CN1809374A

CN1809374A - Proton-sensing G-protein coupled receptors and DNA sequences thereof

Info

Publication number: CN1809374A
Application number: CN 200480017242
Authority: CN
Inventors: B·鲍姆加腾; C·E·琼斯; M－G·路德维格; G·马蒂尼-巴伦; K·瑟文; R·沃尔夫; L·怀德尔; T·叙普利
Original assignee: Novartis AG
Current assignee: Novartis AG
Priority date: 2003-06-20
Filing date: 2004-06-18
Publication date: 2006-07-26

Abstract

This invention relates to the newly identified utility of certain G protein-coupled receptors (GPCRs), in particular to OGR1, GPR4 and TDAG8 (TDAG8 is also named GPR65) polypeptides, and polynucleotides encoding such GPCR polypeptides, to their use in diagnosis and to methods of identifying compounds that are agonists or antagonists to said GPCRs, and to the production of such polypeptides and polynucleotides.

Description

Proton-sensing G-protein coupled receptors and DNA sequence thereof

Invention field

The present invention relates to the new purposes of determining of the polynucleotide of proton-sensing (proton-sensing) g protein coupled receptor (after this being referred to as " proton-sensing G PCRs ") polypeptide and this type of polypeptide of encoding, relate to them in diagnosis with identify purposes aspect the chemical compound of agonist as this type of proton-sensing G PCRs, antagonist, also relate to the generation of this type of polypeptide and polynucleotide.

Background of invention

Except in the effect aspect the calcium metabolism, bone is also playing a significant role aspect the pH stable state regulating.Bone has sizable buffer capacity, its can through cell-mediated process immediately (chemical equilibrium) and slowly earthquake person (Bushinsky DA, 2001, Eur J Nutr, 40:238-244).In chronic acid was poisoned, bone resorption increased to some extent, compared alkalosis and tended to stimulate bone formation (people such as Lemann J, 1966, JClin Invest, 45:1608-1614; People such as Arnett TR, 1996, Bone, 18:277-279; Bushinsky DA, 1996, Am J Physiol, 271:F216-222; Bushinsky DA, 1999, Am J Physiol, 277:F813-819).Because the nutrition of suboptimum and the renal function of decline, the old people usually presents slight chronic acid and poisons, and this can cause the bone resorption that increases, thereby participates in development (Bushinsky DA, 2001, Eur J Nutr, the 40:238-244 of osteoporosis; People such as Frassetto LA, 1996, Am J Physiol, 271:F1114-22).The pH sensitivity mechanism that works in osteocyte is still unknown so far.

In the asthma, the respiratory tract concentration of many active nitrogens and oxygen kind is high.The stability of these kinds and biological activity are that pH is dependent.The pH of the degassing respiratory tract water vapour condensate among the acute asthma patient is lower than below two logarithm levels of contrast experimenter; and make its normalization show that respiratory tract pH is the important determiner (people such as Hunt JF of respiratory inflammation with corticosteroid treatment; 2000; Am JResp, 161:694-699).Shown the acid eosinophilic granulocyte of acceleration of respiratory tract necrosis, also show the effect of respiratory tract acidity in respiratory inflammation (people such as Hunt JF, 2000, Am J Resp, 161:694-699).Once more, the pH sensitivity mechanism of cell is unknown in the respiratory tract.And, the outer activation of the born of the same parents of recent findings neutrophil cell induce they activation (people such as Trevani AS, 1999, JImmunology, 162:4849-4857).Neutrophil cell the host to play an important role in the resisting of infective agent and relate to many inflammatory disease pathogeny (people such as Ganz TM, 1988, AnnIntern Med, 109:127).The outer acidosis of the born of the same parents that reported has also hinted the effect of acidify in respiratory inflammation (people such as Trevani AS for the delay of spontaneous neutrophil cell programmed cell death, the influence that prolongs neutrophil cell functional life aspect, 1999, J.Immunol, 162:4849-4857).Support other evidence of the effect of acidify in respiratory inflammation to be included under the pH of reduction that the CBF in (＜6.5) human bronchial epithelial explant reduces or (the people such as Luk KA that disappears, 1983, Clin Sci, 64:449-451), the pH that reduces is for influence (the Holma BO of respiratory mucus viscosity, 1985, Sci Total Environ, 41:101-123) and guinea pig model in the respiratory tract acidify for the cough influence (Ricciardo FLM, Deng the people, 1999, Am J Resp Crit Care Med, 159:557-562).

Acidosis is for example cancer (people such as Wike-Hooley of multiple disease, Radiother Oncol1984,2:343-66) and ischemia (Webster KA, Cardivasc.Toxicol.2003, the performance pivotal role takes place in sign 3:283-98), wherein known blood vessel.Yet the influence to endotheliocyte does not also fully understand for acidosis.Recently, existing show the outer pH of acid born of the same parents can protect endotheliocyte avoid programmed cell death (people such as Terminella, Am.J.Physiol lung Cell MolPhysiol 2002,283:L1291-302).In addition, acidosis suppresses to be formed by endothelial cell proliferation, migration and capillary tube that 10% FCS stimulates, although the VEGF or the bFGF generation of volume more arranged and exist (D ' people such as Arcangelo, Circ.Res.2000,86:312-8).The outer pH of acid born of the same parents exists down, can be observed the remarkable delay from the blood capillary growth of cultivating the aortic annulus in three-dimensional collagen gel.Exogenous growth factors for example VEGF and bFGF in the presence of, this delay is reduced, and shows that blood vessel reacts and may still exist in the body, because there is a large amount of blood vessel generation somatomedin to have (people such as Burbridge under those situations, Angiogenesis 1999,3:281-88).

Existing being presented in tumor rather than the deleterious sour environment tumor development is conductive, the migration of inducing tumor cell and intrusion (people such as Martinez-Zaguilan, Clin Exp.Metastasis1996,14,176-86), the secretion of substrate degradation metalloproteases (MMPs) (people such as Kato, Cell Biol.Intn1996,20.375-7), and in vitro and in vivo from tumor cell (people such as Fukumura, Cancer Res.2001,61:6020-4) produce for example VEGF (VEGF) (people such as Shi of angiogenesis factor, Oncogene 2001,20:3751-6) and IL8 (people such as Shi, ClinCancer Res.1999, %:3711-21; People such as Karashima, Clin Cancer Res 2003,9:2786-97).

The existing GPR4 (being defined as the pH pick off herein) that shows has expressed in HUVECs (Human umbilical vein endothelial cells), and demonstrate the propagation and the pipe that weaken HUVECs at the siRNA of GPR4 and form (people such as Xu Y, 2003, First annual Atherothrombosis Summit:Arterial Inflammation (Sept.17-19), abstract 5).

Summary of the invention

The present invention is based on our accident discovery---some g protein coupled receptor, especially OGR1, GPR4 and TDAG8 (TDAG8 is also referred to as GPR65), as proton-sensing receptor (proton-sensing G PCRs).Thereby, the present invention relates to the new purposes of some GPCRs with proton-sensing function, relate to polynucleotide, recombined material and their production method of this type of polypeptide of encoding.This type of polypeptide and polynucleotide have importance for the method for relevant some disease treatment, described disease includes but not limited to disease and the medical conditions that proton stable state is wherein changed, be in the disease and medical conditions of hydrion level for example at the proton that relates to raising, the disease that comprises excessive bone loss, comprise osteoporosis, particularly the osteoporosis that causes of senile osteoporosis and renal failure.Except bone metabolism, proton-sensing G PCRs can participate in breathing and cardiovascular function and relevant for example inflammation and the ischemic adjusting of pathological changes of blood supply degeneration.

Further, the present invention relates to utilize gene provided by the invention and polypeptide (for example to identify the agonist of proton-sensing G PCRs and antagonist, inhibitor) method, and the method for the treatment of the disease uneven relevant with institute's compounds identified with proton.Aspect further, the present invention relates to be used to detect the diagnostic test of disease, described disease is relevant with one or more unsuitable proton-sensing G PCRs activity or level.

Invention is described

In first aspect, the present invention relates to the new purposes of some GPCR polypeptide in the pH stable state.

This type of polypeptide is selected from:

(a) isolating polypeptide, described polypeptide by comprise OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: the polynucleotide encoding of polynucleotide sequence NM_008152) preferably;

(b) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:1 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

The isolating proton-sensing G PCR of b (c) polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:1 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(d) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:3 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

(d) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:3 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(e) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:4 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

(f) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that peptide sequence with SEQ ID NO:4 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(g) isolating polypeptide, it comprises the peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4.

(h) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 80% of SEQ ID NO:1,85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity preferably at least;

(i) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 20% of SEQ ID NO:1,30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity preferably at least;

(k) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 80% of SEQ ID NO:3,85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity preferably at least;

(l) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 20% of SEQ ID NO:3,30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity preferably at least;

(m) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 80% of SEQ ID NO:4,85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity preferably at least;

(n) isolating proton-sensing G PCR polypeptide, it has and the peptide sequence 20% of SEQ ID NO:4,30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity preferably at least;

(o) peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4;

(p) isolating proton-sensing G PCR polypeptide, it has or comprises such peptide sequence, this sequence is compared with the peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4 has 0.20, preferably 0.30, more preferably 0.32, more preferably 0.45 homogeneity index;

(q) (a) fragment and the variant of this type of polypeptide in (p); And

(r) (a) polypeptide in (p), it demonstrates pH dependency inositol monophosphate or cAMP formation in the CCL39 hamster fibroblast, perhaps the pH dependent signals in the test of cAMP luciferase reporter gene in CHOK1 CRE-luc cell or the CCL39CRE-luc cell.

Polypeptide of the present invention is the member of the g protein coupled receptor family of polypeptide.With the biological characteristics of defined proton-sensing G PCRs polypeptide herein (for example, with osteoporosis, respiratory disorder, for example asthma, acute/adult respiratory distress syndrome (ARDS), chronic obstructive pulmonary disease (COPD) and cardiovascular disease is associated) after this be called " biological activity of proton-sensing G PCRs " or " proton-sensing activity ".Preferably, polypeptide of the present invention presents the biological activity of at least a aforesaid proton-sensing G PCRs.More preferably, polypeptide of the present invention presents at least a biological activity of OGR1, GPR4 or TDAG8.For example, the main biological characteristics of OGR1 polypeptide and people TDAG8 polypeptide and bone resorption disease association, described disease includes but not limited to the disease that excessive bone loss causes, comprise osteoporosis, Gum disease, the hypercalcemia of gingivitis and periodontitis, paget disease, malignant tumor for example, for example, the hypercalcemia of tumor inducing and metabolic osteopathy.In addition, the main biological characteristics of people GPR4 be for example with disease (modified compound, promptly have excitement or/and the chemical compound of antagonism may be useful in those diseases) relevant, described disease relates to blood vessel and takes place, for example cause Cancerous disease, for example solid tumor thus, heart disease, cardiovascular disease myocardial infarction for example for example, extremity disease, for example peripheral occlusive arterial disease, oculopathy, for example diabetic retinopathy or degeneration of macula, arthritis, for example rheumatoid arthritis, the wherein important disease of Wound care, and dermatosis.In addition, GPR4 for example with disease association, described disease relates to inflammatory or obstructive respiratory disease, for example causes the inducing of tissue injury, bronchus overreaction, reconstruct (remodelling) or disease progression; Described inflammatory or obstructive respiratory disease comprise the asthma of any type or origin, it comprises endogenous (nonallergic) asthma and exogenous (anaphylaxis) asthma, slight asthma, moderate asthma, serious asthma, bronchial asthma, the asthma that firmly causes behind bringing out property asthma, occupational asthma and the bacterial infection.

Polypeptide of the present invention also comprises aforementioned variant polypeptides, comprises all equipotential form and splice variants.This type of polypeptide is by guarding or nonconservative insertion, disappearance and replacement or its arbitrary combination are different from reference polypeptide.Particularly preferred variant is that those insert, replace or lacked several amino acid, for example 50 to 30,30 to 20,20 to 10,10 to 5,5 to 3,3 to 2,2 to 1 or 1 amino acid whose variant with combination in any therein.

The preferred polypeptide fragment of the present invention comprises isolating polypeptide, and it comprises the aminoacid sequence that has from least 30,50 or 100 continuous amino acids of SEQ IDNO:1, SEQ ID NO:3, SEQ ID NO:4; Or isolating polypeptide, it comprises the aminoacid sequence that has from least 30,50 or 100 continuous amino acids of the aminoacid sequence truncate of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4 or disappearance.Preferred fragment is a biological active fragment, its blocking-up or strengthen the biological activity of GPCRs of the present invention, particularly OGR1, GPR4 or TDAG8, and described fragment comprises that those have the active of similar activity or raising or have the undesirable active fragment of reduction.Equally preferably in animal especially people, have antigenicity or immunogenic those fragments.

Polypeptide fragment of the present invention can be used for by the corresponding full-length polypeptide of the synthetic generation of peptide; Thereby these variants can be used as the intermedium that produces full-length polypeptide of the present invention.Polypeptide of the present invention can be " maturation " proteinic form or may be for example part of precursor or fused protein of bigger protein.Comprise that other aminoacid sequence usually is favourable, the sequence that described other aminoacid sequence comprises secretion or targeting sequencing, presequence, help purification is the recombinate additional sequences of aborning stability of polyhistidine residue or be used to for example.

Polypeptide of the present invention can prepare in any suitable manner, for example by separation (seeing below) from naturally occurring source, from the genetically engineered host cell that comprises expression system or by chemosynthesis, utilize for example automated peptide synthesizer, or the combination of these class methods.The method for preparing this type of peptide is well-known in the art.

On the other hand, the present invention relates to the new purposes of proton-sensing G PCR polynucleotide in the pH stable state.These type of polynucleotide are selected from:

(a) isolating polynucleotide, it comprises OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), preferably OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: NM_008152), the polynucleotide sequence of OGR1, people TDAG8 and people GPR4 preferably;

(b) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:1 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

(c) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:1 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(d) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:3 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

(d) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:3 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(e) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:4 has at least 80%, preferably 85%, more preferably 90%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98% or more preferably 99% homogeneity;

(f) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of itself and SEQ IDNO:4 has at least 20%, preferably 30%, more preferably 32%, more preferably 35%, more preferably 45% homogeneity;

(g) isolating polynucleotide, it comprises OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), people GPR4 (searching number: polynucleotide sequence NM_005282);

(h) OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), people GPR4 (searching number: polynucleotide sequence NM_005282);

(i) the isolating polynucleotide sequence of coded polypeptide sequence, described peptide sequence are compared with the peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4 has 0.20, preferably 0.30, more preferably 0.32, more preferably 0.45 homogeneity index;

(q) (a) fragment and the variant of these type of polynucleotide in (i); And

(r) (a) polynucleotide in (i), its encoded polypeptides demonstrates pH dependency inositol monophosphate or cAMP formation in CCL39 hamster fibroblast, perhaps the pH dependent signals in the test of cAMP luciferase reporter gene in CHOK1 CRE-luc cell or the CCL39 CRE-luc cell.

The preferred polynucleotide passage that is used to regulate the pH stable state comprises isolating polynucleotide, it comprises and has at least 15,30, the nucleotide sequence of 50 or 100 continuous nucleotides, described continuous nucleotide is from OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1) preferably, people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) with mice TDAG8 (searching number: sequence NM_008152); Perhaps isolating polynucleotide, it comprises and has at least 30,50 or 100 continuous nucleotide sequences, described continuous amino acid is from OGR1 (searching number: NM 003485.1), rat OGR1 (searching number: XM 234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1) preferably, people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) with mice TDAG8 (searching number: truncate or disappearance in sequence NM_008152).

The preferred polynucleotide variant that is used to regulate the pH stable state comprises splice variant, allele variant and polymorphism, comprises the polynucleotide with one or more single nucleotide polymorphism (SNPs).

The polynucleotide that are used to regulate the pH stable state also comprise the polynucleotide of coded polypeptide variant, described polypeptide variants comprises the aminoacid sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4, and replace, lack or increased several amino acid residue, for example 50 to 30,30 to 20,20 to 10,10 to 5,5 to 3,3 to 2,2 to 1 or 1 amino acid residue with combination in any therein.

On the other hand, the invention provides the polynucleotide that are used to regulate the pH stable state, it is the rna transcription thing of DNA sequence of the present invention.Therefore, provide the RNA polynucleotide that are used to regulate the pH stable state, its:

(a) comprise the rna transcription thing of DNA sequence, the polypeptide of described dna sequence encoding SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4;

(b) be the rna transcription thing of DNA sequence, the polypeptide of described dna sequence encoding SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4;

(c) comprise OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: the rna transcription thing of DNA sequence NM_008152) preferably; Perhaps

(d) be OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: the rna transcription thing of DNA sequence NM_008152) and RNA polynucleotide complementary preferably with it.

(searching number: polynucleotide sequence NM_003485.1) is the cDNA sequence of the polypeptide of coding SEQ ID NO:1 to OGR1.The polypeptide of coding SEQ ID NO:1 polynucleotide sequence can (searching number: polypeptid coding sequence NM_003485.1) be same with OGR1, perhaps it can be except that OGR1 (searching number: the sequence NM_003485.1), the polypeptide of itself SEQ ID NO:1 because the redundancy (degeneracy) of genetic code is also encoded.

(searching number: polynucleotide sequence NM_005282) is the cDNA sequence of the polypeptide of coding SEQ ID NO:3 to people GPR4.The polypeptide of coding SEQ ID NO:3 polynucleotide sequence can (searching number: polypeptid coding sequence NM_005282) be same with people GPR4, perhaps it can be (the searching number: the sequence NM_005282), the polypeptide of itself SEQ ID NO:3 because the redundancy (degeneracy) of genetic code is also encoded except that people GPR4.

(searching number: polynucleotide sequence NM_003608) is the cDNA sequence of the polypeptide of coding SEQ ID NO:4 to people TDAG8.The polypeptide of coding SEQ ID NO:4 polynucleotide sequence can (searching number: polypeptid coding sequence NM_003608) be same with people TDAG8, perhaps it can be (the searching number: the sequence NM_003608), the polypeptide of itself SEQ ID NO:4 because the redundancy (degeneracy) of genetic code is also encoded except that people TDAG8.

The polynucleotide that are used for regulating the pH stable state can utilize the clone of standard and triage techniques to obtain from the cDNA library, described cDNA library derives from mRNA in for example brain, kidney, lung and the immune system cell, and (for example people such as Xu Y is seen in the expression of OGR1,2000, Nat Cell Biol, 2:261-267; People such as Zhu K, 2001, J Biol Chem, 276:41325-41335; Xu Y waits the people, and 1996, Genomics, 35:397-402; People such as An S, 1995, FEBS Letts, 375:121-124 are seen in the expression of GPR4; People such as Kyaw H are seen in the expression of TDAG8,1998, and DNA Cell Biol, people such as 17:493-500 and Choi JW, 1996, Cell Immunol, 168:78-84.) (the standard clone technology is for example seen, people such as Sambrook J, 1989, Molecular Cloning:A LaboratoryManual, second edition, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, N.Y.)。Polynucleotide of the present invention also can from natural origin for example genome dna library obtain, maybe can utilize well-known and commercially available technology and synthesized.

When being used to recombinate, polynucleotide of the present invention produce when being used to regulate the polypeptide of pH stable state, described polynucleotide can comprise the coded sequence of mature polypeptide self, or the coded sequence of the mature polypeptide in the reading frame and other coded sequence, leading or the secretion sequence of for example encoding, preceding (pre-), former (pro-), preceding former (prepro-) protein sequence, or those sequences of other fusogenic peptide part.For example, codified promotes the labelled sequence of fused polypeptide purification.In some preferred embodiment in this respect of the present invention, labelled sequence is six histidine peptides, as pQE carrier (Qiagen, Inc.) provided with Gentz R, wait the people, 1989, described in the Proc Natl Acad Sci USA 86:821-824, or the HA labelling.Polynucleotide also can comprise noncoding 5 ' and 3 ' sequence, the sequence of the non-translated sequence of for example transcribing, montage and polyadenylation signal, ribosome binding site and stable mRNA.

The polynucleotide of code book invention polypeptide, comprise from the congener of unknown species also, can obtain by the method that comprises the following step: utilize to have SEQ ID NO:1, SEQ ID NO:3 or SEQID NO:4 or its fragment, preferably the label probe of the sequence of at least 15 nucleotide screens the library under stringent hybridization condition; And separation comprises the full-length cDNA and the genomic clone of described polynucleotide sequence.This type of hybridization technique is well-known for the technical staff.Preferred stringent hybridization condition is included under 42 ℃ overnight incubation in solution, and described solution comprises: 50% Methanamide, 5 * SSC (150mMNaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5 * Denhardt ' s solution, 10% dextran sulfate and 20 micrograms/ml are through the salmon sperm DNA of degeneration, shearing; Descend washing nozzle among 0.1 * SSC at about 65 ℃ then.Thereby the present invention also comprises the isolating polynucleotide that are used to regulate the pH stable state, it preferably has the nucleotide sequence of at least 100 nucleotide, described polynucleotide obtain by utilizing label probe to screen the library under stringent hybridization condition, the polynucleotide complementation of described probe and coding SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4 or its fragments sequence, i.e. hybridization, described probe is at least 15 nucleotide preferably.

Those skilled in the art understands that in many cases, isolating cDNA sequence is incomplete, because the zone of coded polypeptide does not extend to 5 ' end always.This is the result of reverse transcriptase, reverse transcriptase is a kind of low inherently " processivity " enzyme of (enzyme keeps measuring the adhesive ability of template in polymerization process) that has, and fails to finish a DNA copy of mRNA template in the first chain cDNA is synthetic.

Have several available and the well-known method of those skilled in the art obtained full-length cDNA s, perhaps extend short cDNAs, for example those methods based on the terminal rapid amplifying of cDNA (RACE) (are seen, for example, people such as Frohman MA, 1988, Proc Nat Acad Sci USA, 85:8998-9002).The new improvement of this technology, (ClontechLaboratories Inc.) is example, for example, has significantly simplified the search to longer cDNA with Marathon (trade mark) technology.In Marathon (trade mark) technology, from the mRNA of selected tissue, prepare cDNAs from extracting, and " adapter " sequence is connected to every end.Utilize the specific oligonucleotide primers of gene specific and adapter to carry out the 5 ' end of nucleic acid amplification (PCR) then with " lacking " of amplifying cDNA.Utilize then ' nested ' primer repetition PCR reaction, ' nested ' primer promptly, design the inner annealed primer of the product that increased (usually, in the adapter sequence 3 ' the annealed adapter Auele Specific Primer far away and in the known sequence 5 ' the annealed gene-specific primer far away).Can analyze the product of this reaction then by dna sequencing, and make up full-length cDNA to provide complete sequence or to utilize new sequence information design 5 ' primer to carry out independent total length PCR by directly product being directly connected on the existing cDNA.

Recombinant polypeptide of the present invention can prepare from the genetically engineered host cell that comprises expression system by method well-known in the art.Therefore, further, the present invention relates to comprise the expression system of a kind of polynucleotide of the present invention or multiple polynucleotide, relate to the host cell that utilizes this type of expression system to produce, and relate to by recombinant technique generation polypeptide of the present invention through genetic engineering.Be used to come from the RNAs of DNA construct of the present invention, cell free translation system also can be used for producing this proteinoid.

Produce for reorganization, host cell can be through genetically engineered and expression system or its part that mix polynucleotide of the present invention.Can by as many standard laboratory handbooks, people such as Davis for example, 1986, the method described in people's (ditto) such as BasicMethods in Molecular Biology and Sambrook J is introduced host cell with polynucleotide.

The preferable methods of polynucleotide being introduced host cell comprises, for example, the transfection of the transfection of calcium phosphate transfection, the mediation of DEAE-glucosan, transfection, microinjection, the mediation of cation lipid, electrotransfection, transduction, cut labelling spike (scrape loading), trajectory introducing or infection.

The representational example of suitable host comprises bacterial cell, for example streptococcus (Streptococci), staphylococcus (Staphylococci), escherichia coli (E.coli), streptomycete (Streptomyces) and bacillus subtilis (Bacillus subtilis) cell; Fungal cell, for example yeast cells and aspergillosis (Aspergillus) cell; Insect cell is fruit bat S2 and Spodoptera Sf9 cell for example; Zooblast is CHO, COS, HeLa, C127,3T3, BHK, HEK293 and Bowes melanoma cell for example; And plant cell.

Can use a variety of expression systems, for example, chromosomal, additive type with the deutero-carrier of virus, for example, derived from bacterial plasmid, derived from phage, derived from transposon, derived from yeast episome, derived from insertion element, derived from the yeast chromosomal element, derived from virus baculovirus for example, papovavirus is SV40 for example, vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus and retrovirus, and derived from their carrier of combination, for example those are derived from the carrier of plasmid and phage genetic elements, for example cosmid and phasmid.Expression system can comprise the control area of regulating and causing expression.Usually, can keep, breed or express polynucleotide arbitrarily in the host all can use with system or the carrier that produces polypeptide.By in the multiple well-known and routine techniques any one can be suitable polynucleotide sequence insertion expression system, described technology is described those technology (see above) of people such as for example Sambrook J.Suitable secretion signal can be mixed desired polypeptides and enter inner chamber, periplasmic space or born of the same parents' external environment of endoplasmic reticulum with the protein secreting that allows to be translated.These signals can be endogenic for polypeptide or they can be the allos signal.

Can reclaim and purification polypeptide of the present invention from the reconstitution cell culture by well-known method, described method comprises ammonium sulfate or ethanol precipitation, acid extraction, anion or cation-exchange chromatography, cellulose phosphate chromatography, hydrophobic interaction chromatography, affinity chromatograph, hydroxyapatite chromatography and agglutinin chromatography.Most preferably, high performance liquid chroma-tography is used for purification.When polypeptide is synthetic in born of the same parents, during separation and/or the purification during degeneration, can use the well-known technology regeneration activity conformation that is used for again unfolded protein.

By detecting the sudden change in the related gene, can be with polynucleotide of the present invention as diagnostic reagent.To in cDNA and the genome sequence with OGR1 (searching number: NM_113485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1) preferably, people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: polynucleotide NM_008152) will provide diagnostic tool for the detection of the gene mutation form of feature and described mutant form and parafunctional relation, this instrument can increase or limit the diagnosis of disease or to the sensitivity of disease, described disease is because the low expression of described gene, spending the space of expressing or changing or time expresses and causes.The individuality that carries sudden change in the gene can detect on dna level by multiple technologies well-known in the art.

Diagnostic nucleic acid can obtain from experimenter's cell, for example from organizing vivisection or obduction material to obtain.Genomic DNA can be directly used in detection or can utilize PCR, and preferably RT-PCR or other amplification technique carry out enzymatic amplification with it before analysis.RNA or cDNA also can use in a similar fashion.Disappearance can be detected by the change that amplified production is compared in size with normal genotype with inserting.Point mutation can be identified by the DNA of amplification and the OGR1 nucleotide sequence hybridization of labelling.Preferably the sequence of mating fully and the duplex of mispairing can be distinguished by RNA enzymic digestion or the difference by melting temperature.

The difference of DNA sequence also can be by dna fragmentation electrophoretic mobility in the gel that contains or do not contain denaturant change or by direct dna sequencing detected (see, for example, people such as Myers RM, 1985, Science, 230:1242-1246).The sequence of ad-hoc location change can by the nuclease protection test for example RNA enzyme and S1 protection or chemical cleavage method disclose (see people such as Cotton, 1985, Proc Natl Acad Sci USA, 85:4397-4401).

Can make up the array that comprises polynucleotide of the present invention or its segmental oligonucleotide probe and carry out the effectively for example screening of genetic mutation.This type of array is high density arrays or grid (grids) preferably.The array technique method is well-known and has the general suitability, and can be used for handling various problems in the molecular genetics, comprise gene expression, genetic linkage, hereditary variability, see, for example, people such as Chee M, 1996, Science, 274:610-613 and other list of references of wherein being quoted.

The unusual reduction that polypeptide or mRNA are expressed or the detection of increase level also can be used for diagnosing or definite experimenter to the sensitivity of disease of the present invention.Can utilize the polynucleotide quantitative methods that is used for well-known in the art arbitrarily the expression that reduces or increase to be measured at rna level; described method is for for example; nucleic acid amplification, for example PCR, RT-PCR, RNA enzyme protection, RNA blotting and other hybridizing method.Can be used for determining deriving from protein in host's the sample, the experimental technique of polypeptide level for example of the present invention is well-known for those skilled in the art.This type of test method comprises radioimmunoassay, CBA, western blot analysis and ELISA test.

Therefore on the other hand, the present invention relates to diagnostic kit, it comprises:

(a) polynucleotide of the present invention, OGR1 (searching number: NM_113485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329) preferably, OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: nucleotide sequence NM_008152), perhaps its fragment or rna transcription thing preferably;

(b) with (a) the complementary nucleotide sequence of nucleotide sequence;

(c) polypeptide of the present invention, preferably SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4 or its fragment; Perhaps

(d) at the antibody of polypeptide of the present invention, preferably at the antibody of the polypeptide of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4.

Be appreciated that in any this test kit (a) and (b), (c) or (d) can comprise substantive composition.This test kit is diagnosing the illness, disease especially of the present invention or be useful to the aspects such as sensitivity of disease.

Expression of polypeptides of the present invention is (people such as Xu Y, 2000, Nat Cell Biol, 2:261-267 in for example brain, kidney, lung and immune cell; People such as Zhu K, 2001, J Biol Chem, 276:41325-41335; People such as Xu Y, 1996, Genomics, 35:397-402).

The present invention relates to antibody on the other hand.Polypeptide of the present invention or their fragment, or express their cell can be used as that immunity is original to produce the antibody single-minded to polypeptide immune of the present invention.Term " immunity is single-minded " means that antibody has bigger basically affinity to polypeptide comparison of the present invention other related polypeptide of the prior art.The antibody at polypeptide of the present invention that produces can utilize conventional scheme by polypeptide or the fragment or the cell that carry epi-position are applied to animal, and preferably inhuman animal obtains.For MONOCLONAL ANTIBODIES SPECIFIC FOR, provide any technology of the antibody that is produced by the continuous cell line culture all can use.Example comprises hybridoma technology (Kohler G and Milstein C, 1975, Nature, 256:495-497), trisome tumor (trioma) technology, human B cell hybridoma technology (people such as Kozbor D, 1983, Immunology Today, 4:72) and EBV hybridoma technology (people such as Cole, 1985, Monoclonal Antibodies and Cancer Therapy, 77-96, Alan R.Liss, Inc.).

Be used to produce the technology of single-chain antibody, for example U.S. Patent number 4,946, and those technology described in 778 are also applicable to the single-chain antibody that produces at polypeptide of the present invention.In addition, transgenic mice or other biology comprise other mammal, can be used for expressing humanized antibody.

Above-mentioned antibody can be used to separate or identifies the clone of express polypeptide or comes purified polypeptide by affinity chromatograph.Antibody at polypeptide of the present invention also can be used to treat disease of the present invention or the like.

Polypeptide of the present invention and polynucleotide also can be used as vaccine.Therefore; further; the present invention relates to be used for inducing the immunoreactive method of mammal; it comprises with peptide vaccination mammal of the present invention, and described polypeptide enough produces antibody and/or t cell immune response, and described T cell comprises; for example; produce the T cell or the cytotoxic T cell of cytokine, avoid disease to protect described animal, no matter whether disease forms in individual.Immunoreation in the mammal also can be induced by following method; this method comprises through carrier sends polypeptide of the present invention; described polypeptide instructs polynucleotide to express and coding said polypeptide in vivo, produces antibody so that induce this type of immunoreation and protects described animal to avoid disease of the present invention.A kind of approach of using carrier is by as coating on the granule etc. its acceleration being entered the purpose cell.This kind nucleic acid carrier can comprise the nucleic acid or the DNA/RNA heterozygote of DNA, RNA, modification.For using vaccine, polypeptide or nucleic acid carrier provide with bacterin preparation (compositions) usually.Said preparation can also comprise suitable carriers (carrier).Because polypeptide under one's belt can be destroyed, preferably with its parenteral administration (for example, subcutaneous, intramuscular, intravenous or intradermal injection).The preparation that is suitable for parenteral administration comprises aqueous and nonaqueous aseptic injectable solution, and it can contain antioxidant, buffer agent, antibacterial and make preparation and the isoosmotic solute of receptor's blood; And aqueous and nonaqueous sterile suspension, it can comprise suspending agent and thickening agent.

Preparation can be present in unit dose or the multi-dose container, for example, and the ampoule of sealing and bottle, and can be stored in the cryodesiccated environment, only need add aseptic liquid carrier at once before using.Bacterin preparation also can comprise and be used to strengthen the immunogenic adjuvant system of preparation, for example oil-in-water system and other system known in the art.Dosage depends on that the ratio of vaccine is alive and can easily determine by normal experiment.

Polypeptide of the present invention has one or more biological functions, and it is in prevention and treat and have dependency aspect one or more morbid states.This type of morbid state is the protein level or the active unusual i.e. disease in normal range not of polypeptide of the present invention.This type of disease comprises for example relating to by biological (for example Pneumocystis carinii (pneumocystis carinii), trypsanoma cruzi, trypsanoma brucei, crithidia fusiculata) and infects the disease that causes, and parasitic disease, for example schistosomicide and malaria, tumor (tumor is invaded and neoplasm metastasis), with other disease, for example metachromatic leukodystrophy, muscular dystrophy, amyotrophy and similar disease.And polypeptide of the present invention can relate to the disease that is caused by the loss of excessive bone, comprises for example hypercalcemia of gingivitis and periodontitis, paget disease, malignant tumor of osteoporosis, Gum disease, for example, and the hypercalcemia of tumor inducing and metabolic osteopathy.In addition, polypeptide of the present invention can relate to the disease of excessive cartilage or substrate degradation, comprises that osteoarthritis and rheumatoid arthritis and some relate to the tumor disease of the high level expression and the substrate degeneration of proteolytic enzyme.And polypeptide of the present invention can relate to crown disease, comprises atherosclerosis (comprise atherosclerotic plaque breaks and unstable), autoimmune disease, respiratory system disease and immune-mediated disease (comprising transplant rejection).In addition, polypeptide of the present invention can relate to the osteoporosis (for example childhood, after involutional, climacteric, post-traumatic, by old or caused by corticosteroid treatment or inertia) of multiple origin.

In addition, polypeptide of the present invention can relate to inflammatory or obstructive respiratory disease, thereby causes, for example, and the inducing of tissue injury, bronchus overreaction, reconstruct or disease progression; Inflammatory that the present invention was suitable for or obstructive respiratory disease comprise the asthma of any type or origin, it comprises endogenous (nonallergic) asthma and exogenous (anaphylaxis) asthma, slight asthma, moderate asthma, serious asthma, bronchial asthma, the asthma that firmly causes behind bringing out property asthma, occupational asthma and the bacterial infection.The experimenter who suffers from asthma also comprises the experimenter who for example was lower than for 4 or 5 one full year of life, it presents the symptom and after diagnosing or diagnosable for " baby pants " of panting, it is a kind of fixed patient's kind of main medical attention, often be accredited as initial stage or early stage asthma at present (for simplicity, the asthma that this is specific is called " panting property baby comprehensive is levied "), and, polypeptide of the present invention can relate to the prophylactic treatment of asthma, and paresthesia epilepsy is acute asthma or the frequency of bronchoconstriction outbreak or the reduction of seriousness for example, the provable this point of respiratory tract hyperergy of the enhancing of pulmonary function or improvement.Needs for other symptom treatment reduce and can further prove, described treatment promptly is used for when outbreak takes place or is intended to restriction or ends paresthesia epilepsy, for example antibiotic medicine (for example corticosteroid) or bronchodilators.The preventative benefit of asthma is particularly evident in the experimenter who tends to " morning dipping "." orningdipping " is the asthma syndrome of generally acknowledging; common and feature is for example asthma attack between 4 to 6 o'clock of the morning for most of asthma, promptly at one usually basically away from the time outbreak of the previous symptomatic treating asthma of using arbitrarily.And, polypeptide of the present invention can relate to other inflammatory or obstructive respiratory disease and disease, for example acute lung injury (ALI), acute/adult respiratory distress syndrome (ARDS), chronic obstructive pulmonary, respiratory tract or lung disease (COPD, COAD or COLD), comprise chronic bronchitis or relevant therewith dyspnea, emphysema and because the deterioration of the respiratory tract hyperergy that other medicines treatment, especially other imbedibility Drug therapy cause.The bronchitis that polypeptide of the present invention also relates to which kind of type no matter or origin comprises, for example acute bronchitis, arachidic bronchitis, catarrhal bronchitis, croupous bronchitis, chronic bronchitis or phthinoid bronchitis.The inflammatory of other that polypeptide of the present invention is related or obstructive respiratory disease comprise pneumoconiosis (professional pneumonopathy inflammatory, common of any type or origin, usually follow respiratory tract obstruction, chronic or acute, and suck and cause) by repeatedly dust, comprise, for example aluminosis, anthracosis, asbestosis, chalicosis, ptilosis, arc-welder's disease, silicosis, tabacism and byssinosis.Consider their antiphlogistic activity, particularly relate to the activatory inhibition of oxyphil cell, polypeptide of the present invention also relates to disease, Eosinophilia for example, especially oxyphil cell's respiratory passage diseases of being correlated with (for example, the ill oxyphil cell who comprises lung tissue is soaked into) comprise that acidophil is too much, since its influence respiratory tract and/or lung and, for example, corresponding or follow in loeffler syndrome, oxyphil cell's pneumonia, parasite (especially metazoa) invasion and attack (comprising tropical Eosinophilia's disease), bronchopulmonary aspergillosis, polyarteritis nodosa (comprising Qiu-Si syndrome), the respiratory passage diseases that eosinophilic granuloma's oxyphil cell is correlated with, and the disease of being correlated with by the oxyphil cell who influences respiratory tract that drug reaction causes.

Useful influence is assessed in pharmacology's test in the external and body known to this area is common, and so the place illustrates.Be evincible during above-cited character is tested in vitro and in vivo, utilize to described convenient test mammal, for example rat, mice, Canis familiaris L., rabbit, monkey or isolating organ and tissue, and natural or by for example mammiferous enzyme preparation of recombinant technique preparation.The agonist of polypeptide of the present invention or antagonist, its can by as described here for example the screening test among the embodiment 10 obtain, use in external form that can solution, for example preferably aqueous solution or suspension, and intestinal or parenteral ground make things convenient for the ground warp mouth to use in vivo, for example use with suspension or aqueous solution or with solid gum wafer or Tabules.Under asthma or similar disease situation, can directly agonist and antagonist be delivered to lung.External dosage can be about 10 ^-5Mole and 10 ^-9Between the molar concentration scope.Dosage can be depending on route of administration in the body, is about 0.1 to 100mg/kg.

Triage techniques: polynucleotide of the present invention, polypeptide and at the antibody of polypeptide also can be used for being designed for detect add the screening technique of the influence of the generation of mRNA and polypeptide in the chemical compound pair cell.For example, can utilize monoclonal and polyclonal antibody to make up enzyme-linked immunosorbent assay by standard method known in the art is used to measure excretory or in conjunction with the level of the polypeptide of cell.This can be used for finding to suppress or to improve the medium (also being called antagonist or agonist) that polypeptide produces from the cell or tissue that is fit to operation.

Polypeptide of the present invention can be used for identifying membrane-bound or soluble receptor (if any) by standard receptors bind technology known in the art.These technology include, but are not limited to part combination and crosslinked algoscopy, and wherein polypeptide through radiosiotope (for example, ¹²⁵I) labelling, chemical modification (for example, biotinylated), or be fused on the peptide sequence that is fit to detection or purification, and hatch with the source (cell, cell membrane, cell conditioned medium liquid, tissue extract, body fluid) of putative receptor.Other method comprises biophysics technology for example surface plasma body resonant vibration and spectroscopy.These screening techniques also can be used for identifying the agonist and the antagonist of polypeptide, and they combine its receptor (if any) with the polypeptide competition.The standard method that is used to make up this type of algoscopy is well-known in the art.

The example of the antagonist of polypeptide of the present invention comprise antibody or, in some cases, oligonucleotide or protein with part, substrate, receptor, enzyme or the like are closely related depend on the circumstances, the antagonist of polypeptide can be, the fragment of part, substrate, receptor, enzyme or the like for example; Or be attached to polypeptide of the present invention but do not induce reaction thereby micromolecule that polypeptide active is suppressed.

Screening technique also comprises the use of transgenic technology.The field that makes up transgenic animal is sophisticated.For example, can introduce OGR1, GPR4 or TDAG8 gene in the male pronucleus of the oocyte of being fertilized by microinjection, implant embryo before or after shifting into by retrovirus, perhaps for example the embryonic stem cell by electroporation injection genetic modification enters host's blastula (pl blastulae).The transgenic animal that are particularly useful are so-called " knocking in " animals, wherein the personnel selection etc. the homogenic animal gene that has replaced in this animal gene group.Knocking in transgenic animal is useful for target validation in drug discovery process, and wherein chemical compound is special for people's target.Other useful transgenic animal are " knocking out " animals that are called, wherein partially or completely eliminated of the present invention and by the animal of endogenous dna sequence encoded polypeptides in the cell directly to the expression of congener.But gene knockout targeting specific cells or tissue because the limitation of technology can only betide some cell or tissue, perhaps can betide in the animal all or all basically cells.The transgenic animal technology also provides complete animal expression cloning system, and wherein the gene of Yin Ruing is expressed and produced a large amount of polypeptide of the present invention.

The screening reagent box-like that is used in the said method has become the present invention on the other hand.This type of screening reagent box comprises:

(a) polypeptide of the present invention;

(b) reconstitution cell of expression polypeptide of the present invention;

(c) cell membrane of expression polypeptide of the present invention; Perhaps

(d) antibody of polypeptide of the present invention; This polypeptide is the polypeptide of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4 preferably;

Be appreciated that in any this kind test kit (a) and (b), (c) or (d) can comprise essence composition.

Nomenclature

Provide following definition help to understand above some term of the frequent use of institute.

" antibody " comprises polyclone and monoclonal antibody, chimeric antibody, single-chain antibody and humanized antibody and Fab fragment as used herein, comprises the product in Fab or other immunoglobulin expression library.

" isolating " means through staff and changes from its naturalness, if promptly it appears in the nature, it has acquired change or has shifted out from its initial environment so, or the two all has.For example, natural polynucleotide or the polypeptide that is present in the Living Organism is not " isolating ", but isolated identical polynucleotide or polypeptide are " isolating ", term as used herein from the material of the coexistence of its naturalness.And, introduce organic polynucleotide or polypeptide is " isolating " by conversion, genetic manipulation or by other recombination method arbitrarily, even it still is present in the described organism, this organism can be alive or non-work.

" polynucleotide " are often referred to polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA), and it can be RNA or DNA unmodified or that modify." polynucleotide " comprise, but do not limit, single and double-stranded DNA, be the mixture of list and double-stranded region DNA, list and double-stranded RNA, and be RNA, the hybrid molecule of the mixture of list and double-stranded region, it comprises and can be strand or the more typically DNA and the RNA of the mixture of two strands or list and double-stranded region.In addition, " polynucleotide " relate to and comprise the two three chain zones of RNA or DNA or RNA and DNA.Term " polynucleotide " also comprises DNAs or the RNAs that contains one or more modified bases and has for DNAs or the RNAs stable or main chain that other reason is modified.

" modification " base comprises that for example, tritylation base and rare bases are inosine for example.Can carry out multiple modification to DNA and RNA, thereby, " polynucleotide " comprise the polynucleotide usually found as occurring in nature chemically, enzymatic ground or metabolism ground modified forms, and viral and the DNA of cell and the chemical species of RNA feature." polynucleotide " also comprise short relatively polynucleotide, often are called oligonucleotide.

" polypeptide " refers to comprise two or more amino acid whose any polypeptide that the peptide bond by peptide bond or modification is connected with each other, i.e. structure thing such as peptide." polypeptide " relates to short chain, is commonly referred to peptide, oligopeptide or oligomer, also relates to longer chain, is commonly referred to protein.Polypeptide can contain the aminoacid except that the aminoacid of 20 kinds of gene codes." polypeptide " comprises by natural process, for example translates post-treatment, or pass through the aminoacid sequence that chemical modification technology well-known in the art is modified.This type of is modified in basic textbook and more detailed monograph and the long research document and has a detailed description.Modification can betide any place of polypeptide, comprises peptide main chain, amino acid side chain and amino or carboxyl terminal.The several position that is modified at given polypeptide that is appreciated that same kind can exist with identical or different degree.And given polypeptide can contain polytype modification.Polypeptide can be able to branch because of ubiquitination, and they can be cyclicly, has or does not have a branch.Cyclic, ramose and branch's ring type polypeptide can be produced by translation back natural process or prepare by synthetic method.Modification comprises acetylation, acidylate, the ADP-ribosylation, amidatioon, biotinylation, the covalent attachment of flavin, the covalent attachment of heme moiety, the covalent attachment of nucleotide or nucleotide derivative, the covalent attachment of lipid or lipid derivant, the covalent attachment of phosphatidylinositols, crosslinked, cyclisation, disulfide bond forms, demethylation, the formation of covalent cross-linking, the formation of cystine, the formation of pyroglutamic acid, formylated, γ-carboxylated, glycosylation, the GPI anchor forms, hydroxylating, iodate, methylate, myristoylation, oxidation, Proteolytic enzyme processing, phosphorylation, isoprenylation, racemization, selenizing, sulphation, the aminoacid of transfer RNA mediation is to proteinic interpolation, for example arginylization and ubiquitination (are seen, for example, Proteins-Structure and Molecular Properties, second edition, T.E.Creighton, W.H.Freeman and Company, New York, 1993; Wold, F., Post-translationalProtein Modifications:Perspectives and Prospects, 1-12, inPost-translational Covalent Modification of Proteins, B.C.Johnson, Ed., Academic Press, New York, 1983; People such as Seifter, " Analysis for proteinmodifications and nonprotein cofactors ", Meth Enzymol, 182,626-646,1990, people such as and Rattan, " Protein Synthesis:Post-translationalModifications and Aging ", Ann NY Acad Sci, 663,48-62,1992).

" fragment " of peptide sequence refers to lack than reference sequences but keeps and SEQ ID NO:1 identical biological function of reference polypeptide or the active peptide sequence of SEQ ID NO:3 or SEQ ID NO:4 basically." fragment " of polynucleotide sequence refer to than OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM-005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: the polynucleotide sequence that NM_008152) reference sequences is short preferably.

" variant " refers to different but keep the polynucleotide or the polypeptide of its fundamental property with reference to polynucleotide or polypeptide.The general variant of polynucleotide lists at nucleotides sequence and is different from reference to polynucleotide.Variation in the nucleotide sequence of variant may or may not change the aminoacid sequence with reference to the polynucleotide encoded polypeptide.Nucleotide changes aminoacid replacement, interpolation, disappearance, fusion and the truncate that can cause in the reference sequences encoded polypeptide, and is as described below.The general variant of polypeptide is different from reference polypeptide on aminoacid sequence.Usually, change is limited, thereby the sequence of reference polypeptide and variant is very similar generally, is identical in many zones.Variant and reference polypeptide replacement, insertion, disappearance that can be by one or more combination in any and different.Amino acid residue that replace or that insert may or may not encoded by genetic code.General conservative replacement comprises Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln, Ser, Thr; Lys, Arg; With Phe and Tyr.Polynucleotide or variant polypeptides may be naturally occurring for example allele, and perhaps it known to can being or not naturally occurring variant.The variant that the non-natural of polynucleotide and polypeptide exists can be by induced-mutation technique or is directly synthesized and prepare.What be included as variant in addition is the polypeptide with one or more post translational modifications, described post translational modification for for example glycosylation, phosphorylation, methylate, ADP ribosylation or the like.Embodiment comprises that N-terminal amino acid whosely methylates, serine and the phosphorylation of threonine and the modification of C-terminal glycine.

" allele " refers to one of two or more alterative version of the gene of the specific gene seat that betides in the genome.

" polymorphism " refers to the variation in the nucleotide sequence (with the encoded polypeptide sequence, if relevant) on the given position in colony's internal gene group.

" single nucleotide polymorphism " (SNP) refers to the generation of nucleotide variability on single nucleotide position in colony's internal gene group.SNP can occur in the gene or genomic intergenic region.SNPs can utilize allele specific amplification (ASA) to measure.At least need 3 primers for this method.Article one, universal primer is used for the reverse complemental of polymorphism to be determined.This universal primer can the distance polymorphic base 50 to 1500bps between.Two other (or more) primer is mutually the same, is that 3 ' last base is waved with one in two (or more) allele of coupling formation polymorphism.Then sample DNA is carried out twice (or more) PCR reaction, utilize universal primer and an allele-specific primers at every turn.

" splice variant " used herein refers to generation from the cDNA of RNA molecule molecule, and described RNA molecule is transcribed at first from identical genomic dna sequence but experienced alternative RNA montage.When the montage of primary rna transcript experience alternative RNA montage taking place, be generally used for the removal of intron, causes producing more than one mRNA molecule, every kind of different aminoacid sequence of mRNA molecule codified.The term splice variant also refers to by the coded protein of above-mentioned cDNA molecule.

" homogeneity " has reflected the relation between the determined two or more peptide sequences of comparative sequences or the two or more polynucleotide sequence.Usually, homogeneity refer to respectively two polynucleotide or two peptide sequences on the sequence length that compare accurately nucleotide pair nucleotide or aminoacid to amino acid whose correspondence.

" % homogeneity "---for wherein there not being accurately corresponding sequence, can measure " % homogeneity ".Usually, two sequences that comparison will be compared are to provide dependency maximum between two sequences.This can be included in and insert " breach " in one or two sequence, to improve the degree of comparison.% homogeneity can be measured (overall comparison that is called) on the sequence total length that each will compare, this is particularly suitable for sequence same or very similar length, perhaps measure (the part comparison that is called) on the length of short qualification, this is more suitable for the sequence in unequal length.

" unbalanced pH scope/unbalanced proton stable state "---normal tremulous pulse pH scope (7.36 to 7.44) approximately comprises two standard deviations of normal population; To arbitrarily outside this scope, think unusual.Clinically, " safety " scope of pH is about 7.30 to 7.52; PH itself is not life-threatening usually in this scope.Because the enzymatic activity and the enhanced myocardium irritability that change, the pH outside this scope is possible life-threatening, should take direct measure pH is returned to normally (originate: Http:// www.mtsinai.org/pulmonary/books/physiology/chap7 1.htm).Therefore, " unbalanced pH scope/unbalanced proton stable state " means in the context of present patent application it is part or system's pH value except that 7.36 to 7.44.

" similarity " is the further complicated more mensuration to the relation between two peptide sequences.Usually, " similarity " means the comparison between the aminoacid of two polypeptide chains, based between residue and residue relatively, not only consider from each and compare the correspondence of the residue of (for homogeneity) sequence a strictness, and consider not have accurately corresponding place, based on the basis of evolving, whether a residue may replace another residue.This probability has relevant " mark ", therefrom can determine " the % similarity " of two sequences.

The method that is used for more two or more sequence homogeneity and similarity is well known in the art.Thereby for example, at Wisconsin Sequence Analysis Package, version 9.1 (people such as Devereux J, Nucleic Acids Res, 12,387-395,1984, from GeneticsComputer Group, Madison, Wisconsin, USA can obtain) in obtainable program, for example program BESTFIT and GAP can be used for determining % homogeneity between two polynucleotide and % homogeneity and the % similarity between two polypeptide.BESTFIT uses " local homology " algorithm (J Mol Biol, 147, the 195-197 of Smith and Waterman, 1981, Advances in AppliedMathematics, 2,482-489,1981) and found the single zone of the best of similarity between two sequences.BESTFIT is more suitable in comparison length different two polynucleotide or two peptide sequences, and this program is supposed the part of the longer sequence of sequence representative that this is short.Relatively, GAP compares two sequences, according to the algorithm of Neddleman and Wunsch (J Mol Biol, 48,443-453,1970), seeks " maximum comparability ".GAP is more suitable for the sequence in more about equal length, and is desirably on the total length and compares.Preferably, parameter " breach weight " and " length weight " used in each program are 50 and 3 for polynucleotide sequence respectively, are 12 and 4 for peptide sequence.Preferably, when two sequences that compared are best comparisons, determine % homogeneity and similarity.

Other program that is used for determining homogeneity between sequence and/or similarity also is known in this area, for example BLAST family program (people such as Altschul S F, J Mol Biol, 215,403-410,1990, people such as Altschul S F, Nucleic Acids Res., 25:389-3402,1997, can obtain Bethesda, Maryland from NCBI (NCBI), USA, and can be by the homepage of NCBI Www.ncbi.nlm.nih.govEnter) and FASTA (Pearson W R, Methods inEnzymology, 183,63-99,1990; Pearson W R and Lipman D J, Proc NatAcad Sci USA, 85,2444-2448,1988, can be used as the part of Wisconsin Seq uence AnalysisPackage and obtain).

Preferably, with BLOSUM62 amino acid substitution matrix (Henikoff S and Henikoff J G, Proc.Nat.Acad Sci.USA, 89,10915-10919,1992) be used for peptide sequence relatively, comprise that wherein nucleotides sequence is at first translated into aminoacid sequence before being listed in comparison.

Preferably, service routine BESTFIT is to determine inquiry polynucleotide or the peptide sequence % homogeneity with respect to reference polynucleotide or peptide sequence, and the inquiry of best comparison and the parameter of reference sequences and program are set to default value, and be as indicated above.

" homogeneity index " is the measurement of serial correlation, and it can be used for comparison candidate sequence (polynucleotide or polypeptide) and reference sequences.Thereby, for example, for example have that to be in a ratio of 0.95 exponential candidate's polynucleotide sequence of homogeneity and reference sequences with the reference polynucleotide sequence be homogeneity, just candidate's polynucleotide sequence average 5 differences nearly of per 100 nucleotide that may comprise reference sequences.This type of difference is selected from least one nucleotide deletion, replacement comprises conversion and transversion or insertion.These differences can betide with reference to 5 ' or 3 ' terminal position of polynucleotide sequence or any place between these terminal positions, are dispersed in individually in the nucleotide of reference sequences or are dispersed in the reference sequences with the form of one or more adjacent set.In other words, compare with the reference polynucleotide sequence for obtaining to have that to have the homogeneity index be 0.95 polynucleotide sequence, average 5-25 at most is individual in per 100 nucleotide of reference sequences may lack, replaces or insert, or its combination in any, as indicated above.

Similarly, for polypeptide, for example have that to be in a ratio of 0.95 exponential candidate's peptide sequence of homogeneity and reference sequences with the reference polypeptide sequence be homogeneity, just candidate's peptide sequence can comprise average maximum 5 differences of per 100 aminoacid of reference sequences.This type of difference is selected from least one aminoacid deletion, replacement comprises conservative and non-conservative replacement or insertion.These differences can occur in amino or the carboxyl terminal position or any place between these terminal positions of reference polypeptide sequence, are dispersed in individually in the aminoacid of reference sequences or are dispersed in the reference sequences with the form of one or more adjacent set.In other words, to have the homogeneity index be 0.95 peptide sequence in order to obtain to compare with the reference polypeptide sequence, and average maximum 5 can lack, replace or insert in per 100 aminoacid of reference sequences, or its combination in any, as indicated above.

Relation between the number of nucleotide or aminoacid difference and the homogeneity index can be expressed by following equation:

n _a≤x _a-(x _a·I)

Wherein:

n _aBe the number of nucleotide or aminoacid difference,

x _aBe respectively as OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1) preferably, people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) with mice TDAG8 (searching number: the sum of listed nucleotide NM_008152), perhaps SEQ ID NO:1, amino acid whose sum among SEQ ID NO:3 or the SEQ ID NO:4.

I is the homogeneity index,

Be the symbol of multiplication operator, wherein with x _aWith any non-integer product round down of I to immediate integer, then with the result from x _aDeduct.

" congener " is general term used in this area, refers to have polynucleotide or peptide sequence about the height serial correlation of reference sequences.This dependency can be as indicated above by determining that homogeneity and/or similarity degree between two sequences quantize.What belong to this general terms is term " directly to congener " and " symbiosis congener "." directly to congener " refers to those polynucleotide or polypeptide for the function equivalent of polynucleotide in another species or polypeptide." symbiosis congener " refers to those similar polynucleotide or polypeptide on same species built-in function.

" fused protein " refers to the protein by two kinds of incoherent, fusion genes or its fragment coding.

All publications and list of references that this description is quoted, include but not limited to patent and patent application, quote herein as a reference with its complete content, just as each independent publication or list of references are pointed out to quote as a reference herein specially and individually.The patent application of priority that any the application requires is also quoted as a reference in above-mentioned mode for publication and list of references herein with its complete content.

Embodiment

The clone of embodiment 1:OGR1 and the generation of stable cell lines

(all cells is from ATCC=American type culture collection (American typeculture collection) for CCL39 hamster fibroblast, HEK293 HEKC and MG63 human osteosarcoma cell, Manassas, USA) be incubated in 1: 1 mixture of the DMEM of buffered with bicarbonate and Ham ' s F12 culture medium, wherein added 10% hyclone and antibiotic, under pH7.4 in CO ₂Cultivate in the gas.Set up people's trabecular bone source preosteoblast (preosteoblasts) primary culture and as cultivating of describing in detail previously (people such as Sottile V, 2002, Bone, 30:699-704).By will (U48405 NM_003485) be cloned into the expression vector that pcDNA3.1 (+)/myc-His (Invitrogen, Basel, Switzerland) prepares OGR1 from the cDNA of this receptor of human gene group DNA.Be used to carry out direct mutagenesis from the Quick Change test kit of Stratagene (Basel, Switzerland).For stable transfection, utilize PvuI.Stable with the carrier linearisation and utilize Effectene reagent (Qiagen, Basel, Switzerland) to carry out transient transfection.Then, utilize the screening of antibiotic G418 (400 μ g/ml), isolate the stable cell colony of expressed receptor.Genetically modified expression and film are located the antibody (Zymed/Stehelin﹠amp by the anti-myc that utilizes the FITC labelling; Cie, Basel, Switzerland) carry out immunocytochemistry and confirmed.

Embodiment 2:OGR1 activates the proton-sensing G-protein coupled receptors that IP forms

Inositol monophosphate (IP) forms to be measured: buffer and pH: the saline solution that is used for IP formation experiment cushions with independent HEPES (20mM) or HEPES/EPPS/MES (every kind of 8mM), to cover wideer pH scope.HEPES is 4-(2-hydroxyethyl) piperazine-1-ethyl sulfonic acid, and EPPS is N '-(2-hydroxyethyl) piperazine-N '-3-N-morpholinopropanesulfonic acid, and MES is 2-(N-morpholino) ethane sulfonic acid.The pH meter (Metrohm, Herisau, Switzerland) of the careful calibration of the utilization at room temperature pH with all solution transfers to indicated value.All data in this report are all with reference to the pH under the room temperature.For obtaining the pH under 37 ℃,, should deduct 0.15pH unit for the HEPES buffer in the pH6.8-7.8 scope according to our calibration experiments.IP forms mensuration: use myo[in the DMEM of serum-free culture medium ³H] inositol (100MBq/ml; ART/Anawa Trading, Wangen-Duebendorf, Switzerland) cell culture that converge of labeling and growing in 24 orifice plates 24 hours.Under 37 ℃, cell is being contained 130mMNaCl, 0.9mM NaH then ₂PO ₄, 5.4mM KCl, 0.8mM MgSO ₄, 1.8mM CaCl ₂, the 25mM glucose buffer salt solution in hatch.Add lithium (20mM) with blocking-up inositol monophosphate enzymatic activity, cause the gathering of IP1 (people such as Berridge MJ, 1982, Biochem J, 206:587-595; Berridge MJ and Irvine RF, 1989, Nature, 341:197-205).In need indication part, the adding in 1 minute before adding lithium with thrombin of beef or SPC (all from Sigma, Buchs, Switzerland).Except as otherwise noted, continue to hatch 20 minutes.Strictly foregoing then (people such as Seuwen K, 1988, EMBO J, 7:161-168), ice-cold formic acid extracting cell utilizes also in batches that column chromatography separates total IPs from free inositol.

Result:, observe the intensive and tangible ligand dependent activation of phosphoinositide metabolism in cells transfected along with the instantaneous or stably express of OGR1.This effect continues in the mensuration buffer that lacks calcium, magnesium, phosphate, sulfate, has got rid of OGR1 through the activated possibility of any these compositions.Yet, the change of pH of buffer influences inositol monophosphate (IP) consumingly and forms: the CCL39 hamster fibroblast of stably express OGR1 is hatched in the buffered saline solution of the HEPES of different pH, and measure the gathering of IPs (people such as Berridge MJ under the situation of inositol monophosphate enzyme inhibitor lithium lacking under 37 ℃ or exist, 1982, Biochem J, 206:587-595; Berridge MJ and IrvineRF, 1989, Nature 341:197-205).At pH7.6, IP forms and approaches background when having lithium, yet lower pH causes significantly gathering of IPs, and it was linearity and the highest when pH6.8 in 30 minutes.The pH of our standard test buffer is 7.4, and why it explained that to have observed significant basis in front the experiment active.Proton can be drawn the concentration-response curve that is equipped with standard to the activation of OGR1, cover the outer pH of born of the same parents of relative broad range.In the CCL39 hamster fibroblast half maximum activation of expressed receptor occur in pH 7.48+/-0.04 (meansigma methods+/-sem; N=12).Activate high Collaboration seemingly, have＞2 hill coefficient.Under sour environment (pH＜6.5), IP forms once more and descends, and reflects the common pH dependency of phosphoinositide signaling system in the CCL39 cell.SPC---it is reported activate OGR1 the biological activity lipid---receptor that does not stimulate us to consider does not influence the pH dependent stimulation that IP forms yet.This molecule is activated, yet, suppress the adenyl cyclase that the forskolin in other cell system stimulates, hinting that it acts on the also not clear and definite so far receptor that is different from OGR1.

Importantly, the cell of untransfected or the cell of expressing other receptor do not demonstrate the pH dependent stimulation of phosphoinositide metabolism.Similarly, do not regulated in the scope that is reflected at pH7-8 at other receptor stimulating agent, as being confirmed by thrombin by forward, endogenous receptor (Paris S and Pouyssegur J in the described thrombin activation CCL39 cell, 1986, EMBO J, 5:55-60).Pertussis toxin, PT (PTX) is not suppressed at the IP that is measured under the existence of pH7, lithium and forms, and shows that strongly OGR1 passes through the metabolism of Gq activating phosphatase inositol.Be additional in these cells by the signal that OGR1 caused at the reaction of thrombin, the part that described pH7 of being reflected at and pH7.6 are subjected to PTX suppresses, as early stage work desired (Paris S and Pouyssegur J, 1986, EMBOJ, 5:55-60).The activation of OGR1 is very strong under neutral or slight acid pH.Suitable with the activation of other GPCRs that causes by its cognate ligand.In the HEK of the HEK of transient transfection cell and stable transfection cell, also observe the strong pH dependency that IP forms activate (half maximum activation in pH 7.38+/-0.04 (meansigma methods+/-sem; N=4)).The activated passage of some pH for temperature be highstrung (people such as Smith GD, 2002, Nature, 418:186-190).Yet, form speed at the IP that pH7.6 and pH7.0 measured and only be subjected to the influence of scope at the minimum level of 35-42 ℃ temperature for OGR1.

The receptor model of embodiment 3:OGR1

Receptor model: consider the high similarity between the GPCRs of OGR1 and other rhodopsin sample, set up the homology model for template with the rhodopsin structure announced (Palczewski K waits the people, 2000, Science 289:739-745).Primary sequence and the cattle rhodopsin (bRHO) of OGR1 are compared, and, utilize SCWRL program (Bower MJ for the amino acid whose position of indication, Deng the people, 1997, J Mol Biol 267:1268-1282) replaces the side chain that exists among the bRHO with the corresponding side chain of OGR1.Use molecular mechanics and the perfect structure that obtains of kinetics, utilization has the (people such as Cornell WD of the AMBER field of force apart from the dependency dielectric function of ε=1*r, 1995, J Am ChemSoc, parm96.dat parameter 117:5179-5197), we are used for the perfect Wit! of energy The minimax module of P software, and the sander_classic module of AMBER6 program package.In all computational processes, by fixedly be in C alpha atom or the position (potential energy minimumization) in 0.5A in the motion with the harmonic wave electromotive force by limiting them.Born of the same parents' outer shroud and all amino acid side chains are able to freely-movable in the electromotive force in the field of force.Between residue CYS94 and CYS172, introduce disulfide bond.Born of the same parents' internal ring not included.

The result: histidine should play a significant role in the pH of OGR1 dependency activates.Really, the inspection of the 3D model of receptor is shown that several histidine may cluster in born of the same parents' outer surface, place the top of spiral I, IV and VII, and in born of the same parents' internal ring 1 and 2.All histidine are all guarded in the sequence (seeing searching number XM_138218, XM_234483 and U88367 respectively) of mice, rat and cattle.Especially, this model prediction has direct interaction of hydrogen bond between H20 and the H269 under protonation state not, thereby connects spiral I and spiral VII.Secondary interaction may connect receptor N-terminal and born of the same parents' outer shroud 1 between H17 and H84.Yet, consider the flexibility of born of the same parents' outer shroud, compare with the interaction between H269 with H20, as if this interaction still less may form, and needs to limit so that it drops on appropriate position at first in our model.Other histidine is found in other position at receptor, but they seem more not obvious with the interaction or the strong electrostatic interaction of other residue.We set about respectively with might suddenly change to phenylalanine by crucial histidine, and measure pH dependency receptor activation in the transient transfection experiment.By immunocytochemistry, utilize C-terminal myc labelling to all receptor constructs screening recombinant protein expression, and find recombinant protein with similar horizontal expression on cell membrane.The sudden change of histidine 89,159,175 does not have main influence at function of receptors.Yet consistent with our expection, each all is that normal sensitivity that pH is changed is needed for a histidine 17,20,84,269.In addition, H169 is important.These amino acid whose sudden changes have caused can not stimulating at pH6.8 the receptor of IP formation, yet, in case be exposed to sourer pH, can recover active.Proton concentration-response curve seems right shift, that is, reduce for the sensitivity of part.It is active all can not to observe the dependent basis of enhanced pH in any case.Based on our model, be difficult to the direct explanation of the participation situation of H169 in proton-sensing, because its geometry at born of the same parents' outer shroud 2, can't be predicted at present well in the position of H169.The sudden change of H245 can not tolerate, and causes serious (although inwhole) loss function.According to our model, this aminoacid is positioned spiral VI, towards liquid environment, and may be required for the integrity of total.To have minimum purpose histidine and still have the receptor of function at pH7-7.8 in order to produce, our preparation has also been tested H89,159,175F construct.Coded protein still works in the HEK of transient transfection cell as wild-type receptor really.

Histidine to can with Zn ²⁺And Cu ²⁺Atomic coordinate, and should the fact be used to study GPCR structure-function (people such as Elling CE, 1995, Nature, 374:74-77).Based on our model, we expect Zn ²⁺And Cu ²⁺By stablizing H20-H269 to suppressing proton dependency receptor activation with the right not protonation state of possibility H17-H84.Really, two kinds of OGR1 dependency IP formation that ionic micro-molar concentration strong inhibition is stimulated when pH6.9.In contrast CCL39 cell, Cu ²⁺IP to stimulated by thrombin forms still not influence, Zn ²⁺Ion causes the part of this reaction to suppress.

The RT-PCR expression map of embodiment 4:OGR1

RT-PCR expression map: utilize acid phenol processes from cell culture, to prepare total RNA.Utilizing Superscript II that RNA is carried out the DNA enzyme handles and reverse transcription (LifeTechnologies/Invitrogen, Basel, Switzerland).With Expand High Fidelity Taq (Roche, the Basel, Switzerland) utilize following temperature cycles scheme to set up the parallel reaction that is used for OGR1 and glyceraldehyde-3-phosphate dehydrogenase (GPDH): 94 ℃ of degeneration in following 30 seconds, 65 ℃ (OGR1) or 55 ℃ (GPDH) annealing in following 45 seconds, 72 ℃ of extensions in following 50 seconds; For OGR1 is 36 circulations, is 30 circulations for GPDH.Measure the interior mark of GPDH as the mRNA amount.For OGR1, the clone PCR product is also verified by order-checking.Use following primer: the OGR1 forward: 5 '-CTGAGCCCATGAGGAGTGTG-3 ', oppositely: 5 '-GGTAGGACGCCAGCAGCAGG-3 '; GPDH forward: 5 '-TTAGCACCCCTGGCCAAGG-3 ', oppositely: 5 '-CTTACTCCTTGGAGGCCATG-3 '

The existence that has disclosed the mRNA of OGR1 in the MG63 human osteosarcoma cell by the expression map of RT-PCR, and we find that these cells react consumingly to neutrality or acid pH really, follow IP to form.This signal is suitable with the signal that is caused by Kallidin I on amplitude, Kallidin I activate endogenous recipient in the MG63 cell (people such as Brechter AB, 2002, Regul Pept, 103:39-51).In pH7.46+/-0.01 (meansigma methods+/-sem; N=5) observe half maximum activation.IP forms that pretreatment is insensitive and suppressed by the copper ion of micro-molar concentration to PTX, and this has repeated the result of above-mentioned ectopic expression about OGR1 in the fibroblast.Former generation human osteoblast cell precursor for separating from trabecular bone has obtained similar result.Half maximum activation in the primary cell betide pH7.41+/-0.02 (meansigma methods+/-sem; N=3).

The expression study of embodiment 5:OGR1

Utilize antibody (No.132511, the Zymed/Stehelin﹠amp of the anti-myc of FITC labelling; Cie, Basel, Switzerland) the detection recombinant receptor.For detecting plasma membrane mark annexin V, use the antibody (No.A13202, Juro Supply, Luzern, Switzerland) of alexa labelling.Dye nuclear with dyestuff H33258 (Sigma, Buchs, Switzerland).Experiment to osseous tissue is carried out with the 4 μ m section of paraffin-embedded organ, and described organ is collected the female Wistar rats from 6 monthly ages.To cut into slices and in dimethylbenzene, take off cured and utilize pepsin digestion to expose antigen (10 minutes, Sigma, Buchs, Switzerland).By hatch 5 minutes, hatch with 10% lowlenthal serum then and sealed endogenous peroxidase in 1 hour with 3% hydrogen peroxide.Utilized rabbit polyclonal antibody (1: 100, hatched in 3 hours) carry out immunohistochemistry and detect, described antibody is by Lifespan Biosciences Inc. (Seattle, the U.S.) exploitation, at peptide epitopes CFVSETTHRDLARLRG (SEQ ID NO:2), it is identical with people and rat OGR1.Utilize ABC peroxidase stain test kit (Santa CruzBiotechnology/LabForce, Nunningen, Switzerland) to show dyeing.Immunohistochemistry (as described in top paragraph) for the rat bone section is positioned OGR1 for osteoblast and osteocyte.

Embodiment 6:OGR1-1 knock-out mice

The generation of OGR1-1 knock-out mice:

The generation of the targeting vector of homologous recombination: the locus of mice OGR1-1 transcript mCT51440 called after mCG51257 on identifying in mice genome C elera data base corresponding to No. 12 chromosomes of mice.Come amplifying genom DNA according to Celera sequence information design primer, in order to produce homologous recombination and the targeting vector that knocks out the OGR-1 gene.Primer sequence with the condition that is used for the amplification of two flank genome areas is:

For regional 1: forward primer: TS145:CTATCTGCATGTGGAGCCCC and reverse primer: TS140:CTGGCAGGATAGGTCACCAT.Utilize KOD Hot Start archaeal dna polymerase (Novagen/Juro, Luzerne, Switzerland) in T3 PCR Biometra temperature cycling device, to carry out PCR.In brief, with 200ng 129Sv genomic DNA and 200 μ M dNTP mixture, 600nM forward primer, 600nM reverse primer, 5 μ l10X PCR buffer (1mMMgSO ₄) and 1 μ l KOD Hot Start archaeal dna polymerase be prepared in together in the cumulative volume of 50 μ l.Be used for genomic DNA amplification be set to 94 ℃ 3 minutes, 94 ℃ 30 seconds, 58 ℃ 30 seconds, 68 ℃ of 35 circulation are 5 minutes then, then 68 ℃ of last down extensions 5 minutes.At last, reactant is cooled to 4 ℃.Utilize Zero blunt Topo PCR clone's test kit (LifeTechnologies/Invitrogen, Basel, Switzerland) according to the PCR product sub-clone of manufacturers instruction, produced the pTOPO-zone 1 that confirms through order-checking 4 μ l.

For regional 2: forward primer: TS143:GCTTGCATGGTGGCTGTCTC and reverse primer: TS142:TACAACACCACCTGCACAGA.Utilize Pfu archaeal dna polymerase (Promega, Wallisellen, Switzerland) in Perkin Elmer PE9600 PCR temperature cycling device, to carry out PCR.In brief, 200ng 129Sv genomic DNA and 200 μ M dNTP mixture, 1 μ M forward primer and 1 μ M reverse primer, 1 * Pfu dna polymerase buffer liquid (are contained 2mM MgSO ₄), 5% dimethyl sulfoxine (DMSO) and 1.25 μ lPfu archaeal dna polymerases are prepared in the cumulative volume of 50 μ l together.Be used for genomic DNA fall progressively the amplification be set to 94 ℃ 3 minutes, 30 seconds, 68 ℃ of 10 circulation 94 ℃ 30 seconds, 68 ℃ (1 ℃/circulation) 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 68 ℃ of 25 circulation are 5 minutes then, and at 68 ℃ of following final steps of 10 minutes.At last, reactant is cooled to 4 ℃.Utilize forward primer TS167:CCATCGATGCTTGCCTCTAAACTAGTCT and reverse primer TS168:ATAGTTTAGCGGCCGCCTCTACTGTCCTTGTGGCTT, with the Pfu polymerase with top identical condition under, by nested PCR this PCR reactant of 1 μ l is increased.Utilize Zero blunt Topo PCR clone's test kit (Invitrogen, Basel, Switzerland) to confirm with the PCR product sub-clone of 4 μ l and by order-checking according to manufacturers instruction.For generation is used for the targeting vector of homologous recombination, utilize zone 1 to make template and primer forward: TS170:CCCAAGCTTAGAGCAGGTGACTGTGCATA and oppositely: TS171:CCGCTCGAGCTTTGGGCCAGAAGGAGCCT amplification gene group fragment 1.The pTopo-zone 1 of 10ng is as the template in the PCR mixture, and described PCR mixture is as utilizing KODHot Start polymeric enzymatic amplification zone 1 described.In T3PCR Biometra temperature cycling device, carry out PCR and be set to: 94 ℃ 2 minutes, 94 ℃ 15 seconds, 58 ℃ 30 seconds, 74 ℃ of 31 circulation are 1 minute and 30 seconds then, then 74 ℃ of last extensions 1 minute.Utilize PCR purification kit (Qiagen, the Basel, Switzerland) come purification institute amplification PCR fragment according to manufacturers instruction, it is digested with restriction endonuclease HindIII and XhoI, connection enters the carrier pRAY-2 (searching number U63120) that HindIII/XhoI digested, and confirms through order-checking.

Utilize 1 μ l pTopo-zone 2 to make template and forward primer TS167 and reverse primer TS168 second genomic fragment that increase.The PCR mixture is described and be set to as zone 1 amplification: 94 ℃ 2 minutes, 94 ℃ 15 seconds, 55 ℃ 30 seconds, 68 ℃ of 35 circulation are 1 minute and 30 seconds then, are last extension step 68 ℃ 5 minutes then.Utilize Zero blunt Topo PCR clone test kit sub-clone institute's amplification PCR fragment and pass through order-checking and confirm.After with restriction endonuclease ClaI and NotI digestion, the connection of PCR fragment is entered the carrier pRAY-2 that comprises fragment 1 that ClaI/NotI digested.The OGR1 targeting vector that is obtained confirms by checking order.

Embryonic stem cell is cultivated and transfection: utilize restriction endonuclease ScaI with last OGR-1 targeting vector linearisation and under 250V and 500 μ F 17 μ g electroporations to be entered 1.5 * 10e7 129S3 mouse embryo stem cell (ES cell).With cell culture in the 6cm ware of the embryo fibroblast that contains former generation inactivation.Adding in 24 hours contains the selection culture medium (200 μ g/ml, Gibco/Invitrogen, Basel, Switzerland) of G418 behind the electroporation.The homologous recombination incident (carrying out gene type) of behind electroporation, isolating the resistance embryonic stem cell and entering the OGR-1 locus with evaluation target construct in 10 days by PCR by nested pcr analysis.

Carry out gene type by PCR: with 50 μ l lysis buffer (0.05%SDS, 50 μ g/ml E.C. 3.4.21.64s, 10mM Tris/HCL, pH7.4) extract embryonic stem cell and utilize the thick embryonic stem cell extract of 1 μ l and 200 μ M dNTP mixture, 600nM forward primer, 600nM reverse primer, 1x Taq PCR master mixture (Qiagen, the Basel, Switzerland) together with the cumulative volume of 25 μ l, in Tgradient PCR Biometra temperature cycling device, diagnose PCR.The used primer of PCR is to be used for the forward primer of amplification for the first time: TS207:TGATATTGCTGAAGAGCTTGGCGGC and reverse primer: TS203:CCAGGGTAGCTTTGCAACATGC, and the forward primer that is used for nested reaction: TS208:AGCGCATCGCCTTCTATCGCC and reverse primer: TS204:ATGGGCTTTGCCATGAGGCAG.The PCR condition be 95 ℃ 3 minutes; 95 ℃ 30 seconds, 62 ℃ 45 seconds, 72 ℃ of 35 circulation 2 minutes.For nested reaction, with the first set reaction thing of 1 μ l 95 ℃ 3 minutes; 95 ℃ 30 seconds, 62 ℃ 45 seconds, 72 ℃ of 25 circulation increased in 2 minutes.At last, the nested PCR reactant to 10 μ l is analyzed on 1% agarose gel.

The Southern gene type of embryonic stem cell:, utilize 100ng pTopo zone 1 to make template by pcr amplification OGR1 genome area in order to produce the probe that is suitable for southern blotting technique hybridization.The amplification the primer is forward: TS146:CAAGGGCAGGGGAGTCAAGG and reverse: TS159:TAATTATTCTACTTTATTAC.The PCR mixture utilizes the PfuDNA polymerase as mentioned above.The setting that is used for PCR be 94 ℃ 2 minutes, 15 seconds, 72 ℃ of 10 circulation 94 ℃ 15 seconds, 55 ℃ (1 ℃/circulation) 30 seconds then are 94 ℃ 15 seconds, 45 ℃ 15 seconds, 72 ℃ of 25 circulation 30 seconds.At last, reactant is cooled to 4 ℃.Utilize the PCR purification kit as mentioned above institute's amplification PCR fragment to be carried out purification.

Utilize 12 μ g genomic DNAs and restriction endonuclease SspI/RsrII or SspI/XhoI, will spend the night from the genomic DNA digestion of 129S3 embryonic stem cell.The DNA that is digested on 0.9% agarose gel, separated and trace to Hybond N+ film (Amersham, D ü bendorf, Switzerland).Utilize Amersham rediprime II test kit such as the manufacturer is described contains ³²The random primer labelling of the dna probe of P-dCTP.Under in the PerfectHyb Plus hybridization buffer (Sigma, Buchs, Switzerland) 65 ℃, film hybridization is spent the night washing and imaging in 0.5 * SSC, 0.1%SDS by being exposed to Kodak X-O-Mat film.

Utilize the single integration of confirming the target construct corresponding to the segmental neo probe of the NheI/BamHI of pRAY2 carrier under the same conditions.

Genome analysis: unfold (spread) and the previous day embryonic stem cell is divided carrying out chromosome.For chromosome is unfolded, with 10 μ g/ml Colchicines (KaryoMax, Gibco/Invitrogen, Basel, Switzerland) at 37 ℃ and 10%CO ₂Middle processing embryonic stem cell 4.5 hours was hatched 10 minutes among (37 ℃) 0.56%KCl of preheating at room temperature then.Fixing by the ice-cold methanol/acetic acid of profit (3: 1).On microscope, analyze chromosomal unfolding.

Blastocyst injection and breeding: the embryonic stem cell that target is fixed is injected into C57Bl/6 host's blastocyst and it is transferred among the C57Bl/6x Balb/c N1 foster mother of pseudo-fetus.Identify chimeric offspring by fur is painted.With 129S3 wild females and male chimera copulation.Kind system by gene type PCR test offspring transmits.

Embodiment 7: the screening test that is used for agonist or the antagonist of OGR1

Method: utilize the cytoplasmic calcium transition (transients) of the dull and stereotyped reader of calcon-carboxylic acid Flou-3 and fluorescence imaging (MolecularDevices/BucherBiotech, Basel, Switzerland) record.With the dyestuff (2 μ g/ml) of the acetoxy-methyl ester CCL39 cell dyeing to the OGR1 transfection, this dyeing comprises under 37 ℃ in the complete medium of 5mM proenicide to be carried out 1 hour, to suppress multiple drug resistance transport protein.Washed cell and comprising 130mM NaCl, 0.9mMNaH then ₂PO ₄, 5.4mM KCl, 0.8mM MgSO ₄, 1.8mM CaCl ₂, 25mM glucose, 5mM HEPES the buffer salt solution of pH7.6 in kept 45 minutes under the room temperature.For identifying receptor antagonist, in these last 15 minutes of hatching, add test compounds.After being transferred to reader, record baseline (Fb), (20mM HEPES pH6) causes that acidify comes irritation cell to the strong buffer by adding appropriate amount then.Alternatively, add test compounds in this stage and identify the excitability molecule.Calculate F '=(F-Fb)/Fb with fluorescence reading F normalization.

The result: the outer pH of born of the same parents is changed to the quick and instantaneous rising that sourer value has caused cellular calcium concentration from pH7.6, shows the release that cation is preserved in the born of the same parents.The amplitude of reaction is that pH is dependent, raises with acidity.Half maximum activity betide pH7.20+/-0.04 (meansigma methods+/-sem; N=3).Receptor antagonist blocking-up fluorescence signal.

The clone of embodiment 8:GPR4 and stable cell lines produce

Utilize primer GPR4F and GPR4R (5 ' CACC ATG GGC AAC CAC ACGTGG GAG GGC TGC 3 ' and 5 ' TCA TTG TGC TGG CGG CAG CATCTT CAG CTG CA 3 ' are respectively) the people GPR4 that from genomic DNA, increases.The PCR reactant mixture contains 0.2mM dNTPs, 1x PCR buffer (contains 1.5mM MgCl ₂), 0.5 Taq of unit archaeal dna polymerase, every kind of primer of 40pmol and sterilized water, cumulative volume 50 μ l.The template that is used for this reaction is human gene group DNA (Promega, Southampton, a Britain).Utilize Biometra T3 temperature cycling device to utilize following cycling condition to carry out PCR: 95 ℃ of degeneration 2 minutes, 15 seconds, 60 ℃ annealing of 95 ℃ of degeneration of 35 circulation were extended 1 minute in 15 seconds and 72 ℃ then.Last extending in carried out under 72 ℃ 7 minutes.The PCR product of purification 1.1kb is also cloned into pcDNA3.1D/V5-His-TOPO (Invitrogen, Paisley, Britain) with it.

Produce the stable cell lines of expressing GPR4 in CHOK1 CRE-lu cell or CCL39CRE-luc cell, described cytotostatic is expressed cAMP dependency luciferase reporter gene to detect the variation of the cAMP that responds part.Utilize Lipofectamine 2000 (Invitrogen, Paisley, Britain) according to manufacturers protocol, in above-mentioned cell line, produce stable cell lines by transfection GPR4cDNA expression construct.Cells transfected is selected in the presence of the G418 of 400 μ g/ml or 1mg/ml.The antibiotic in 3 weeks is picked out single clone and its expansion is used for further analysis after selecting.

Embodiment 9:GPR4 activates the proton-sensing G-protein coupled receptors that cAMP forms

CAMP forms test: in serum-free DMEM culture medium, with [ ³H] adenine (100MBq/ml; Amersham, D ü bendorf, Switzerland) labelling is incubated at the cell culture that converges 4 hours in 24 orifice plates.Then under 37 ℃ as above be used for the buffered saline solution incubated cell of IP test (embodiment 2).According to indication, (IBMX 1mM) adds to allow gathering of cAMP with the phosphodiesterase inhibitor isobutyl methylxanthine.Incubation time is 15 minutes.Ice-cold then trichloroacetic acid extract cell and utilize in batches that column chromatography separates with free adenine cAMP with ATP (Salmon Y, 1979, Adv.Cycl.Nucleot Res, 10:35-55).

The result: aforesaid expression study and cAMP form test show this receptor really to the closely similar scope of OGR1 in pH change and react.SPC, its it is reported be GPR4 part (people such as Zhu K, 2001, J Biol Chem 276:41325-41335), self does not regulate the pH dependent stimulation and does not activate cAMP forming.In the HEK293 of transient transfection cell, GPR4 to half maximum activation of cAMP betide pH 7.55+/-0.02 (meansigma methods+/-sem; N=6).

Embodiment 10: the screening test that is used for agonist or the antagonist of GPR4

In the previous day of testing, with every hole 10-20,000 cell inoculation is in white 96 orifice plates, and at 37 ℃ of following 5%CO with the cell of as described in example 8 above coexpression GPR4 and cAMP luciferase reporter gene ₂Existence in overnight incubation.With 200 μ l HBS buffer (130mMNaCl, 0.9mM NaH ₂PO ₄, 0.8mM MgSO ₄, 1.8mM CaCl ₂, 5.4mM KCl, 25mM glucose, 20mM HEPES) at suitable pH washed cell once, described buffer contains the suitable chemical compound that will test, for example can use any inside or commercially available compound library.Non-CO under 37 ℃ ₂Hatched in the incubator dull and stereotyped 4-5 hour.After 4-5 hour from cell sucking-off buffer and once with the HBS pH7.4 washed cell of 200 μ l.HBS pH7.4 by adding 100 μ l and Steady Glo luciferase reagent (Promega, Southampton, the Britain) cell lysis of 100 μ l, and be placed on the rotation platform violent rotation 25-30 minute.It is luminous to utilize luminous agent to measure.In acid pH buffer (pH6.8 or pH7.0), produced high luminous signal.In the test, for example in acid pH buffer (pH6.8 or pH7.0), characterize antagonist by comparing weakening of luminous signal with no chemical compound contrast.

The RT-PCR expression map of embodiment 11:GPR4

RNA extracts and the first chain cDNA synthesizes: utilize RNeasy extraction test kit (Qiagen, Crawley, Britain) to prepare RNA according to the scheme of manufacturer from cell.Used cell is HBECs, the former generation people lung fibroblast of former generation human bronchial epithelial cell (HBECs), differentiation, former generation human bronchial smooth muscle cell (BSMC), human peripheral T cell and human peripheral neutrophil cell.Former generation people cell from Biowhittaker buy or, the indication part is arranged, separate from the periphery human blood according to standard method.Utilize the reagent that is provided in the first chain cDNA synthetic agent box (Roche, Lewes, Britain) to prepare the first chain cDNA from separating from total RNA of cell with scheme.

RT-PCR: will map among the cDNA of GPR4 receptor in deriving from tissue and above-mentioned different cell types by reverse transcriptase-polymerase chain reaction (RT-PCR).The tissue cDNA that is used for the RT-PCR collection of illustrative plates is bought from Clontech (Basingstoke, Britain).Each reactant mixture cumulative volume is 25 μ l, contains 0.2mM dNTPs, 1x PCR buffer (comprises 1.5mM MgCl ₂), every kind of primer and the deionized water of the Taq archaeal dna polymerase of 0.5 unit, 50pmol.Template used cDNA is from the business-like cDNA (from Clontech panel I and II (2.5 μ l)) that derives from tissue sample, or come since as the cDNAs (1 μ l) for preparing of the described cell type of previous section.Used GPR4RT-PCR primer is as follows: 5 ' TGG GCG TCT ACC TGA TGA A 3 ' and 5 ' GGG TTT GGC TGT GCT GTT 3 '.Utilize Biometra Trio PCR machine in the pipe of 0.2ml, to circulate.Cycling condition is as follows: 94 ℃ of degeneration of 1 circulation 1 minute and 45 seconds, 15 seconds, 60 ℃ annealing of 94 ℃ of degeneration of 35 circulation were extended 30 seconds for 15 seconds, 72 ℃ then.Analytical reactions thing and use ethidium bromide staining on 1.5% agarose gel.Contrast RT-PCR reaction is used for the special primer of housekeeping gene GAPDH and is carried out.

Quantitative RT-PCR: measure messenger rna level in total RNA sample by the TaqMan quantitative RT-PCR.Primer and probe are bought acquisition as the pre-reagent of optimizing from Applied Biosystems (Warrington, Britain).The quantitative RT-PCR reaction is carried out in triplicate with 25 μ l final volume, and contains 1xTaqMan Universal PCR master mix target cDNA prepared product in each reactant.Utilize ABI PRISM 7700 sequential detectors (Applied Biosystems, Warrington, Britain) to experimentize, and utilize ABI PRISM 7700 SequenceDetection System softwares to analyze.Amplification condition is as follows: 50 ℃ of 2 minutes and 95 ℃ 10 minutes, 95 ℃ of 40 circulation 15 seconds and 60 ℃ are 1 minute then.Data are come quantitatively by the standard curve extrapolation that produces from the cDNA storehouse that utilizes 12 kinds of people's tissues, at housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) normalization.

The summary of the expression map data of table 1:GPR4

Tissue or cell type

GPR4 expresses

Brain	-
Brain	-	The heart	+
Kidney	+++	The heart	+
Kidney	+++	Liver	+++
Lung	+++	Liver	+++
Lung	+++	Pancreas	+++
Placenta Hominis	-	Pancreas	+++
Placenta Hominis	-	Skeletal muscle	+
Colon	++	Skeletal muscle	+
Colon	++	Ovary	-
Leukocyte	-	Ovary	-
Leukocyte	-	Prostate	++
Small intestinal	+++	Prostate	++
Small intestinal	+++	Spleen	+++
Testis	++	Spleen	+++
Testis	++	Thymus	++
Mononuclear cell	++	Thymus	++
Mononuclear cell	++	Bronchial epithelial cell	+
The bronchial epithelial cell of differentiation	+	Bronchial epithelial cell	+
The bronchial epithelial cell of differentiation	+	Lung fibroblast	+
Asm cell	++	Lung fibroblast	+
Asm cell	++	Neutrophil cell	+++
The T-cell	+	Neutrophil cell	+++

The immunolocalization research of embodiment 12:GPR4

Utilize antibody (No.132511, the Zymed/Stehelin﹠amp of the anti-myc of FITC labelling; Cie, Basel, Switzerland) detect recombinant receptor.For detecting plasma membrane mark annexin V, used the antibody (No.A13202, Juro Supply, Luzern, Switzerland) of alexa labelling.Dye nuclear with dyestuff H33258 (Sigma, Buchs, Switzerland).The experiment of the enterprising pedestrian's tissue of the lung tissue paraffin section of 3 μ m of mounting on the polysine microscope slide.At first use dimethylbenzene and industrial methylated spirit (IMS) to 70%IMS processing paraffin section, and seal endogenous peroxydase with the hydrogen peroxide of 0.05% in the methanol.To cut into slices behind the microwave irradiation and in the antigen recovery solution of Dako pH6, dye.Unnecessary background dyeing utilizes Dako serum-free protein blocker to reduce by 5 minutes.Utilization is by LifespanBiosciences Inc. (Seattle, the U.S.) Kai Fa rabbit polyclonal antibody is (1: 500,4 ℃ are spent the night) carry out immunohistochemistry and detect, described antibody is at peptide epitopes RSDVAKALHNLLRFLASDK (SEQ ID NO:5), the epi-position of its behaviour GPR4, or alternatively utilize the rabbit polyclonal antibody that is produced at peptide epitopes DELFRDRYNHTFCFEKFPME (SEQ ID NO:6), described epi-position behaviour and mice GPR4's.By at first utilizing the anti-rabbit immunoglobulin of the biotinylated pig of Dako (1: the 200) processing in the Dako diluent to show dyeing in 30 minutes.Behind the washing step, handle section with Dako Streptavidin-biotin peroxide combined enzyme agent (SABCpx).(DAB) manifests response location with diaminobenzidine.Use Cole ' s hematoxylin that nuclear is carried out counterstain.

Table 2: through the protein expression of the GPR4 of immunohistochemical analysis

Tissue	The location of expressing	GPR4 expresses
Tissue	The location of expressing	GPR4 expresses	Lung, asthma	The respiratory epithelium neutrophil cell	++ +++
Lung is normal	Respiratory epithelium neutrophil cell pulmonary alveolar macrophage	-/+ +++ +	Lung, asthma	The respiratory epithelium neutrophil cell	++ +++

Above data show that the GPR4 protein expression raises in asthma patient's respiratory epithelium, show may exist and the getting in touch of disease.GPR4 protein is disappearance or only faint expression in normal subjects's lung tissue.The GPR4 protein expression has confirmed result's (table 1) of mRNA level in pulmonary alveolar macrophage, neutrophil cell and the bronchial smooth muscle of normal lung tissue.

The functional trial of embodiment 13:GPR4 (test of neutrophil cell chemotaxis):

According to the method for delivering in the past (people such as Frevert CW, J Immunology Methods, 1998,213:41) test with 96 well plate format.The all cells buffer obtains from Invitrogen (Paisley, Britain).Calcium fluorescein-AM dyestuff obtains from Molecular Probes (Invitrogen, Paisley, Britain).Neutrophil cell separate as previously mentioned (people such as Haslett C, 1985, Am JPath, 119:101).Briefly, the citrate whole blood is mixed with 4% glucosan-T500 and make it stand on ice 30 minutes to remove erythrocyte.From peripheral blood lymphocytes, isolate granulocyte (PMN) by Ficoll-Paque density gradient centrifugation.Remove the sedimentary any red blood cell contamination of PMN by the hypotonic shock cracking.The isolating granulocyte of institute (neutrophil cell) fluorescent dye calcium fluorescein-AM (5 μ g) labelling.Then the neutrophil cell of institute's labelling is mixed mutually with the test compounds (0.001-1000nM) in being diluted in DMSO and at room temperature hatched 10 minutes.Agonist (buffer of pH6.8 or pH7.0) is placed in the bottom cell of 96 hole chemotaxis cells.Be covered in polycarbonate filter (5 μ m) dull and stereotyped and cell on, and if the use antagonist, with its application of sample on the filter of top.Allow cell under 37 ℃, to contain 5%CO ₂Humidified incubator in the migration 90 minutes.When the stage of hatching finishes, utilize the dull and stereotyped reader of porous fluorescence (Fluoroskan II, Labsystems) 485nm excite with the 538nm emission under the quantitative cell that moves.Positive control cell (cell that does not add antagonist) is represented maximum cell chemotaxis reaction.And do not have the negative control (not stimulating) of agonist, promptly pH＞=7.4 join the bottom cell.The difference of positive control and negative control has been represented the chemotactic activity of cell.In test, characterize antagonist by the reduction of comparing the chemotactic response of acid pH with the contrast of no chemical compound.

The functional trial of embodiment 14:GPR4 (form changes test):

Following mensuration agonist (pH dose response) curve: with granulocytic aliquot (80 μ l 4-5 * 10 ⁵Cell) mixes in 1.2ml group pipe (cluster tubes) with 10 μ l test buffer (1x PBS, pH7.4 adds 0.1%BSA).Sample and hatch 5 minutes (in water-bath) at 37 ℃ gently vibrates.After this time, agonist is joined in all pipes, just add 10 μ l test buffer in zero contrast.Sample and hatching in 37 ℃ of water-baths other 5 minutes gently vibrates.Then with 0.25% the CellFix pre-cooling of 250 μ l ice, that optimize ^TMThe every pipe of solution (Becton Dickinson, Oxford, Britain) adding is with cessation reaction and keep the cellular morphology variation up to analysis.Before obtaining data from the FACSCalibur flow cytometer, pipe and hatched 10 minutes on ice gently vibrates.At first obtain FSC/SSC figure, utilize gate (gated) granulocyte to obtain FSC/FL-2 figure then from first figure.Neutrophil cell is different with the oxyphil cell on the FL-2 figure, because the latter has higher autofluorescence.

For antagonist (still not having chemical compound) test, with the granulocyte (4-5 of 80 μ l * 10 of aliquot ⁵Cell) 10 * enriched compound (0.1-1000 μ M is final) that contains the DMSO (the highest by 10%) of constant density with 10 μ l is mixed in the 1.2ml group pipe, and sample and hatch 5 minutes (in water-bath) at 37 ℃ gently vibrates.Agonist (pH6.8 or 7.0 buffer) is joined in all pipes, except pulverised compound/zero agonist contrast, to wherein adding 10 μ l test buffer.Vibrating sample and in 37 ℃ of water-baths, hatching other 5 minutes on the support gently.Then with 250 μ l ice 0.25%CellFix pre-cooling, that optimize ^TMSolution adds every pipe, and the support and hatched 10 minutes on ice of vibrating gently before obtaining data from flow cytometer.Neutrophil cell is different with the oxyphil cell on the FL-2 figure, because the latter has higher autofluorescence.In test, characterize antagonist by compare the reduction that viewed form changes with no chemical compound (promptly only the buffer of pH6.8 or pH7.0) contrast.

The gene expression atlas screening of embodiment 15:GPR4

Identify the potential therapeutic target that blood vessel takes place by screening-gene, described gene demonstrates dependency expression with the marker gene of generally acknowledging that is used for endotheliocyte.This marker gene collection is including but not limited to CDH5, VWF, KDR, TIE, TEK, PTPRB, ANGPT2 (generally acknowledged gene symbol is according to Human Genome Organization/unnamed gene committee (HUGO/HGNC)).

(CA 95051, USA for 3380 Central Expressway, Santa Clara to utilize Affymetrix; Http:// www.affymetrix.com/index.affx) the oligonucleotide arrays technology, obtain gene expression data by the dna microarray analysis.

Enter data into software tool GeneSpring (Silicon Genetics, 2601 SpringStreet, Redwood City, CA 94063, USA; Http:// www.silicongenetics.com/cgi/SiG.cgi/index.smf).

For each marker gene, by utilizing the Pearson correlation method---the statistics of dependency is measured the demonstration gene of having identified other dependency expression.Think that 0.7 to 1 relative coefficient shows strong correlation.

In being considered the gene of potential drug targets, analyze to show that 12 kinds of GPCRs have＞0.7 relative coefficient.

The gene symbol (HUGO/HG NC) of generally acknowledging	The another name gene symbol	Marker gene with high correlation	Dependency	Part
The gene symbol (HUGO/HG NC) of generally acknowledging	The another name gene symbol	Marker gene with high correlation	Dependency	Part	GPR116 ELTD1 CALCRL FZD4 GPR143 GPR126 GPR4 EDG1 F2R CMKOR1 GPR124 GPR56	ETL OA1 VIGR PAR1 RDC1 TEM5 TM7L N4	VWF TIE CDH5 VWF ANGPT2 CDH5 VWF VWF ANGPT2 CDH5 TEK VWF	91％ 89％ 88％ 82％ 79％ 73％ 73％ 72％ 72％ 72％ 70％ 70％	Orphan Orphan adrenomedulin Wnt Orphan Orphan proton S1P fibrin ferment adrenomedulin Orphan Orphan

The endothelial cell proliferation test of embodiment 16:GPR4

The application on human skin capillary endothelium (HDMECs) in former generation and the Human umbilical vein endothelial cells in former generation (HUVECs) are bought from PromoCell, Heidelberg, Germany.

HDMECs is incubated among endotheliocyte minimal medium (the Endothelial Cell BasalMedium) MV, wherein replenished the hyclone (FCS) of SupplementPack/ endothelial cell growth culture medium (Endothelial Cell Growth Medium) MV and 5%, HUVECs is incubated at and has replenished SupplementPack/ endothelial cell growth culture medium and add in the endotheliocyte minimal medium of 12.5%FCS.The endotheliocyte minimal medium is as the limit or hungry culture medium.

As people such as Reynolds LE, Nat Med.2002Jan; 8 (1): 27-34 is described to separate the mice primary cell from mouse lung.Briefly, with mouse lung chopping, collagenase digesting (Gibco), filter and gained cell suspension be tiled in coating 0.1% gelatin (Sigma), 10mg/ml fibronectin (Sigma) and 30 μ g/ml Vitrogen (Collaborative Biomedical Research) mixture bottle on.(Dynal, Wiltshire UK) pass through single negative (FC γ-RII/III antibody to the magnetic bead that utilizes the Mus IgG of the Chinese People's Anti-Japanese Military and Political College to put together; Pharmingen) and two positive (ICAM-2; Pharmingen) cell category comes the purification endotheliocyte, has produced＞97% pure colony.

Measure propagation as with different somatomedin VEGF for example ₁₆₅The function of the outer pH of born of the same parents (10ng/ml) and in the endotheliocyte that stimulates of bFGF (0.5ng/ml).In addition, with transfection at the endotheliocyte of the siRNA of GPR4 or in the presence of the chemical compound of targeting GPR4, carry out similar experiment, so that illustrate the specific action of GPR4 in this process.The propagation of endotheliocyte is used as the external reading that takes place for blood vessel.The inhibition representative of endothelial cell proliferation reduces a kind of approach that blood vessel takes place.

Used a kind of endothelial cell proliferation test of mixing based on BrdU (Biotrak CellProliferation Elisa System V.2, Amersham, England).With every hole 5 * 10 ³The density of individual cell is coated with the HUVEC inoculation that branch converges in 96 orifice plates of 1.5% gelatin, hatches in 37 ℃ of following growth mediums then.After 24 hours, with the culture medium in the hole that will hatch with somatomedin replace with the basal medium that contains 1.5%FCS, the culture medium in the residue hole is replaced with growth medium.After 24 hours, culture medium is replaced with the fresh culture that contains same amount FCS (5% or 1.5%), adds and subtracts chemical compound and the specificity growth factor that will test as previously mentioned.The hole that comprises no somatomedin in addition is as the baseline control for the somatomedin influence.After hatching 24 hours, add the BrdU label solution and cell hatched fixing after 24 hours, sealing again and add the anti-BrdU antibody of peroxidase labelling.Utilize 3,3 ', 5,5 '-tetramethyl benzidine substrate detects bonded antibody, and this substrate is formed with the colour response product, with its at 450nm with the spectrophotometric standard measure.Every kind of sample carries out in triplicate.Transfection the cell of siRNA after transfection, used in 24 hours.

Embodiment 17: for the endotheliocyte programmed cell death test of GPR4

HDMECs is incubated among the endotheliocyte minimal medium MV, wherein replenished the hyclone (FCS) of SupplementPack/ endothelial cell growth culture medium MV and 5%, HUVECs is incubated at and has replenished SupplementPack/ endothelial cell growth culture medium and add in the endotheliocyte minimal medium of 12.5%FCS.The endotheliocyte minimal medium is as the limit or hungry culture medium.

As people such as Reynolds LE, Nat Med.2002Jan; 8 (1): 27-34 is described to separate the mice primary cell from mouse lung.Briefly, with mouse lung chopping, collagenase digesting (Gibco), filter and gained cell suspension be tiled in coating 0.1% gelatin (Sigma), 10mg/ml fibronectin (Sigma) and 30 μ g/ml Vitrogen (Collaborative Biomedical Research) mixture bottle on.The magnetic bead (Dynal, Wiltshire, Britain) that utilizes the Mus IgG of the Chinese People's Anti-Japanese Military and Political College to connect passes through single negative (FC γ-RII/III antibody; Pharmingen) and two positive (ICAM-2; Pharmingen) cell category comes the purification endotheliocyte, has produced＞97% pure colony.

Measure the function of programmed cell death as the outer pH of born of the same parents.In addition, with transfection at the endotheliocyte of the siRNA of GPR4 or in the presence of the chemical compound of targeting GPR4, carry out similar experiment, so that illustrate the specific action of GPR4 in this process.Use the contrast of serum starvation as inducing apoptosis, and with VEGF ₁₆₅(10ng/ml) as the contrast that reduces the cell programmed cell death.The representative of inducing of programmed cell death suppresses a kind of approach that blood vessel takes place in the endotheliocyte.

Utilize Cell Death Detection ELISA ^PLUSSystem (Roche Diagnostics) measures programmed cell death according to the scheme of manufacturer.Briefly, at serum starvation, utilize pH variation, somatomedin, chemical compound or GPR4-siRNA to handle after, with cell (HUVECs or HDMVECs) with the lysis buffer in 100 μ l/ holes 37 ℃ of gentle cracking only to discharge the kytoplasm content and centrifugal 10 minutes with 200g.20 μ l supernatant are transferred to ELISA contain 80 μ l immunoreagents of antibody dull and stereotyped also the adding, and in Titer Plate shaking table, hatched in 2 hours to shake (300 rev/mins).With the incubation buffer washed cell that is provided in the test kit 3 times.Add the ABTS colour reagent of 100 μ l and after 10 minutes, utilize Spectromax 190Microplate Spectrophotometer to measure OD, and do blank with ABTS solution at 405nm.Every kind of sample carries out in triplicate.

The endothelial cell migration test of embodiment 18:GPR4

MS1 is the mouse islets endothelial cell line that utilizes the middle T antigen transduction of polyoma virus to be set up, and buys from ATCC.The MS1 cell culture is in containing Eagle ' the s culture medium of Dulbecco ' s improvement that 4mM L-glutamine, 1.5g/L sodium bicarbonate and 4.5g/L glucose add 5%FCS.

BEnd3 is the mouse brain endothelial cell line of being set up with the transduction of SV40 large T antigen, and buys from ATCC.The bEnd3 cell culture is in containing Eagle ' the s culture medium of Dulbecco ' s improvement that 4mM L-glutamine, 1.5g/L sodium bicarbonate and 4.5g/L glucose add 10%FCS.

As people such as Reynolds LE, Nat Med.2002Jan; 8 (1): 27-34 is described to separate the mice primary cell from mouse lung.Briefly, with mouse lung chopping, collagenase digesting (Gibco), filter and gained cell suspension be tiled in the mixture that is coated with 0.1% gelatin (Sigma), 10mg/ml fibronectin (Sigma) and 30 μ g/ml Vitrogen (Collaborative Biomedical Research) bottle on.The magnetic bead (Dynal, Wiltshire, Britain) that utilizes the Mus IgG of the Chinese People's Anti-Japanese Military and Political College to put together passes through single negative (FC γ-RII/III antibody; Pharmingen) and two positive (ICAM-2; Pharmingen) cell category comes the purification endotheliocyte, has produced＞97% pure colony.

Measure endotheliocyte towards the particular growth factor for example the migration of VEGF (10ng/ml) or S1P (100nM) as the function of pH outside the born of the same parents.In addition, with transfection at the endotheliocyte of the siRNA of GPR4 or in the presence of the chemical compound of targeting GPR4, carry out similar experiment, so that illustrate the specific action of GPR4 in this process.The migration of endotheliocyte is used as the external reading that takes place for blood vessel.The inhibition representative of endothelial cell migration suppresses a kind of approach that blood vessel takes place.

Utilize BD Falcon HTS FluoroBlok Multiwell Insert System to carry out migration test.This system is made up of the porous insert in 24 holes, and is used to study the motion of cell by the porous fluorescence blocking-up PET film of 8 μ m pore sizes.The light barrier film only allows to detect those migrations by film and adhere to the cell of insert bottom.

Down bag is by 2 hours and with the PBS washing once at 37 ℃ with 1.5% gelatin in the bottom of insert.Striding the hole insert with 24 puts into and contains 600 μ l basal medium+0.1%BSA and replenish the different somatomedin will test to some extent and/or 24 orifice plates of inhibitor.

Endotheliocyte (going down to posterity 3-5 time) is incubated in the complete growth medium to 70-80% converges.By the trypsinization harvesting, 30000 cells among 100 μ l basal medium+0.1%BSA additional or not additional inhibitor are joined in the insert (upper strata cell).Chemoattractant (somatomedin) is only added lower floor's cell come the irritation cell migration by aperture, different inhibitor is added the concentration to guarantee to equate in two cells by setting up gradient.

Flat board was hatched 2-5 hour at 37 ℃.The following migrating cell that will be positioned film with 4%FA is fixed 10 minutes in room temperature, will examine poststaining (post-stain) 15 minutes with the PBS rinsing and with Hoechst dyestuff 33342.Use Cellomics ArrayScan ^TMThe II cell counter is counted staining cell automatically.Every kind of sample carries out in triplicate.

Cellomics ArrayScan ^TM(Pittsburgh PA) is automatization's fluorescence imaging microscope to the II cell counter for Cellomics, Inc., and it is used for scanning 16 visuals field (wide is 350 μ m), every hole and calculates the cell in each visual field.Represent with Microsoft Excel analytical data and with the average ± SEM of migrating cell.

With the use in 24 hours after transfection of siRNA cells transfected.

Embodiment 19: the endotheliocyte-smooth muscle cell for GPR4 is total to culture experiment (bud formation)

People's arteria pulmonalis smooth muscle (HPASM) cell is bought from PromoCell, Heidelberg, Germany, and be incubated in the smooth muscle cell minimal medium (Smooth Muscle CellBasal Medium) 2 that has replenished SupplementPack/Smooth Muscle Cell GrowthMedium 2 and 10%FCS.

All culture medium and fill-in are all bought from PromoCell, Heidelberg, Germany.

In the particular growth factor for example in the presence of VEGF (10ng/ml), bFGF, PDGF or the S1P (100nM), the bud of measuring the endotheliocyte on the layer of smooth muscle cells forms the function as the outer pH of born of the same parents.In addition, with transfection at the endotheliocyte of the siRNA of GPR4 or in the presence of the chemical compound of targeting GPR4, carry out similar experiment, so that illustrate the specific action of GPR4 in this process.The bud of endotheliocyte is formed the external reading that takes place as for blood vessel.The inhibition representative that the endotheliocyte bud forms reduces a kind of approach that blood vessel takes place.

With 10% cattle type i collagen albumen among the PBS 37 ℃ down bag by 48 hole tissue culturing plates 5 hours.With the HPASM cell (2 * 10 in the 500 μ l smooth muscle cell growth medium ii ⁴Cells/well) is inoculated in collagen layer and allow it at 37 ℃ and 5%CO ₂In adhered to 24 hours.Remove growth medium, and with HDMECs in the endothelial cell growth culture medium or HUVECs (5 * 10 ³Cells/well) is inoculated in the top of the HPASM cell monolayer that converges.After cell hatched 24 hours, culture medium is replaced to the minimal medium that contains different somatomedin and/or chemical compound (basis+1.5%FCS).Under 37 ℃, hatched dull and stereotyped 6 days.Upgrade culture medium, somatomedin and chemical compound after 2-3 days.Removed culture medium at the 6th day and with 4%PFA room temperature fixed cell 5 minutes.Dye by CD31, utilizing anti-people CD31 antibody (Becton Dickinson), is that biotinylated goat anti-mouse antibody and Streptavidin-HRP (horseradish peroxidase) (all from SouthernBiotechnology) can manifest the endotheliocyte bud then.Follow by diaminobenzidine (DAB) color reaction and use the Diff-Quick counterstain.

Utilize inverted phase contrast microscope under the 1.25x amplification with cell imaging, and utilize DefiniensCellenger software (Definiens AG, Munich, Germany) analyze the image that is obtained, the quantity of described computed in software nuclear, the length of bud and area, and branch.

Grow to detect in time for co-culture experiments, DiI-Ac-LDL (20 μ g/m) adding is total in the culture medium and at 37 ℃ and 5%CO ₂Hatched 4 hours.Upgraded DiI-Ac-LDL dyeing in per 3 days.DiI-LDL is a fluorescent dye, its specifically by endotheliocyte but not smoothed myocyte absorb, thereby do not need fixed cell can detect the endotheliocyte bud.

Transfection the cell of siRNA after transfection, used in 24 hours.

Embodiment 20: for blood vessel generation model in the body of GPR4: the agar cell that contains somatomedin

In GPR4 k.o mice and wt mice and the wt mice that crosses with the compound treatment that influences GPR4, measure the formation of height blood vessel tissue around the agar cell that somatomedin is housed.This test is about the model of blood vessel generation in the body and is used to characterize antiangiogenic agent.

Will at interval the hole perforation of 0.8mm and the polytetrafluoroethylene cell that adds 20U/ml heparin (containing or do not contain somatomedin) filling with 0.8% agar under gnotobasis be transplanted the into flank of mice with 80 rules.For subcutaneous transplantation, produce little skin incision to allow to transplant the insertion of trocar at the root of tail.Under gnotobasis, cell is implanted by little otch at back part of animal.Utilize wound clips that skin incision is sealed.If added somatomedin for example VEGF (3 μ g/ml) and bFGF (0.3 μ g/ml) and S1P (5mM/ml) in the agar, after 4 days, around cell, form vascular tissue so.After transplanting the 4th day utilizes CO ₂Put to death animal.Then cell is taken out from animal and carefully the vascularization fibrous tissue around each cell is taken out, and for example weight, hemoglobin and Tie2 protein content are analyzed to utilize different parameters.Alternatively, will organize quick-freezing and processing to be used for the histology.The amount of hemoglobin has reflected blood volume and hemorrhage combination.On the contrary, Tie2 only is expressed in endotheliocyte specifically, thereby the Tie2 protein level can be used as the tolerance of particular organization's vascularization.

The weight in wet base that grows in implant fibrous tissue is on every side measured after taking-up immediately.Then after adding the RIPA buffer of 2ml, with 24000 rev/mins with whole tissue homogenate (Ultra TurraxT25) 1 minute.Under 7000 rev/mins with centrifugal 1 hour of homogenate and utilize 0.45 μ m GHP syringe filtering supernatant to pollute to avoid lipid.Measure hemoglobin and the proteinic amount of Tie2 in the supernatant.Utilize Drabkin reagent test kit (Sigma haemoglobin #525) to measure content of hemoglobin by spectrophotometric analysis at 540nm.The filtrate (100 μ l) of aliquot is added in Drabkin ' the s solution of 0.9ml and in incubated at room mixture at least 15 minutes.Mixture is proportional in absorbance and the hemoglobin concentration of 540nm.The calibration curve that utilizes the whole blood sample before be used for from the different volumes of donor mice to obtain then is converted to blood volume with hemoglobinometry and measures (μ l).The Tie2 protein level is measured by ELISA: (#05-584) bag is spent the night by Nunc Maxsisorb 96 orifice plates for 2mg/ml, UBI with the anti-Tie-2AB33 capture antibody of every hole 0.1ml down at 4 ℃.Hatch and the hole was sealed in 2 hours with hole washing three times and by at room temperature shake (300 rev/mins) with 3%Top-Block (Juro #TB232010).Washing hole and add protein cleavage liquid (0.1-0.5mg in the cumulative volume of 0.2ml) and once more incubated at room 2 hours.After the washing, at room temperature use Tie2 and detect antibody complex (R﹠amp; D #AF762,0.5 μ g/ml) and the anti-goat-alkali phosphatase conjugate among the PBS-T+0.1%Top-Block (dilution in 1: 6000, SIGMA#A-8062) 1 hour.After the washing, detect Tie-2 antibody complex by hatching, and read absorbance at 405nm with p-nitrophenyl phosphoric acid (SIGMA#N-2270, tablet).With the recombined human ectodomain (sTie-2Fc) that is dissolved in the Tie-2 that is fused to human IgG1's constant region in the RIPA buffer with the concentration range in 0.1ng-300ng/ hole as standard.

Embodiment 21: about the coordination metastasis model of the 4T1 mouse mammary tumor of GPR4

In GPR4k.o mice and wt mice and the wt mice that crosses with the compound treatment that influences GPR4, measure the growth of coordination homology breast tumor and its neoplasm metastasis.It is crucial that blood vessel takes place for tumor growth and transfer formation.

As people such as Michigami T at Breast Cancer Res Treat.2002 Oct; 75 (3): the inoculated tumour cell described in the 249-58.With 4T1 mouse mammary tumor cell (1 * 10 ⁶/ 0.1ml PBS) inoculation of coordination ground is advanced in the female Balb/c mice of the homology right mammary fat pad in (6-8 age in week).Tumor begins to form after cell inoculation 7-10 days.In wide in range time-histories experiment, Microscopic examination showed begins to form lung and bone respectively and shifts after 2 and 3 weeks behind the cell inoculation.The back termination of 3 weeks is tested and tumor is weighed.To organize quick-freezing and processing to be used for the histology or to be used for ELISA and western blot analysis in the cracking of RIPA buffer.

Embodiment 22: about the coordination metastasis model of the B16-BL6 murine melanoma of GPR4

In GPR4k.o mice and wt mice and the wt mice that crosses with the compound treatment that influences GPR4, measure the growth of coordination homology melanoma and its neoplasm metastasis.It is crucial that blood vessel takes place for tumor growth and transfer formation.

The B16-BL6 mouse melanin tumor cell is cultured to super converge and with 5 * 10 among the 1 μ l HBSS ⁴Individual cell coordination ground Intradermal (i.d.) inoculation is advanced in the female C57/BL6 mice of the homology ear skin in (6-8 age in week).Solid location (stereotactic) microscopically inject and with injection cell between two blood vessels of ear periphery.Began to form tumor behind the cell inoculation in 7-10 days.In 100% animal, formed neoplasm metastasis in about 10 days, and about 30% animal has the lung tumor transfer after 3 weeks at the cranium lymph node.The back termination experiment of 3 weeks.Size by imaging tumor of quantitative former generation is weighed enlargement of lymph node tumor metastasis simultaneously.To organize quick-freezing and processing to be used for the histology or to be used for ELISA and western blot analysis in the cracking of RIPA buffer.

Embodiment 24: about the inductive arthritis model of mice antigen of GPR4

In GPR4k.o mice and wt mice and the wt mice that crosses with the compound treatment that influences GPR4, carry out the model in antigen induction joint.Blood vessel occurs in the rheumatoid arthritis and plays a significant role.

As before by people such as Grosios K, Inflamm Res.2004Apr; 53 (4): 133-42 is described to be tested.The-21 days and the-14 days with female mice in two positions at back at methylated bovine serum albumin (mBSA Fluka Chemie AG) Intradermal sensitization, wherein said methylated bovine serum albumin and complete Freund's adjuvant are with homogenate in 1: 1 (0.1ml contains 1mg/mlmBSA).At the 0th day, right knee joint accepted to be dissolved in the 10mg/mlmBSA (knee joint of injections of antigens) of 10 μ l in 5% glucose solution, and left knee joint is only accepted 5% the glucose solution (knee joint of injection carrier) of 10 μ l.After the intrinsic articulation injection, utilize a caliper measurements left side and right knee joint diameter then immediately, and remeasured at the 2nd, 4,7,9,11 and 14 day.Handle every day.The ratio of right knee joint swelling with left knee joint swelling calculated, and R/L knee joint swelling ratio was drawn to the time, thereby provide the contrast and area under curve (AUC) chart of processed group.Utilize the excel spreadsheet lattice that the percentage rate of individual processed group AUCs is suppressed control group A UC (0% suppresses) is calculated.At the 14th day, pass through CO ₂Suck and put to death mice and take out right and left knee joint, and processing is used for histologic analysis.Utilize Histodurplastic embedding method (Leica AG, Germany) that knee joint is processed and be used for non-decalcification histology.Go up from contrast and arthritis knee joint cutting section (5 μ m) at RM2165 rotary microtome (Leica AG, Germany).Behind the Giemsa staining, according to standard scheme, with microscope slide according to from left knee joint/right knee joint of each animal to carrying out numeral number and reading with blind (blinded) form.

Embodiment 25: the retinopathy of precocious model (ROP)-GPR4

In GPR4k.o mice and wt mice and the wt mice that crosses with the compound treatment that influences GPR4, carry out the retinopathy model of hypoxia inducible.Hypoxia is the main motive force that induces the retina medium vessels to take place in this model.

As people such as Reynolds LE, Nat Med.2002Jan; 8 (1): people such as 27-34 and Wilkinson-Berka JL are at Invest Ophthalmol Vis Sci.2003Mar; 44 (3): this test of the carrying out described in the 974-9.By being placed, the cub in 7 day age and its mother comprise 75% ± 5%O ₂And 2%CO ₂(utilize medical grade O ₂With the technical grade air) closed cells in induce ROP in the C57BL/6 mice.Utilize gas analyser (Model ML 205; AD Instruments, Pty., Ltd., Castle Hill, New South Wales, Australia) and chart recorder (Chart, ver.3.5, on the MacLab/2E System; AD Instruments, Pty., Ltd.) gas level in twice pair of cell every day is monitored.Approximately 2.5L/ minute airflow rate helps to keep the CO that metabolism produces ₂Adequate level and O ₂The reduction of pressing.Mice is remained on 5 days (hyperoxic period, postnatal P7-P12 days) in the cell, put it into then in the room air that (blood vessel of hypoxia inducible took place, P12-P17) after 5 days.With glucosan-FITC perfusion mice is with outstanding vascular and detect retina, and analyze as the bulk sample slide glass or by the histology.

The clone of embodiment 26:TDAG8 and stable cell lines produce

From genomic DNA amplification people TDAG8, utilize following primer: forward, 5 '-GACTTCTCTGTTTACTTTCTA-3 '; Oppositely, 5 '-GTTCTACTCAAGGACCTCTA-3 '.The PCR reactant mixture contains 0.2mM dNTPs at the cumulative volume of 20 μ l, 1x PCR buffer (contains 1.5mM MgCl ₂), 0.5 Taq/Tgo of unit archaeal dna polymerase mixture (Roche), every kind of primer of 40pmol and sterilized water.The template that is used for this reaction is human gene group DNA (Promega, Wallisellen, a Switzerland).Utilize Biometra T3 temperature cycling device to carry out PCR, utilize following cycling condition: 95 ℃ of degeneration 2 minutes are that 30 seconds, 60 ℃ annealing of 95 ℃ of degeneration of 38 circulation were extended 1 minute in 45 seconds and 72 ℃ then.Last extend in 72 ℃ and carried out 7 minutes.

The PCR product cloning is advanced topo PCR4 carrier (Invitrogen, Basel, Switzerland) and order-checking.From then on utilize following primer to increase again in the construct cDNA then: forward: 5 '-TCCGGAATTCGCCACCATGAACAGCACATGTATT-3 ' is reverse: 5 '-GATCCGCTCGAGCTCAAGGACCTCTAATTC-3 ' is so that introduce EcoRI restriction site and kozak sequence at coded sequence 5 ' end, and introduces the XhoI restriction site just at 3 ' end before termination codon.Then the cDNA sub-clone is advanced expression vector pcDNA3.1/myc-His, as with the fused protein of myc labelling.

Produced the stable cell lines of expressing TDAG8 in CCL39 cell or CCL39CRE-luc cell, its stably express cAMP dependency luciferase reporter gene is to detect the cAMP of response part.Utilize Effectene (Qiagen, Basel, Switzerland) according to manufacturers protocol, in above-mentioned cell line, produce stable cell lines by transfection TDAG8cDNA expression construct.Cells transfected is selected in the presence of the G418 of 400 μ g/ml.The antibiotic in 3 weeks is picked out single clone and its expansion is used for further analysis after selecting.

Embodiment 27:TDAG8 activates the proton-sensing G-protein coupled receptors that cAMP forms

CAMP forms test: in serum-free DMEM culture medium, with [ ³H] adenine (100MBq/ml; Amersham, D ü bendorf, Switzerland) labelling is incubated at the cell culture that converges 4 hours in 24 orifice plates.Then, test in (embodiment 2) described buffered saline solution at 37 ℃ of following incubated cells about IP as top.If point out, with the phosphodiesterase inhibitor isobutyl methylxanthine (IBMX, thus 1mM) add to allow gathering of cAMP.Incubation time is 15 minutes.Ice-cold then trichloroacetic acid extract cell and utilize in batches column chromatography cAMP is separated from free adenine and ATP (Salmon Y, 1979, Adv.Cycl.Nucleot Res, 10:35-55).

The result: aforesaid expression study and cAMP form test show this receptor really to the closely similar scope of OGR1 in pH change and react.Psychosine it is reported be TDAG8 part (people such as Im DS, 2001, J Cell Biol, 153:429-434), they self do not activate cAMP and form.Half maximum activation of cAMP by TDAG8 in the CCL39 of stably express receptor cell betide pH 7.15+/-0.02 (meansigma methods+/-sem; N=6).

Embodiment 28: the screening test that is used for agonist or the antagonist of TDAG8:

With every hole 10-20,000 cell inoculation is in white 96 orifice plates with the cell of as described in example 8 above coexpression TDAG8 and cAMP luciferase reporter gene.In the previous day of testing, culture medium is replaced by serum-free DMEM and at 37 ℃ of 5%CO ₂Exist down the cell overnight incubation.100 μ l HBS buffer (130mM NaCl, 0.9mM NaH with suitable pH ₂PO ₄, 0.8mM MgSO ₄, 1.8mM CaCl ₂, 5.4mM KCl, 25mM glucose, 20mMHEPES) washed cell once.The suitable HBS buffer of 100 μ l that will contain the chemical compound (for example any inside or commercially available compound library) that will test to some extent then joins on the cell.Non-CO under 37 ℃ ₂Hatched in the incubator dull and stereotyped 4-5 hour.After 4-5 hour from cell sucking-off buffer and once with the PBS washed cell of 100 μ l.Come cell lysis by adding 15 μ l lysis buffers (5mM tris-phosphoric acid, 4mM DTT, 0.4mM EDTA, 2% glycerol, 0.2%triton X-100), vibrated 1 minute and incubated at room 20 minutes.As automatic adding 50 μ l substrate buffer solution (E1483, Promega, Wallisellen, Switzerland) time, (Labsystems LuminoskanRS carries out substrate simultaneously and distributes and signal measurement for BioConcept, Allschwill) enterprising traveling optical signal measurement at Labsystems LuminoskanRS.Agonist in the test has produced luminous enhancing, and antagonist has produced luminous weakening.For example, antagonist is characterised in that in the test with no chemical compound contrast compares weakening of luminous signal, and half maximum activation of people TDAG8 in the acid pH buffer of pH6.8 or pH7.0 for example.In the CCL39CRE-luc of stably express receptor cell by people TDAG8 to inductive half maximum activation of luciferase betide pH7.28+/-0.02 (meansigma methods+/-sem; N=7).

The expression of embodiment 29:TDAG8 in osteoclast and osteoclast precursor cell

People's peripheral blood lymphocytes of former generation (PBMNCs is made up of the subclass of mononuclear cell, lymphocyte and other hemocyte type) is cultivated in the MEMalpha culture medium of having replenished 10% hyclone.For inducing the osteoclast differentiation, replenished in some cultures and contained M-CSF (25ng/ml, R﹠amp; D Systems, Abingdon, Britain), RANK part (50ng/ml, InsightBiotechnology, Wembley, Britain), TGFbetal (5ng/ml, R﹠amp; D Systems, Abingdon, Britain), the cytokine mixture of dexamethasone (1 μ M, Sigma, Buchs, Switzerland).Sophisticated osteoclast is observed in after the processing 17 days.

Utilize RNAeasy (Qiagen, Basel, Switzerland) from preparing RNA with intracellular cytokine mixture process or untreated culture.Utilizing Superscript II (Life technologies/Invitrogen, Basel, Switzerland) that RNA is carried out the DNA enzyme handles and reverse transcription.The parallel PCR that utilizes following temperature cycles scheme to set up for TDAG8 and glyceraldehyde-3-phosphate dehydrogenase (GPDH) with Expand High FidelityTaq (Roche) reacts: 94 ℃ of degeneration in following 30 seconds, 56 ℃ (TDAG8) or 55 ℃ (GPDH) annealing in following 45 seconds, 72 ℃ of extensions in following 50 seconds; For TDAG8 is 36 circulations, is 30 circulations for GPDH.Measure the interior mark of GPDH as the mRNA amount.For TDAG8, the clone PCR product is also verified by order-checking.Use following primer: TDAG8 forward: 5 '-AACTACTTGTCAGCATCACA-3 ', oppositely: 5 '-GTTCTACTCAAGGACCTCTA-3 '; GPDH forward: 5 '-TTAGCACCCCTGGCCAAGG-3 ', oppositely: 5 '-CTTACTCCTTGGAGGCCATG-3 '.

Result: the strongly expressed of in the osteoclast of PBMNCs and differentiation fully, all observing TDAG8.

Embodiment 30: osteoclast differentiation and activity test (for the functional trial of TDAG8)

People's peripheral blood lymphocytes of former generation (PBMNCs) is cultivated in the MEMalpha culture medium of having replenished 10% hyclone.For inducing the osteoclast differentiation, replenished in the culture and contained M-CSF (25ng/ml, R﹠amp; D Systems, Abingdon, Britain), RANK part (50ng/ml, InsightBiotechnology, Wembley, Britain), TGFbeta1 (5ng/ml, R﹠amp; D Systems, Abingdon, Britain), the cytokine mixture of dexamethasone (1 μ M, Sigma, Buchs, Switzerland).For the influence of research pH, in atomization, cell is maintained in the culture medium of different pH, and behind the acid phosphatase stain of paratartaric acid resistance, count sophisticated osteoclast at microscopically for the osteoclast differentiation.

For the influence of research pH, PBMNCs is inoculated on the Os Bovis seu Bubali slice, and in the presence of aforesaid cytokine mixture, under standard conditions, cultivates up to the 14th day to osteoclast activity.Then culture is transferred to the culture medium of different pH, and cultivated again after 3 days and estimate osteoclast activity with the concentration of the collagen segment that is discharged by the area of measuring resorbent bone.In addition, people TDAG8 antagonist (for example, by embodiment 17 screening test obtained) can reverse viewed neutral environment for example pH6.8 or 7.0 agonist effect.

Embodiment 31: pursue sequence alignment:

Utilize GCG program " Gap " (people such as Devereux J, 1984, Nucl Acids Res, 12:387-395.) aligned sequences.

Employed protein sequence with Refseq database retrieval number:

OGR1 NP_003476

GPR4 NP_005273

TDAG8 NP_003599

The comparison of people OGR-1 and people GPR4: percentage ratio similarity: 50.838 percentage ratio homogeneity: 45.251

The comparison of people OGR-1 and people TDAG8: percentage ratio similarity: 45.706 percentage ratio homogeneity: 34.663

The comparison of people GPR4 and people TDAG8: percentage ratio similarity: 46.061 percentage ratio homogeneity: 36.970

Sequence table

＜110〉Novannis company

＜120〉new g protein coupled receptor and DNA sequence thereof

<130>4-33201P1

<160>6

＜170〉PatentIn version 3 .1

<210>1

<211>365

<212>PRT

＜213〉people

<220>

＜221〉peptide

<222>(1)..(365)

<223>

<400>1

Met Gly Asn Ile Thr Ala Asp Asn Ser Ser Met Ser Cys Thr Ile Asp

1 5 10 15

His Thr Ile His Gln Thr Leu Ala Pro Val Val Tyr Val Thr Val Leu

20 25 30

Val Val Gly Phe Pro Ala Asn Cys Leu Ser Leu Tyr Phe Gly Tyr Leu

35 40 45

Gln Ile Lys Ala Arg Asn Glu Leu Gly Val Tyr Leu Cys Asn Leu Thr

50 55 60

Val Ala Asp Leu Phe Tyr Ile Cys Ser Leu Pro Phe Trp Leu Gln Tyr

65 70 75 80

Val Leu Gln His Asp Asn Trp Ser His Gly Asp Leu Ser Cys Gln Val

85 90 95

Cys Gly Ile Leu Leu Tyr Glu Asn Ile Tyr Ile Ser Val Gly Phe Leu

100 105 110

Cys Cys Ile Ser Val Asp Arg Tyr Leu Ala Val Ala His Pro Phe Arg

115 120 125

Phe His Gln Phe Arg Thr Leu Lys Ala Ala Val Gly Val Ser Val Val

130 135 140

Ile Trp Ala Lys Glu Leu Leu Thr Ser Ile Tyr Phe Leu Met His Glu

145 150 155 160

Glu Val Ile Glu Asp Glu Asn Gln His Arg Val Cys Phe Glu His Tyr

165 170 175

Pro Ile Gln Ala Trp Gln Arg Ala Ile Asn Tyr Tyr Arg Phe Leu Val

180 185 190

Gly Phe Leu Phe Pro Ile Cys Leu Leu Leu Ala Ser Tyr Gln Gly Ile

195 200 205

Leu Arg Ala Val Arg Arg Ser His Gly Thr Gln Lys Ser Arg Lys Asp

210 215 220

Gln Ile Gln Arg Leu Val Leu Ser Thr Val Val Ile Phe Leu Ala Cys

225 230 235 240

Phe Leu Pro Tyr His Val Leu Leu Leu Val Arg Ser Val Trp Glu Ala

245 250 255

Ser Cys Asp Phe Ala Lys Gly Val Phe Asn Ala Tyr His Phe Ser Leu

260 265 270

Leu Leu Thr Ser Phe Asn Cys Val Ala Asp Pro Val Leu Tyr Cys Phe

275 280 285

Val Ser Glu Thr Thr His Arg Asp Leu Ala Arg Leu Arg Gly Ala Cys

290 295 300

Leu Ala Phe Leu Thr Cys Ser Arg Thr Gly Arg Ala Arg Glu Ala Tyr

305 310 315 320

Pro Leu Gly Ala Pro Glu Ala Ser Gly Lys Ser Gly Ala Gln Gly Glu

325 330 335

Glu Pro Glu Leu Leu Thr Lys Leu His Pro Ala Phe Gln Thr Pro Asn

340 345 350

Ser Pro Gly Ser Gly Gly Phe Pro Thr Gly Arg Leu Ala

355 360 365

<210>2

<211>16

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this peptide is used to produce the antibody at OGR1

＜220〉peptide

<221>

<222>(1)..(16)

<223>

<400>2

Cys Phe Val Ser Glu Thr Thr His Arg Asp Leu Ala Arg Leu Arg Gly

1 5 10 15

<210>3

<211>362

<212>PRT

＜213〉people

<220>

＜221〉peptide

<222>(1)..(362)

<223>

<400>3

Met Gly Asn His Thr Trp Glu Gly Cys His Val Asp Ser Arg Val Asp

1 5 10 15

His Leu Phe Pro Pro Ser Leu Tyr Ile Phe Val Ile Gly Val Gly Leu

20 25 30

Pro Thr Asn Cys Leu Ala Leu Trp Ala Ala Tyr Arg Gln Val Gln Gln

35 40 45

Arg Asn Glu Leu Gly Val Tyr Leu Met Asn Leu Ser Ile Ala Asp Leu

50 55 60

Leu Tyr Ile Cys Thr Leu Pro Leu Trp Val Asp Tyr Phe Leu His His

65 70 75 80

Asp Asn Trp Ile His Gly Pro Gly Ser Cys Lys Leu Phe Gly Phe Ile

85 90 95

Phe Tyr Thr Asn Ile Tyr Ile Ser Ile Ala Phe Leu Cys Cys Ile Ser

100 105 110

Val Asp Arg Tyr Leu Ala Val Ala His Pro Leu Arg Phe Ala Arg Leu

115 120 125

Arg Arg Val Lys Thr Ala Val Ala Val Ser Ser Val Val Trp Ala Thr

130 135 140

Glu Leu Gly Ala Asn Ser Ala Pro Leu Phe His Asp Glu Leu Phe Arg

145 150 155 160

Asp Arg Tyr Asn His Thr Phe Cys Phe Glu Lys Phe Pro Met Glu Gly

165 170 175

Trp Val Ala Trp Met Asn Leu Tyr Arg Val Phe Val Gly Phe Leu Phe

180 185 190

Pro Trp Ala Leu Met Leu Leu Ser Tyr Arg Gly Ile Leu Arg Ala Val

195 200 205

Arg Gly Ser Val Ser Thr Glu Arg Gln Glu Lys Ala Lys Ile Lys Arg

210 215 220

Leu Ala Leu Ser Leu Ile Ala Ile Val Leu Val Cys Phe Ala Pro Tyr

225 230 235 240

His Val Leu Leu Leu Ser Arg Ser Ala Ile Tyr Leu Gly Arg Pro Trp

245 250 255

Asp Cys Gly Phe Glu Glu Arg Val Phe Ser Ala Tyr His Ser Ser Leu

260 265 270

Ala Phe Thr Ser Leu Asn Cys Val Ala Asp Pro Ile Leu Tyr Cys Leu

275 280 285

Val Asn Glu Gly Ala Arg Ser Asp Val Ala Lys Ala Leu His Asn Leu

290 295 300

Leu Arg Phe Leu Ala Ser Asp Lys Pro Gln Glu Met Ala Asn Ala Ser

305 310 315 320

Leu Thr Leu Glu Thr Pro Leu Thr Ser Lys Arg Asn Ser Thr Ala Lys

325 330 335

Ala Met Thr Gly Ser Trp Ala Ala Thr Pro Pro Ser Gln Gly Asp Gln

340 345 350

Val Gln Leu Lys Met Leu Pro Pro Ala Gln

355 360

<210>4

<211>337

<212>PRT

＜213〉people

<220>

＜221〉peptide

<222>(1)..(337)

<223>

<400>4

Met Asn Ser Thr Cys Ile Glu Glu Gln His Asp Leu Asp His Tyr Leu

1 5 10 15

Phe Pro Ile Val Tyr Ile Phe Val Ile Ile Val Ser Ile Pro Ala Asn

20 25 30

Ile Gly Ser Leu Cys Val Ser Phe Leu Gln Pro Lys Lys Glu Ser Glu

35 40 45

Leu Gly Ile Tyr Leu Phe Ser Leu Ser Leu Ser Asp Leu Leu Tyr Ala

50 55 60

Leu Thr Leu Pro Leu Trp Ile Asp Tyr Thr Trp Asn Lys Asp Asn Trp

65 70 75 80

Thr Phe Ser Pro Ala Leu Cys Lys Gly Ser Ala Phe Leu Met Tyr Met

85 90 95

Lys Phe Tyr Ser Ser Thr Ala Phe Leu Thr Cys Ile Ala Val Asp Arg

100 105 110

Tyr Leu Ala Val Val Tyr Pro Leu Lys Phe Phe Phe Leu Arg Thr Arg

115 120 125

Arg Ile Ala Leu Met Val Ser Leu Ser Ile Trp Ile Leu Glu Thr Ile

130 135 140

Phe Asn Ala Val Met Leu Trp Glu Asp Glu Thr Val Val Glu Tyr Cys

145 150 155 160

Asp Ala Glu Lys Ser Asn Phe Thr Leu Cys Tyr Asp Lys Tyr Pro Leu

165 170 175

Glu Lys Trp Gln Ile Asn Leu Asn Leu Phe Arg Thr Cys Thr Gly Tyr

180 185 190

Ala Ile Pro Leu Val Thr Ile Leu Ile Cys Asn Arg Lys Val Tyr Gln

195 200 205

Ala Val Arg His Asn Lys Ala Thr Glu Asn Lys Glu Lys Lys Arg Ile

210 215 220

Ile Lys Leu Leu Val Ser Ile Thr Val Thr Phe Val Leu Cys Phe Thr

225 230 235 240

Pro Phe His Val Met Leu Leu Ile Arg Cys Ile Leu Glu His Ala Val

245 250 255

Asn Phe Glu Asp His Ser Asn Ser Gly Lys Arg Thr Tyr Thr Met Tyr

260 265 270

Arg Ile Thr Val Ala Leu Thr Ser Leu Asn Cys Val Ala Asp Pro Ile

275 280 285

Leu Tyr Cys Phe Val Thr Glu Thr Gly Arg Tyr Asp Met Trp Asn Ile

290 295 300

Leu Lys Phe Cys Thr Gly Arg Cys Asn Thr Ser Gln Arg Gln Arg Lys

305 310 315 320

Arg Ile Leu Ser Val Ser Thr Lys Asp Thr Met Glu Leu Glu Val Leu

325 330 335

Glu

<210>5

<211>19

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this peptide is used to produce the antibody at GPR4

<220>

＜221〉peptide

<222>(1)..(19)

＜223〉be used to produce the peptide 2 of the antibody of GPR4

<400>5

Arg Ser Asp Val Ala Lys Ala Leu His Asn Leu Leu Arg Phe Leu Ala

1 5 10 15

Ser Asp Lys

<210>6

<211>20

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this peptide is used to produce the antibody at GPR4

<220>

＜221〉peptide

<222>(1)..(20)

＜223〉be used to produce the peptide of the antibody of GPR4

<400>6

Asp Glu Leu Phe Arg Asp Arg Tyr Asn His Thr Phe Cys Phe Glu Lys

1 5 10 15

Phe Pro Met Glu

20

Claims

1. the purposes of isolating proton-sensing G PCR polypeptide is used to develop the medicine that is used for disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions.

2. the purposes of isolating proton-sensing G PCR polypeptide is used to develop the medicine that is used for disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions; Described polypeptide is selected from:

(a) by the isolating polypeptide of polynucleotide encoding, described polynucleotide comprise OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: polynucleotide sequence NM_008152) preferably;

(b) isolating proton-sensing G PCR polypeptide, it comprises peptide sequence with SEQ ID NO:1 and has at least 20% peptide sequence;

(c) isolating proton-sensing G PCR polypeptide, it comprises peptide sequence with SEQ ID NO:3 and has at least 20% peptide sequence;

(d) isolating proton-sensing G PCR polypeptide, it comprises the peptide sequence that the peptide sequence with SEQ ID NO:4 has at least 20% homogeneity;

(e) isolating polypeptide, it comprises the peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4;

(f) isolating proton-sensing G PCR polypeptide, it has the homogeneity with the peptide sequence at least 20% of SEQ ID NO:1;

(g) isolating proton-sensing G PCR polypeptide, it has the homogeneity with the peptide sequence at least 20% of SEQ ID NO:3;

(h) isolating proton-sensing G PCR polypeptide, it has the homogeneity with the peptide sequence at least 20% of SEQ ID NO:4;

(i) peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4; With

(l) (a) polypeptide in (i), it is presented at the dependent inositol monophosphate of pH in the CCL39 hamster fibroblast and forms, perhaps in cAMP luciferase reporter gene is measured in CHOK1 CRE-luc cell or CCL39 CRE-luc cell the pH dependent signals.

3. as the purposes of isolating polypeptide claimed in claim 1 or 2, described polypeptide comprises the peptide sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4.

4. as the purposes of isolating polypeptide claimed in claim 1 or 2, described polypeptide is made up of the peptide sequence of SEQID NO:1, SEQ ID NO:3 or SEQ ID NO:4.

5. the purposes of isolating polynucleotide is used to develop the medicine that is used for disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions; Described polynucleotide are selected from:

(a) isolating polynucleotide, its comprise OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: polynucleotide sequence NM_008152) preferably;

(b) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:1 has at least 20% homogeneity;

(c) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:3 has at least 20% homogeneity;

(d) the isolating polynucleotide of coding proton-sensing G PCR peptide sequence, the peptide sequence of described peptide sequence and SEQ ID NO:4 has at least 20% homogeneity;

(f) isolating polynucleotide, its comprise OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: polynucleotide sequence NM_008152) preferably;

(g) OGR1 (searching number: NM_003485.1), rat OGR1 (searching number: XM_234483), mice OGR1 (searching number: NM_175493), cattle OGR1 (searching number: NM_174329), OGR1 (searching number: NM_003485.1), people GPR4 (searching number: NM_005282), mice GPR4 (searching number: NM_175668), people TDAG8 (searching number: NM_003608) and mice TDAG8 (searching number: polynucleotide sequence NM_008152) preferably;

(h) (a) polynucleotide in (g), the dependent inositol monophosphate of pH that its encoded polypeptides is presented in the CCL39 hamster fibroblast forms or the pH dependent signals in CHOK1 CRE-luc cell or CCL39CRE-Iuc cell in cAMP luciferase reporter gene is measured.

6. the purposes of the antibody of any one polypeptide in the specific bond claim 1 to 4 is used to produce the medicine that prevents and/or treats disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions;

Pharmaceutical composition, it comprises the antibody that is used to prevent and/or treat disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, any one polypeptide in the described antibody specific bond claim 1 to 4; Or

The method that prevents and/or treats of disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, described method comprises the antibody that to needs this type of experimenter who prevents and/or treats uses effective dose, any one polypeptide in the described antibody specific bond claim 1 to 4.

7. screening technique, it is used to identify the proton-sensing active chemical compound of antagonism according to any one polypeptide of claim 1 to 4.

8. screening technique, it is used to identify the exciting active chemical compound of proton-sensing according to any one polypeptide of claim 1 to 4.

9. screening technique, it is used to identify stimulates or suppresses the function of polypeptide of claim 1 to 4 or the chemical compound of expression, and described method comprises and is selected from:

(a) by directly or indirectly with the bonded labelling of candidate compound, quantitatively or qualitative determination or detection candidate compound to the combination of described polypeptide (perhaps cell or film) or its fused protein to expressing described polypeptide;

(b), measure candidate compound to described polypeptide (perhaps cell or film) or the bonded competition of its fused protein to expressing described polypeptide in the presence of the competitor of labelling;

(c) cell or the cell membrane suitable detection system of utilization to expressing described polypeptide, whether the test candidate compound causes producing signal by activating or suppressing described polypeptide; Or

(d) for example utilize the ELISA test, detect the influence of candidate compound the generation of polypeptide described in the mRNA of coding said polypeptide or the cell;

The method of the group that constitutes.

10. prevent and/or treat the method for disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, described method comprises the accessory rights that this type of experimenter who prevents and/or treats uses effective dose to needs and requires 7 the obtainable antagonist of method.

11. prevent and/or treat the method for disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, described method comprises the accessory rights that this type of experimenter who prevents and/or treats uses effective dose to needs and requires 8 the obtainable agonist of method.

12. pharmaceutical composition, it is used to prevent and/or treat disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, and described compositions comprises the obtainable antagonist of method of accessory rights requirement 7.

13. pharmaceutical composition, it is used to prevent and/or treat disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, and described compositions comprises the obtainable agonist of method of accessory rights requirement 8.

14. diagnostic kit, it comprises at the antibody according to any one polypeptide of claim 1 to 4.

15. diagnostic kit, it comprises the pharmaceutical preparation that is used to prevent and/or treat disease and medical conditions, proton stable state imbalance in wherein said disease and the medical conditions, and described pharmaceutical preparation comprises at the antibody according to any one polypeptide of claim 1 to 4.