conjunction with the mazEF promoter DNA (Figure 14 B) of 50bp.Increase (His) ₆The proteic amount of MazE and MazF is simultaneously with (His) ₆The ratio of MazE/MazF is held constant at 1: 2.With (His) ₆MazE adding separately compares, and MazF has significantly improved (His) ₆MazE combines with the mazEF promotor.Under these conditions, the mazEF promoter fragment of 50bp is at (His) ₆The concentration of MazE is moved (Figure 14 C) (His) of greater concn when hanging down to 0.2 μ M ₆The MazE-MazF mixture is observed super migration under existing, and this shows under higher concentration more (His) ₆The MazE-MazF mixture is attached on the dna fragmentation, and proving has a plurality of (His) in the mazEF promotor ₆MazE-MazF mixture binding site.

[0320] conserved amino acid sequence in the MazE homologue---found the homologue of MazE by blast search, the comparison of their aminoacid sequences shows in Figure 15.Although usually, MazE is not high conservative in bacterium, still has conservative zone in the MazE homologue.At first, the N end regions of MazE is more more conservative than other zones among the MazE.MazE is that a pI is 4.7 acidic protein, but its N end regions still has a little several conservative alkaline residue (K7, R8 and R16), is called as N-box (Figure 15).Because MazE can be in conjunction with the mazEF promoter DNA, so N-box may be responsible for the combination of DNA.The second, a conservative C end regions is arranged, be called Hp-box (Figure 15), it contains several conservative hydrophobic residues.

[0321] N-box of MazE is responsible for combining of MazE and MazE-MazF mixture and DNA---at plasmid pET21cc-EF (His) ₆In the mazE gene in make up multiple different rite-directed mutagenesis, change the conservative amino acid residues among the N-box into Ala.Purifying is by MazE mutant protein and MazF (His) ₆The mixture that forms.Detect these mixtures and mazEF promotor bonded ability respectively by EMSA.Shown in Figure 16 A, by the MazE mutant and the MazF (His) that in N-box, have sudden change (K7A, R8A, S12A or R16A) ₆The mixture that forms can not be in conjunction with mazEF promoter DNA (Figure 16 A, swimming lane 3,4,5 and 6).But the replacement of the conserved amino acid beyond N-box sudden change, for example MazE does not influence the mixture and the DNA bonded ability (Figure 16 A is respectively a swimming lane 7 and 8) that comprise these mutains.At plasmid pET28a-(His) ₆Also make up other in the mazE gene among the E and replaced sudden change.All have (His) that replaces sudden change (K7A, R8A, S12A or R16A) in N-box ₆The MazE mutant has been lost its ability in conjunction with DNA (corresponding respectively to Figure 16 B, swimming lane 3,4,5 and 6), and (His) of wild-type ₆MazE has kept its ability in conjunction with the mazEF promotor (Figure 16 B, swimming lane 2).(His) of sudden change (R48A, F53A, L55A/L58A and E57Q) takes place to replace on the contrary, beyond N-Box ₆The MazE mutant can combine (data not shown) with the mazEF promoter DNA.These results show that the DNA binding ability of MazE-MazF mixture is because the MazE albumen in the mixture, and N-box is responsible for combining of MazE and DNA.

[0322] interaction between MazE and the MazF---carry out yeast two-hybrid and detect the interaction of checking between MazE and the MazF.In order to prove which zone among the MazE is essential for the interaction of itself and MazF, produce the mazE gene of total length and the various N end and the C end disappearance construct (referring to Figure 17) of mazE gene by PCR, they are cloned in the EcoRI-PstI site of pGAD-C1 carrier, form according to the translation of reading frame with the Gal4 transcriptional activation domain and to merge, each in these plasmids all with the pGBD-MazF cotransformation in the PJ69-4A yeast cell.Have pGAD-MazE, pGAD-MazE Δ (1-13), pGAD-MazE Δ (1-24), pGAD-MazE Δ (1-37) or pGAD-MazE Δ (76-82) can be at the synthetic medium that lacks Trp, Leu, His and Ade (SD substratum with the corotation beggar of pGBD-MazF, Clontech) go up growth, and the corotation beggar who has pGAD-MazE Δ (1-46) or pGAD-MazE Δ (68-82) and a pGBD-MazF can not grow.The MazE of these digital proof total lengths, MazE Δ (1-13), MazE Δ (1-24), MazE Δ (1-37) and MazE Δ (76-82) can interact with MazF, and further N end deletion mutant MazE Δ (1-46) and further C end deletion mutant MazE Δ (68-82) can not.These results show that be responsible in the zone of the 38-75 residue of MazE and the interaction of MazF.

[323] in pGBD-C1, make up a series of from the C-terminal of MazF and the truncated mutant of N-terminal, and with the pGAD-MazE cotransformation in the PJ69-4A cell.The yeast cell of these all cotransformations all can not be grown lacking on the complete synthetic medium of Trp, Leu, His and Ade, shows that all these MazF mutant all can not interact with MazE.Therefore the N of MazF end and C end regions may all participate in the interaction with MazE, perhaps the deletion mutantion of Chan Shenging destroyed to the structure conformation of the favourable MazF of MazE interaction.

[0324] at plasmid pET28a-(His) ₆Also produced rite-directed mutagenesis among the E, to make up (His) ₆MazE R48A, F53A, L55A/L58A and E57Q mutant.Check with these (His) with non-sex change PAGE ₆The mixture of MazE mutant and MazF forms.Shown in Figure 18 A, (His) ₆MazE mutant R48A, F53A and E57Q can form mixture (respectively shown in Figure 18 A swimming lane 5,6 and 7) with MazF, and (His) ₆MazE L55A/L58A mutant can not form mixture (Figure 18 A swimming lane 4) with MazF.Use EMSA proof wild-type (His) ₆MazE and (His) ₆MazE L55A/L58A mutant can be in conjunction with mazEF promoter DNA (being shown in Figure 18 B respectively, swimming lane 2 and 3).When adding MazF, wild-type (His) ₆MazE can interact form mixture with MazF, and only uses wild-type (His) ₆The trip road of MazE (Figure 18 B, swimming lane 2) is compared in the position near the gel top and has been produced super mobile band (Figure 18 B, swimming lane 4).But to (His) ₆Add MazF among the MazE L55A/L58A and can not cause the super mobile dna fragmentation of appearance, proved conclusively (His) ₆MazE L55A/L58A mutant can not interact with MazF and form mixture.

[0325] discusses

[0326] the habit-forming system of the mazEF in the intestinal bacteria is made up of two gene mazE and mazF, their encode respectively unsettled toxinicide MazE and stable toxin MazF.The toxic action of MazF is activated by ppGpp, ppGpp is a reply amino acid starvation (Aizenman et al. (1996) sees before), because some microbiotic (Sat et al. (2001) sees before), and because toxic protein Doc (Hazan et al. (2001) sees before) and the signal that produces by RelA albumen.In these cases, the degraded of unsettled MazE has caused free to stablize the appearance of MazF, and MazF can apply toxic action by pair cell.Therefore the regulation and control to the cell concn of MazE are main determining factors of necrocytosis.In brief, by forming mixture with MazF, MazE has suppressed the toxic action of MazF.And, MazE also by with the combining of mazEF promotor, participate in the regulation and control certainly (Marianovsky et al. (2001) sees before) that mazEF expresses.Just as shown here, MazE comprises at least two functional domains: DNA binding domains and MazF binding domains.

[0327] fusion rotein (His) ₆MazE can interact with MazF and be combined on the mazEF promotor.Similar to MazF, MazF (His) ₆Form dimer, suppress external protein synthesis, the inhibition of this protein synthesis is by adding (His) simultaneously ₆MazE and saved (data not shown).Therefore, external, compare with MazF with wild-type MazE, the fusion rotein of His mark seems to show similar functionally active.Use highly purified (His) ₆MazE and MazF have proved (His) ₆MazE can self in conjunction with the mazEF promotor, this interacts and to be enhanced by adding MazF.In fact, MazF makes (His) ₆MazE has strengthened more than 10 times with combining of mazEF promoter DNA.(His) at greater concn ₆MazE or (His) ₆Under the MazE-MazF mixture, in electrophoretic mobility shift assay, observe the super mobile mixture that comprises the mazEF promoter DNA, show (His) ₆MazE and (His) ₆The MazE-MazF mixture all has more than one binding site on the mazEF promoter DNA.It should be noted that former research prompting in the mazEF promoter region, have three MazE binding sites (Lah et al. (2003) J Biol Chem 278,14101-14111).What is interesting is, be not progressively to move by the observed band of EMSA.

[0328] rite-directed mutagenesis in the conservative N-box of MazE (K7A, R8A, S12A and R16A) has destroyed (His) ₆MazE and MazE-MazF (His) ₆The DNA binding ability (Figure 16) of mixture, prompting MazE is responsible for MazE-MazF (His) ₆The DNA binding ability of mixture, and the N end regions of the high conservative in MazE is the DNA binding domains.

[0329] carrying out yeast two-hybrid detects to determine to be responsible for the interactional zone of MazE-MazF.Discovery combines the residue 38 to 75 that needs MazE C end with MazF.It should be noted that has a conservative C end regions among the MazE, be called Hp-box, and it is rich in hydrophobic residue.The sudden change of conserved amino acid Leu55 and Leu58 (L55A/L58A) has destroyed (His) among the MazEHp-box ₆Interaction between MazE and the MazF.Yeast two-hybrid test shows that also the proteic entire structure of MazF may be essential for the interaction of itself and MazE, because destroyed interaction between MazE and the MazF from the disappearance of the N-terminal of MazF or C-terminal.

[0330] determines MazE-MazF (His) by gel-filtration ₆The molecular weight of mixture is 76.9kD.The MazE-MazF of purifying (His) ₆When mixture carries out tricine SDS-PAGE electrophoresis, find MazE and MazF (His) ₆Ratio approximately be 1: 2 (Figure 11, swimming lane 2).Even at excessive (His) ₆Under the existence of MazE or MazF, at (His) ₆The ratio of MazE and MazF still stably remains on about 1: 1.8 (Figure 12) in the MazE-MazF mixture.Because MazE (Lah et al. (2003) sees before) and MazF (His) ₆All exist, so MazE-MazF (His) with dimeric forms ₆Mixture (76.9kDa) may be by a MazE dimer (predicting that its size is about 18.6kD, because the molecular weight of MazE is 9.3kD) and two MazF (His) ₆Dimer (predicts that its size is about 56.6kDa, because MazF (His) ₆Dimeric molecular weight is 28.3kDa) form.

[0331] as mentioned above, people such as Kamada (see before (2003)) have measured the crystalline structure of MazE-MazF mixture.The crystalline structure of MazE-MazF mixture has been proved conclusively listed result here aspect several, comprising: find that 1) MazE and MazF form 2: 4 allos, six aggressiveness, form (MazF by alternative MazF and MazE homodimer ₂-MazE ₂-MazF ₂).Be important to note that the mixture that forms according to 2: 4 stoichiometry between MazE and the MazF looks it is very stable, because at (His) ₆In the MazE-MazF mixture (His) ₆The ratio of MazE and MazF is because which is excessive greatly and change (Figure 12) in two kinds of protein.2) the C end regions of MazE and the MazF homodimer in the MazE-MazF composite structure interact.The Hp-box that finds in this research has participated in coming outwardly the most stable MazE and the interface between the MazF (Figure 19).3) according to the similarity of MazE and other habit-forming assembly toxinicides, and the regional distribution of alkalescence on the electrostatic surface of MazE and MazF, Lys7 among people such as Kamada (see before (2003)) the proposition MazE and Arg8 are the primary DNA anchored sites in the MazE-MazF mixture.As what proved here, (His) ₆MazE and MazE-MazF (His) ₆The DNA binding ability of mixture is not only destroyed owing to the rite-directed mutagenesis of Lys7 and Arg8, but also because of the sudden change of other conservative amino acid residues (Ser12 and Arg16) in the N-box destroyed (Figure 19).Likelyly be that because MazE exists with dimer, thereby two N-box in the MazE dimer have together participated in and the combining of DNA.

EXAMPLE IV

[0332] as shown here,, suppressed proteinic synthetic in the intestinal bacteria cell free system, and the toxinicide PemI that adds anti-PemK has recovered proteinic synthetic by toxin--the PemK albumen of purifying of " pemI-pemK be addicted assembly " coding.Studies show that further PemK is a sequence-specific endoribonuclease, it cuts mRNA, and arrestin matter is synthetic, and PemI has blocked the endoribonuclease activity of PemK.As described herein-in, PemK optimizes 5 of A Nucleotide in the present UAX sequence (wherein X is C, A or U) ' or 3 ' end to the cutting of single stranded RNA.After inducing, PemK incising cell mRNA has blocked in the intestinal bacteria proteinic synthetic effectively.Therefore, the present invention has proved that PemK by at specific site cutting mRNA, disturbs the effect of mRNA.Therefore, inventor of the present invention has found that PemK is a novel endoribonuclease, here with its called after " mRNA interferases ".In the genome of many bacteriums, found the PemK homologue.

Propose PemK and homologue thereof and form a novel endoribonuclease family, they are by sequence-specific mode incising cell mRNA, and the function of interference mRNA.Also see also Figure 33 and 34.

[0333] material and method

[0334] bacterial strain and plasmid: use e. coli bl21 (DE3) and BW25113 cell according to the description here.Use plasmid R100 as template,, it be cloned in the NdeI-XhoI site of pET21cc (Novagen) by pcr amplification pemIK gene, the C of PemK end with (His) ₆Label merges the translation that produces according to reading frame.With this plasmid called after pET21cc-IK (His) ₆The pemI gene clone in the NdeI-BamHI site of pET28a (Novagen), is produced plasmid pET28a-(His) ₆I.PemI is as an expressing fusion protein, and its N end has (His) ₆Label is the zymoplasm cleavage site afterwards, and it is called as (His) ₆PemI.The pemK gene is cloned into pBAD, and (Guzman et al. (1995) JBacteriol 177 4121-4130), produces plasmid pBAD-K.Intestinal bacteria mazG gene clone produces plasmid pET11a-MazG in the NdeI-BamHI site of pET11a (New England Biolabs).The mazG gene clone to the pINIII carrier (Nakano et al. (1987) J Virol 61,302-307) in, produce plasmid pIN-MazG.Intestinal bacteria era gene clone produces plasmid pET28a-Era in the ScaI-XhoI site of pET28a.The era gene also is cloned into and is produced plasmid pIN-Era in the pINIII carrier.

[0335] protein purification: for (His) ₆The purifying of PemI is with pET28a-(His) ₆I introduces in e. coli bl21 (DE3) bacterial strain, uses 1mM IPTG to induce (His) ₆The expression of PemI 4 hours.Use Ni-NTA (QIAGEN) purifying (His) ₆PemI albumen.With pET21cc-IK (His) ₆Also be incorporated in e. coli bl21 (DE3) bacterial strain.Induce down PemI and PemK (His) at 1mM IPTG ₆Coexpression 4 hours.Use Ni-NTA (QIAGEN) purifying PemI-PemK (His) ₆Mixture.For from PemI-PemK (His) ₆Purifying PemK (His) in the mixture ₆, with PemI-PemK (His) ₆Mixture dissociates in the 5M Guanidinium hydrochloride, from PemK (His) ₆Last release PemI.Again catch PemK (His) with Ni-NTA resin (QIAGEN) ₆, wash-out and by the substep refolding of dialysing then.

[0336] body internal protein and DNA synthetic detect: contain the intestinal bacteria BW25113 of pBAD-K growth in the M9 substratum of improvement (add 0.5% glycerine, do not have glucose, and the aminoacid mixture of every kind of 1mM, do not have methionine(Met)).OD when culture ₆₀₀Reach at 0.6 o'clock, adding pectinose to final concentration is 0.2%, induces the expression of PemK.Shown in the moment take out cell culture (1 milliliter), with 5uCi[ ³⁵S]-methionine(Met) mix (being used for the synthetic of analysing protein) or with the 2uCi methyl- ³H-thymus pyrimidine (being used for the synthetic of analyzing DNA) mixes.37 degrees centigrade mix 1 minute after, measure the speed (Pedersen et al. (2002) Mol Microbiol45,501510) of dna replication dna and protein synthesis according to former description.Be used for the sample that analyzing total cell protein synthetic SDS-PAGE analyzes in order to prepare, shown in different constantly take out 500 microlitres [ ³⁵S]-methionine(Met) mixes reaction mixture, joins in the chilled tubes that contains 25 microlitre 100%TCA and 100 mcg/ml on-radiation methionine(Met)s.Centrifugal collecting cell precipitation is carried out autography behind the SDS-PAGE.

[0337] primer extension analysis: use T7 primer (5 '-AGATCTCGATCCCGCAAATTAAT-3 ') (SEQ ID NO:14) and G6 primer (5 '-TTAGAGATCAATTTCCTGCCGTTTTAC-3 ') (SEQ ID NO:15), as template, pcr amplification goes out to contain the dna fragmentation of T7 promotor and mazG gene with pET11a-MazG.Using the same T7 primer and E5 primer (5 '-TTAAAGATCGTCAACGTAACCG-3 ') (SEQ IDNO:16), is template with pET28a-Era, and pcr amplification goes out to comprise another dna fragmentation of T7 promotor and era gene.Use the extensive transcript reagent box of T7 (Promega), from these two dna fragmentations, prepare mazG mRNA and era mRNA respectively.Use PemK (His) ₆, part is cut the RNA substrate, and 37 degrees centigrade act on 15 minutes.Cleavage reaction mixture (20 microlitre) contains 4 microgram RNA substrates, 0.2 microgram PemK (His) ₆, 1 microlitre RNA enzyme inhibitors, 20mM Tris-HCl (pH 8.0), 100mM NaCl and 1mM DTT.The part cleaved products is used RNAeasy post (QIAGEN) purifying, removes PemK (His) ₆Albumen.Use primer G1 (5 '-TGCTCTTTATCCCACGGGCAGC-3 ') (SEQ ID NO:17), G2 (5 '-GCCCAGTTCACCGCGAAGATC GTC-3 ') (SEQ ID NO:18), G3 (5 '-GGTTTTGATTTGCTCCCAACGGGCAAG-3 ') (SEQ ID NO:19), G4 (5 '-CATTTCCT CCTCCAGTTTAGCCTGGTC-3 ') (SEQ ID NO:20), and G5 (5 '-TTGCCAGACTTCTTCCATTGTTTCG AG-3 ') (SEQ ID NO:21) carries out the primer extension analysis of mazG RNA; Use primer E1 (5 '-GATCCCCACAATGCGGTGACGAGT-3 ') (SEQ ID NO:22), E2 (5 '-CACGTTGTCCACTTTGTTCACC GC-3 ') (SEQ IDNO:23), E3 (5 '-CAGTTCAGCGCCGAGGAAACGCAT-3 ') (SEQ ID NO:24), and E4 (5 '-GCGTTCGTCG TCGGCCCAACCGGA-3 ') (SEQ ID NO:25) carries out the primer extension analysis of era RNA.Use the T4 polynucleotide kinase, to 5 of primer ' end mark [γ- ³²P] ATP.Primer extension reaction carried out 1 hour at 42 degrees centigrade.Except PemK (His) ₆Beyond not joining in the cleavage reaction mixture, use the same terms to carry out control experiment.Primer extension product is analyzed on 6% sequencing gel, is to use the dna sequencing gradient band of same primers as preparation on the next door of product.

[0338] synthetic RNA is cut by PemK

The RNA 5 ' of 30 bases-UAAGAAGGAGAUA UACAUAUGAAUCAAAUC-3 ' (SEQID NO:11), sense-rna 5 '-GAUUUGAUUCAUAUGUAUAU CUCCUUCUUA-3 ' (SEQID NO:26) and complementary DNA 5 '-GATTTGATTCATATGTATATC TCCTTCTTA-3 ' (SEQ ID NO:27) is commercial synthetic.Use the T4 polynucleotide kinase, to RNA5 ' end mark [γ-32P] ATP of 30 bases, with it as PemK (His) ₆Substrate.The RNA cleaved products of 30 bases is splined on 20% sequencing gel and (contains 7M urea), go up simultaneously a rna ladder degree band, it is according to former description (Smith and Roth. (1992) J Biol Chem267,15071-15079), by to 5 ' 30 base RNA of end mark carry out that part alkaline hydrolysis obtains.According to former description (Zhang et al. (2003) is the same), measure the influence of the formation of RNA-RNA two strands and RNA-DNA two strands to the RNA cutting of PemK mediation.

[339] PemK is in vivo to the Northern trace and the primer extension analysis of the effect of mRNA: pIN-MazG and pIN-Era plasmid are transformed in the intestinal bacteria BW25113 cell that comprises pBAD-K, produce BW25113/pBAD-K/pIN-MazG and BW25113/pBAD-K/pIN-Era bacterial strain respectively.Cell 37 degrees centigrade of growths on the LB substratum that contains penbritin (50ug/ml) and paraxin (20ug/ml).OD ₆₀₀Numerical value reaches at 0.4 o'clock, add IPTG to final concentration be 1mM, induce that mazG or era mRNA's is synthetic.37 degrees centigrade continue to hatch 30 minutes after, adding pectinose to final concentration is 0.2%, induces the expression of PemK.PemK induces the back at different time samplings.(Sarmientos et al. (1983) Cell 32 1337-1346), used hot phynol method to extract total cell RNA according to former description.The dna fragmentation that use contains total length mazG or era gene ORF prepares two radiolabeled probes respectively, uses it for the Northern engram analysis.Use primer G2 (being used for mazG mRNA) or E1 (being used for era mRNA) to carry out primer extension analysis.In order to detect lpp mRNA, add the different later on total cell RNAs of extraction from intestinal bacteria BW25113/pBAD-K constantly of pectinose, carry out the Northern engram analysis, use radiolabeled lpp ORF dna fragmentation as probe.Use primer lpp-C (5 '-AGAATGTGCGCC ATTTTTCACT-3 ') (SEQ ID NO:28) to carry out the primer extension analysis of lpp mRNA.

[0340] about the particular methodology details of accompanying drawing

[0341] Figure 26, PemK is to the influence of DNA in the body and protein synthesis.(A) PemK influences the DNA synthetic.The intestinal bacteria BW25113 cell that contains pBAD-K is grown in the M9 substratum in 37 degrees centigrade, and glycerine is as carbon source.OD when culture ₆₀₀Reach at 0.6 o'clock, adding pectinose to final concentration is 0.2%, induces the expression of PemK.By induce at PemK the back different constantly detect methyl- ³Mixing of H-thymus pyrimidine, the multiple-copy rate of mensuration DNA carries out according to the description in material and the method.(B) PemK is to the influence of protein synthesis.By induce mixing of the different detection constantly in back [35S]-methionine(Met) at PemK, measure proteinic synthesis rate, carry out according to the description in material and the method.(C) PemK induces back total cell protein matter synthetic SDS-PAGE to analyze.Induce the moment shown in the back to take out cell culture (1 milliliter) at PemK, with 5uCi[ ³⁵S]-the methionine(Met) mixing.37 degrees centigrade mix 1 minute after, will [ ³⁵S]-methionine(Met) mixes reaction mixture (500 microlitre) and joins in the chilled tubes that contains 25 microlitre 100%TCA solution and 100 mcg/ml on-radiation methionine(Met)s.Centrifugal collecting cell precipitation is carried out autography behind the SDS-PAGE.The band of representing with arrow is PemK.

[0342] Figure 27, PemK and PemI influence the cell-free protein synthetic.(A) PemK suppresses the cell-free protein synthetic.Protein synthesis in intestinal bacteria T7 S30 extract system (Promega) 37 degrees centigrade carried out 1 hour.From pET11a-MazG, express MazG, from plasmid pET28a-Era, express (His) ₆Era.Swimming lane 1 does not add the contrast of PemK; Swimming lane 2-5 adds 0.125,0.25,0.5 and 1 microgram PemK (His) respectively ₆(B) releasing of PemI to suppressing by protein synthesis in the cell free system of PemK mediation.Swimming lane 1 does not add PemK (His) ₆Contrast; Swimming lane 2 adds 1 microgram PemK (His) ₆Swimming lane 3-5,1 microgram PemK (His) ₆With 0.5,1,2 micrograms (His) ₆PemI is common respectively to add.(C) cell free system and PemK preincubate are for the influence of protein synthesis.Before adding pET28a-Era plasmid, cell free system and PemK (His) ₆Perhaps do not add PemK (His) ₆, 37 degrees centigrade of preincubates 15 minutes.Hatch down at 37 ℃, protein synthesis was carried out 1 hour again.Reaction product uses SDS-PAGE to analyze, and carries out autography afterwards.Swimming lane 1 is not with PemK (His) ₆The contrast of preincubate; Swimming lane 2 is with the PemK (His) of 1 microgram ₆Preincubate adds the pET28a-Era plasmid afterwards; Swimming lane 3 is with the PemK (His) of 1 microgram ₆Preincubate adds pET28a-Era plasmid and 1 microgram (His) afterwards together ₆PemI; Swimming lane 4 is with the PemK (His) of 1 microgram ₆(His) with 1 microgram ₆PemI is hatched together jointly, adds the pET28a-Era plasmid afterwards.

[0343] Figure 28, the endoribonuclease activity of PemK.(A) PemK is to the cutting of mazG mRNA and the PemI restraining effect to the RNA cutting of PemK mediation.Swimming lane 1, contrast only has mazG mRNA; Swimming lane 2, mazG mRNA (1.5 microgram) and 0.2 microgram PemK (His) ₆Hatch jointly; Swimming lane 3-6, mazG mRNA (1.5 microgram) and 0.2 microgram PemK (His) ₆And 0.05,0.1,0.2 and 0.4 microgram (His) ₆PemI is hatched respectively jointly; Swimming lane 7, mazG mRNA (1.5 microgram) and 0.4 microgram (His) ₆PemI is hatched jointly.Be reflected at 37 degrees centigrade and carried out 15 minutes, reaction product is analyzed with 3.5% non-sex change PAGE afterwards, uses the TAE damping fluid.(B), (C), (D) and (E), the primer extension analysis of PemK cleavage site among mazG mRNA and the era mRNA.Carry out primer extension assay according to the description in material and the method.Each primer extension product is analyzed on 6% sequencing gel, is to use the dna sequencing gradient band of same primers as preparation on the next door of product.With PemK (His) ₆Dna sequence dna gradient band complementary RNA sequence around the cleavage site shows that on the right side cleavage site is shown by arrow.What show in this figure is to use PemK (His) among primer G1 (B) and the detected mazG mRNA of G2 (C) ₆Cleavage site, and the PemK (His) among use primer E1 (D) and the detected era mRNA of E4 (E) ₆Cleavage site.

[0344] Figure 29 is by the formation inhibition PemK endoribonuclease activity of RNA/RNA.The RNA of synthetic one 30 base, PemK (His) among its sequence and the mazG mRNA ₆Sequence around the cleavage site identical (Table II, second row).(A) the PemK cleavage site on the 30 base RNA.Use T4 polynucleotide kinase usefulness [γ- ³²P]-ATP is to 5 of 30 base RNA ' end mark, then with PemK (His) ₆Under 37 degrees centigrade, hatched 15 minutes.Cleaved products is analyzed on 20% sequencing gel.Swimming lane 1,5 ' end mark [ ³²P] the big tick marks of 11 base RNA; Swimming lane 2, according to former description (Smith and Roth. (1992) J Biol Chem267,15071-15079), use part alkaline hydrolysis from 5 ' end mark [ ³²P] the rna ladder degree band of 30 base RNA preparation; Swimming lane 3 does not use PemK (His) ₆5 ' end mark of handling [ ³²P] 30 base RNA; Swimming lane 4,5 ' end mark [ ³²P] 30 base RNA use PemK (His) ₆The cleaved products of cutting.The size of each band in the swimming lane 1 and 4 is represented with the number of its total nucleotide.(B) formation of RNA-RNA two strands is to the active influence of PemK endoribonuclease.Swimming lane 1, only underlined [ ³²P] 30 base RNA (1pmol); Swimming lane 2, mark [ ³²P] 30 base RNA (1pmol) and 0.2 microgram PemK (His) ₆Hatched 15 minutes at 37 degrees centigrade; Swimming lane 3-7, mark [ ³²P] 30 base RNA (1pmol) and its 30 base sense-rna according to shown in different ratios anneal, then with 0.2 microgram PemK (His) ₆Hatched 15 minutes at 37 degrees centigrade.Reaction product uses 15% PAGE to analyze, and carries out autography then.

[0345] Figure 30, Northern trace and the effect of primer extension analysis PemK to various different mRNA in the body.(A) Northern engram analysis PemK is in vivo to mazG, the effect of era and lpp mRNA.In the presence of 1mM IPTG, prepare mazG mRNA and era mRNA from pIN-MazG and pIN-Era respectively, add pectinose (to final concentration 0.2%) after 30 minutes, to induce the expression of PemK.Transcribe lpp mRNA from escherichia coli chromosome.After PemK induces, shown in different constantly extract total cell RNA, be used for the Northern engram analysis.Control experiment is carried out under the same conditions, does not have inducing of PemK.(B), (C) and (D), the primer extension analysis of PemK cleavage site among mazG, era and the lpp mRNA in vivo.Shown in different constantly extract total cell RNA, be used for primer extension assay.Primer extension product is analyzed on 6% sequencing gel, is to use the dna sequencing gradient of same primers as preparation on the next door of product.Show on the right side that with the dna sequence dna gradient complementary RNA sequence around the PemK cleavage site cleavage site is shown by arrow.What show in this figure is to use PemK cleavage site among the detected mazG mRNA of primer G2 (B); Use the PemK cleavage site among the detected eramRNA of primer E1 (C), and use the PemK cleavage site among the detected lpp mRNA of primer lpp-C (D).

[0346] result

[0347] PemK is to the influence of DNA in the body and protein synthesis: the pemK gene is cloned into the pBAD carrier, and (Guzman et al. (1995) J Bacteriol 177 produces plasmid pBAD-K in 4121-4130), and it is transformed among the intestinal bacteria BW25113.Induce the expression of PemK in BW25113/pBAD-K by adding pectinose to final concentration 0.2%.After PemK induces, shown in Figure 26 A and B, in the speed of different chronometry dna replication dnas and protein synthesis.Duplicate and proteinic the synthesizing of DNA all are affected because of inducing of PemK, but the influence degree that dna replication dna is subjected to significantly is lower than the influence that protein synthesis is subjected to.After PemK was induced 10 minutes, it is about 50% that proteinic synthetic quilt promptly reduces, and the inhibition of dna replication dna reaches similar level and needs about 100 minutes.Shown in Figure 26 C, the different SDS-PAGE of total cell protein synthetic constantly analysis revealeds after PemK induces, PemK is the general inhibitor of cell protein synthetic.After PemK induces 0-30 minute band (indicating) by arrow the degree of depth increase, reduce then.According to its molecular weight with induce kinetics, this band representative be derivative PemK protein.

[0348] PemK suppresses the protein synthesis in the cell free system: according to the description of material and method, from coexpression PemI and PemK (His) ₆Coli strain BL21 (DE3)/pET21cc-IK (His) ₆Middle purifying PemK (His) ₆(the C end has label).From coli strain BL21 (DE3)/pET28a-(His) ₆Purifying among the I (His) ₆PemI (the N end has label).In following experiment in vitro, PemK (His) ₆(His) ₆PemI is hereinafter referred to as PemK and PemI.In order to determine whether arrestin matter synthetic of PemK, to MazG in the acellular RNA/ protein synthesis system of intestinal bacteria and (His) to the PemK of purifying ₆The effect of Era synthetic detects.MazG is synthetic from plasmid pET11a-MazG, (His) ₆Era is synthetic from plasmid pET28a-Era, two synthetic all carried out under 37 degrees centigrade 1 hour, used intestinal bacteria T7 S30 extract systems (Promega), was not having PemK (Figure 27 A, swimming lane 1) or PemK content constantly increase under the condition of (Figure 27 A, swimming lane 2-5) and carry out.PemK has suppressed MazG and (His) with dose-dependent form ₆Synthetic (Figure 27 A) of Era.These results show that PemK has suppressed protein synthesis, and this is consistent with the inhibition (Figure 26 B and 26C) of the protein synthesis of observed PemK mediation in vivo.The delay that the dna replication dna of observed in vivo PemK mediation suppresses then is presumably because the synthetic second-order effect that is suppressed of cell protein.What is interesting is, add the inhibition that toxinicide PemI has blocked the protein synthesis of PemK mediation, recovered MazG and (His) ₆Era's is synthetic, and this also (Figure 27 B) occur with the dose-dependent form of PemI.Should be noted in the discussion above that then preincubate is to (His) if PemI and plasmid DNA add reaction system at 37 degrees centigrade of preincubates after 15 minutes with PemK at the intestinal bacteria cell free system ₆Era synthetic do not have significant negative impact (swimming lane 1 and 3 among the comparison diagram 27C).But do not having under the situation of PemI, do not having protein to produce (Figure 27 C, swimming lane 2).Obviously, no matter PemI is adding (Figure 27 C, swimming lane 3) with PemK preincubate in system after 15 minutes, or PemI and PemK together add (Figure 27 C, swimming lane 4) when preincubate, (His) ₆The synthetic of Era all has been resumed.First target of these results suggest PemK is mRNA, rather than tRNA, rrna and needed other factors of protein synthesis in cell free system.

[0349] the endoribonuclease activity of PemK: use plasmid pET11a-MazG as template,, obtain comprising the dna fragmentation of T7 promotor and mazG gene by pcr amplification according to the description in material and the method.Similarly, use pET28a-Era, obtain the dna fragmentation that another contains T7 promotor and era gene as template.Use the extensive transcript reagent box of T7 (Promega), from these two dna fragmentations, prepare mazG mRNA and era mRNA respectively.Under 37 degrees centigrade, hatched 15 minutes with PemK, mazG mRNA is digested to small segment (Figure 28 A, swimming lane 2), and the adding of PemI has suppressed the cutting (Figure 28 A, swimming lane 3-6) of mazG mRNA in dose-dependent mode.PemI self is for not effect (Figure 28 A, swimming lane 7) of mazG mRNA.Use era mRNA to obtain similar result as substrate.These results prove that PemK is a cutting mRNA arrestin matter synthetic endoribonuclease, and the effect of PemI is a toxinicide, and it has blocked the endoribonuclease activity of PemK.

[0350] product that cut by PemK of mazG mRNA forms clearly band (Figure 28 A) on 3.5% polyacrylamide gel, and this fact shows that PemK cuts on the specific site of RNA.According to material and method, partly cut mazG mRNA with PemK, carry out primer extension then, used 5 different oligodeoxyribonucleotide primers, G1 is to G5.Compare with the contrast of carrying out parallel processing PemK processing still of no use, the product electrophoresis on 6% sequencing gel that uses PemK to handle detects along mazG mRNA many special cleavage sites.According to material and method, the era mRNA that part is digested by PemK has also carried out primer extension reaction, uses 4 different primers, and E1 is to E4, to detect the PemK cleavage site along era mRNA.In order to determine PemK cleavage site definite sequence on every side, the product of each primer extension is all analyzed on 6% sequencing gel, uses the dna sequencing gradient band (Figure 28 B-E) with the same primers as preparation.

[0351] Table II has shown the mRNA sequence around the PemK cleavage site.Shown mazG mRNA (from pET11a-MazG), era mRNA (from pET28a-Era) and lpp mRNA (from e. coli chromosomal dna, referring to Figure 30 D) go up PemK cleavage site (representing with arrow) mRNA sequence on every side.Conservative UA Nucleotide shows with runic.A residue among the initiator codon AUG is numbered+1, what then numbering showed is the position of Nucleotide among the mRNA.

The gene title	Primer	MRNA sequence around the cleavage site
			mazG	G1	(-27)UUUUAACUUU↓AAGAAGGAGA(-8)
	(-14)AAGGAGAUAU↓ACAUAUGAAT(+6)
		G2		(+112)GAAGAAACCUA↓CGAAGUGCU(+131)
G3	(+196)GUGGUGUUUU↓ACGCGCAAAU(+215)
		(+234)CUUUGACUUU↓AAUGAUAUUU(+253)
	(+240)CUUUAAUGAU↓AUUUGCGCUG(+259)
		(+290)CGCAUGUUUU↓GCUGAUAGUU(+309)
	G4			(+523)GAGGUGAUGUA↓CGAAGCGCG(+542)
G5		(+597)UGCCACGGUU↓AAUCUGGCUC(+616)
	(+684)AGUGGAGCGU↓AUUGUUGCCG(+703)
		era		E1	(+10)GATAAAAGUU↓ACUGCGGAUU(+29)
E2	(+144)GGGGAUCCAU↓ACUGAAGGCG(+163)
				(+169)CAGGCGAUCU↓ACGUCGAUAC(+188)
E3	(+509)GUAAGCAUCU↓ACCUGAAGCG(+528)
				(+541)CCGGAAGAUU↓ACAUCACCGA(+560)
E4	(+625)GAACUGCCGUA↓CUCCGUGAC(+644)
			(+676)CGCGGUGGUU↓AUGACAUCAA(+695)
	lpp			lppC	(+210)CAACAUGGCU↓ACTAAATACC(+229)

[0353] Table II has shown the sequence around the main cleavage site of mazG mRNA, era mRNA and lpp mRNA (lppmRNA is referring to Figure 30 D), and this is measured by primer extension assay.These discoveries show that the UA dinucleotides has in all cleavage sites except a cleavage site, and main 5 of A residue in present UAX (X is C, A or the U) sequence ' or the 3 ' end that cuts out, has only an exception, promptly cut out in the present UGC sequence between the U and G residue (Table II, the 7th row).In the cleavage site of 18 mensuration, the UAC sequence appears among wherein 11.

[0354] according to the sequences Design around PemK cleavage site among the mazG mRNA RNA substrate of one 30 base, comprise UAC sequence (Table II, second row).Use the T4 polynucleotide kinase, with [γ- ³²P] ATP carries out mark to 5 of RNA ' end.In the primer extension assay that uses total length mazGmRNA, the UAC sequence is only cut (Figure 28 B) in 5 ' end-grain cutting of A residue.But 5 of A residue in the RNA of the 30 bases UAC sequence therein (No. 15 base in 30 bases) ' and 3 ' hold and all cut finely (Figure 29 A).In 15% non-sex change PAGE, its migration of cleaved products of 30 base RNA substrates is a band (Figure 29 B, a swimming lane 2).If before adding PemK, anneal in varing proportions with sense-rna and 30 base RNA substrates, then sense-rna has suppressed the cutting (Figure 29 B, swimming lane 3-7) of RNA in dose-dependent mode.When making 30 base RNA and its complementary DNA form two strands, obtain similar result.These results show that the cleavage site of the PemK of 30 base RNA substrates is protected in RNA-RNA and RNA-DNA two strands.Therefore can reach a conclusion, PemK is the sequence-specific endoribonuclease at single stranded RNA.

[0355] mRNA cutting in the body after PemK induces: in order to check PemK in vivo to the effect of mRNA, according to the description of material and method, the different moment after PemK induces are extracted total cell RNA, carry out Northern trace and primer extension analysis.16S and 23S rRNA are stable to PemK in vivo, because by the total cell RNA sample of 1% sepharose inspection, in PemK induces 60 fens later clock times, do not observe the remarkable change of their band depths.This shows that 16S and 23S rRNA are subjected to good protection in vivo, is not cut by PemK.Figure 30 A has shown that PemK induces or do not induce down, in the difference result of mazG, era and lpp mRNA Northern trace constantly.MazG and era mRNA be respectively from pIN-MazG and pIN-Era preparation, induced 30 minutes with the IPTG of 1mM, adds pectinose (final concentration is 0.2%) afterwards to induce the expression of PemK.Lpp mRNA transcribes from escherichia coli chromosome.All these three mRNA were degraded behind the PemK induced expression in 10 minutes, and do not having under the PemK inductive situation, in 60 minutes incubation time, do not observe any variation (Figure 30 A), compare with lpp mRNA with mazG, era mRNA major part is converted into littler clearly band, and is relatively stable in this band 60 minutes after PemK induces.The character of the mRNA cleaved products that this is stable is also unknown.

[0356] also carries out primer extension assay, determined the PemK cleavage site among the mRNA in the body.Each cleavage site among mazG, era and the lpp mRNA is shown in respectively among Figure 30 B, C and the D.In all cases, PemK induces and just occurred a band (swimming lane 2 of Figure 30 B, C and D) in back 10 minutes, and its degree of depth progressively strengthens (swimming lane 2-6) in PemK induces back 60 minutes incubation time.It should be noted that this band almost can't detect (swimming lane 1) in the time of 0 minute, clearly illustrate that observed cutting is because inducing of PemK caused.The cutting of mazG and lpp mRNA is to take place between A in the UAC sequence and the C residue, and the cutting of era mRNA takes place between U and A residue.MazG mRNA in vivo with external cleavage site identical (comparison diagram 28C and Figure 30 B).Cutting (comparison diagram 28D and Figure 30 C) in the body of era has also appearred in identical site when the identical primer of external use detects.The UAC sequence that is cut among mazG and the era mRNA is within the reading frame of two ORF, encode respectively Try41 (MazG) and Tyr7 (Era), and the UAC sequence that is cut in lpp mRNA is between two adjacent codons are promptly encoded the ACU of the GCU of Ala73 and coding Thr74.PemK is very special to the cutting of mRNA in vivo, because do not detect other cutting incidents, shown in Figure 30 B, C and D.Therefore, with RelE (it promotes the mRNA cutting that codon is special, occurs on the ribosomal A site) (Pedersen et al. (2003) Cell 112,131-140; Hayes and Sauer. (2003) Mol Cell 12,903-911) differently be, PemK is sequence-specific endoribonuclease, can be by cutting mRNA arrestin matter synthetic, the reading of the mode of cutting and rrna and codon has nothing to do.

[0357] conclusion

[0358] the present invention has partly related to a new discovery, by the toxin PemK of the habit-forming assembly coding of pemI-pemK, is a sequence-specific endoribonuclease promptly.External and the intravital PemK of studies show that passes through to have suppressed proteinic synthetic at specific site place cutting mRNA.In the intestinal bacteria cell free system, it is proteinic synthetic that the PemK of purifying has suppressed, and add the restraining effect that PemI can block PemK, recoverin matter synthetic.And, proved that here mRNA is degraded by PemK, and the mRNA cutting of PemK mediation is suppressed by PemI.Therefore the effect of PemI is a toxinicide, and it has suppressed the endoribonuclease activity of PemK by forming mixture with PemK.With regard to endoribonuclease is active, the PemI-PemK mixture be do not have active.

[0359] showing here is that PemK is a high special for single stranded RNA, because when RNA substrate and its sense-rna or complementary DNA formation RNA-RNA or RNA-DNA two strands, the cutting of the RNA of PemK mediation is blocked.The result here also show PemK preferably in UAX sequence (X is C, A or U) 5 of the A residue ' or 3 ' end-grain cutting cut.Here the result of Ti Chuing shows that also PemK is irrelevant to cutting and the rrna of RNA, and this is with obviously different by the RelE of the habit-forming assembly coding of relBE.RelE can not cut free RNA, but promotes degraded (Christensen and Gerdes. (2003) Mol Microbiol 48, the 1389-1400 of rrna A site mRNA with the codon specificity of height; Pedersen et al. (2003) Cell112,131-140; Hayes and Sauer. (2003) Mol Cell 12,903-911).

[0360] in the research of in kis-kid system (it is a habit-forming assembly identical with pemI-pemK), carrying out in front, have report show Kid (PemK) in vitro inhibition duplicating of ColE1 initial period, but have no significant effect for duplicating then of P4DNA.DnaB be considered to the inhibiting target of Kid (PemK) (Ruiz-Echevarria et al. (1995) JMol Biol 247,568-577).But there is not the interaction between data support Kid (PemK) and the DnaB.What is interesting is that noticing that ColE1 duplicates to be risen at first by RNAII is suppressed (Cesareni et al. (1991) Trends Genet 7,230-235 by RNAI; Davison. (1984) Gene 28,1-15), and P4DNA duplicate the regulation and control that mainly are subjected to alpha protein (Briani et al. (2001) Plasmid 45,1-17).Participate in the metabolic RNA enzyme of RNAI and RNA II estimate in the duplicating of control ColE1 plasmid, to play an important role (Jung andLee. (1995) Mol Biol Rep 22,195-200).RNA II contains a plurality of UAC sequences, wherein two ring district (Tomizawa and Itoh. (1982) Cell 31,575-583 that are present in the first and second stem rings; Tomizawa. (1984) Cell 38,861-870).Therefore the ColE1 dna replication dna by the inhibition of Kid (PemK) may be since RNA II by due to the endoribonuclease active degradation of Kid (PemK).And, toxin Kid (PemK) in the bacterium suppresses the fact (de la Cueva-Mendezet al. (2003) the Embo J22 of various different eukaryotic cell growths, 246-251), can pass through its endoribonuclease activity at cell mRNA, rather than the interaction of itself and DnaB and easily obtain explaining.

[0361] in many bacteriums, all had been found that the homologue of PemK.MazF (ChpAK) and ChpBK are two class PemK albumen (Santos Sierra et al. (1998) FEMS Microbiol Lett 168, the 51-58 in the intestinal bacteria; Masuda et al. (1993) JBacteriol 175,6850-6856; Christensen et al. (2003) J Mol Biol332,809-819).Toxin MazF (ChpAK) by the habit-forming assembly coding of mazEF has 25% consistence with PemK; Toxin C hpBK by the habit-forming assembly coding of chpB has 41% consistence with PemK.It should be noted that known MazF (ChpAK) and ChpBK by cutting mRNA with the similar mode of RelE, suppress translation (Christensen et al. (2003) is the same).But inventor of the present invention proves that recently MazF is an endoribonuclease, and it is by (Zhang et al. (2003) MolCell 12,913-923), its effect does not rely on rrna the cutting single-chain mRNA of distinguished sequence place arrestin matter synthetic.MazF preferably cuts mRNA (Zhang et al. (2003) is the same) between the A of ACA sequence and C residue.

[0362] the proteic crystalline structure of Kid (PemK) has been confirmed as homodimer (people (2002) Structure (Camb) 10 such as Hargreaves, 1425-1433; Hargreaves et al. (2002) Acta Crystallogr D Biol Crystallogr58,355-358).Although the structure of MazF also is not determined, Kamada et al (2003) has reported the crystalline structure of MazE-MazF mixture (MazF2-MazE2-MazF2), and mixture is formed by two MazF homodimers and a MazE homodimer.What is interesting is the structural similitude of MazF homodimer in the structure of Kid (PemK) homodimer and the MazE-MazF mixture.But in combining the MazF homodimer of MazE, conservative ring between β chain S1 and the S2 (being called the S1-S2 ring) stretches in the solvent, most of random arrangement, and in Kid (PemK) homodimer two corresponding annular become " closely " conformation (Kamada etal. (2003) Mol Cell 11,875-884).S1-S2 in Kid (PemK) homodimer structure encircles, and has formed the structure in a similar cavity, has comprised alkaline surface and conservative hydrophobic pocket.Conservative hydrophobic pocket identification for MazE in the formation of MazE-MazF mixture plays important used (Kamada et al. (2003) is the same).Inventor of the present invention proposes, and the C end that carries the MazE of a large amount of negative charges extends may simulate single stranded RNA, and it is combined between the S1-S2 ring in the MazF homodimer (Zhang et al. (2003) is the same).PemI is considered to combine with PemK in a very similar way, has blocked the endoribonuclease activity of PemK.

[0363] inventor of the present invention has carried out property research to PemK and MazF, they are confirmed as the sequence-specific endoribonuclease of single stranded RNA, but their physiological function seems still and other known endoribonucleases that as RNA enzyme E, A and T1 have obvious difference.PemK and MazF become general protein synthesis inhibitor by the function of interference cell mRNA.Well-known little RNA, as micRNA (mRNA-mieRNA mRNA) (Mizuno et al. (1984) Proc Natl Acad Sci USA 81,1966-1970), miRNA (Ambros. (2001) Cell 107,823-826) and siRNA (Billy et al. (2001) Proc Natl Acad Sci USA 98,14428-14433), disturb the function of special target RNA.Ribozyme also acts on the target RNA specifically, disturb its function (Puerta-Fernandez et al. (2003) FEMS Microbiol Rev 27,75-97).The homologue (comprising MazF) that inventor of the present invention proposes PemK and PemK forms a new endoribonuclease family, and they have new mRNA interference mechanism, make mRNA be cut at special sequence place.Therefore they are named as " mRNA interferases " here.Reported as former, Kid (PemK) causes human cancer cell's apoptosis, and Kis (PemI) suppresses the toxic action (de la Cueva-Mendez et al. (2003) is the same) of Kid (PemK).Therefore, the adjustable mRNA EVAC (Evacuation Network Computer Model) that this is new might play a role in the therapeutic treatment (for example gene therapy) of human diseases.

EXAMPLE V

[0364] just as shown here, the function of PemK is highly sequence-specific endoribonuclease, and it is at the incising cell mRNA of UAX sequence place, and wherein X is C, A or U.This activity can realize protein synthesis inhibition partly or completely in the pair cell.According to any possibility that is incorporated into each position of preceding two nucleotide positions in four kinds of Nucleotide be identical principle and shown in three Nucleotide in any will be incorporated into the 3rd nucleotide position, according to the calculating of standard, the predict frequency that UAX sequence (wherein X is C, A, U) appears in the rna transcription product is 3/64.Should be appreciated that with predict frequency and compare, comprise the UAX sequence of lower or upper frequency in some rna transcription products.Therefore, special rna transcription product or the relevant rna transcription product susceptibility of being cut by the PemK endoribonuclease depends on UAX sequence or the frequency of PemK target sequence in transcription product.And the personnel that have ordinary skill in this area can be according to the sequence prediction transcription product of the rna transcription product susceptibility for the cutting of PemK mediation.

Example VI

[0365] usually, RNA interferases and special RNA interferases of the present invention can also be advantageously used in the body and the component of external protein production system, the proteinic generation of background in these production systems (non-specific) reduces greatly or is removed, and has produced " single albumen " synthesis system like this.Use " single albumen " synthesis system expressed proteins not have the albumen that pollutes basically, so for preferably or must to use for the application of " purifying " protein Preparation thing be useful.These application comprise, still are not limited to, and the proteinic nucleus magnetic resonance (NMR) that need not purifying is analyzed and other protein structures mensuration, comprises the structure determination that relates to membranin.About the structural analysis of membranin, the protein prepared product that uses method of the present invention to produce is very suitable for the experimental program that relates to solid state NMR.One preferred aspect, method of the present invention can be advantageously used in uses radio isotope special membranin of special marked in the cell background.Next the membranin that is labeled is incorporated in the suitable cytolemma by endogenous cell mechanism, and the protein that is labeled there can be at an easy rate be detected according to the character of its mark.

[0366] be used in the body or the single protein synthesis system of external application in order to make up, use mRNA interferases (for example PemK and/or MazF) that this system is carried out pre-treatment, described mRNA interferases cuts endogenous mRNA, and blocking protein is synthetic from these mRNA's.In order to realize this pre-treatment in vivo, the tetracycline-regulated gene of mRNA interferases is introduced in cell or the tissue, induce its expression.Introduce in cell and/or the tissue foreign gene and the method for expressing, describe to some extent above, and be known in the art.In order to realize external mRNA interferases pre-treatment, the mRNA interferases of purifying is joined in the external translation system.Be known in the art various external translating system, comprise, but be not limited to rabbit reticulocyte, wheatgerm and colibacillary extract.For producing " single albumen " in these bodies or in any one of vitro system, the genetic constructs of coding desirable proteins is carried out through engineering approaches, transcribe out the wherein all removed mRNA of all mRNA interferases target sequences.The mRNA that this step produces is insensitive for the endoribonuclease activity of the mRNA interferases that adds in " single albumen " expression system.MRNA transcription product of the present invention through through engineering approaches can be called as " mRNA of anti-interference enzyme " here like this.By from the construct of for example through engineering approaches, inducing it to express, thereby express the mRNA of anti-interference enzyme.The mRNA of anti-interference enzyme is translated into protein, and does not have other basically to the active responsive proteinic translation of mRNA interferases, and what so in fact produce is single protein example.This method can be used for protokaryon or eukaryotic system.

[0367] be to be understood that use the mRNA interferases handle also can be simultaneously with the expression of anti-interference enzyme mRNA/induce or add simultaneously and carry out.This method can with relate in single albumen the synthetic external or body of the present invention (based on cell) system and use jointly.

[0368] based on the expression system of cell: because MazF is the endoribonuclease of a sequence specific (ACA), it is only to single stranded RNA (the zhang et al.2003 that works, the same), so develop " single protein " synthesis system, the purposes of example MazF in these are used based on cell.

[0369] like this, develop single protein synthesis system, with synthetic sophisticated human eosinophilic granulocyte chemotactic protein in bacterial cell.In order to reach this purpose, the novel nucleic acids sequence of composite coding wild-type eosinophilic granulocyte chemotactic protein aminoacid sequence.The RNA molecule of transcribing from this novel nucleic acids sequence does not have the ACA sequence.Referring to Figure 35, SEQ ID NO:30-31 (being respectively the nucleic acid and the aminoacid sequence of sophisticated human eosinophilic granulocyte chemotactic protein).The nucleic acid of the human eosinophilic granulocyte chemotactic protein of this encoding mature is cloned in the cold shock carrier (pCOLDI), and this carrier is hatched at low temperatures, expressing protein when IPTG exists.Referring to Figure 36.The significant advantage of this expression system is that low nonspecific proteins is expressed background.

[0370] nucleotide sequence that is to be understood that the coding target polypeptides can use various method to produce.These methods comprise: design and produce the synthetic nucleic acid sequence of the desired polypeptides of can encoding, nucleotide sequence does not wherein have the ACA sequence; And separate the nucleotide sequence of the desired polypeptides of can encoding and each ACA series jump wherein is another triplet sequence, wherein these sudden changes are silent mutations with regard to changing the coded aminoacid sequence of nucleic acid.

[0371] material and method

[0372] using pCold I carrier to carry out cold shock induces

[0373], induces the expression of gene of controlling by this controlling element so add 1mM IPTG because pCold I carrier comprises the lac operon.For some albumen, preferably when reaching mid-log phase (OD600=0.4-0.7), cell induces, to improve Protein Folding at 15 degrees centigrade.In order to determine to be suitable for the condition of optimum protein matter output,, analyze with SDS-PAGE inducing the different time sampling in back.Usually, when expression was induced, cell was cultivated in the LB substratum, but used radio isotope at needs, for example ¹⁵N or ¹³During the C labelled protein, use M9 or MJ9 substratum.

[0374] shown below here from the SD site of pColdI carrier to the nucleotide sequence of multiple clone site.Expressed protein is held the deleted sequence that comprises 15 residues at N, and it is by a downstream box (DB, it is that translation strengthens cis element), His ₆Label and Xa factor site are formed, and are multiple clone site afterwards.

GAGG SD

The sequence in TAATACACC SD downstream (SEQ ID NO:29)

ATGAATCACAAAGTG DB(SEQ?ID?NO：30)

CATCATCATCATCATCAT His ₆(SEQ?ID?NO：31)

ATCGAAGGTAGG factor Xa site (SEQ ID NO:32)

CATATGGAGCTCGGTACCCTCGAG?GGATCC

NdeI SacI KpnI XhoI BamHI

GAATTCAAGCTTGTCGACCTGCAGTCTAGA multiple clone site (SEQ ID NO:33)

EcoRI?□HindIII?SalI?PstI?XbaI

[0375] in order to make up pCold (SP) eosinophilic granulocyte chemotactic protein (being also referred to as pSPSeotaxin here), more than shown in two ACA sequences that show with bold Italic be changed and be ATA, to remove the recognition site of MazF interferases.

[0376] is to be understood that method of the present invention can be used in any expression vector or expression vector system (for example pET carrier).PCold I carrier proposes as exemplary carrier, and the purpose of above embodiment is not a restriction category of the present invention.

[0377] about the special methodology details of accompanying drawing

[0378] Figure 37 comprises the e. coli bl21 (DE3) of pACYCmazF or comprise pACYCmazF and the e. coli bl21 (DE3) of pCold (SP) eotaxin is cultivated in containing suitable antibiotic M9-dextrose culture-medium.OD when culture ₆₀₀Reach at 0.5 o'clock, culture is transferred in 15 degrees centigrade and was cultivated 15 minutes, to wherein adding 1mM IPTG.Shown in the timed interval, take out 1 milliliter of culture, join and contain 10uCi ³⁵In the test tube of S-methionine(Met), hatched (pulse) afterwards, add 0.2 milliliter of 50 mg/ml methionine(Met), hatch 5 minutes (tracking) at 15 minutes.Use the cell of M9-dextrose culture-medium rinsing mark, be resuspended in then in the SDS-PAGE sample-loading buffer of 100 microlitres.Each sample is got 10 microlitres and is analyzed with SDS-PAGE, carries out autography afterwards.

[0379] result

[0380] pCOLDI that comprises the novel nucleic acids sequence of the human eosinophilic granulocyte chemotactic protein of encoding mature is used as template.Referring to Figure 36.The plasmid that produces is named as pCold (SP) eotaxin.Use comprises the plasmid pACYCmazF of the mazF gene under the control of T7 promotor, the expression of inducing MazF.E. coli bl21 (DE3) cell that comprises pACYCmazF self or pACYCmazF and pCold (SP) eotaxin is cultivated in containing suitable antibiotic M9-dextrose culture-medium.OD when culture ₆₀₀Reach at 0.5 o'clock, culture is transferred in 15 degrees centigrade and was cultivated 15 minutes, to wherein adding 1mM IPTG.Shown in the timed interval, take out 1 milliliter of culture, join and contain 10uCi ³⁵In the test tube of S-methionine(Met), in the presence of mark, hatch after (pulse) 15 minutes, add 0.2 milliliter of 50 mg/ml methionine(Met), hatch 5 minutes (tracking).Use the cell of M9-dextrose culture-medium rinsing mark, be resuspended in the SDS-PAGE sample-loading buffer of 100 microlitres then.Get 10 microlitres in each sample and analyze, carry out autography afterwards with SDS-PAGE.As former (the Zhang et al.2003, the same) that reports, it is proteinic synthetic in BL21 (DE3) cell that the mazF expression of gene has suppressed.But mature human's eosinophilic granulocyte chemotactic protein (by the mRNA coding that does not comprise the ACA sequence) is synthetic not by the expression inhibiting of mazF.Referring to Figure 37.This result's proof can use single protein preparation method of the present invention to obtain a large amount of single albumen.

[0381] importantly, carried out parallel experiment, e. coli bl21 (DE3) cell that wherein only comprises pCold (SP) eotaxin is cultivated in containing suitable antibiotic M9-dextrose culture-medium.These experiments have shown that MazF is expressed in the effect in this system.When the cell that carries pCold (SP) eotaxin during by cold shock, has not simultaneously produced lot of background e. coli protein with human eosinophilic granulocyte chemotactic protein there being MazF to induce.As described herein-in, when MazF and eosinophilic granulocyte chemotactic protein were together induced, the cell protein background was significantly reduced.After 3 hours MazF induced, the background protein expression had almost been removed fully, had produced to continue only to express the cell that single albumen is human eosinophilic granulocyte chemotactic protein.

[0382] expression of eosinophilic granulocyte chemotactic protein continues at least 72 hours, does not change in the generation speed of preceding 36 hours eosinophilic granulocyte chemotactic proteins, shows that cell protein synthetic ability almost be not subjected to the influence that MazF expresses in 3 days.This proof, the needed rrna of protein synthesis, tRNA, every other cellular component all are not subjected to the influence of MazF inductive.These results also mean energy metabolism and Nucleotide is synthetic and amino acid whose biosynthesizing, the influence that not expressed by MazF.

[0383] it should be noted that also expressing 72 hours of derivative cell culture at MazF hatches in the process OD ₆₀₀(0.5) do not increase, show that the growth of cell after MazF induces is suppressed fully, and cell has kept intact protein synthesis capacity.But there be not under the MazF inductive situation OD ₆₀₀Be elevated to 1.2 from 0.5 in 72 hours incubation times of 15 degrees centigrade, this can find out from the generation of background cell protein.

[0384] in order to determine the generation level of eosinophilic granulocyte chemotactic protein in above expression system, separates the culture of same amount, analyze with SDS-PAGE.After the cold shock 36 hours, the eosinophilic granulocyte chemotactic protein band of a clear dyeing has appearred, account for about 5% of total cell protein.These results are to use M9 minimum medium described above to obtain.Use the M9 substratum for use ¹³C glucose and ¹⁵It is important that N ammonium chloride carries out proteinic isotopic enrichment.But if desired be the unlabelled protein of mass production, can use nutritional medium, for example the LB substratum.Really, inventor of the present invention has been found that the culture of hatching in the LB substratum, and the output of eosinophilic granulocyte chemotactic protein can be up to the 20% or 40 mg/litre cultures (the per 25 liters of cultures of 1 gram) of total cell protein.The eosinophilic granulocyte chemotactic protein that is important to note that the cell generation of hatching in M9 or LB substratum is completely soluble, does not form inclusion body.

[0385] as indicated in top, the cell quality does not increase in the process of hatching, because cell is grown and suppressed fully in cold shock is hatched.Therefore the cell machine is used for single protein production system of the present invention (SPP) the cold shock production of cloned genes in the pCold carrier afterwards fully.Therefore, after MazF induces, cell culture can be concentrated under the condition that the cell growth occurs and keep the inconsistent degree of survival with cell.Really, inventor of the present invention can concentrate at least 4 times of (OD with the culture of exponential growth after measured ₆₀₀From 0.7 to 2.8) do not influence the output of clone gene product.This means the substratum that can use the used substratum 25% of normal culture that the cell growth occurs.In other words, might only use 6.5 liters LB substratum to produce the 1 people's eosinophilic granulocyte chemotactic protein that restrains.This is the advantage that there is special important meaning in SPP of the present invention system, because these characteristics have obviously reduced the enrichment expressing a large amount of albumen or the be used for NRM structural research required cost of isotopic albumen.

[0386] acellular expression system: rabbit reticulocyte, wheatgerm and colibacillary extract comprise the cell free translation system of normal use.All extracts all are prepared as crude extract, comprise exogenous RNA and translate necessary macromolecular components (70S or 80S rrna, tRNA, aminoacyl-tRNA synthetase, initial, extension and terminator factor or the like).Generally in each extract, replenish amino acid, energy derive (ATP, GTP), energy-regenerating system (for eukaryotic system is phosphocreatine and creatine phosphokinase, is phosphoenolpyruvic acid and pyruvate kinase for the intestinal bacteria lysate) and other cofactor (Mg for example ²⁺, K+, etc.) to guarantee effective translation.

[0387] employed genetic material (for example RNA or DNA) has determined that any in the method for two kinds of external protein synthesis is useful.The translation system of standard, for example reticulocyte lysate uses RNA as template, and " link coupled " uses dna profiling to be transcribed into RNA with " connection " system, and then translation RNA.

[0388] rabbit reticulocyte lysate: rabbit reticulocyte lysate is the effective external eukaryotic protein synthesis system that is used for exogenous RNA (natural or through engineering approaches) translation.Reticulocyte is the tool karyocyte of eggcase, and function mainly is the synthetic of oxyphorase in their body, and oxyphorase occupies more than 90% of reticulocyte synthetic proteins.These immature red corpuscle have preparation a large amount of sphaeroprotein necessary all machines, comprise the sphaeroprotein mRNA of capacity and the component of cell translation system (above describe in detail and known in the art) here.Can by with Ca ²⁺The micrococcal nuclease that relies on is hatched jointly, removes endogenous sphaeroprotein mRNA, afterwards by adding EGTA chelating Ca ²⁺Make the micrococcal nuclease inactivation.Even the lysate that this nuclease is handled shows low background and under lower concentration to effective utilization of exogenous RNA.Foreign protein synthetic speed is close with observed synthesis rate in complete reticulocyte.Can use and handle or untreated reticulocyte lysate, from adding cap or not adding the synthetic bigger protein of RNA (eucaryon or virus) of cap.

[0389] wheat malt germ extract: because endogenous mRNA level is low, makes wheat malt germ extract have minimum background and integrate, so it is a replacement easily of rabbit reticulocyte extract.Wheat malt germ extract is translated the exogenous RNA from various different organisms effectively, comprises that those derive from virus, yeast, higher plant and mammiferous RNA.When translation contained the double-stranded RNA small segment or suppress the RNA of oxidation mercaptan of rabbit reticulocyte lysate, it was a preferred systems.

[0390] add cap or do not add the RNA template of cap: reticulocyte lysate and wheat malt germ extract are the effective systems of the RNA of translation in-vitro transcription or the RNA that extracts from cell or tissue.When using external synthetic RNA, it is active that the existence of 5 ' cap sequence may improve translation.Compare with the reticulocyte lysate extract, use the translation of wheat malt germ extract generally more to depend on cap.If think that the RNA cap is essential, then can be in prokaryotic vector with the encoding sequence subclone, it can directly directly be expressed from the dna profiling of intestinal bacteria cell free system, thereby realizes that RNA adds cap.

[0391] in the translation reaction of standard, purified RNA is as the template of translation.And on the other hand, " connection " or " link coupled " system uses DNA as template.Rna transcription is from DNA, and is translated subsequently and need not any purifying.This system needs the phage polymerase promoter (T7, T3, or SP6) of template DNA and protokaryon usually.RNA polymerase (for example RNA polymerase of protokaryon phage) is transcribed into RNA with DNA, and the extract of eucaryon or protokaryon is translated as protein with RNA.Be used for transcribing: the dna profiling of translation reaction can be cloned into plasmid vector or be produced by PCR." connection " system is a two-step reaction, comprises using transcribing and the next translation in rabbit reticulocyte or wheatgerm lysate of phage polysaccharase.Transcribe with translation reaction and can carry out respectively or coupling mutually.

[0392] intestinal bacteria extract: with transcribe and translate the eukaryotic system that carries out continuously different be in Bacillus coli cells, to transcribe and translate simultaneously and take place.What therefore external intestinal bacteria translation system related to is single step reaction.In transcribing, 5 of RNA ' end can be used for ribosomal combination, is used for translation then, and its 3 ' end is still being transcribed.Previously the rrna that is attached on the RNA has kept the stability of transcription product, and has promoted effective translation.Therefore, the translation system of bacterium is very suitable for expressing fast the gene product of protokaryon or eucaryon.In a preferred embodiment, the Shine-Dalgarno ribosome bind site is included in the upstream of used dna profiling initiator codon, to cause high protein output and best initial fidelity.The intestinal bacteria translation system does not need eucaryotic RNA to add cap.

[0393] the intestinal bacteria extract also has other benefit, and promptly cross reactivity or other problems relevant with the intrinsic protein in the eucaryon lysate are reduced or remove.And intestinal bacteria S30 extract system can express from the dna vector that comprises natural escherichia coli promoter sequence (for example lac or tac).The intestinal bacteria cell free system is made up of the crude extract that is rich in endogenous mRNA.Be used to transcribe in order to prepare this extract/translate, it is hatched, to translate endogenous mRNA, next endogenous mRNA is degraded.The low-level endogenous mRNA that produces in the lysate of this preparation makes it possible to find external source synthetic product.

[0394] eukaryotic translation signal: have some significant differences between protokaryon and the eukaryotic mrna transcription product, should pay attention to.Eukaryotic mrna generally has two kinds of modifications after transcribing: 5 ' 7-methyl GTP cap and 3 ' poly (A) tail.The purpose of these two kinds of modifications all is by stoping the prematurity degraded to make mRNA stable.5 ' cap sequence also combine the translation enhancing that makes mRNA by promoting that mRNA and eucaryon are ribosomal, and guarantee that correct AUG initiator codon is identified.Conserved sequence, perhaps " Kozak " sequence is generally considered to be rrna binding signal the strongest in the eukaryotic mrna.For initial translation effectively, crucial element is the G residue of Kozak sequence+1 and-3 A residue.The mRNA that lacks the Kozak concensus sequence might effectively be translated in the eucaryon cell free system, if this mRNA comprises the 5 ' non-translational region (UTR) of the moderate-length of not stablizing secondary structure.

[0395] protokaryon translation signals: in bacterium, rrna is guided on the AUG initiation site by the zone of being rich in purine that is called as Shine-Dalgarno (SD) sequence.3 of 16S rRNA in this sequence and the 30S ribosomal subunit ' holds complementary.The SD zone is positioned at the upstream of AUG initiator codon, comprises concensus sequence as known in the art.Special mRNA with the number of the anti-Shine-Dalgarno sequence complementary Nucleotide of 16S rRNA on very big difference is arranged, from few to 2 to 9 or more.Ribosome bind site (RBS) with respect to the position of AUG initiator codon (usually from initiation site A begin-6 to-10) for the efficient of translation, be very important.

Example VII A

[0396] the present invention has also comprised the preparation method of little single stranded RNA in a large number, and this method relates to simple biochemical step.Developing this method makes and for example not to need a large amount of siRNA of expensive chemosynthesis step or the production of miRNA to become possibility.

[0397] in brief, use the synthetic RNA that comprises a plurality of placed in-line little identical sequences of t7 rna polymerase.Tandem repetitive sequence among the RNA is separated by the triplet sequence, and the triplet sequence can be by mRNA interferases of the present invention, for example MazF (special cutting ACA sequence) or the special cutting of PemK (special cutting is the UAC sequence for example).Next use the mRNA interferases that the RNA that comprises the tandem repetitive sequence that is separated by interferases recognition sequence (being special triplet sequence) is handled, the site that interferases identification is mixed will produce identical little RNA like this.

Experimental technique

The preparation of the CAGGAGAUACCUCAAUGAUCA of 21 bases (SEQ ID NO:34)

Step 1: the dna fragmentation of synthetic following two 21 bases (5 ' end is by phosphorylation)

11 211 10

5′p-CTCAATGATCACAGGAGATAC-3′(SEQ?ID?NO：35)

3′-TCCTCTATGGAGTTACTAGTG-p?5′(SEQ?ID?NO：36)

Step 2: connect to obtain polymer

Step 3: use following two primers to carry out PCR:

1 12

#1 5 '-(T7 promotor)-GGGACAGGAGATACCT-3 ' (SEQ ID NO:37)

#2?3′-TGTCCTCTATGGAGTTACTAGTG-5′(SEQ?ID?NO：38)

Step 4: use t7 rna polymerase to produce RNA from the dna fragmentation of step 3

Step 5: with the RNA product of MazF processing reaction step 4 and the product of purifying 21 bases.

[0398] uses for some, may be to use the t7 rna polymerase and/or the MazF of band His label preferably, can use the nickel chromatography column that they are separated from reaction mixture like this.

[0399] technician will appreciate that existing the ACA triplet to hinder use MazF in target RNA sequence inside digests RNA as interferases.In this case, for example can use for the sequence-specific PemK of UAC (U or A) triplet, rather than MazF.In a word, should analyze recognition site to the RNA sequence of being studied with (if any) the known RNA interferases of determining which type of has.Such analysis is useful when can be used in the application that relates to a certain RNA for which kind of RNA interferases of evaluation.

[0400] therefore the invention describes the method for using simple biochemical method to prepare the little RNA of a large amount of high quality (for example siRNA or miRNA).Equally, this method provides cost replacement method to one's profit for the method for the little RNA of chemosynthesis of expensive and technical complexity.

Example VII A I

[0401] use mRNA interferases inducing cell death: with sequence-specific mode incising cell mRNA, and arrestin matter synthetic effectively causes the inhibition of cell growth and the death of cell when being induced for MazF and PemK.Verified in yeast, Africa xenopus and people's cell PemK (Kid) expression inhibiting the propagation of cell.Coexpression PemI (Kis) has recovered cell proliferation in these cells, thereby cell is discharged from the inhibition of PemK (dela Cueva-Mendez et al., 2003, the same).As following described, checked that MazF induces the effect to people's cell here.Although used inducing of the control MazF of T-Rex system (Invitrogen) in this embodiment, may be used among the present invention but the technician is to be understood that any inducible system.But many experiments considerations are depended in the selection of inducible system, comprise, but are not limited to, and induce the cell type that will work, required expression level and inductive kinetics.

[0402] plasmid and clone: intestinal bacteria mazF gene clone under the control of tetracycline operator TetO2, produces plasmid pcDNA4/TO-MazF in pcDNA4/TO carrier (Invitrogen).Plasmid pcDNA4/TO-MazF is transformed in the T-Rex-293 cell (Invitrogen), produces T-Rex 293/MazF clone, in this clone, adds the expression that tsiklomitsin can be induced MazF.Intestinal bacteria mazE gene clone produces plasmid pcDNA3-MazE in the pcDNA3 carrier.PcDNA3-MazE is transformed in the T-Rex 293/MazF cell, produces T-Rex 293/MazF/MazE clone.

[0403] MazF is to human cell's toxic action: in the expression of inducing MazF in the presence of the tsiklomitsin in T-Rex 293/MazF cell.In the different moment, (expect blue solution for 0.4%, Sigma) dead cell among the painted method pair cell group is counted by using the cytoactive staining agent.Simultaneously parallelly under the same conditions carry out control experiment, but do not have tsiklomitsin.As shown in figure 38, compare, at the MazF inductive remarkable change was just arranged in first day by the form of the T-Rex 293/MazF cell of abduction delivering MazF with the form of contrast (not inducing) cell.Attractively be, nearly 50% dead in the time of five days by the cell to the of abduction delivering MazF, 80% inducing cell death (Figure 38) is arranged during by the 7th day.These results show that MazF is virose for people's cell.

[0404] present invention includes use, but the expression of these mRNA interferases produces response to the induction regulating controlling element or is regulated and control by these elements to any suitable mRNA interferases.Suitable mRNA interferases comprises that those can mediate the mRNA interferases of toxic action when expressing in cell.In a specific embodiment, the cell of expressing the mRNA interferases is a mammalian cell.The exemplary mRNA interferases of the present invention comprise intestinal bacteria MazF directly to homologue and homologue.

[0405] therefore, the present invention also is included in and uses mRNA interferases of the present invention in the application that relates to gene therapy.The cell of being expressed certain molecule (this molecule study subject for example defectiveness or disappearance among the people experimenter) by through engineering approaches can be designed to by the mixing and the cell of self-destruction of mRNA interferases of the present invention, the expression of interferases is controlled by derivable controlling element.Be used for providing the mechanism of automatic anti-fault in the integration that gene therapy use to destroy the induced means of cell, by this mechanism, after these cells have produced useful effect to study subject and/or before they may produce deleterious effect, promptly be eliminated.

Example I X

[0406] generation of MazF mutant: produced MazF mutant (E24A), 24 L-glutamic acid (Glu) are wherein replaced by L-Ala (Ala).This results of mutation is to have reduced about 10 times by the mRNA interferases activity that synthetic substrate is measured.Based on a variety of causes, the active reduction of MazF is important.The first, because sudden change, MazF (E24A) mutant significantly reduces the toxicity of the host cell of expressing it.Toxicity reduces the expression level that makes MazF mutant in the cell and improves.When for example using pET 28a system, obtained quite high MazF output (about 15 mg/litre behind the purifying).This high expression level is very important for obtaining quite a large amount of MazF, MazF can by ¹⁵N and ¹³C carries out double-tagging and is used for the NMR structure determination.The second, the low mRNA interferases activity of mutant MazF is important for the RNA interaction sites of measuring on the MazF dimer, by the RNA substrate is joined ¹⁵N and ¹³Carry out this mensuration in the MazF sample of C mark.The 3rd, because mutant MazF has kept mRNA interferases activity, the structure of mutant MazF may be similar to the dimeric three-dimensional structure of wild-type MazF, and itself and RNA compound structure expection meeting provide information to the molecular mechanism of the mRNA interferases function of MazF.

[0407] expression of mutant MazF uses pET 28a to carry out, and product contains the extension (Figure 39 A) of 20 residues of N end like this, extends and contains His label and zymoplasm cleavage site.Can from fusion rotein, the extension of N end be scaled off, shown in Figure 39 B.Arrow among Figure 39 A has shown the zymoplasm cleavage site.For MazF (E24A) fusion rotein that cuts total length, the zymoplasm of 0.04 unit is joined (His) of 10 microgram Ni-NTA purifying ₆Among the MazF (E24A), hatched 8 hours at 4 degrees centigrade.Use the Ni-NTA chromatography column to remove the N end fragment that scales off.Figure 39 has shown (swimming lane 1, (His) of purifying of separating that successfully cuts with the MazF fusion rotein that cuts ₆MazF (E24A); Swimming lane 2, (His) after the zymoplasm cutting ₆MazF (E24A)).N end extend remove before and remove after the single quantum of heteronuclear relevant (heteronuclear single quantum coherence) (HSQC) spectral line demonstration protein all be stable in the week at room temperature.

[0408] in addition, prepared Arg29 by Ala alternate MazF mutant.Find that this mutant (R29A) compares toxicity with wild-type MazF reduction is also arranged, this makes it can be by overexpression.Purifying for example ¹⁵The MazF of N mark (R29A) prepares, and expression level is 10 mg/litre.This mutant has also obtained extraordinary hsqc spectrum line.

Embodiment X

[0409] evaluation and the property research of the MazF homologue in the malignant bacteria

Evaluation and property research from the MazF homologue of mycobacterium tuberculosis: tuberculosis is the chronic infection disease, causes the death more than 2,000,000 its every year.It may be one of ancient disease of the mankind, is caused by mycobacterium tuberculosis.Inventor of the present invention has identified a gene (rv2801c) on the karyomit(e) of mycobacterium tuberculosis, the albumen of this genes encoding and intestinal bacteria MazF height homology.Especially, inventor of the present invention cloned the rv2801c gene and determine this genes encoding contain 118 amino acid whose albumen and intestinal bacteria MazF has 40% consistence.Referring to Figure 41 A.Mycobacterium tuberculosis MazF gene (called after MazF-mt1 here) has been cloned among the pBAD; For the response of pectinose inductive, the MazF-mt1 that expresses from the pBAD carrier is virose for intestinal bacteria.Importantly, the colony-forming unit of cell (CFU) has reduced about 10 after MazF-mt1 induces 60 minutes ⁴Doubly.MazF-mt1 also is cloned among the pET28a, and successful expression have (His) ₆The MazF-mt1 of label, and on the Ni-NTA chromatography column purifying.

[0410] as shown in figure 40, MazF-mt1 shows the specificity at UAC sequence place cutting RNA, and this specificity to PemK is similar.Therefore, a member of the interferases of the mRNA really family protein of MazF-mt1.In brief, use the synthetic era mRNA of t7 rna polymerase, according to the present invention in above description carry out cleavage reaction.Use identical primer to obtain primer extension and dna ladder degree.The cleavage site of MazF-mt1 is represented with arrow.

[0411] except the MazF-mt1 gene, inventor of the present invention has also found other four MazF homologues by the mycobacterium tuberculosis chromosome coding, and its genome name is respectively Rv0456A, Rv1991C, Rv0659C and Rv1942C.Referring to Figure 41 B.The sequence alignment of these genes and MazF shows that each all is the homologue of intestinal bacteria MazF in these sequences, therefore is accredited as the MazF homologue of mycobacterium tuberculosis.By Rv1991c, Rv0456a, the MazF homologue of Rv0659c and Rv1942c coding be by called after MazF-mt2 respectively ,-mt3 ,-mt4 and-mt5.MazF-mt1, mt2 ,-mt3 ,-mt4 and-nucleic acid of mt5 and aminoacid sequence be shown in Figure 43 A-E and Figure 44 A-E.

[0412] coding MazF-mt2 ,-mt3 ,-mt4 and-gene of mt5 will be cloned in the pBAD carrier, also will according to the front for the description of MazF-mt1 check in the presence of pectinose, induce their express after their influences that intestinal bacteria are grown.Also can use mRNA cutting in Northern trace and the body of primer extension analysis inspection after mycobacterium tuberculosis MazF homologue is induced according to above detailed description.Can check that also external the and body internal protein under the existence of mycobacterium tuberculosis MazF homologue synthesizes.

In [0413] five mycobacterium tuberculosis MazF gene each all can be cloned into mycobacterium expression vector pMIP12 (Picardeau et al. (2003) FEMS MicrobiolLett 229,277-281), make them at M. smegmatics (Mycobacteriumsmegmatis) (non-pathogenic bacteria, the model rapidly of growing, belong to Mycobacterium) the middle expression, detect them at the toxic action in this bacterium under the different growth conditionss.What is interesting is especially how the gene of explaination MazF-mt is regulated and control in mycobacterium tuberculosis.Tubercule bacillus pathogenic depends on that the granulomatous formation of lung, granuloma are tubercule bacilluss and are being in because the position that exists during the non-growth conditions that restriction caused of oxygen and nutritive substance.Understanding tubercule bacillus is very important at this preclinical physiology for the diagnosis and the treatment that improve this destructive disease.Under different growth conditionss, carry out the dna microarray analysis of mycobacterium tuberculosis gene, to determine how the MazF-mt gene is regulated and control when these conditions generations are replied.

[414] the right redundancy of the oxin-antitoxin of bacterium points out them to play an important role in cell physiological.After deliberation various growth conditions, with the gene of finding these molecules of coding by the conditions in vitro of abduction delivering.One of derivative condition of many research prompting mazF depends on ppGppp and rigorous replying.For example, the not death after the level of artificial rising ppGppp that is intestinal bacteria mazEF deletion mutant of the observations of a very early time (Aizenman et al., 1996, the same).The relA gene of the mycobacterium tuberculosis of coding ppGpp synthetic enzyme is cloned and has been carried out property research, show its in external long-term surviving, work (Primm et al., 2000, J Bacteriol 182,4889-4898).The level of ppGpp (p) raises under the condition that those researchist's proofs are enumerated below all.In order to extend these discoveries, with the transcription response of research MazF homologue to various different growth conditionss, preparation RNA from toxicity mycobacterium tuberculosis (bacterial strain H37Rv), in order to the condition of listing down RNA is handled, carry out the transcription response of quantitative polyase chain reaction (Q-PCR) research MazF homologue.

[0415] growth conditions

[0416] stationary phase: the H37Rv cell is common mycobacterium substratum (Middlebrook 7H9 has added 0.2% glucose, 0.2% glycerine, 0.5%BSA level V branch and 0.1%Tween80).Reaching OD ₆₀₀After, (doubling time of mycobacterium tuberculosis is about 24 hours) is stationary phase of 3 days, prepares total RNA of cell afterwards.The contrast of this experiment is the RNA of the cell of mid-log phase growth.

Trinitride: mid-term, the H37Rv cell of logarithmic growth was divided into two cultures: a 5mM of use sodiumazide was handled 2 hours.

Carbon hunger: with the 7H9 substratum rinsing of no carbon source in early days to the H37Rv cell of logarithmic phase in mid-term, and resuspended 24 hours with this substratum.

The amino acid downward modulation: the H37Rv cell grows to mid-log phase in the 7H9 substratum that adds 20 seed amino acids.Culture is divided into two parts with the abundant rinsing of no amino acid whose substratum, adds fresh containing amino acid and do not have amino acid whose substratum respectively, cultivates 24 hours.

Amino acid starvation: the Bacillus coli cells that uses Serine hydroxymate to handle makes it to L-Serine hunger, has shown that such intestinal bacteria are by abduction delivering mazEF locus (Christensen et al., 2003, the same).The mycobacterium tuberculosis that uses Serine hydroxymate to handle does not show the rising of ppGpp (p), point out these species may be insensitive to the toxicity of this amino acid analogue (Primm et al., 2000, the same).Will induce the ability of MazF-mt homologue to detect to amino acid analogue with toxic action of having identified.

Antibiotic treatment: detect the known microbiotic that in mycobacterium tuberculosis, influences protein synthesis (Streptomycin sulphate) and rna transcription (Rifampin), in H37Rv, induce the ability of MazF homologue.

In the population in the whole world 1/3rd, mycobacterium tuberculosis exists with latent state, is closed in the granuloma, infer its can not touch nutritive substance or oxygen (Flynn andChan, 2001, Annu Rev Immunol 19,93-129).(for example HIV state, malnutrition etc.) then disease will be activated again if host's immunity system suffers damage for a certain reason.

Cause watchful to be that be subjected to the zone of HIV puzzlement in the world, the tuberculosis case of hiding increases gradually, these cases have resistance to many medicines, therefore are difficult to or can not treat.Therefore, understand the mechanism of controlling these direct bacterial growth control endogenous mechanism, provide huge hope for the novel therapies of developing this destructive disease of treatment.

Therefore, determine that endogenous MazF-mt gene hiding and activating/effect in the state of activation again, can and/or find that the surrogate therapeutic factor provides Useful Information for design.Inventor of the present invention has also used blast search, finds that the MazF homologue is present in many prokaryotic organism bodies, and the pathogenic agent that comprises other is streptococcus aureus and Bacillus anthracis for example.Referring to Figure 41.Especially, inventor of the present invention has found the homologue MV1993 (MazF-sal) of MazF in streptococcus aureus.Referring to Figure 41 B.Streptococcus aureus is a gram positive bacterium, and it is the most common Gram-positive pathogenic agent that causes nosocomial infection in hospital.The consistence of intestinal bacteria MazF and MazF-sal demonstration 25% and 44% similarity.

In addition, the MazF homologue also is found in Bacillus anthracis and subtilis.Referring to Figure 41 B.Homologue (MazF-bsl) in intestinal bacteria MazF and its subtilis shows 32% consistence and 48% similarity, shows 32% consistence and 48% similarity with homologue (MazF-bal) in its Bacillus anthracis.Bacillus anthracis and subtilis all are gram positive bacteriums.Have only 7 amino acid replacements between MazF-bsl and the MazF-bal.The difference that has shown aminoacid sequence and position among Figure 41 B, and here described in detail: what at first show is the single-letter abbreviation of MazF-bsl residue, be the position of numeral then, be the single-letter abbreviation (A42V of MazF-bal residue then, R66K, D97E, E98V, D101I, K102R and A112G).Streptococcus aureus, subtilis, the nucleic acid and the aminoacid sequence of the MazF in the Bacillus anthracis (class Pem) homologue, and intestinal bacteria ChpBK sequence is shown among Figure 45 A-D and Figure 46 A-D.

Embodiment XI

The optimization of SPP system in the intestinal bacteria

Can be by changing different growth conditionss (and other experiment parameter), intestinal bacteria SPP of the present invention system is optimized, be used to express different proteins.The technician should be appreciated that the target that will reach about this respect comprises: (a) MazF induces back cell protein synthesis capability to keep the prolongation of phase; (b) synthetic and (c) raising of desirable proteins expression level of reduction or removal background cell protein.It should also be understood that SPP of the present invention system may comprise the expression of the mRNA interferases of non-MazF.Also can under the background of SPP, consider to have and help to express and/or the coexpression factor of product stability, so that the expression level that target polypeptides is improved or optimizes.

Inventor of the present invention has changed MazF and has induced many culture condition afterwards, with the proteinic production of optimization aim.Although these Experimental design are to optimize the expression of people's eosinophilic granulocyte chemotactic protein, these principles are applicable to other proteic expression too well.Beginning uses the gene of the synthetic eosinophilic granulocyte chemotactic protein of codon of intestinal bacteria preference, but removed ACA sequences all in the gene.The synthetic gene clone makes that being displaced downwardly to 15 degrees centigrade in cold shock or temperature can express the eosinophilic granulocyte chemotactic protein after inducing in the pColdI carrier.Use this eosinophilic granulocyte chemotactic protein system, the change condition prolongs the expression of eosinophilic granulocyte chemotactic protein after MazF induces, as following description.

Inventor of the present invention has determined after 37 degrees centigrade are induced MazF 15 degrees centigrade of productions of eosinophilic granulocyte chemotactic protein of having induced the remarkably influenced of eosinophilic granulocyte chemotactic protein.Especially, induce MazF and 37 degrees centigrade of relatively demonstrations of inducing MazF for 15 degrees centigrade, under comparatively high temps, induce MazF significantly to reduce owing to the synthetic background that causes of general cell protein.The evidence of this discovery is that almost do not have can detected protein band corresponding to expression of cellular proteins.But under these experiment conditions, the synthetic of eosinophilic granulocyte chemotactic protein but significantly descends.Under higher temperature, MazF may because of, for example rrna/tRNA is more responsive to the ribonuclease activity of MazF under higher temperature; And/or the reduction of 37 degrees centigrade of synthetic needed other cellular component stability of following protein synthesis, Nucleotide and amino acid bio, and the reason pair cells such as energy generation under 37 degrees centigrade produce destruction.

Because these factors can not produce in the cell after MazF induces, their forfeiture or minimizing will cause the decline of eosinophilic granulocyte chemotactic protein throughput.

In order to optimize protein expression, can change a series of experiment parameter, comprise experiment parameter described below.What be to be understood that the description of following condition relates to is MazF and eosinophilic granulocyte chemotactic protein, but is applicable to the combination of other mRNA interferases and required polypeptide too well.Carry the e. coli bl21 (DE3) of pACYCmazF and pCold (SP) eotaxin and cultivate in M9 minimum medium (each manages 15 milliliters of cultures), 37 degrees centigrade grow to mid-log phase (OD ₆₀₀=0.5 to 0.8).Under 37,30,25,20 and 15 degrees centigrade of 5 different temperature, induce MazF then.Preincubate added 1mM IPTG and induces MazF to express 5,10 and 15 minutes after 10 minutes under these different temperature.Under 15 degrees centigrade, keep culture then, induce the eosinophilic granulocyte chemotactic protein.After cold shock 0,0.5,1,2,4,8,12,24,36,48,72 and 96 hours with ³⁵S-methionine(Met) labeled cell 15 minutes.The SDS-PAGE of total cell protein analyze disclosed consider that the background cell protein is synthetic, the optimum condition of the SPP system after eosinophilic granulocyte chemotactic protein throughput rate and the eosinophilic granulocyte chemotactic protein production persistence.For the similar analysis of current detection and other polypeptide, use coomassie brilliant blue staining to estimate at each the eosinophilic granulocyte chemotactic protein that produces constantly or the actual amount of other polypeptide.

Intracellular protease is the activity of Lon and ClpP for example, also can influence proteinic accumulation and stability.Verified, for example sudden change among clpP and the lon (single mutation or two sudden change) significantly reduced the degraded of cell protein in the coli strain (Kandror et al., 1994, Proc Natl Acad Sci USA 94,4978-4981).Find according to these, can these sudden change transductions be gone in BL21 (DE3) cell, make up bacterial strain, improve the SPP system with these sudden changes (lon, clpP and lon-clpP) by the mode of P1 transduction.Therefore, check the accumulation (in this cell these proteinase genes one or more deleted) of polypeptide in BL21 (DE3) cell, can find after the eosinophilic granulocyte chemotactic protein is induced in the SPP system 3-4 days, the raising of protein output.Like this, can set up the specified conditions that are used for intestinal bacteria SPP system, synthetic with the cell protein of the highest production that obtains the eosinophilic granulocyte chemotactic protein and minimum background.And as described above here, this experimental program is applicable to other SPP systems that used different mRNA interferases and polypeptide equally well.

It is the production that improves MazF that another one reduces the measure of background cell protein synthetic.This purpose can reach by the ACA sequence of removing in the mazF gene, and the existence of ACA sequence may cause the degraded of MazF transcription product.Surprisingly, in 111 proteic mazF ORF of residue of coding, always have 9 ACA sequences.With regard to regard to possibility predicted frequency at random, the frequency of this ACA sequence is very high.

These ACA sequences may work in the self regulating and control of MazF, and in self regulating and control, MazF cuts in these ACA site of himself mRNA, causes the remarkable decline of MazF protein yield like this.Consider that according to these imagination is removed some or all ACA sequences among the mazF ORF.Referring to Figure 42.Importantly, the sequence change of imagining in MazF can not change the aminoacid sequence of MazF.Beginning uses the method for PCR-based to change preceding 6 residues that MazF N holds, and the gene of generation is named as mazFa.

Change three ACA sequences of C end independently, and the codon of the Leu99 that will encode changes into CUG from UUA, CUG is the more leucine codons of preference of intestinal bacteria.The gene that produces is named as mazFb.The combination results of mazFa and mazFb sudden change the mazFa.b that all are removed of all ACA sequences.

Use wild-type mazF, mazFa (6ACA), mazFb (3ACA) and mazFab (9ACA), can in the SPP system, measure the ACA sequence and from MazF, remove the effect that is produced.In experiment, the wild-type mazF gene among the pACYC mazF is replaced with mazFa, mazFb or mazFab.Use this four plasmids, just might check from mazF and to remove the ACA sequence how to reduce background effectively proteic synthetic.

In order to use the SPP system to obtain higher protein output, preferably use for example LB of nutritional medium, and do not use the M9 substratum.Therefore, the adjustment of experiment parameter is to be used for optimizing the condition of growing at the LB substratum.Can be according to above here description, optimize various growth conditions and be used for cultivation at the LB substratum.These conditions comprise, but are not limited to MazF inductive top condition, MazF inductive Best Times length, the optimum temperuture of eosinophilic granulocyte chemotactic protein production and the best incubation time that obtains maximum eosinophilic granulocyte chemotactic protein output.

Although to the description of these experiments is to use eosinophilic granulocyte chemotactic protein to produce as model system with their, it is possible different that different albumen reach the top condition of production peak.Therefore may need little experiment adjustment to obtain best expression level for each target protein.Can use other growth mediums well known by persons skilled in the art and the system combined use of SPP, and the expression in other substratum is optimized according to above description to M9 and LB substratum.

Just as described above, inventor of the present invention has had been found that another one is called PemK from the mRNA interferases of plasmid R100, and it is at UAC/A/U sequence place cutting mRNA.Referring to EXAMPLE IV.Identified many other mRNA interferases, comprised colibacillary ChpBK, from 5 of mycobacterium tuberculosis different mRNA interferases and from the mRNA interferases of Bacillus anthracis.

All mRNA interferases of listing above are the candidates that come in handy, and can be advantageously used in and improve the SPP system.In case it is clear that their RNA cleavage specificity is studied, can measure their validity in the SPP system, and compare with the effect of MazF.Because the expection of these mRNA interferases has different RNA cleavage specificities, they may be in that to reduce the background cell protein more effective, therefore little than the destruction of MazF pair cell aspect synthetic.These mRNA interferases are not only for the exploitation of SPP system in the intestinal bacteria, and also are useful instruments for the exploitation that comprises SPP system in the yeast at the other biological body.

Intestinal bacteria SPP described herein system has used the pColdI carrier, and it is the production of inducible protein at low temperatures.Protein production under the low temperature is useful for many albumen, because they are more effectively and stable folding usually under lower temperature.

And the coexpression molecular chaperones can further improve correct folding proteinic output in the SPP system.Purpose hereto, the gene that is called as the cold shock molecular chaperones that triggers the factor (Kandror andGoldberg, 1997, the same) have been cloned and have been used for SPP of the present invention system.Be considered to help at low temperatures proteic folding because trigger the factor, can in the SPP system, utilize coexpression to trigger the influence that the factor is expressed for desirable proteins.Trigger the gene of the factor and GroEL and GroES (heat shock molecular chaperones) and also will be cloned in the pColdI carrier, check proteinic output and the influence of expressed protein solubility.

Although some preferred embodiment of the present invention has been carried out above detailed description and special explaination, purpose is not to limit the present invention in these embodiments.Under situation about not departing from, can carry out various change as following category of the present invention that claim proposed and spirit.

Sequence table

<110>Inouye，Masayori

Zhang，Junjie

Zhang，Yong?Long

Qing，Guoliang

Suzuki，Motoo

＜120〉mRNA interferases and using method thereof

<130>University?of?Medicine?&?Dentistry?of?New?Jersey(601-1-131PCT)

<140>Not?yet?assigned

<141>2004-06-14

<150>60/543,693

<151>2004-02-11

<150>60/478,515

<151>2003-06-13

<160>92

<170>FastSEQ?for?Windows?Version?4.0

<210>1

<211>336

<212>DNA

＜213〉intestinal bacteria

<400>1

atggtaagcc?gatacgtacc?cgatatgggc?gatctgattt?gggttgattt?tgacccgaca?60

aaaggtagcg?agcaagctgg?acatcgtcca?gctgttgtcc?tgagtccttt?catgtacaac?120

aacaaaacag?gtatgtgtct?gtgtgttcct?tgtacaacgc?aatcaaaagg?atatccgttc?180

gaagttgttt?tatccggtca?ggaacgtgat?ggcgtagcgt?tagctgatca?ggtaaaaagt?240

atcgcctggc?gggcaagagg?agcaacgaag?aaaggaacag?ttgccccaga?ggaattacaa?300

ctcattaaag?ccaaaattaa?cgtactgatt?gggtag 336

<210>2

<211>111

<212>PRT

＜213〉intestinal bacteria

<400>2

Met?Val?Ser?Arg?Tyr?Val?Pro?Asp?Met?Gly?Asp?Leu?Ile?Trp?Val?Asp

1 5 10 15

Phe?Asp?Pro?Thr?Lys?Gly?Ser?Glu?Gln?Ala?Gly?His?Arg?Pro?Ala?Val

20 25 30

Val?Leu?Ser?Pro?Phe?Met?Tyr?Asn?Asn?Lys?Thr?Gly?Met?Cys?Leu?Cys

35 40 45

Val?Pro?Cys?Thr?Thr?Gln?Ser?Lys?Gly?Tyr?Pro?Phe?Glu?Val?Val?Leu

50 55 60

Ser?Gly?Gln?Glu?Arg?Asp?Gly?Val?Ala?Leu?Ala?Asp?Gln?Val?Lys?Ser

65 70 75 80

Ile?Ala?Trp?Arg?Ala?Arg?Gly?Ala?Thr?Lys?Lys?Gly?Thr?Val?Ala?Pro

85 90 95

Glu?Glu?Leu?Gln?Leu?Ile?Lys?Ala?Lys?Ile?Asn?Val?Leu?Ile?Gly

100 105 110

<210>3

<211>333

<212>DNA

＜213〉intestinal bacteria

<400>3

atggaaagag?gggaaatctg?gcttgtctcg?cttgatccta?ccgcaggtca?tgagcagcag?60

ggaacgcggc?cggtgctgat?tgtcacaccg?gcggccttta?atcgcgtgac?ccgcctgcct?120

gttgttgtgc?ccgtaaccag?cggaggcaat?tttgcccgca?ctgccggctt?tgcggtgtcg?180

ttggatggtg?ttggcatacg?taccacaggt?gttgtacgtt?gcgatcaacc?ccggacaatt?240

gatatgaaag?cacggggcgg?aaaacgactc?gaacgggttc?cggagactat?catgaacgaa?300

gttcttggcc?gcctgtccac?tattctgact?tga 333

<210>4

<211>110

<212>PRT

＜213〉intestinal bacteria

<400>4

Met?Glu?Arg?Gly?Glu?Ile?Trp?Leu?Val?Ser?Leu?Asp?Pro?Thr?Ala?Gly

1 5 10 15

His?Glu?Gln?Gln?Gly?Thr?Arg?Pro?Val?Leu?Ile?Val?Thr?Pro?Ala?Ala

20 25 30

Phe?Asn?Arg?Val?Thr?Arg?Leu?Pro?Val?Val?Val?Pro?Val?Thr?Ser?Gly

35 40 45

Gly?Asn?Phe?Ala?Arg?Thr?Ala?Gly?Phe?Ala?Val?Ser?Leu?Asp?Gly?Val

50 55 60

Gly?Ile?Arg?Thr?Thr?Gly?Val?Val?Arg?Cys?Asp?Gln?Pro?Arg?Thr?Ile

65 70 75 80

Asp?Met?Lys?Ala?Arg?Gly?Gly?Lys?Arg?Leu?Glu?Arg?Val?Pro?Glu?Thr

85 90 95

Ile?Met?Asn?Glu?Val?Leu?Gly?Arg?Leu?Ser?Thr?Ile?Leu?Thr

100 105 110

<210>5

<211>249

<212>DNA

＜213〉intestinal bacteria

<400>5

atgatccaca?gtagcgtaaa?gcgttgggga?aattcaccgg?cggtgcggat?cccggctacg 60

ttaatgcagg?cgctcaatct?gaatattgat?gatgaagtga?agattgacct?ggtggatggc?120

aaattaatta?ttgagccagt?gcgtaaagag?cccgtattta?cgcttgctga?actggtcaac?180

gacatcacgc?cggaaaacct?ccacgagaat?atcgactggg?gagagccgaa?agataaggaa?240

gtctggtaa 249

<210>6

<211>82

<212>PRT

＜213〉intestinal bacteria

<400>6

Met?Ile?His?Ser?Ser?Val?Lys?Arg?Trp?Gly?Asn?Ser?Pro?Ala?Val?Arg

1 5 10 15

Ile?Pro?Ala?Thr?Leu?Met?Gln?Ala?Leu?Asn?Leu?Asn?Ile?Asp?Asp?Glu

20 25 30

Val?Lys?Ile?Asp?Leu?Val?Asp?Gly?Lys?Leu?Ile?Ile?Glu?Pro?Val?Arg

35 40 45

Lys?Glu?Pro?Val?Phe?Thr?Leu?Ala?Glu?Leu?Val?Asn?Asp?Ile?Thr?Pro

50 55 60

Glu?Asn?Leu?His?Glu?Asn?Ile?Asp?Trp?Gly?Glu?Pro?Lys?Asp?Lys?Glu

65 70 75 80

Val?Trp

<210>7

<211>258

<212>DNA

＜213〉intestinal bacteria

<400>7

atgcatacca?cccgactgaa?gagggttggc?ggctcagtta?tgctgaccgt?cccaccggca?60

ctgctgaatg?cgctgtctct?gggcacagat?aatgaagttg?gcatggtcat?tgataatggc?120

cggctgattg?ttgagccgta?cagacgcccg?caatattcac?tggctgagct?actggcacag?180

tgtgatccga?atgctgaaat?atcagctgaa?gaacgagaat?ggctggatgc?accggcgact?240

ggtcaggagg?aaatctga 258

<210>8

<211>85

<212>PRT

＜213〉intestinal bacteria

<400>8

Met?His?Thr?Thr?Arg?Leu?Lys?Arg?Val?Gly?Gly?Ser?Val?Met?Leu?Thr

1 5 10 15

Val?Pro?Pro?Ala?Leu?Leu?Asn?Ala?Leu?Ser?Leu?Gly?Thr?Asp?Asn?Glu

20 25 30

Val?Gly?Met?Val?Ile?Asp?Asn?Gly?Arg?Leu?Ile?Val?Glu?Pro?Tyr?Arg

35 40 45

Arg?Pro?Gln?Tyr?Ser?Leu?Ala?Glu?Leu?Leu?Ala?Gln?Cys?Asp?Pro?Asn

50 55 60

Ala?Glu?Ile?Ser?Ala?Glu?Glu?Arg?Glu?Trp?Leu?Asp?Ala?Pro?Ala?Thr

65 70 75 80

Gly?Gln?Glu?Glu?Ile

85

<210>9

<211>24

<212>PRT

＜213〉artificial sequence

<220>

<223>T54?to?K77?fragment?of?E.coli?MazE

<400>9

Thr?Leu?Ala?Glu?Leu?Val?Asn?AspIle?Thr?Pro?Glu?Asn?Leu?His?Glu

1 5 10 15

Asn?Ile?Asp?Trp?Gly?Glu?Pro?Lys

20

<210>10

<211>18

<212>PRT

＜213〉artificial sequence

<220>

＜223〉the N60-K77 fragment of intestinal bacteria MazE

<400>10

Asn?Asp?Ile?Thr?Pro?Glu?Asn?Leu?His?Glu?Asn?Ile?Asp?Trp?Gly?Glu

1 5 10 15

Pro?Lys

<210>11

<211>30

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic RNA substrate

<400>11

uaagaaggag?auauacauau?gaaucaaauc 30

<210>12

<211>50

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide

<400>12

gctcgtatct?acaatgtaga?ttgatatata?ctgtatctac?atatgatagc 50

<210>13

<211>50

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide

<400>13

cgagcataga?tgttacatct?aactatatat?gacatagatg?tatactatcg 50

<210>14

<211>23

<212>DNA

＜213〉artificial sequence

<400>14

agatctcgat?cccgcaaatt?aat 23

<210>15

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>15

ttagagatca?atttcctgcc?gttttac 27

<210>16

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>16

ttaaagatcg?tcaacgtaac?cg 22

<210>17

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>17

tgctctttat?cccacgggca?gc 22

<210>18

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>18

gcccagttca?ccgcgaagat?cgtc 24

<210>19

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>19

ggttttgatt?tgctcccaac gggcaag 27

<210>20

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>20

catttcctcc?tccagtttag?cctggtc 27

<210>21

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>21

ttgccagact?tcttccattg?tttcgag 27

<210>22

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>22

gatccccaca?atgcggtgac?gagt 24

<210>23

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>23

cacgttgtcc?actttgttca?ccgc 24

<210>24

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>24

cagttcagcg?ccgaggaaac?gcat 24

<210>25

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>25

gcgttcgtcg?tcggcccaac?cgga 24

<210>26

<211>30

<212>RNA

＜213〉artificial sequence

<220>

＜223〉sense-rna

<400>26

gauuugauuc?auauguauau?cuccuucuua 30

<210>27

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉complementary DNA

<400>27

gatttgattc?tatgtatat?ctccttctta 30

<210>28

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>28

agaatgtgcg?ccatttttca?ct 22

<210>29

<211>9

<212>DMA

＜213〉artificial sequence

<220>

＜223〉dna fragmentation

<400>29

taatacacc 9

<210>30

<211>15

<212>DNA

＜213〉artificial sequence

<400>30

atgaatcaca?aagtg 15

<210>31

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna fragmentation

<400>31

catcatcatc?atcatcat 18

<210>32

<211>12

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna fragmentation

<400>32

atcgaaggta?gg 12

<210>33

<211>60

<212>DNA

＜213〉artificial sequence

<220>

＜223〉multiple clone site

<400>33

catatggagc?tcggtaccct?cgagggatcc?gaattcaagc?ttgtcgacct?gcagtctaga 60

<210>34

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>34

caggagauac?cucaaugauc?a 21

<210>35

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>35

ctcaatgatc?acaggagata?c 21

<210>36

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>36

tcctctatgg?agttactagt?g 21

<210>37

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>37

gggacaggag?atacc?t 16

<210>38

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉dna primer

<400>38

tgtcctctat?ggagttacta?gtg 23

<210>39

<211>330

<212>DNA

＜213〉salt tolerant genus bacillus

<400>39

atgccagtac?cggatagagg?gaatcttgtt?tatgtagact?ttaacccaca?atcgggtcat?60

gaccaagccg?ggacacgacc?ggctattgtt?ttgtccccta?aattatttaa?taaaaacaca?120

ggttttgcgg?tggtttgtcc?aattaccaga?caacaaaaag?gttatccttt?tgaaatagaa?180

ataccaccgg?ggttacctat?tgaaggggtt?attcttactg?accaagtaaa?aagtctggat?240

tggagagcaa?gaaactttca?cattaaagga?caagcaccag?aggaaactgt?tactgattgt?300

ttacaactta?ttcatacatt?tttatcttaa 330

<210>40

<211>363

<212>DNA

＜213〉staphylococcus epidermidis

<400>40

atgattagaa?gaggagatgt?ttatttagcg?gatttatcac?cagttcaagg?gtctgaacaa?60

gggggagtaa?gacctgtagt?tatcattcaa?aatgatactg?gtaataaata?tagtccaact?120

gtaattgtag?ctgcgattac?tgatgggatt?aataaagcga?aaataccaac?ccacgtagaa?180

attgaaaaga?aaaagtataa?attagacaaa?gattcagtta?ttcttcttga?acaaattaga?240

acactagata?aaaagcgttt?aaaagaaaaa?ttaacatttt?tatcagagag?taaaatgata?300

gaggttgata?atgccttaga?tattagtttg?ggattaaata?actttgatca?tcataaatct?360

taa 363

<210>41

<211>411

<212>DNA

＜213〉streptococcus aureus

<400>41

atgattagac?gaggagatgt?ttatttagca?gatttatcac?cagtacaggg?atctgaacaa?60

gggggagtca?gacctgtagt?cataattcaa?aatgatactg?gtaataaata?tagtcctaca?120

gttattgttg?cggcaataac?tggtaggatt?aataaagcga?aaataccgac?acatgtagag?180

attgaaaaga?aaaagtataa?gttggataaa?gactcagtta?tattattaga?acaaattcgt?240

acacttgata?aaaaacgatt?gaaagaaaaa?ctgacgtact?tatccgatga?taaaatgaaa?300

gaagtagata?atgcactaat?gattagttta?gggctgaatg?cagtagctca?accagaaaaa?360

ttaggcgtct?attatatgta?tttttcagag?ataaataaaa?tattgatata?a 411

<210>42

<211>351

<212>DNA

＜213〉subtilis

<400>42

ttgattgtga?aacgcggcga?tgtttatttt?gctgatttat?ctcctgttgt?tggctcagag?60

caaggcgggg?tgcgcccggt?tttagtgatc?caaaatgaca?tcggaaatcg?cttcagccca?120

actgctattg?ttgcagccat?aacagcacaa?atacagaaag?cgaaattacc?aacccacgtc?180

gaaatcgatg?caaaacgcta?cggttttgaa?agagattccg?ttattttgct?ggagcaaatt?240

cggacgattg?acaagcaaag?gttaacggat?aagattactc?atctggatga?tgaaatgatg?300

gataaggttg?atgaagcctt?acaaatcagt?ttggcactca?ttgattttta?g 351

<210>43

<211>324

<212>DNA

＜213〉Neisseria meningitidis

<400>43

atggatatgg?tagtacgcgg?cggaatctat?ctggtctcct?tagacccgac?cgtaggaagc?60

gaaatcaaaa?agacacgtcc?ttgtgtcgta?gtctctcctc?ctgaaataca?caactatctc?120

aagactgtgc?tgatcgttcc?catgacgagc?ggaagccgtc?ctgccccgtt?ccgcgtcaat?180

gtccgctttc?aggataaaga?cggtttgctt?ttgcccgaac?agattagggc?tgtggataaa?240

gccggattgg?tcaaacatct?tggcaattta?gacaacagta?cggctgaaaa?actgtttgca?300

gtattgcagg?agatgtttgc?ctga 324

<210>44

<211>366

<212>DNA

＜213〉morganella morganii strain

<400>44

atgcgccggc?ggctggtcag?gaggaaatct?gacatggaaa?gaggggaaat?ctggcttgtc?60

tcgcttgacc?ctaccgcagg?tcatgagcag?cagggaacgc?ggccggtact?gattgtcacg?120

ccggctgctt?ttaaccgcgt?gacccgcctg?cctgttgttg?tgcccgtgac?cagcggaggt?180

aattttgccc?gcacagcagg?ctttgctgtg?tcgcttgacg?gcgccggcat?acgtaccacc?240

ggcgttgtgc?gttgcgatca?accccggacg?atcgatatga?aagcccgcgg?cggcaaacga?300

ctcgaacggg?tgccagagac?tatcatggac?gacgttcttg?gccgtctggc?caccatcctg?360

acctga 366

<210>45

<211>321

<212>DNA

＜213〉mycobacterium tuberculosis

<400>45

gtggtgattc?ggggagcggt?ctacagggtc?gacttcggcg?atgcgaagcg?aggccacgag?60

caacgcgggc?ggcgctacgc?cgtggtcatc?agccccggct?cgatgccgtg?gagtgtagta?120

accgtggtgc?cgacgtcgac?aagcgcccaa?cctgcggttt?tccgaccaga?gctggaagtc?180

atgggaacaa?agacacggtt?cctggtggat?cagatccgga?cgatcggcat?cgtctatgtg?240

cacggcgatc?cggtcgacta?tctggaccgt?gaccaaatgg?ccaaggtgga?acacgccgtg?300

gcacgatacc?ttggtctgtg?a 321

<210>46

<211>109

<212>PRT

＜213〉salt tolerant genus bacillus

<400>46

Met?Pro?Val?Pro?Asp?Arg?Gly?Asn?Leu?Val?Tyr?Val?Asp?Phe?Asn?Pro

1 5 10 15

Gln?Ser?Gly?His?Asp?Gln?Ala?Gly?Thr?Arg?Pro?Ala?Ile?Val?Leu?Ser

20 25 30

Pro?Lys?Leu?Phe?Asn?Lys?Asn?Thr?Gly?Phe?Ala?Val?Val?Cys?Pro?Ile

35 40 45

Thr?Arg?Gln?Gln?Lys?Gly?Tyr?Pro?Phe?Glu?Ile?Glu?Ile?Pro?Pro?Gly

50 55 60

Leu?Pro?Ile?Glu?Gly?Val?Ile?Leu?Thr?Asp?Gln?Val?Lys?Ser?Leu?Asp

65 70 75 80

Trp?Arg?Ala?Arg?Asn?Phe?His?Ile?Lys?Gly?Gln?Ala?Pro?Glu?Glu?Thr

85 90 95

Val?Thr?Asp?Cys?Leu?Gln?Leu?Ile?His?Thr?Phe?Leu?Ser

100 105

<210>47

<211>120

<212>PRT

＜213〉staphylococcus epidermidis

<400>47

Met?Ile?Arg?Arg?Gly?Asp?Val?Tyr?Leu?Ala?Asp?Leu?Ser?Pro?Val?Gln

1 5 10 15

Gly?Ser?Glu?Gln?Gly?Gly?Val?Arg?Pro?Val?Val?Ile?Ile?Gln?Asn?Asp

20 25 30

Thr?Gly?Asn?Lys?Tyr?Ser?Pro?Thr?Val?Ile?Val?Ala?Ala?Ile?Thr?Asp

35 40 45

Gly?Ile?Asn?Lys?Ala?Lys?Ile?Pro?Thr?His?Val?Glu?Ile?Glu?Lys?Lys

50 55 60

Lys?Tyr?Lys?Leu?Asp?Lys?Asp?Ser?Val?Ile?Leu?Leu?Glu?Gln?Ile?Arg

65 70 75 80

Thr?Leu?Asp?Lys?Lys?Arg?Leu?Lys?Glu?Lys?Leu?Thr?Phe?Leu?Ser?Glu

85 90 95

Ser?Lys?Met?Ile?Glu?Val?Asp?Asn?Ala?Leu?Asp?Ile?Ser?Leu?Gly?Leu

100 105 110

Asn?Asn?Phe?Asp?His?His?Lys?Ser

115 120

<210>48

<211>136

<212>PRT

＜213〉streptococcus aureus

<400>48

Met?Ile?Arg?Arg?Gly?Asp?Val?Tyr?Leu?Ala?Asp?Leu?Ser?Pro?Val?Gln

1 5 10 15

Gly?Ser?Glu?Gln?Gly?Gly?Val?Arg?Pro?Val?Val?Ile?Ile?Gln?Asn?Asp

20 25 30

Thr?Gly?Asn?Lys?Tyr?Ser?Pro?Thr?Val?Ile?Val?Ala?Ala?Ile?Thr?Gly

35 40 45

Arg?Ile?Asn?Lys?Ala?Lys?Ile?Pro?Thr?His?Val?Glu?Ile?Glu?Lys?Lys

50 55 60

Lys?Tyr?Lys?Leu?Asp?Lys?Asp?Ser?Val?Ile?Leu?Leu?Glu?Gln?Ile?Arg

65 70 75 80

Thr?Leu?Asp?Lys?Lys?Arg?Leu?Lys?Glu?Lys?Leu?Thr?Tyr?Leu?Ser?Asp

85 90 95

Asp?Lys?Met?Lys?Glu?Val?Asp?Asn?Ala?Leu?Met?Ile?Ser?Leu?Gly?Leu

100 105 110

Asn?Ala?Val?Ala?Gln?Pro?Glu?Lys?Leu?Gly?Val?Tyr?Tyr?Met?Tyr?Phe

115 120 125

Ser?Glu?Ile?Asn?Lys?Ile?Leu?Ile

130 135

<210>49

<211>116

<212>PRT

＜213〉subtilis

<400>49

Met?Ile?Val?Lys?Arg?Gly?Asp?Val?Tyr?Phe?Ala?Asp?Leu?Ser?Pro?Val

1 5 10 15

Val?Gly?Ser?Glu?Gln?Gly?Gly?Val?Arg?Pro?Val?Leu?Val?Ile?Gln?Asn

20 25 30

Asp?Ile?Gly?Asn?Arg?Phe?Ser?Pro?Thr?Ala?Ile?Val?Ala?Ala?Ile?Thr

35 40 45

Ala?Gln?Ile?Gln?Lys?Ala?Lys?Leu?Pro?Thr?His?Val?Glu?Ile?Asp?Ala

50 55 60

Lys?Arg?Tyr?Gly?Phe?Glu?Arg?Asp?Ser?Val?Ile?Leu?Leu?Glu?Gln?Ile

65 70 75 80

Arg?Thr?Ile?Asp?Lys?Gln?Arg?Leu?Thr?Asp?Lys?Ile?Thr?His?Leu?Asp

85 90 95

Asp?Glu?Met?Met?Asp?Lys?Val?Asp?Glu?Ala?Leu?Gln?Ile?Ser?Leu?Ala

100 105 110

Leu?Ile?Asp?Phe

115

<210>50

<211>115

<212>PRT

＜213〉Neisseria meningitidis

<400>50

Met?Tyr?Ile?Pro?Asp?Lys?Gly?Asp?Ile?Phe?His?Leu?Asn?Phe?Asp?Pro

1 5 10 15

Ser?Ser?Gly?Lys?Glu?Ile?Lys?Gly?Gly?Arg?Phe?Ala?Leu?Ala?Leu?Ser

20 25 30

Pro?Lys?Ala?Phe?Asn?Arg?Ala?Thr?Gly?Leu?Val?Phe?Ala?Cys?Pro?Ile

35 40 45

Ser?Gln?Gly?Asn?Ala?Ala?Ala?Ala?Arg?Ser?Ser?Gly?Met?Ile?Ser?Thr

50 55 60

Leu?Leu?Gly?Ala?Gly?Thr?Glu?Thr?Gln?Gly?Asn?Val?His?Cys?His?Gln

65 70 75 80

Leu?Lys?Ser?Leu?Asp?Trp?Gln?Ile?Arg?Lys?Ala?Ser?Phe?Lys?Glu?Thr

85 90 95

Val?Pro?Asp?Tyr?Val?Leu?Asp?Asp?Val?Leu?Ala?Arg?Ile?Gly?Ala?Val

100 105 110

Leu?Phe?Asp

115

<210>51

<211>121

<212>PRT

＜213〉morganella morganii strain

<400>51

Met?Arg?Arg?Arg?Leu?Val?Arg?Arg?Lys?Ser?Asp?Met?Glu?Arg?Gly?Glu

1 5 10 15

Ile?Trp?Leu?Val?Ser?Leu?Asp?Pro?Thr?Ala?Gly?His?Glu?Gln?Gln?Gly

20 25 30

Thr?Arg?Pro?Val?Leu?Ile?Val?Thr?Pro?Ala?Ala?Phe?Asn?Arg?Val?Thr

35 40 45

Arg?Leu?Pro?Val?Val?Val?Pro?Val?Thr?Ser?Gly?Gly?Asn?Phe?Ala?Arg

50 55 60

Thr?Ala?Gly?Phe?Ala?Val?Ser?Leu?Asp?Gly?Ala?Gly?Ile?Arg?Thr?Thr

65 70 75 80

Gly?Val?Val?Arg?Cys?Asp?Gln?Pro?Arg?Thr?Ile?Asp?Met?Lys?Ala?Arg

85 90 95

Gly?Gly?Lys?Arg?Leu?Glu?Arg?Val?Pro?Glu?Thr?Ile?Met?Asp?Asp?Val

100 105 110

Leu?Gly?Arg?Leu?Ala?Thr?Ile?Leu?Thr

115 120

<210>52

<211>118

<212>PRT

＜213〉mycobacterium tuberculosis

<400>52

Met?Met?Arg?Arg?Gly?Glu?Ile?Trp?Gln?Val?Asp?Leu?Asp?Pro?Ala?Arg

1 5 10 15

Gly?Ser?Glu?Ala?Asn?Asn?Gln?Arg?Pro?Ala?Val?Val?Val?Ser?Asn?Asp

20 25 30

Arg?Ala?Asn?Ala?Thr?Ala?Thr?Arg?Leu?Gly?Arg?Gly?Val?Ile?Thr?Val

35 40 45

Val?Pro?Val?Thr?Ser?Asn?Ile?Ala?Lys?Val?Tyr?Pro?Phe?Gln?Val?Leu

50 55 60

Leu?Ser?Ala?Thr?Thr?Thr?Gly?Leu?Gln?Val?Asp?Cys?Lys?Ala?Gln?Ala

65 70 75 80

Glu?Gln?Ile?Arg?Ser?Ile?Ala?Thr?Glu?Arg?Leu?Leu?Arg?Pro?Ile?Gly

85 90 95

Arg?Val?Ser?Ala?Ala?Glu?Leu?Ala?Gln?Leu?Asp?Glu?Ala?Leu?Lys?Leu

100 105 110

His?Leu?Asp?Leu?Trp?Ser

115

<210>53

<211>243

<212>DNA

＜213〉abnormal cocci of anti-the radiation

<400>53

atgacgagtc?aaattcagaa?atggggcaac?agcctcgcgc?tccgcattcc?caaagctctg?60

gcgcagcagg?tgggactgac?gcagagttca?gaagtggagc?tgcttcttca?ggacggtcag?120

attgtcatcc?ggccagttcc?tgctcggcag?tacgatctcg?ccgcgctgct?ggccgaaatg?180

acacctgaaa?atctgcatgg?ggaaacagac?tggggcgcac?tggaaggacg?cgaggaatgg?240

taa 243

<210>54

<211>246

<212>DNA

＜213〉salt tolerant genus bacillus

<400>54

gtgacactca?tgactactat?acaaaagtgg?ggaaatagtt?tagctgttcg?tattccgaac?60

cattatgcta?aacatattaa?cgttacgcaa?ggatctgaaa?ttgaactaag?cttagggagt?120

gatcaaacga?ttattttaaa?gcctaaaaaa?agaaagccaa?cattagagga?attagtggca?180

aaaatcactc?ctgaaaacag?acataacgaa?attgatttcg?ggagaacagg?aaaggaattg?240

ttgtaa 246

<210>55

<211>258

<212>DNA

＜213〉escherichia coli plasmid R100

<400>55

atgcatacca?cccgactgaa?gagggttggc?ggctcagtta?tgctgaccgt?cccaccggca?60

ctgctgaatg?cgctgtctct?gggcacagat?aatgaagttg?gcatggtcat?tgataatggc?120

cggctgattg?ttgagccgta?cagacgcccg?caatattcac?tggctgagct?actggcacag?180

tgtgatccga?atgctgaaat?atcagctgaa?gaacgagaat?ggctggatgc?accggcgact?240

ggtcaggagg?aaatctga 258

<210>56

<211>294

<212>DNA

＜213〉escherichia coli plasmid R466b

<400>56

atgttatatt?taaatataac?ttttatggag?ggaaaaatgc?ataccactcg?actgaagaag?60

gttggcggct?cagtcatgct?gaccgtccca?ccggcactgc?tgaatgcgct?gtcgctgggt?120

acagataatg?aagttggcat?ggtcattgat?aatggccggc?tgattgtgga?gccgcacaga?180

cgcccgcagt?attcactggc?tgagctgttg?gcacagtgcg?atccgaacgc?tgaaatctcg?240

gcagaagaac?gtgaatggct?ggatgcgccg?gcggctggtc?aggaggaaat?ctga 294

<210>57

<211>258

<212>DNA

＜213〉intestinal bacteria

<400>57

gtgcagatgc?gtattaccat?aaaaagatgg?gggaacagtg?caggtatggt?cattcccaat?60

atcgtaatga?aagaacttaa?cttacagccg?gggcagagcg?tggaagtgca?ggtgagcaac?120

aaccaactga?ttctgacacc?catctccagg?cgctactcgc?ttgatgaact?gctggcacag?180

tgtgacatga?acgccgcgga?acttagcgag?caggatgtct?ggggtaaatc?cacccctgcg?240

ggtgacgaaa?tatggtaa 258

<210>58

<211>255

<212>DNA

＜213〉pseudomonasputida

<400>58

atgcagatca?agattcaaca?gtggggcaac?agcgccgcga?tccgcttgcc?cgccgcagta?60

ctcaagcaga?tgcgcctcgg?tgtcggctcc?accctgagcc?ttgacacaac?gggtgagacg?120

atggtgctca?aacccgtcag?gtcgaaaccc?aagtacaccc?ttgaggaact?gatggcccag?180

tgtgacctga?gtgcaccgga?gccagaggac?atggccgact?ggaatgccat?gcgcccagtg?240

gggcgtgaag?tgtga 255

<210>59

<211>260

<212>DNA

<213>Photobacterium?profundum

<400>59

gtgcaatgag?aactcagata?agaaagatcg?gtaactcact?tggttcaatt?attcctgcca?60

cttttattcg?tcagcttgaa?ctggcagagg?gcgcagaaat?tgatgttaaa?acggttgatg?120

gaaaaattgt?gattgagcca?attagaaaaa?tgaaaaaacg?tttcccattc?agtgagcgtg?180

aattactaag?tggattggat?gcacacactg?ctcatgctga?cgaactggtt?gtaatttcta?240

cccaggagct?aggcgaataa 260

<210>60

<211>80

<212>PRT

＜213〉abnormal cocci of anti-the radiation

<400>60

Met?Thr?Ser?Gln?Ile?Gln?Lys?Trp?Gly?Asn?Ser?Leu?Ala?Leu?Arg?Ile

1 5 10 15

Pro?Lys?Ala?Leu?Ala?Gln?Gln?Val?Gly?Leu?Thr?Gln?Ser?Ser?Glu?Val

20 25 30

Glu?Leu?Leu?Leu?Gln?Asp?Gly?Gln?Ile?Val?Ile?Arg?Pro?Val?Pro?Ala

35 40 45

Arg?Gln?Tyr?Asp?Leu?Ala?Ala?Leu?Leu?Ala?Glu?Met?Thr?Pro?Glu?Asn

50 55 60

Leu?His?Gly?Glu?Thr?Asp?Trp?Gly?Ala?Leu?Glu?Gly?Arg?Glu?Glu?Trp

65 70 75 80

<210>61

<211>81

<212>PRT

＜213〉salt tolerant genus bacillus

<400>61

Met?Thr?Leu?Met?Thr?Thr?Ile?Gln?Lys?Trp?Gly?Asn?Ser?Leu?Ala?Val

1 5 10 15

Arg?Ile?Pro?Asn?His?Tyr?Ala?Lys?His?Ile?Asn?Val?Thr?Gln?Gly?Ser

20 25 30

Glu?Ile?Glu?Leu?Ser?Leu?Gly?Ser?Asp?Gln?Thr?Ile?Ile?Leu?Lys?Pro

35 40 45

Lys?Lys?Arg?Lys?Pro?Thr?Leu?Glu?Glu?Leu?Val?Ala?Lys?Ile?Thr?Pro

50 55 60

Glu?Asn?Arg?His?Asn?Glu?Ile?Asp?Phe?Gly?Arg?Thr?Gly?Lys?Glu?Leu

65 70 75 80

Leu

<210>62

<211>85

<212>PRT

＜213〉intestinal bacteria PemI plasmid R100

<400>62

Met?His?Thr?Thr?Arg?Leu?Lys?Arg?Val?Gly?Gly?Ser?Val?Met?Leu?Thr

1 5 10 15

Val?Pro?Pro?Ala?Leu?Leu?Asn?Ala?Leu?Ser?Leu?Gly?Thr?Asp?Asn?Glu

20 25 30

Val?Gly?Met?Val?Ile?Asp?Asn?Gly?Arg?Leu?Ile?Val?Glu?Pro?Tyr?Arg

35 40 45

Arg?Pro?Gln?Tyr?Ser?Leu?Ala?Glu?Leu?Leu?Ala?Gln?Cys?Asp?Pro?Asn

50 55 60

Ala?Glu?Ile?Ser?Ala?Glu?Glu?Arg?Glu?Trp?Leu?Asp?Ala?Pro?Ala?Thr

65 70 75 80

Gly?Gln?Glu?Glu?Ile

85

<210>63

<211>97

<212>PRT

＜213〉intestinal bacteria PemI plasmid R466b

<400>63

Met?Leu?Tyr?Leu?Asn?Ile?Thr?Phe?Met?Glu?Gly?Lys?Met?His?Thr?Thr

1 5 10 15

Arg?Leu?Lys?Lys?Val?Gly?Gly?Ser?Val?Met?Leu?Thr?Val?Pro?Pro?Ala

20 25 30

Leu?Leu?Asn?Ala?Leu?Ser?Leu?Gly?Thr?Asp?Asn?Glu?Val?Gly?Met?Val

35 40 45

Ile?Asp?Asn?Gly?Arg?Leu?Ile?Val?Glu?Pro?His?Arg?Arg?Pro?Gln?Tyr

50 55 60

Ser?Leu?Ala?Glu?Leu?Leu?Ala?Gln?Cys?Asp?Pro?Asn?Ala?Glu?Ile?Ser

65 70 75 80

Ala?Glu?Glu?Arg?Glu?Trp?Leu?Asp?Ala?Pro?Ala?Ala?Gly?Gln?Glu?Glu

85 90 95

Ile

<210>64

<211>85

<212>PRT

＜213〉intestinal bacteria

<400>64

Met?Gln?Met?Arg?Ile?Thr?Ile?Lys?Arg?Trp?Gly?Asn?Ser?Ala?Gly?Met

1 5 10 15

Val?Ile?Pro?Asn?Ile?Val?Met?Lys?Glu?Leu?Asn?Leu?Gln?Pro?Gly?Gln

20 25 30

Ser?Val?Glu?Ala?Gln?Val?Ser?Asn?Asn?Gln?Leu?Ile?Leu?Thr?Pro?Ile

35 40 45

Ser?Arg?Arg?Tyr?Ser?Leu?Asp?Glu?Leu?Leu?Ala?Gln?Cys?Asp?Met?Asn

50 55 60

Ala?Ala?Glu?Leu?Ser?Glu?Gln?Asp?Val?Trp?Gly?Lys?Ser?Thr?Pro?Ala

65 70 75 80

Gly?Asp?Glu?Ile?Trp

85

<210>65

<211>84

<212>PRT

＜213〉pseudomonasputida

<400>65

Met?Gln?Ile?Lys?Ile?Gln?Gln?Trp?Gly?Asn?Ser?Ala?Ala?Ile?Arg?Leu

1 5 10 15

Pro?Ala?Ala?Val?Leu?Lys?Gln?Met?Arg?Leu?Gly?Val?Gly?Ser?Thr?Leu

20 25 30

Ser?Leu?Asp?Thr?Thr?Gly?Glu?Thr?Met?Val?Leu?Lys?Pro?Val?Arg?Ser

35 40 45

Lys?Pro?Lys?Tyr?Thr?Leu?Glu?Glu?Leu?Met?Ala?Gln?Cys?Asp?Leu?Ser

50 55 60

Ala?Pro?Glu?Pro?Glu?Asp?Met?Ala?Asp?Trp?Asn?Ala?Met?Arg?Pro?Val

65 70 75 80

Gly?Arg?Glu?Val

<210>66

<211>85

<212>PRT

<213>Photobacterium?profundum

<400>66

Ala?Met?Arg?Thr?Gln?Ile?Arg?Lys?Ile?Gly?Asn?Ser?Leu?Gly?Ser?Ile

1 5 10 15

Ile?Pro?Ala?Thr?Phe?Ile?Arg?Gln?Leu?Glu?Leu?Ala?Glu?Gly?Ala?Glu

20 25 30

Ile?Asp?Val?Lys?Thr?Val?Asp?Gly?Lys?Ile?Val?Ile?Glu?Pro?Ile?Arg

35 40 45

Lys?Met?Lys?Lys?Arg?Phe?Pro?Phe?Ser?Glu?Arg?Glu?Leu?Leu?Ser?Gly

50 55 60

Leu?Asp?Ala?His?Thr?Ala?His?Ala?Asp?Glu?Leu?Val?Val?Ile?Ser?Thr

65 70 75 80

Gln?Glu?Leu?Gly?Glu

85

<210>67

<211>228

<212>DNA

＜213〉homo sapiens

<400>67

atgggtccag?catctgttcc?gactacctgt?tgctttaacc?tggcgaaccg?caaaattccg?60

ctgcagcgcc?tggaaagcta?tcgccgtatt?acctctggca?aatgcccgca?gaaagcggtg?120

atctttaaaa?ccaaactggc?gaaagatatt?tgcgcggatc?cgaaaaaaaa?atgggtgcag?180

gattctatga?aatatctgga?tcagaaatct?ccgaccccga?aaccgtaa 228

<210>68

<211>73

<212>PRT

＜213〉homo sapiens

<400>68

Gly?Pro?Ala?Ser?Pro?Thr?Thr?Cys?Cys?Phe?Asn?Leu?Ala?Asn?Arg?Lys

1 5 10 15

Ile?Pro?Leu?Gln?Arg?Leu?Glu?Ser?Tyr?Arg?Arg?Ile?Thr?Ser?Gly?Lys

20 25 30

Cys?Pro?Gln?Lys?Ala?Val?Ile?Phe?Lys?Thr?Lys?Leu?Ala?Lys?Asp?Ile

35 40 45

Cys?Ala?Asp?Pro?Lys?Lys?Lys?Trp?Val?Gln?Asp?Ser?Met?Lys?Tyr?Leu

50 55 60

Asp?Gln?Lys?Ser?Pro?Thr?Pro?Lys?Pro

65 70

<210>69

<211>357

<212>DNA

＜213〉mycobacterium tuberculosis

<400>69

gtgatgcgcc?gcggtgagat?ttggcaggtc?gatctcgacc?ccgctcgagg?tagcgaagcg?60

aacaaccagc?gccccgccgt?cgtcgtcagc?aacgaccggg?ccaacgcgac?cgccacgcgt?120

cttgggcgcg?gcgtcatcac?cgtcgtgccg?gtgacgagca?acatcgccaa?ggtctatccg?180

tttcaggtgt?tgttgtcggc?caccactact?ggtctccagg?tcgactgcaa?ggcgcaggcc?240

gagcaaatca?gatcgattgc?taccgagcgg?ttgctccggc?caatcggccg?agtttcagcc?300

gccgaacttg?cccagctcga?tgaggctttg?aaactgcatc?tcgacttatg?gtcgtag 357

<210>70

<211>282

<212>DNA

＜213〉mycobacterium tuberculosis

<400>70

atgctgcgcg?gtgagatctg?gcaggtcgac?ctggatccgg?cccgcggcag?cgcggcaaat?60

atgcggcggc?cagcggtaat?tgtcagcaac?gacagggcca?acgctgccgc?gatacgtctc?120

gaccgaggcg?tggtgccggt?tgtcccggtt?accagcaaca?ccgaaaaggt?ccccattcca?180

ggtgttgttg?ccggcagcga?gcggtggcct?ggccgtcgat?tcgaaggcgc?aggcccagca?240

ggttggatcc?gtcgctgcgc?aacgtctccc?ctgccgagct?ga 282

<210>71

<211>345

<212>DNA

＜213〉mycobacterium tuberculosis

<400>71

gtggtgatta?gtcgtgccga?gatctactgg?gctgacctcg?ggccgccatc?aggcagtcag?60

ccggcgaagc?gccgcccggt?gctcgtaatc?cagtcagatc?cgtacaacgc?aagtcgcctt?120

gccactgtga?tcgcagcggt?gatcacgtcc?aatacggcgc?tggcggcaat?gcccggcaac?180

gtgttcttgc?ccgcgaccac?aacgcgactg?ccacgtgact?cggtcgtcaa?cgtcacggcg?240

attgtcacgc?tcaacaagac?tgacctcacc?gaccgagttg?gggaggtgcc?agcgagcttg?300

atgcacgagg?ttgaccgagg?acttcgtcgc?gtactggacc?tttga 345

<210>72

<211>309

<212>DNA

＜213〉mycobacterium tuberculosis

<400>72

atgcggcgcg?gtgaattgtg?gtttgccgcc?acacctggtg?gtgacagacc?agtacttgtc?60

cttaccagag?atccggtggc?agaccgcatc?ggcgcggtcg?ttgtggtggc?cctaacccgc?120

acccgccgag?gcctggtgtc?ggaattggag?ctcacggccg?tcgaaaaccg?tgttccgagc?180

gactgcgtcg?tcaacttcga?caacattcat?acgttgccac?gcaccgcatt?ccgacgccgc?240

atcacccggc?tgtccccggc?ccgcctgcac?gaagcctgtc?aaacactccg?ggcgagcacg?300

gggtgttga 309

<210>73

<211>330

<212>DNA

＜213〉mycobacterium tuberculosis

<400>73

gtgaccgcac?ttccggcgcg?cggagaggtg?tggtggtgtg?agatggctga?gatcggtcgg?60

cgaccagtcg?tcgtgctgtc?gcgcgatgcc?gcgatccctc?ggctgcgacg?cgcacttgtc?120

gcgccctgca?ccacgaccat?ccgagggcta?gccagtgagg?ttgttcttga?acccggttcc?180

gacccgatcc?cgcgccgttc?cgcggtgaat?ttggactcag?tcgaaagtgt?ctcggtcgcg?240

gtattggtga?atcggcttgg?ccgcctcgcc?gacatccgga?tgcgcgccat?ctgcacggcc?300

ctcgaggtcg?ccgtcgattg?ctctcgatga 330

<210>74

<211>118

<212>PRT

＜213〉mycobacterium tuberculosis

<400>74

Met?Met?Arg?Arg?Gly?Glu?Ile?Trp?Gln?Val?Asp?Leu?Asp?Pro?Ala?Arg

1 5 10 15

Gly?Ser?Glu?Ala?Asn?Asn?Gln?Arg?Pro?Ala?Val?Val?Val?Ser?Asn?Asp

20 25 30

Arg?Ala?Asn?Ala?Thr?Ala?Thr?Arg?Leu?Gly?Arg?Gly?Val?Ile?Thr?Val

35 40 45

Val?Pro?Val?Thr?Ser?Asn?Ile?Ala?Lys?Val?Tyr?Pro?Phe?Gln?Val?Leu

50 55 60

Leu?Ser?Ala?Thr?Thr?Thr?Gly?Leu?Gln?Val?Asp?Cys?Lys?Ala?Gln?Ala

65 70 75 80

Glu?Gln?Ile?Arg?Ser?Ile?Ala?Thr?Glu?Arg?Leu?Leu?Arg?Pro?Ile?Gly

85 90 95

Arg?Val?Ser?Ala?Ala?Glu?Leu?Ala?Gln?Leu?Asp?Glu?Ala?Leu?Lys?Leu

100 105 110

His?Leu?Asp?Leu?Trp?Ser

115

<210>75

<211>93

<212>PRT

＜213〉mycobacterium tuberculosis

<400>75

Met?Leu?Arg?Gly?Glu?Ile?Trp?Gln?Val?Asp?Leu?Asp?Pro?Ala?Arg?Gly

1 5 10 15

Ser?Ala?Ala?Asn?Met?Arg?Arg?Pro?Ala?Val?Ile?Val?Ser?Asn?Asp?Arg

20 25 30

Ala?Asn?Ala?Ala?Ala?Ile?Arg?Leu?Asp?Arg?Gly?Val?Val?Pro?Val?Val

35 40 45

Pro?Val?Thr?Ser?Asn?Thr?Glu?Lys?Val?Pro?Ile?Pro?Gly?Val?Val?Ala

50 55 60

Gly?Ser?Glu?Arg?Trp?Pro?Gly?Arg?Arg?Phe?Glu?Gly?Ala?Gly?Pro?Ala

65 70 75 80

Gly?Trp?Ile?Arg?Arg?Cys?Ala?Thr?Ser?Pro?Leu?Pro?Ser

85 90

<210>76

<211>114

<212>PRT

＜213〉mycobacterium tuberculosis

<400>76

Met?Val?Ile?Ser?Arg?Ala?Glu?Ile?Tyr?Trp?Ala?Asp?Leu?Gly?Pro?Pro

1 5 10 15

Ser?Gly?Ser?Gln?Pro?Ala?Lys?Arg?Arg?Pro?Val?Leu?Val?Ile?Gln?Ser

20 25 30

Asp?Pro?Tyr?Asn?Ala?Ser?Arg?Leu?Ala?Thr?Val?Ile?Ala?Ala?Val?Ile

35 40 45

Thr?Ser?Asn?Thr?Ala?Leu?Ala?Ala?Met?Pro?Gly?Asn?Val?Phe?Leu?Pro

50 55 60

Ala?Thr?Thr?Thr?Arg?Leu?Pro?Arg?Asp?Ser?Val?Val?Asn?Val?Thr?Ala

65 70 75 80

Ile?Val?Thr?Leu?Asn?Lys?Thr?Asp?Leu?Tht?Asp?Arg?Val?Gly?Glu?Val

85 90 95

Pro?Ala?Ser?Leu?Met?His?Glu?Val?Asp?Arg?Gly?Leu?Arg?Arg?Val?Leu

100 105 110

Asp?Leu

<210>77

<211>102

<212>PRT

＜213〉mycobacterium tuberculosis

<400>77

Met?Arg?Arg?Gly?Glu?Leu?Trp?Phe?Ala?Ala?Thr?Pro?Gly?Gly?Asp?Arg

1 5 10 15

Pro?Val?Leu?Val?Leu?Thr?Arg?Asp?Pro?Val?Ala?Asp?Arg?Ile?Gly?Ala

20 25 30

Val?Val?Val?Val?Ala?Leu?Thr?Arg?Thr?Arg?Arg?Gly?Leu?Val?Ser?Glu

35 40 45

Leu?Glu?Leu?Thr?Ala?Val?Glu?Asn?Arg?Val?Pro?Ser?Asp?Cys?Val?Val

50 55 60

Asn?Phe?Asp?Asn?Ile?His?Thr?Leu?Pro?Arg?Thr?Ala?Phe?Arg?Arg?Arg

65 70 75 80

Ile?Thr?Arg?Leu?Ser?Pro?Ala?Arg?Leu?His?Glu?Ala?Cys?Gln?Thr?Leu

85 90 95

Arg?Ala?Ser?Thr?Gly?Cys

100

<210>78

<211>109

<212>PRT

＜213〉mycobacterium tuberculosis

<400>78

Met?Thr?Ala?Leu?Pro?Ala?Arg?Gly?Glu?Val?Trp?Trp?Cys?Glu?Met?Ala

1 5 10 15

Glu?Ile?Gly?Arg?Arg?Pro?Val?Val?Val?Leu?Ser?Arg?Asp?Ala?Ala?Ile

20 25 30

Pro?Arg?Leu?Arg?Arg?Ala?Leu?Val?Ala?Pro?Cys?Thr?Thr?Thr?Ile?Arg

35 40 45

Gly?Leu?Ala?Ser?Glu?Val?Val?Leu?Glu?Pro?Gly?Ser?Asp?Pro?Ile?Pro

50 55 60

Arg?Arg?Ser?Ala?Val?Asn?Leu?Asp?Ser?Val?Glu?Ser?Val?Ser?Val?Ala

65 70 75 80

Val?Leu?Val?Asn?Arg?Leu?Gly?Arg?Leu?Ala?Asp?Ile?Arg?Met?Arg?Ala

85 90 95

Ile?Cys?Thr?Ala?Leu?Glu?Val?Ala?Val?Asp?Cys?Ser?Arg

100 105

<210>79

<211>351

<212>DNA

＜213〉Bacillus anthracis

<400>79

ttgattgtaa?aacgcggcga?cgtgtatttt?gcagaccttt?ccccagttgt?tggttctgag?60

caaggaggtg?ttcgtccggt?tcttgtcatt?caaaatgaca?tcggaaatcg?ttttagtcca?120

acggtgattg?tagcggctat?tactgcacag?attcaaaaag?cgaaattacc?cactcatgtg?180

gaaattgatg?cgaaaaagta?cggttttgag?agagattctg?ttattttact?tgagcagatt?240

cgaacaatcg?ataagcagcg?cttaacggac?aaaatcactc?acttagatga?agtgatgatg?300

attcgtgtag?atgaagcgct?acaaattagt?ttaggactaa?tagattttta?a 351

<210>80

<211>116

<212>PRT

＜213〉Bacillus anthracis

<400>80

Met?Ile?Val?Lys?Arg?Gly?Asp?Val?Tyr?Phe?Ala?Asp?Leu?Ser?Pro?Val

1 5 10 15

Val?Gly?Ser?Glu?Gln?Gly?Gly?Val?Arg?Pro?Val?Leu?Val?Ile?Gln?Asn

20 25 30

Asp?Ile?Gly?Asn?Arg?Phe?Ser?Pro?Thr?Val?Ile?Val?Ala?Ala?Ile?Thr

35 40 45

Ala?Gln?Ile?Gln?Lys?Ala?Lys?Leu?Pro?Thr?His?Val?Glu?Ile?Asp?Ala

50 55 60

Lys?Lys?Tyr?Gly?Phe?Glu?Arg?Asp?Ser?Val?Ile?Leu?Leu?Glu?Gln?Ile

65 70 75 80

Arg?Thr?Ile?Asp?Lys?Gln?Arg?Leu?Thr?Asp?Lys?Ile?Thr?His?Leu?Asp

85 90 95

Glu?Val?Met?Met?Ile?Arg?Val?Asp?Glu?Ala?Leu?Gln?Ile?Ser?Leu?Gly

100 105 110

Leu?Ile?Asp?Phe

115

<210>81

<211>348

<212>DMA

＜213〉pseudomonasputida

<400>81

gtgaaacggt?tgaaattcgc?caggggtgat?attgttcgcg?tcaacctgga?cccaacagtc?60

gggcgggaac?agcagggctc?cggccgacct?gcactggtac?ttactccggc?tgcgttcaat?120

gcttcaggcc?tggctgtaat?catcccgatc?actcaaggtg?gggatttcgc?gaggcatgcg?180

ggtttcgctg?tcacgctcag?cggtgcgggc?acgcagactc?agggggtgat?gctttgcaac?240

caggtgcgca?cagtcgacct?tgaagcacga?tttgccaagc?gcatagagtc?ggtgcctgaa?300

gctgtcatcc?tggatgcact?ggcgcgtgtg?caaaccctat?tcgattaa 348

<210>82

<211>345

<212>DNA

＜213〉hide mycobacterium

<400>82

tgaattgctc?tgacggaacg?cggcgacatc?tacatcgttt?cgcttgaccc?gacgtcggga?60

catgagcaga?gcggcacgcg?cccagtattg?gtcgtgtccc?cgggcgcgtt?taatcgcctg?120

acgaaaacac?cggtcgtgct?acctataaca?cgcggcggga?actttgcccg?aacggcaggg?180

ttcgctgtct?cgctgaccga?tgcgggtact?cgcaccgccg?gcgtaatacg?ctgcgatcag?240

cctcgctcga?ttgatatccg?cgcccgtaaa?ggccgcaagg?ttgaacgtgt?gccgtctggg?300

gttcttgacg?aagcgttggc?caagctcgcc?acgatcttga?cttga 345

<210>83

<211>366

<212>DNA

＜213〉shigella flexneri 2a st.301

<400>83

atggtaaagg?cacggacgcc?acatcgtggt?gagatctggt?attttaaccc?tgatccggtt?60

gccgggcatg?aacttcaggg?gccacattat?tgcattgtgg?taacggacaa?aaaactcaac?120

aatgttttaa?aagttgctat?gtgctgcccg?atttcaacag?gggcaaatgc?agcacgttcc?180

acaggggtga?cggtgaacgt?cctcccccgt?gatacgcaaa?ccggtaacct?gcatggcgtt?240

gtactttgtc?accagctaaa?agccgtcgat?cttattgccc?gtggcgctaa?atttcatacc?300

gttgccgatg?aaaaattgat?tagtgaagtt?atcagtaaac?tggtgaattt?aatcgaccca?360

caataa 366

<210>84

<211>351

<212>DNA

＜213〉intestinal bacteria

<400>84

atggtaaaga?aaagtgaatt?tgaacgggga?gacattgtgc?tggttggctt?tgatccagca?60

agcggccatg?aacagcaagg?tgctggtcga?cctgcgcttg?tgctctccgt?tcaagccttt?120

aatcaactgg?gaatgacgct?ggtggccccc?attacgcagg?gcggaaattt?tgcccgttat?180

gccggattta?gcgttccttt?acattgcgaa?gaaggcgatg?tgcacggcgt?ggtgctggtg?240

aatcaggtgc?ggatgatgga?tctacacgcc?cggctggcaa?agcgtattgg?tctggctgcg?300

gatgaggtgg?tggaagaggc?gttattacgc?ttgcaggcgg?tggtggaata?a 351

<210>85

<211>115

<212>PRT

＜213〉pseudomonasputida

<400>85

Met?Lys?Arg?Leu?Lys?Phe?Ala?Arg?Gly?Asp?Ile?Val?Arg?Val?Asn?Leu

1 5 10 15

Asp?Pro?Thr?Val?Gly?Arg?Glu?Gln?Gln?Gly?Ser?Gly?Arg?Pro?Ala?Leu

20 25 30

Val?Leu?Thr?Pro?Ala?Ala?Phe?Asn?Ala?Ser?Gly?Leu?Ala?Val?Ile?Ile

35 40 45

Pro?Ile?Thr?Gln?Gly?Gly?Asp?Phe?Ala?Arg?His?Ala?Gly?Phe?Ala?Val

50 55 60

Thr?Leu?Ser?Gly?Ala?Gly?Thr?Gln?Thr?Gln?Gly?Val?Met?Leu?Cys?Asn

65 70 75 80

Gln?Val?Arg?Thr?Val?Asp?Leu?Glu?Ala?Arg?Phe?Ala?Lys?Arg?Ile?Glu

85 90 95

Ser?Val?Pro?Glu?Ala?Val?Ile?Leu?Asp?Ala?Leu?Ala?Arg?Val?Gln?Thr

100 105 110

Leu?Phe?Asp

115

<210>86

<211>111

<212>PRT

＜213〉hide mycobacterium

<400>86

Met?Thr?Glu?Arg?Gly?Asp?Ile?Tyr?Ile?Val?Ser?Leu?Asp?Pro?Thr?Ser

1 5 10 15

Gly?His?Glu?Gln?Ser?Gly?Thr?Arg?Pro?Val?Leu?Val?Val?Ser?Pro?Gly

20 25 30

Ala?Phe?Asn?Arg?Leu?Thr?Lys?Thr?Pro?Val?Val?Leu?Pro?Ile?Thr?Arg

35 40 45

Gly?Gly?Asn?Phe?Ala?Arg?Thr?Ala?Gly?Phe?Ala?Val?Ser?Leu?Thr?Asp

50 55 60

Ala?Gly?Thr?Arg?Thr?Ala?Gly?Val?Ile?Arg?Cys?Asp?Gln?Pro?Arg?Ser

65 70 75 80

Ile?Asp?Ile?Arg?Ala?Arg?Lys?Gly?Arg?Lys?Val?Glu?Arg?Val?Pro?Ser

85 90 95

Gly?Val?Leu?Asp?Glu?Ala?Leu?Ala?Lys?Leu?Ala?Thr?Ile?Leu?Thr

100 105 110

<210>87

<211>121

<212>PRT

＜213〉shigella flexneri 2a str.301

<400>87

Met?Val?Lys?Ala?Arg?Thr?Pro?His?Arg?Gly?Glu?Ile?Trp?Tyr?Phe?Asn

1 5 10 15

Pro?Asp?Pro?Val?Ala?Gly?His?Glu?Leu?Gln?Gly?Pro?His?Tyr?Cys?Ile

20 25 30

Val?Val?Thr?Asp?Lys?Lys?Leu?Asn?Asn?Val?Leu?Lys?Val?Ala?Met?Cys

35 40 45

Cys?Pro?Ile?Ser?Thr?Gly?Ala?Asn?Ala?Ala?Arg?Ser?Thr?Gly?Val?Thr

50 55 60

Val?Asn?Val?Leu?Pro?Arg?Asp?Thr?Gln?Thr?Gly?Asn?Leu?His?Gly?Val

65 70 75 80

Val?Leu?Cys?His?Gln?Leu?Lys?Ala?Val?Asp?Leu?Ile?Ala?Arg?Gly?Ala

85 90 95

Lys?Phe?His?Thr?Val?Ala?Asp?Glu?Lys?Leu?Ile?Ser?Glu?Val?Ile?Ser

100 105 110

Lys?Leu?Val?Asn?Leu?Ile?Asp?Pro?Gln

115 120

<210>88

<211>116

<212>PRT

＜213〉intestinal bacteria

<400>88

Met?Val?Lys?Lys?Ser?Glu?Phe?Glu?Arg?Gly?Asp?Ile?Val?Leu?Val?Gly

1 5 10 15

Phe?Asp?Pro?Ala?Ser?Gly?His?Glu?Gln?Gln?Gly?Ala?Gly?Arg?Pro?Ala

20 25 30

Leu?Val?Leu?Ser?Val?Gln?Ala?Phe?Asn?Gln?Leu?Gly?Met?Thr?Leu?Val

35 40 45

Ala?Pro?Ile?Thr?Gln?Gly?Gly?Asn?Phe?Ala?Arg?Tyr?Ala?Gly?Phe?Ser

50 55 60

Val?Pro?Leu?His?Cys?Glu?Glu?Gly?Asp?Val?His?Gly?Val?Val?Leu?Val

65 70 75 80

Asn?Gln?Val?Arg?Met?Met?Asp?Leu?His?Ala?Arg?Leu?Ala?Lys?Arg?Ile

85 90 95

Gly?Leu?Ala?Ala?Asp?Glu?Val?Val?Glu?Glu?Ala?Leu?Leu?Arg?Leu?Gln

100 105 110

Ala?Val?Val?Glu

115

<210>89

<211>17

<212>RNA

＜213〉artificial sequence

<220>

＜223〉mRNA transcript

<400>89

aatgatgaca?ctggaag 17

<210>90

<211>17

<212>RNA

＜213〉artificial sequence

<220>

＜223〉mRNA transcript

<400>90

gtcgttgaca?ttgatgg 17

<210>91

<211>17

<212>RNA

＜213〉artificial sequence

<220>

＜223〉mRNA transcript

<400>91

atctcgaaca?cgcagcc 17

<210>92

<211>17

<212>RNA

＜213〉artificial sequence

<220>

＜223〉mRNA transcript

<400>92

tcgttttaca?cccttga 17

Claims (35)

1. detect the active method of mRNA interferases or its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) express described nucleotide sequence; (c) nucleotide sequence and the endoribonuclease substrate that step (b) is expressed hatched jointly; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provide the endoribonuclease that detects described mRNA interferases or its functional fragment active means.

2. identifying can the regulating mRNA interferases or the screening method of the active factor of its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) express described nucleotide sequence; (c) under can promoting the active condition of endoribonuclease, the nucleotide sequence and the endoribonuclease substrate of expressing in the step (b) are hatched jointly; (d) add at least a factor, measure the endoribonuclease activity whether it can regulate described mRNA interferases or its functional fragment; And the cutting of (e) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provide the endoribonuclease that detects described mRNA interferases or its functional fragment active means, and the change that wherein is cut amount of substrate under the condition that the described at least a factor exists has identified to regulate modifies the described mRNA interferases or the active factor of its functional fragment.

3. the method for claim 2, wherein said method is carried out or is carried out in cell external.

4. the method for claim 2, the active factor of endoribonuclease that wherein can regulate described mRNA interferases or its functional fragment increases the cutting of substrate.

5. the method for claim 2, the active factor of endoribonuclease that wherein can regulate described mRNA interferases or its functional fragment reduces the cutting of substrate.

6. the active method of regulating mRNA interferases or its functional fragment, wherein said activity is the endoribonuclease activity, described method comprises: the nucleotide sequence that the described mRNA interferases of coding or its functional fragment (a) are provided; (b) express described nucleotide sequence; (c) under can promoting the active condition of endoribonuclease, the nucleotide sequence and the endoribonuclease substrate of expressing in the step (b) are hatched jointly; (d) factor of adding claim 2, the described factor can be regulated the endoribonuclease activity of described mRNA interferases or its functional fragment; And the cutting of (e) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and the means that detect described mRNA interferases or its functional fragment ribonuclease activity is provided that the change that wherein is cut amount of substrate under the condition that the described factor exists provides the endoribonuclease of regulating described mRNA interferases or its functional fragment active means.

7. detect the active method of mRNA interferases or its functional fragment, wherein said activity is the endoribonuclease activity, and described method comprises: the aminoacid sequence that described mRNA interferases (a) is provided; (b) under can promoting the active condition of endoribonuclease, aminoacid sequence in the step (a) and endoribonuclease substrate are hatched jointly; And the cutting of (c) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provide the endoribonuclease that detects described mRNA interferases or its functional fragment active means.

8. identifying can the regulating mRNA interferases or the screening method of the active factor of its functional fragment, and wherein said activity is the endoribonuclease activity, and described method comprises: the aminoacid sequence that described mRNA interferases (a) is provided; (b) under the active condition of endoribonuclease the aminoacid sequence and the endoribonuclease substrate of step (a) are hatched jointly can promoting; (c) add at least a factor, determine whether it can regulate the endoribonuclease activity of described mRNA interferases or its functional fragment; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provide the endoribonuclease that detects described mRNA interferases or its functional fragment active means, and the change that wherein is cut amount of substrate when the described at least a factor exists has identified can regulate the described mRNA interferases or the active factor of its functional fragment endoribonuclease.

9. the method for claim 8, wherein said method is external or carry out in cell.

10. the method for claim 8, the active factor of endoribonuclease that wherein can regulate described mRNA interferases or its functional fragment increases the cutting of substrate.

11. the method for claim 8, the active factor of endoribonuclease that wherein can regulate described mRNA interferases or its functional fragment reduces the cutting of substrate.

12. the active method of regulating mRNA interferases or its functional fragment, wherein said activity are the endoribonuclease activity, described method comprises: the aminoacid sequence that described mRNA interferases (a) is provided; (b) under the active condition of endoribonuclease the aminoacid sequence and the endoribonuclease substrate of step (a) are hatched jointly can promoting; (c) factor of adding claim 8, the described factor can be regulated the endoribonuclease activity of described mRNA interferases or its functional fragment; And the cutting of (d) measuring described substrate, the cutting of wherein said substrate has shown that endoribonuclease is active and provide the endoribonuclease that detects described mRNA interferases or its functional fragment active means, and the change that wherein is cut amount of substrate under the condition that the described factor exists provides the endoribonuclease of regulating described mRNA interferases or its functional fragment active means.

13. be used for the treatment of the method for the patient with disease, the composition that described method comprises significant quantity on described patient's administering therapeutic to be alleviating the symptom of described disease, and described composition comprises acceptable buffer reagent on the nucleotide sequence of at least one coding mRNA interferases or its functional fragment and the medicine.

14. the method for claim 13, the expression of at least one nucleotide sequence of wherein said composition increase the cutting of endoribonuclease substrate, to alleviate the symptom of described disease.

15. the method for claim 14, wherein said disease is an infectation of bacteria, describedly uses the composition of described treatment significant quantity to described patient, alleviates the symptom of infectation of bacteria by the number that is reduced in bacterium in described patient's body.

16. the method for claim 15, wherein said infectation of bacteria comprise at least a antibiotic-resistant bacteria bacterial strain.

17. the method for claim 14, wherein said disease is the hyperplasia disease, and described composition from described treatment significant quantity to described patient that use is alleviated the symptom of described hyperplasia disease by the number that reduces hyperplasia disease cell in described patient's body.

18. treatment has the patient's of disease method, described method comprises composition to described patient's administering therapeutic significant quantity to alleviate the symptom of described disease, and described composition comprises acceptable buffer reagent on mRNA interferases or its functional fragment and the medicine.

19. the method for claim 18, the mRNA interferases in the wherein said composition or its functional fragment have improved the cutting of endoribonuclease substrate, to alleviate the symptom of described disease.

20. the method for claim 19, wherein said disease is an infectation of bacteria, and described composition from described treatment significant quantity to described patient that use is alleviated the symptom of infectation of bacteria by the number that reduces bacterium in described patient's body.

21. the method for claim 20, wherein said infectation of bacteria comprise at least a antibiotic-resistant bacteria bacterial strain.

22. the method for claim 19, wherein said disease is the hyperplasia disease, and described composition from described treatment significant quantity to described patient that use is alleviated the symptom of described hyperplasia disease by the number that reduces hyperplasia disease cell in described patient's body.

23. the method for claim 17 or 22, wherein said proliferative disease are selected from the group that following disease is formed: the restenosis behind the heteroplasia of different tissues and metaplasia, inflammatory conditions, autoimmune disorders, hyperproliferative skin disease, psoriasis, allergy/asthma, atherosclerosis and the angioplasty.

24. in cell, prepare the method for polypeptide, described method comprises: the described cell of nucleotide sequence transfection of (a) using coding said polypeptide, wherein the nucleotide sequence of coding said polypeptide is suddenlyd change, to use other triplet codon to replace mRNA interferases recognition sequence, wherein the described amino acid sequence of polypeptide by described mutant nucleic acid sequence encoding does not change because of described sudden change; (b) with the described cell of nucleotide sequence transfection of coding mRNA interferases, wherein said mRNA interferases is discerned described mRNA interferases recognition sequence; And (c) in described cell, express step (a) and nucleotide sequence (b), wherein in described cell, express the means that step (a) and nucleotide sequence (b) provide preparation polypeptide in described cell.

25. the method for claim 24, wherein the mRNA recognition sequence is ACA (ACA) sequence, and the mRNA interferases is MazF or its functional fragment that comprises SEQ ID NO:2.

26. the method for claim 24, mRNA recognition sequence wherein are uridylic-VITAMIN B4-X (UAX) sequences, wherein X is cytosine(Cyt) (C), A or U, and the mRNA interferases is PemK or its functional fragment that comprises SEQ ID NO:4.

27. the method for claim 25, wherein the expression of nucleic acids of step (b) reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises the ACA sequence.

28. the method for claim 26, wherein the expression of nucleic acids of step (b) reduces or has suppressed synthetic by the cell polypeptide of the nucleic acid sequence encoding that comprises the UAX sequence.

29. the method for claim 24, wherein step (a) and (b) carry out simultaneously.

30. the method for claim 24 also comprises described cell before (c) step or in (c) step, hatches in comprising the isotopic substratum of at least a radio-labeling.

31. prepare the method for polypeptide, described method comprises: the nucleotide sequence that coding said polypeptide (a) is provided, wherein the nucleotide sequence of coding said polypeptide is suddenlyd change, to substitute mRNA interferases recognition sequence with other triplet codon, wherein the described amino acid sequence of polypeptide by described mutant nucleic acid sequence encoding does not have owing to described sudden change is changed; (b) provide coding mRNA the nucleotide sequence of interferases, wherein said mRNA interferases is discerned described mRNA interferases recognition sequence; And (c) express step (a) and nucleotide sequence (b), wherein the expression of step (a) and nucleotide sequence (b) provides the method for producing this polypeptide.

32. the method for claim 31, wherein the mRNA recognition sequence is the ACA sequence, and the mRNA interferases is MazF or its functional fragment that comprises SEQ ID NO:2; Perhaps mRNA recognition sequence wherein is the UAX sequence, and wherein X is C, A or U, and the mRNA interferases is PemK or its functional fragment that comprises SEQ ID NO:4.

33. prepare the method for a plurality of polyribonucleotide sequences, described method comprises: first and second nucleotide sequences (a) are provided, a zone of wherein said first nucleotide sequence and a regional complementarity of described second nucleotide sequence, and two complementary region of described first and second nucleotide sequences do not comprise and mRNA interferases recognition site complementary sequence, and described first and second nucleotide sequences at their 5 ' end all by phosphorylation; (b) complementary region by described first and second nucleotide sequences makes described first and second nucleotide sequences annealing, form double-stranded nucleotide sequence, it comprises the complementary region that flank is the strand overhang, wherein each described strand overhang comprises at least one and mRNA interferases recognition site complementary sequence, and described strand overhang is complementary mutually; (c) connect annealed first and second nucleotide sequences by complementary strand overhang, form the concatermer that comprises a plurality of annealed first and second nucleotide sequence tandem repetitive sequences; (d) use comprise the T7 promotor and with first primer in the zone of described first nucleic acid array complementation and with the described concatermer of second primer amplification of described second nucleic acid array complementation, wherein said amplification produces a plurality of concatermers that comprise the T7 promotor; (e) use the T7 RNA polymerase to transcribe out the RNA molecule from described a plurality of concatermers, wherein each described RNA molecule comprises the tandem repetitive sequence that a plurality of flanks are the polyribonucleotide sequence of mRNA interferases recognition site; And (f) use and can digest described RNA molecule at the mRNA interferases of described interferases recognition site place cutting RNA, wherein said digestion produces a plurality of described polyribonucleotide sequences.

34. the method for claim 33, wherein the mRNA recognition sequence is the ACA sequence, and the mRNA interferases is MazF or its functional fragment that comprises SEQ ID NO:2; Perhaps mRNA recognition sequence wherein is the UAX sequence, and wherein X is C, A or U, and the mRNA interferases is PemK or its functional fragment that comprises SEQ ID NO:4.

35. isolated nucleic acid sequences, this sequence encoding and mRNA interferases or its functional fragment have the polypeptide of sequence and/or structural homology, and wherein said polypeptide can show the endoribonuclease activity; The cell that comprises the expression vector of described separated nucleic acid sequence and comprise described expression vector; The expression vector that comprises described separated nucleic acid sequence, wherein said nucleotide sequence effectively is connected with regulating and controlling sequence, and the cell that comprises described expression vector; The transgenic animal that comprise described separated nucleic acid sequence, wherein nucleotide sequence is expressed at least one cell of transgenic animal; Isolating aminoacid sequence, polypeptide that this sequence comprises and mRNA interferases or its functional fragment have sequence and/or structural homology, and wherein said polypeptide can show the endoribonuclease activity; The expression vector of coding said polypeptide, and the cell that comprises described expression vector; The expression vector of coding said polypeptide, wherein said polypeptide expression are under the control of regulating and controlling sequence, and the cell that comprises described expression vector; Express the transgenic animal of described polypeptide, wherein polypeptide is expressed at least one cell of transgenic animal; The composition that comprises acceptable buffer reagent on described separated nucleic acid sequence or described polypeptide and the medicine, and any purposes in described two kinds of compositions are used for the treatment of the patient with disease, to alleviate the symptom of described disease; And comprise described separated nucleic acid sequence, comprise described polypeptide or its functional fragment the amino acid separation sequence, with the buffer reagent of mRNA interferases activity compatible and the test kit of operation instruction material.

Images