CN1809588A - A novel method of modulating bone-realted activity - Google Patents

Abstract

This invention relates to modulating bone-related activity in a subject by modulating Ror molecules. The invention further relates to compositions and methods for the screening, diagnosis and development of therapies for bone-related disorders.

Description

Regulate bone photo and close active novel method

Invention field

The present invention is in biology field.More particularly, the present invention relates to the method and composition of diagnosis, prognosis, prevention, treatment and the therapy assessment of bone photo related disorders.

Background of invention

The problem of bone photo related disorders (disorders) and disease obtains considerable attention in the past few years.The characteristics of bone photo related disorders are that the bone that is caused by the imbalance between bone resorption and the bone forming loses.In the whole vital process, exist continuous bone remodeling.In this remodeling process, at the bone resorption of osteoclast with osteoblasticly exist delicate balance between recovering subsequently.Relate in the cartilage and the scleroblast of intermembranous ossification is a specialized cell in the osseous tissue, it generates stromatin, causes the formation of new bone.Bone forming, promptly osteogenesis is that bone mass in the bone is kept requisite.Do not resemble scleroblast, osteoclast is with bone resorption and remove relevant.In normal bone, the balance between the bone resorption of the bone forming of scleroblast mediation and osteoclast mediation is mutual with being maintained by the modulated work mutually of complexity.

There are many many defectives, disease and the illnesss relevant with Skeletal system.Several examples comprise, but be not limited to osteoporosis, osteocarcinoma, sacroiliitis, rickets, fracture, periodontopathy, bone parts defective, molten osteopathy, primary and Secondary cases hyperparathyroidism, scleromalacia (paget ' s disease), richets, hyperostosis and osteopetrosis.Evaluation relates to the mechanism of Osteoblast Differentiation and renewal process for understanding physiology of bone and bone disorders, is critical as osteoporosis.These illnesss may relate to the defective bone forming that the defective maturation owing to the one-tenth osteoprogenitor cells of inferring causes.

Be necessary to develop the method for treatment and osteogenesis diseases associated or illness, quicken osteoplastic method, identify the method for regulating (strengthen or weaken) osteoplastic preparation, and the evaluation gene relevant with the bone photo related disorders or the method for its protein product.

The mechanism that evaluation bone forming and bone resorption relate to is critical for understanding physiology of bone and bone disorders as osteoporosis.Gene or its protein product relevant with the bone photo related disorders can be used to illustrate the molecular mechanism of bone forming, bone resorption, be used for screening screening and development new drug, diagnosis, prognosis, prevention and the treatment of bone development and bone loss illness, and the assessment of bone photo related disorders such as osteoporosis therapies.

The present invention not only provides a kind of adjusting bone photo to close active method, and it also provides the method for the mechanism that a kind of promote understanding bone forming and bone resorption relate to.

Summary of the invention

The present invention relates to a kind of expression cassette that comprises the polynucleotide of coding Ror polypeptide or its homologue or derivative or fragment or variant or mutant, under the control of wherein said polynucleotide exercisable promotor in osteocyte.

The present invention relates to a kind of host cell that comprises the expression cassette of the polynucleotide that contains coding Ror polypeptide or its homologue or derivative or fragment or variant or mutant, under the control of wherein said polynucleotide exercisable promotor in eukaryotic cell, described promotor and described polynucleotide allos.

The present invention relates to a kind of composition of regulating bone-related activity, comprise Ror molecule or its homologue or derivative or fragment or the variant or the mutant of significant quantity.

The present invention relates to a kind of method of screening reagent, described method comprises: (a) with reagent and Ror molecular combinations; (b) detect described reagent to the active effect of Ror, active reduction of wherein detected Ror or raising are that reagent is the indication that bone photo closes reagent.

The present invention relates to a kind of method of screening reagent, described method comprises: (a) with reagent and isolated cells combination, described cell contains a kind of Ror promoter sequence, and it is operably connected on the reporter gene; (b) detect the effect of described reagent to reporter gene activity, wherein as the reduction or the raising of the Ror promoter activity of measuring by reporter gene activity be that reagent is the indication that bone photo closes reagent.

The present invention relates to a kind of the screening and regulate the bonded method of Ror polypeptide, comprising: (a) the Ror polypeptide is contacted when having reagent with the Ror binding partners binding partners; (b) the Ror polypeptide is contacted when having contrast or not having described reagent with the Ror binding partners; (c) by to Ror polypeptide described in the step (a) and described binding partners combine and step (b) described in the Ror polypeptide compare the bonded reagent of selecting to regulate Ror polypeptide and Ror binding partners with combining of binding partners.

The present invention relates to a kind of bone photo of in the experimenter, regulating and close active method, comprise to experimenter's administration and regulate target Ror developed by molecule or active reagent.

The present invention relates to a kind of Wnt-1 and active method of Wnt-3 of in the experimenter, regulating, comprise with effective regulation and control Wnt-1 and the active amount administration of Wnt-3 and regulate target Ror2 molecule or active reagent.

The present invention relates to a kind of active method of Wnt-3 of in the experimenter, regulating, comprise with the active amount administration of effective regulation and control Wnt-3 and regulate target Ror1 expression of polypeptides or active reagent.

The present invention relates to a kind of evaluation adjusting bone photo and close active compositions and methods, comprising: (a) in cell, express the Ror molecule or utilize endogenous Ror to express; (b) described cell is contacted with described reagent; (c) expression or the activity of monitoring Ror molecule, wherein Ror expresses or active increase and decrease is accredited as described reagent and regulates bone photo and close active when having described reagent.

The present invention relates to a kind of compositions and methods of regulating the Wnt signal pathway of identifying, one or more can regulate Ror developed by molecule or active reagent to comprise screening, and wherein said Ror developed by molecule or the active reagent can regulated is the reagent of regulating the Wnt signal pathway.

The present invention relates to a kind of method that bioactive molecules is connected on the cell of expressing the Wnt polypeptide, described method comprises described cell is contacted with Ror2 polypeptide in conjunction with described bioactive molecules, and allow described Wnt polypeptide and described Ror2 polypeptide to be bonded to each other, thereby described bioactive molecules is connected on the described cell.

The present invention relates to a kind of method of the experimenter being screened the bone photo related disorders, comprise the following steps: the expression of measure R or molecule in the experimenter and be determined at the molecule of Ror described in the experimenter and its relative expression who in the normal subjects, compares, or the relative expression who compares with the expression among its same experimenter after carrying out the treatment of bone photo related disorders.

The present invention relates to a kind of method of the experimenter being screened the bone photo related disorders, comprise the following steps: the activity of measure R or polypeptide in the experimenter and be determined at the polypeptide of Ror described in the experimenter and its relative reactivity of in the normal subjects, comparing, or the relative reactivity of comparing with the activity among its same experimenter after carrying out the treatment of bone photo related disorders.

The present invention relates to a kind of method that participates in osteoplastic gene of identifying, comprising: a) in cell, cross expression Ror molecule, b) variation of gene expression pattern and c) measure which gene and be subjected to the Ror expression regulation, identify by this to participate in osteoplastic gene.

The present invention relates to a kind of method of identifying the gene of regulating the Wnt signal pathway, comprise: a) in cell, cross expression Ror molecule, b) variation of gene expression pattern and c) measure which gene and be subjected to the Ror expression regulation, identify the gene of regulating the wnt signal pathway by this.

The present invention relates to a kind of Ror2 of utilization and serve as a mark and identify the method for the people's preosteoblast breeding, be included in and measure the Ror2 expression of gene among the human osteoblast cell, wherein the Ror2 that improves expresses cell is accredited as the preosteoblast of breeding.

The present invention relates to a kind of Ror2 of utilization serves as a mark and identifies the method for the mouse bone-forming cell be in the matrix stage of maturity, be included in and measure the Ror2 expression of gene in the mouse bone-forming cell, wherein the Ror2 that improves expresses cell is accredited as the scleroblast that is in the matrix stage of maturity.

The present invention relates to a kind of method of the Ror2 of mensuration kinase activity, comprising: (a) obtain the Ror2 polypeptide; (b) exist ³²P γ ATP tense marker Ror2 polypeptide; (c) mix by measurement ³²The amount of P is measured the Ror2 kinase activity, wherein ³²The kinase whose activity of the bright Ror2 of the scale of P.

Accompanying drawing summary and sequence description

Can understand the present invention more fully by as detailed below and the accompanying drawing that forms the application's part and the sequence table of enclosing.

Fig. 1 is presented at the human osteoblast cell and breaks up the kinase whose expression decreased of Ror in late period.By gene chip analysis on GlHuman1a chip (circle) and the expression by Ror2 (Figure 1A) and Ror1 (Figure 1B) in real-time RT-PCT (bar shaped) the evaluation cell, it has represented the different steps of the differentiation of scleroblast from preosteoblast to ripe osteocyte.For two kinds of methods, all the relative mRNA among the HOB-03-C5 is expressed and be set at 1.Probe and primer that table 1 among the embodiment 1 li is listed in utilization carry out real-time RT-PCT.The level standard of mRNA is turned to the expression of 18SrRNA in every kind of sample.The mean+/-standard error (SE) of three RT-PCR reactions of each clone.Ror2 in the HOB-05-T1 cell express by RT-PCR be detect less than.Clone: 03-C5-HOB-03-C5, preosteoblast, 03-CE6-HOB-03-CE6, early stage scleroblast; 02-C1-HOB-02-C1, ripe scleroblast; 01-C1-HOB-01-C1, preceding osteocyte; 05-T1-HOB-05-T1, ripe osteocyte (in embodiment 1 with reference to figure 1).

Fig. 2 shows that SFRP-1 suppresses Ror2 and expresses.Be used to self stabilization cross the HOB-01-09 osteocyte of expression SFRP-1 (01-09SFRP-1) or blank carrier (01-09 carrier) or from wild-type or SFRP-1-/-result that gene chip that poly A (+) RNA of the cranium of mouse Ror2 (closed bar shaped) and Ror1 (open bar shaped) on the GlHumanla chip express is analyzed.Wild-type and SFRP1-/-mouse in the Ror1 expression levels under the chip investigative range.Described 01-09 carrier cell and in wild-type mice relative mRNA express and be set in 1 (in embodiment 1 with reference to figure 2).

Fig. 3 shows the proteinic predict domain structure of Ror.Described structural domain is: the IG-immunoglobulin (Ig); FRZ-curls; The tricyclic structure that kringle-finds in thrombogen at first by three pairs of disulfide linkage connections; M-strides film; Tyr Kin-Tyrosylprotein kinase.B. in the Ror1 module of curling the location of disulfide linkage (Roszmusz, etc., E., 2001, Journal of BiologicalChemistry.276:18485-90).Numeral is meant in the described curling structural domain 10 conservative halfcystines (in embodiment 1 with reference to figure 3).

Fig. 4 shows the expression of Ror2, but is not Ror1, and kinases breaks up in early days up to the mouse bone-forming cell differentiation the human osteoblast cell and increases late period.A. with people MSC incubation (the 0.1mM dexamethasone in growth medium, 0.05mM xitix and 10mM β-glycerophosphate) and collect total cell RNA and analyze Ror1 and Ror2 expression of gene in people's skeletonization substratum by RT-PCR in the specified time.B. with mouse MC3T3-E1 cell incubation (the 25ug/ml xitix in growth medium and 10mM β-glycerophosphate) and collect total cell RNA and analyze Ror1, Ror2, alkaline phosphatase (AP) and Bone Gla protein (OC) expression of gene (in embodiment 2 with reference to figure 3) in mouse skeletonization substratum by RT-PCR in the specified time.

Fig. 5 shows the expression of Ror protein in the U2OS cell.A. the diagram of total length Ror1 and Ror2 kinases and Ror2 mutant.FLAG-flag epi-position mark; The M-membrane spaning domain; The TyrKin-tyrosine kinase domain.B. from the western blotting of the flag epi-position mark of whole cell protein extracts (50 μ g/ swimming lane) of U2OS cell, described cell carries out transfection with specified Ror construct.The position of Ror1, Ror2 and Ror2KD by arrow mark and Ror2 Δ C-flag by the arrow mark.C. the top column shows as the radioautogram of the external autophosphorylation test-results of carrying out as described in down at general method (GeneralMethods), and the Ror2-flag or the Ror2KD-flag of described test use immunoprecipitation on flag affinity agarose carries out.In the column of bottom, separate the protein of 10 flag immunoprecipitation by SDS-PAGE and dye analysis with the kinases level of evaluation in the autophosphorylation reaction (in embodiment 3,6 and 8 with reference to figure 5) by silver.

Fig. 6 shows Ror2 kinase inhibition Wnt-3, but strengthens the Wnt-l activity.With the reorganization luciferase reporter gene that comprises 16 copy TCF binding sites the U2OS culture is carried out transient transfection, described TCF binding site 5 ' is cloned on the thymidine kinase promotor.In A, with promotor-reporter gene and pcDNA3.1 (+) (carrier), Ror2-flag (R2), Wnt-3-HA (w3), or Wnt-3-HA adds that the Ror2-flag (hole with the ng/96 orifice plate is represented) of specified amount or SFRP-1 (S) or the two carry out cotransfection together.In B, with promotor-reporter gene and pcDNA3.1 (+), Wnt-1-HA (w1), or Wnt-1-HA adds that the Ror2-flag of specified amount or SFRP-1 or the two carry out cotransfection together.At random to value 1 of luciferase value, described luciferase value is measured behind the transfection reporter gene when having pcDNA3.1 (+).In A, the result is the mean value ± SE of at least two independent experiments, n 〉=16, asterisk show uciferase activity under the level that obtains separately with Wnt-3-HA remarkable reduction ( ^*P＜0.05, ^*-p＜0.0001).In B, the result is the mean value ± SE of at least three independent experiments, n 〉=24, asterisk show the significantly improving of on the level that obtains separately uciferase activity with Wnt-1-HA ( ^*-p＜0.05, ^*-p＜0.0001) (in embodiment 4 with reference to figure 6).

Fig. 7 shows Ror1 kinase inhibition Wnt-3, but for the active not influence of Wnt-1.As among Fig. 6, replace Ror2-flag except using Ror1-flag (R1).Mean value+SE, n 〉=8.In A, asterisk show uciferase activity under the level that obtains separately with Wnt-3-HA remarkable reduction ( ^*P＜0.01, ^*-p＜0.0001) (in embodiment 5 with reference to figure 7).

Fig. 8 shows that the tyrosine kinase activity of Ror2 is that the enhancing of Wnt-1 and Wnt-3 are active and most ofly suppresses necessary.As among Fig. 6, replace Ror2-flag except using Ror2KD-flag (R2KD).In A and B, the result is the mean value ± SE of at least three independent experiments, n 〉=24.Asterisk show uciferase activity under the level that obtains separately with Wnt-3-HA remarkable reduction ( ^*-p＜0.0001) (in embodiment 6 with reference to figure 8).

Fig. 9 shows that the tenuigenin structural domain of Ror2 is enhancing and the active part inhibition of the Wnt-3 institute heart need of Wnt-1.As among Fig. 6, replace Ror2-flag except using Ror2 Δ C-flag (R2d).In A, the result is the mean value ± SE of at least two independent experiments, n 〉=16, asterisk show uciferase activity under the level that obtains separately with Wnt-3-HA remarkable reduction ( ^*P＜0.05, ^*-p＜0.0001).In B, n 〉=8 (in embodiment 6 with reference to figure 9).

Figure 10 shows that Ror2 and Ror2KD are in conjunction with Wnt-1 and Wnt-3.With vehicle Control or specified Ror2-flag and Wnts-HA combination transient transfection COS7 cell.To replace Ror2 or Wnts the total amount of DNA is kept constant by adding pcDNA3.1 (+) or pUSEamp respectively.At the 24th hour, by directly (top) or after precipitating with anti-flag antibody mediated immunity (bottom) carry out SDS-PAGE lysate analyzed.Carry out immunoblotting (in embodiment 7 with reference to Figure 10) with anti-HA antibody.

Figure 11 shows that Ror2 distinguishes between different Wnts.With specified Wnts-HA and Ror2-Flag (+) or pcDNA3.1 the COS7 cell is carried out transient transfection.At the 24th hour, lysate is carried out immunoprecipitation is also analyzed Wnts by anti-HA antibody (top) existence with anti-flag antibody.The bottom column shows the western blot analysis that carries out the COS7 extract with anti-HA antibody, and described extract comprises specified Wnts and Ror2-flag (in the contrast of immunoprecipitation moderate application of sample) (in embodiment 7 with reference to Figure 11).

Figure 12 shows that the degree that crossing of Wnt-1 and Wnt-3 expressed the Ror2 autophosphorylation does not influence.A. the result's of the outer analysis of Phosphorylation of top column display body radioautograph, described analysis of Phosphorylation utilizes the Ror2-flag of immunoprecipitation on flag affinity agarose to carry out as described under at general method, and it comes from the U2OS cell with Ror2-flag and specified Wnts cotransfection.The bottom column shows the protein immunoblotting of the same film of carrying out with anti-flag antibody.B. the radioautograph signal standards is turned to the relative signal that the proteic total amount of immunoreactivity Ror2 also will obtain in each reaction and be set in one when disappearance Wnts.Mean value ± the SE of three independent experiments (in embodiment 8 with reference to Figure 12).

Figure 13 shows that Ror2 suppresses the white stabilization of tenuigenin beta-catenin of Wnt mediation.Given combination with Ror2 (R2) and Wnts (W) is carried out transient transfection to the U2OS culture.To replace Ror2 or Wnts the total amount of DNA is kept constant by adding pcDNA3.1 (+) or pUSEamp respectively.At the 24th hour, carry out protein immunoblotting with the white antibody of anti-beta-catenin and come analysis of cells matter albumen.By after examining equal application of sample with anti-beta-actin antibody staining, the signal that the level standard that beta-catenin is white obtains when turning to disappearance Wnts.Numeral is the mean value (in embodiment 9 with reference to Figure 13) of three independent experiments.

Figure 14 shows the active pattern of a kind of Ror2 of imagination, and Ror2 is in conjunction with two kinds of Wnts thus, they are separated from the acceptor (Frizzled receptor) that curls and suppresses them and stablizes the white ability of beta-catenin.In addition, Wnt1 causes a kind of activation of unidentified signal cascade in conjunction with the Ror2 acceptor, and described cascade needs the tyrosine kinase activity of Ror2 acceptor and causes the enhancing of the reactive promoter activity of Wnt.The Wnt3 combination does not stimulate identical cascade, but activates other Tyrosylprotein kinase dependency incident on the contrary, and this causes the inhibition of the reactive promotor of Wnt.The acceptor that FZ-curls, GSK-3 β-glycogen synthase kinase β, β-cat-beta-catenin is white, Lef/Tcf-lymph toughener binding factor/T-cell transcription factor (in embodiment 10 with reference to Figure 14).

Figure 15 shows the evaluation of Ror2 binding partners in the U2OS cell.Full cell extract with the U2OS cell of the construct transient transfection of identifying is above carried out immunoprecipitation with anti-flag antibody and on 4-12% (A) or 7% (B) polyacrylamide gel, carry out SDS-PAGE and analyze.In parallel laboratory test, the 4-12% gel is transferred on the nitrocellulose membrane and carries out protein immunoblotting with anti-flag (C) or anti-Tyrosine O-phosphate (D) antibody.Arrow points appears as the dependent band of Ror2.The molecular weight that M-represents with kDa.55 and 25kDa around remarkable band be isolating IgG subunit from flag affinity agarose (in embodiment 11 with reference to Figure 15).

Figure 16 shows the cell intracellular domain of Ror2 in conjunction with Notch2 (Notch21C).With vehicle Control or specified Ror2-flag and Notch21C-V5-his combination the U2OS cell is carried out transient transfection.By adding pcDNA3.1 (+) total amount of DNA is kept constant.At the 24th hour, with anti-flag antibody carry out protein immunoblotting or directly (top) come analytical pyrolysis liquid by SDS-PAGE.Carry out immunoblotting (in embodiment 12 with reference to Figure 16) with anti-V5 (top) or anti-his (bottom) antibody.

Figure 17 confirms to stablize the preparation of the clone of expressing Ror2 and Ror1.A. crossing expression Ror2, Ror2-Flag, Ror1-Flag, or relative Ror2 and Ror1 mRNA expresses in the HOB-01-09 cell of blank carrier (pcDNA 3.1 (+)).Relative mRNA expression in the HOB-01-09-pcDNA cell is set in one.Utilize probe listed in the table 1 of embodiment 1 and primer to carry out real-time RT-PCR.The level standard of mRNA is turned to the expression of 18S rRNA in each sample.B. the protein immunoblotting (50 μ g/ swimming lane) of using the appointment antibody from the full cell extract in the HOB-01-09 cell to carry out, described cell is crossed expression Ror2, Ror2-Flag, Ror1-Flag, or blank carrier (in embodiment 13 with reference to Figure 17).

Table 1 shows the primer and the probe (at embodiment 1 reference table 1) of the real-time RT-PCR analysis that is used for people Ror mRNA.

Table 2 shows the primer and the probe (at embodiment 2 reference tables 2) of the real-time RT-PCR analysis that is used for mouse Ror mRNA.

Table 3 shows the primer and the probe (at embodiment 2 reference tables 3) of the real-time RT-PCR analysis that is used for mouse alkaline phosphatase and Bone Gla protein (osteocalcin) mRNA.

Table 4 shows possible Ror2 interacting protein (reference table 4 in embodiment 9).

The rule of Nucleotide in the given patent application of 37C.F.R. § 1.821-1.825 and/or aminoacid sequence content is followed in following 48 sequences explanation and the sequence table that invests this paper.(" to the requirement-sequence rules of the patent application that comprises Nucleotide and/or aminoacid sequence content ") and the sequence table that meets the standard ST.25 of World Intellectual Property Organization (WIPO) (1998) and EPO and PCT require (detailed rules and regulations 5.2 and 4.95 (a-bis) and 208 save and the annex C of administrative rules).Described sequence explanation contains the code of a letter that is useful on the nucleotide sequence symbol and the code that is used for amino acid whose three letters, as at Nucleic Acids Res., 13,3021-3030, (1985) with at Biochemical J., 219 (2), 345-373, (1984) defined such in, incorporate described document into this paper by reference at this.Follow the rule shown in the 37C.F.R. § 1.822 for Nucleotide and used symbol and the form of amino acid sequence data.

SEQ ID NO:1 comprises at first at TCR-α enhanser first kind of nucleotide sequence of TCF DNA binding site of identifying in the CD3-e enhanser and common TCF DNA binding site.

SEQ ID NO:2 comprises at first at TCR-α enhanser second kind of nucleotide sequence of TCF DNA binding site of identifying in the CD3-e enhanser and common TCF DNA binding site.

SEQ ID NO:3 is the proteic nucleotide sequence of coding Ror1.

SEQ ID NO:4 is the aminoacid sequence that Ror1 albumen is inferred.

SEQ ID NO:5 is the proteic nucleotide sequence of coding Ror2.

SEQ ID NO:6 is the aminoacid sequence that Ror2 albumen is inferred.

SEQ ID NO:7 is the proteic nucleotide sequence of coding Ror1-flag.

SEQ ID NO:8 is the aminoacid sequence that Ror1-flag albumen is inferred.

SEQ ID NO:9 is the proteic nucleotide sequence of coding Ror2-flag.

SEQ ID NO:10 is the aminoacid sequence that Ror2-flag albumen is inferred.

SEQ ID NO:11 is the proteic nucleotide sequence of coding Ror2 Δ C-flag.

SEQ ID NO:12 is the aminoacid sequence that Ror2 Δ C-flag albumen is inferred.

SEQ ID NO:13 is the nucleotide sequence that is used to make up the last strand primer of Ror1-flag.

SEQ ID NO:14 is the nucleotide sequence that is used to make up the following strand primer of Ror1-flag.

SEQ ID NO:15 is the nucleotide sequence that is used to make up strand primer on article one of Ror2-flag.

SEQ ID NO:16 is the nucleotide sequence that is used to make up strand primer under article one of Ror2-flag.

SEQ ID NO:17 is the nucleotide sequence that is used to make up strand primer on the second of Ror2-flag.

SEQ ID NO:18 is the nucleotide sequence that is used to make up strand primer under the second of Ror2-flag.

SEQ ID NO:19 is the 3rd nucleotide sequence of going up strand primer that is used to make up Ror2-flag.

SEQ ID NO:20 is the nucleotide sequence that is used to make up the 3rd the following strand primer of Ror2-flag.

SEQ ID NO:21 is the nucleotide sequence that is used to make up the last strand primer of Ror2KD-flag.

SEQ ID NO:22 is the nucleotide sequence that is used to make up the following strand primer of Ror2KD-flag.

SEQ ID NO:23 is the nucleotide sequence that is used to make up the last strand primer of Ror2 Δ C-flag.

SEQ ID NO:24 is the nucleotide sequence that is used to make up the following strand primer of Ror2 Δ C-flag.

SEQ ID NO:25 is the nucleotide sequence (2993-3013) of the forward primer of identifier Ror1.

SEQ ID NO:26 is the nucleotide sequence (3049-3074) of the reverse primer of identifier Ror1.

SEQ ID NO:27 is the nucleotide sequence (3018-3044) of the probe of identifier Ror1.

SEQ ID NO:28 is the nucleotide sequence (1149-1169) of the forward primer of identifier Ror2.

SEQ ID NO:29 is the nucleotide sequence (1239-1259) of the reverse primer of identifier Ror2.

SEQ) D NO:30 is the nucleotide sequence (1174-1198) of the probe of identifier Ror2.

SEQ ID NO:31 is a nucleotide sequence (2350-2370) of identifying the forward primer of mouse Ror1.

SEQ ID NO:32 is a nucleotide sequence (2402-2421) of identifying the reverse primer of mouse Ror1.

SEQ ID NO:33 is a nucleotide sequence (2372-2395) of identifying the probe of mouse Ror1.

SEQ ID NO:34 is a nucleotide sequence (364-386) of identifying the forward primer of mouse Ror2.

SEQ ID NO:35 is a nucleotide sequence (429-448) of identifying the reverse primer of mouse Ror2.

SEQ ID NO:36 is a nucleotide sequence (400-424) of identifying the probe of mouse Ror2.

SEQ ID NO:37 is a nucleotide sequence (1354-1373) of identifying the forward primer of mouse alkaline phosphatase.

SEQ ID NO:38 is a nucleotide sequence (1445-1464) of identifying the reverse primer of mouse alkaline phosphatase.

SEQ ID NO:39 is a nucleotide sequence (1416-1442) of identifying the probe of mouse alkaline phosphatase.

SEQ ID NO:40 is a nucleotide sequence (78-96) of identifying the forward primer of mouse Bone Gla protein.

SEQ ID NO:41 is a nucleotide sequence (124-145) of identifying the reverse primer of mouse Bone Gla protein.

SEQ ID NO:42 is a nucleotide sequence (98-121) of identifying the probe of mouse Bone Gla protein.

SEQ ID NO:43 is the nucleotide sequence (2000 to+1) of 5 ' non-translational region of people Ror1 gene.

SEQ ID NO:44 is the nucleotide sequence (2000 to+1) of 5 ' non-translational region of people Ror2 gene.

SEQ ID NO:45 is the 5 ' nucleotide sequence of the last strand primer of (1-782) partly that is used to make up Notch2IC.

SEQ ID NO:46 is the 5 ' nucleotide sequence of the following strand primer of (1-782) partly that is used to make up Notch2IC.

SEQ ID NO:47 is the 3 ' nucleotide sequence of the last strand primer of (783-2307) partly that is used to make up Notch2IC.

SEQ ID NO:48 is the 3 ' nucleotide sequence of the following strand primer of (783-2307) partly that is used to make up Notch2IC.

Detailed Description Of The Invention

The applicant finds significantly to reduce in the expression of human osteoblast cell's gene of encoding human receptor tyrosine kinase sample orphan receptor (orphan receptor) 1 and 2 (Ror1 and Ror2) between the idiophase. The applicant also provides Ror2 expression and secretion type frizzled related protein 1 (secreted frizzled-related protein 1, the evidence that expression SFRP-1) oppositely is correlated with. Reported that SFRP-1 is a kind of potential osteoporosis target, it is the apoptosis of stimulating osteoblast (WO 01/19855) in vitro and in vivo.

And the applicant finds that in Gegenbaur's cell Ror1 and Ror2 regulate the Wnt signal pathway, the osteoblastic survival of described approach regulation and control bone formative. In one embodiment, Ror2 kinase inhibition Wnt-3 but to strengthen Wnt-1 active. In addition, Ror2 in conjunction with Wnt-1 and Wnt-3 albumen the two. In another embodiment, the cytoplasmic structure territory of Ror2 is that the heart needs for the enhancing of Wnt-1, but also nonessential for the inhibition of Wnt-3 activity. In another embodiment, Ror1 kinase inhibition Wnt-3 does not still affect the activity of Wnt-1.

Several Ror2 binding partners have also been identified.

The invention provides a kind of expression cassette of the Ror of comprising polypeptide, but under the control of its operation start in osteocyte. The present invention further provides and regulate the composition that bone photo closes activity, it comprises Ror molecule or its homologue or derivative or fragment or variant or the mutant of effective dose.

The invention provides a kind of method of screening reagent, described method comprises: (a) with a kind of reagent and Ror molecular combinations; (b) detect described reagent to the effect of Ror activity; The reduction or the raising that wherein detect the Ror activity are that reagent is the indication that bone photo closes reagent.

And, the invention provides a kind of the screening and regulate Ror in conjunction with a kind of method of reagent of binding partners, described method comprises: (a) Ror is contacted with the Ror binding partners in the situation that a kind of reagent exists; (b) in the situation that contrast exists or described reagent lacks, Ror is contacted with a kind of Ror binding partners; (c) by the combination of Ror described in the step (a) and binding partners and the combination of Ror described in the step (b) and binding partners being compared to select to regulate the reagent of Ror molecule.

Described method can also comprise a kind of method of screening reagent, and described method comprises: (a) that a kind of reagent is combined with the isolated cell that comprises the Ror promoter sequence, described promoter sequence functionally is connected on the reporter gene; (b) detect described reagent to the impact of Ror activity; Reduction or the raising of the Ror activity of wherein being measured by reporter gene are that reagent is the indication that bone photo closes reagent.

The invention provides a kind of form with pharmaceutical composition and use a kind of reagent with the method for the treatment of bone photo related disorders to the experimenter, described reagent is accredited as regulates Ror expression or active. And, the invention provides to the experimenter and use a kind of method that is accredited as the reagent of regulating the Ror expression, described experimenter is diagnosed with disease or the illness that is associated with the Wnt signal pathway. The reagent that the present invention further provides effective dose closes purposes in the activity at the preparation composition in order to regulate bone photo in the treatment of bone photo related disorders, and described reagent is regulated expression or the activity of target Ror molecule. Preferably identify described reagent by screening technique provided herein.

Expression or active reagent for the preparation of the adjusting target Ror molecule of composition can be selected from antibody, little molecule, peptide, oligopeptides and polypeptide.

Used reagent preferably comprises a kind of antisensenucleic acids to the Ror gene specific or siRNA molecule according to the present invention, the nucleic acid of wherein said antisensenucleic acids or siRNA molecular recognition and one or more Ror polypeptide of combination coding, its homologue, derivative, fragment, variant or mutant.

The expression or the active reagent that are used in another embodiment adjusting Ror molecule according to the present invention can be in conjunction with the Ror binding partners.

When being Ror2, target Ror molecule can be selected from the ADP/ATP carrier protein for the preparation of the reagent according to composition of the present invention; UDPG Ceramide glucosyltransferase sample 1; 14-3-3 albumen beta/alpha; 14-3-3 albumen γ; ribophorin 1; arginine N-transmethylase 1, cellular apoptosis susceptibility protein, NOTCH2 albumen and Human Skeletal Muscle LIM-albumen 3.

The present invention further provides and regulate the method that bone photo closes active composition a kind of the preparation, wherein said method comprises:

(i) by a kind of reagent and Ror molecule is combined and detect described reagent and identify that for the impact of Ror activity bone photo closes reagent,

(ii) bone photo of identifying in step (i) pass reagent and the pharmaceutically useful carrier of effective dose is combined to form described composition.

The present invention also provides other purposes of Ror molecule, as identify that the adjusting bone forms and/or the reagent of Wnt signal (signaling), identify the gene or the protein that participate in bone formation and/or Wnt signal, diagnostic purposes, medicine target as medicine, the effectiveness of assessment medicine, and produce host cell and transgenic animals.

The invention provides a kind of Ror2 of utilization and serve as a mark and identify the method for proliferative human preosteoblast, be included in the expression that detects the Ror2 gene among the human osteoblast cell, the Ror2 that wherein improves expresses cell is accredited as the proliferative preosteoblast.

The invention provides a kind of Ror2 of utilization serves as a mark and identifies that mouse bone-forming cell is in the matrix method in (matrix) maturity period, be included in the expression of measuring the Ror2 gene in the mouse bone-forming cell, the Ror2 that wherein improves expresses cell is accredited as the Gegenbaur's cell that is in the matrix maturity period.

In addition, the invention provides a kind of method of the Ror2 of mensuration kinase activity, comprise that (a) obtains the Ror2 polypeptide; (b) exist³²There is tense marker Ror2 polypeptide in P γ ATP; (c) mix by mensuration³²The quantitative determination Ror2 kinase activity of P, wherein³²The amount indication Ror2 kinase activity of P.

The definition of abbreviation and term:

In order to fully understand term and the abbreviation that is used for this specification sheets, provide following definition.

As used in this paper and the claims, singulative " a ", " an " and " the " comprise the meaning of plural number, unless context has clearly different explanations.Thereby for example, the literary style of " a hostcell " comprises multiple such host cell, and the literary style of " an antibody " refers to one or more antibody and its equivalent well known by persons skilled in the art, or the like.

Abbreviation in the specification sheets is following corresponding to unit of measure, technology, performance or compound: " g " means gram (s), " mg " means milligram (s), " ng " means nanogram (s), and " kDa " means kilodalton (s), " ℃ " mean degree centigrade (s), " cm " means centimetre (s), " s " means second (s), and " min " means minute (s), and " h " means hour (s), " l " means liter (s), " ml " means milliliter (s), and " μ l " means microlitre (s), and " pl " means skin liter (s), " M " means volumetric molar concentration, " mM " means millimolar concentration, and " mmole " means mmole (s), and " kb " means kilobase (s), " bp " means base pair (s), and " RT " means room temperature.

" Dulbecco ' s-modified Eagle substratum " is abbreviated as DMEM.

" high performance liquid chromatography " is abbreviated as HPLC.

" high flux screening " is abbreviated as HTS.

" open reading frame " is abbreviated as ORF.

" mass spectroscopy " is abbreviated as MS.

" tandem mass spectrum analysis " is abbreviated as MS/MS.

" polyacrylamide gel electrophoresis " is abbreviated as PAGE.

" polymerase chain reaction " is abbreviated as PCR.

" ThermoScript II polymerase chain reaction " is abbreviated as RT-PCR.

" sodium laurylsulfonate " is abbreviated as SDS.

" sodium dodecyl sulfate-polyacrylamide gel electrophoresis " is abbreviated as SDS-PAGE.

" people's skeletal muscle LIM-albumen 3 " is abbreviated as (SLIM 3).

" adenine nucleotide shifted divisor 2 " is abbreviated as the ADP/ATP carrier proteins.

" bone mineral density " is abbreviated as BMD.

" ribosome-RNA(rRNA) " is abbreviated as rRNA ".

" non-translational region " is abbreviated as UTR.

" T cytokine " is abbreviated as TCF.

" dithiothreitol (DTT) " is abbreviated as DTT.

In the context in this manual, will adopt multiple term.As used herein, term Ror refers to the family of receptor tyrosine kinase sample orphan receptor (orphan receptors)." Ror molecule " refers to the Ror polypeptide, Ror peptide, its fragment, varient and mutant, and the nucleic acid of coding Ror polypeptide, Ror peptide and fragment or varient or mutant." Ror molecule " also refers to Ror polynucleotide, gene and varient thereof and mutant." Ror molecule " and " Ror " refer to Ror1 and Ror2 molecule the two.

" target Ror molecule " refers to the Ror molecule that its activity is regulated by reagent of the present invention.Described target Ror molecule can be the Ror polypeptide, its homologue, derivative or fragment or varient or mutant.Target Ror molecule can also be nucleic acid (oligonucleotide of RNA or DNA or polynucleotide).For example, if the gene transcription thing is the target of experiment, then target Ror molecule will be a transcript.Be to be understood that term target Ror molecule refers to full-length molecule and fragment, varient and mutant, glairy epi-position.Target Ror molecule both can be that the Ror1 molecule also can be Ror2 molecule or the two.

Term " Wnt " refers to conservative, that be rich in halfcystine, secretor type a glycoprotein family that relates to the early embryonic development importance.The Wnt gene also relates to cancer." Wnt " specifically comprises the Wnt gene of whole people and non-human animal's species as used herein, includes but not limited to Mammals, as people, mouse, rat and other rodent etc.Term " Wnt " comprises natural people Wnt gene and encoded polypeptides, comprises people Wnt-1 (in the past being called int-1) (vanOoyen etc., EMBO J, 4,2905-9, (1985)), Wnt-3 (Roelink etc., Genomics, 17,790-792, (1993); Huguet etc., Cancer Res., 54,2615-2521, (1994)), and varient, particularly variant amino acid sequence body.

" Wnt signal pathway " refers to any by such as Wnt-1, Wnt-2, the approach that Wnt albumen such as Wnt-3 are regulated.

" the Wnt signal pathway of standard " refers to the activation undertaken by the proteic Wnt albumen of Disheveled, and it then suppresses to come the white glycogen synthase kinase-3 of autophosphorylation beta-catenin.The phosphorylation beta-catenin is degraded rapidly in vain after the ubiquitinization.But, unphosphorylated beta-catenin gathers in vain and is displaced in the nuclear, and it works as the cofactor of T cytokine transcriptional activation agent mixture there.

Term " secreted frizzled related protein " or " SFRP " relate to the secreted receptor of Wnt signal pathway.

The phosphoric acid ester form of term " nucleic acid molecule " ribonucleotide (RNA molecule) or deoxyribonucleotide (dna molecular), or any phosphodiester analogue that exists with single stranded form or double-stranded spiral.Double-stranded DNA-DNA, DNA-RNA and RNA-RNA spiral are possible.Term nucleic acid molecule, particularly DNA or RNA molecule refer to the firsts and seconds structure of molecule, and it are not limited to any specific three grades of forms.Thereby this term comprises double-stranded DNA, particularly the double-stranded DNA of finding in linear (for example, restriction fragment) or ring-shaped DNA molecule, plasmid and karyomit(e) etc.In the structure of specific double chain DNA molecule is discussed, can sequence be described according to the sequence that normal convention only provides on DNA non-transcribed chain (that is, have with mRNA homologous sequence chain) 5 '-3 ' direction.

" recombinant nucleic acid molecules " is the nucleic acid molecule that had carried out the molecule biological processes, that is, and and the nucleic acid molecule that non-natural takes place.In addition, term " recombinant DNA molecules " refers to a kind of nucleotide sequence, and it and non-natural take place, and perhaps can make by the artificial combination of two original isolating sequence fragments, that is, link together by the dna fragmentation with discontinuity under the normal circumstances." recombinant production " means usually by chemical synthesis process, or the artificial combination that realizes by the manual handling of separating acid fragment, for example, by gene engineering and the similar recombinant technology that utilizes Restriction Enzyme, ligase enzyme, for example, by Sambrook etc., MolecularCloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; (1989), or Ausubel etc., Current Protocols in Molecular Biology, Current Protocols (1989), with DNA Cloning:A Practical Approach, volume I and 11 (D.N.Glover edits) IREL Press, Oxford, the technology that (1985) are introduced.

Redundant code identical with coding usually or conserved amino acid substitutes a kind of codon, generally introduces or remove simultaneously a recognition sequence site.Perhaps, the nucleic acid fragment of required function can be linked together to produce single hereditary entity, it is included in the required combination of the function that does not have discovery in the common natural form.The Restriction Enzyme recognition site is the target of this class manual handling normally, but other locus specificity target, for example, promotor, dna replication dna site, regulating and controlling sequence, control sequence or other useful feature can be incorporated into by design.The example of recombinant nucleic acid molecules comprises recombinant vectors, as comprises the clone or the expression vector of the dna sequence dna of coding phl gene protein, and this dna sequence dna is in 5 '-3 ' (justice is arranged) direction or is in 3 '-5 ' (antisense) directions.

Term " polynucleotide ", " nucleotide sequence ", " nucleic acid ", " nucleic acid molecule ", " nucleotide sequence ", " oligonucleotide " refer to a series of nucleotide base among DNA and the RNA (also claiming " Nucleotide "), and mean the chain of any two or more Nucleotide.Described polynucleotide can be strand or double-stranded mosaic mixture or derivatives thereof or modification body.Can on base portion, sugar moieties or phosphoric acid skeleton, modify, so that for example improve stability, its hybridization parameter etc. of molecule oligonucleotide.Antisense oligonucleotide can comprise the base portion of modification, and it is selected from the group that comprises following member:

5 FU 5 fluorouracil, 5-bromouracil, the 5-chlorouracil, the 5-iodouracil, xanthoglobulin, xanthine, the 4-acetylcytosine, 5-(carboxyl hydroxymethyl) uridylic, 5-carboxyl methylamino methyl-2-thiouridine, 5-carboxyl methylamino 6-Methyl Uracil, dihydrouracil, beta-D-galactosyl queosine, inosine, the N6-isopentenyl gland purine, the 1-methyl guanine, the 1-methylinosine, 2, the 2-dimethylguanine, the 2-methyladenine, the 2-methyl guanine, the 3-methylcystein, 5-methylcytosine, the N6-VITAMIN B4, the 7-methyl guanine, 5-methylamino 6-Methyl Uracil, 5-methoxyl group amino methyl-2-thiouracil, β-D-mannose group queosine, 5 '-methoxyl group carboxyl 6-Methyl Uracil, the 5-methoxyuracil, 2-methylthio group n6-isopentenyl gland purine, wybutoxosine, pseudouracil, queosine, 2-sulphur cytosine(Cyt), 5-methyl-2-thiouracil, the 2-thiouracil, the 4-thiouracil, methyl uracil, uridylic-5-fluoroacetic acid methyl esters, uridylic-5-fluoroacetic acid, 5-methyl-2-deracil, 3-(3-amino-3-N-2-carboxyl propyl group) uridylic, and 2,6-diaminopurine.Nucleotide sequence generally carries genetic information, comprises by the cell mechanism utilization to make the information of protein and enzyme.These terms comprise two strands-or strand genome and cDNA, RNA, and the polynucleotide of any synthetic and genetic manipulation, and justice and antisense polynucleotides are arranged.This comprises strand and duplex molecule, that is, DNA-DNA, DNA-RNA and RNA-RNA hybrid, and by " protein nucleic acid " that the base conjugation is formed to the amino acid backbone (PNA).This also comprises the nucleic acid that comprises modified base, for example, and sulfo-uridylic, thioguanine and Fluracil, or comprise the nucleic acid of carbohydrate or lipid.

Polynucleotide of the present invention can be synthetic by standard method known in the art, for example, and by using automatic dna synthesizer (as can be from Biosearch, Applied Biosystems waits those that are purchased).As an example, phosphorothioate oligonucleotide can be by Stein etc., Nucl.Acids Res., 16,3209, the method for (1988) is synthetic, the methyl phosphorodithioate oligonucleotide can utilize controlled micropore glass polymkeric substance upholder preparation (Sarin etc., Proc.Natl.Acad.Sci.U.S.A.85,7448-7451, (1988) etc.Having developed several different methods is delivered to antisense DNA or RNA in the cell, for example, antisense molecule can be injected directly in the tissue site, or can use the improved antisense molecule (be connected in the antisense molecule on peptide or the antibody, be combined in to described peptide or antibodies specific the acceptor or the antigen of expressing on the target cell surface) that design comes target expectation cell systemicly.Transcribe in the external and body of dna sequence dna that perhaps, can be by encoding antisense RNA molecule and prepare the RNA molecule.These dna sequence dnas can be integrated into widely in the carrier, described vector integration suitable R NA polymerase promoter, as T7 or SP6 polymerase promoter.Perhaps, depend on used promotor, the Antisense cDNA construct of composition or inducibility synthesize antisense rna can be stabilized in the ground transfered cell system.But, be difficult to obtain to be enough to suppress the antisense molecule IC of endogenous mRNAs translation usually.So preferable methods is utilized a kind of DNA construct of reorganization, wherein antisense oligonucleotide is placed under the control of strong promoter.Use the target cell among this construct transfection experimenter will cause transcribing of capacity single stranded RNA s, it will form the translation that also stops target gene mRNA with endogenous target gene transcript complementary base pair thus.For example, thus a kind of carrier can be imported and in the body it is absorbed to and guide transcribing of sense-rna by cell.This carrier can keep free or be colored body integrating, as long as it can be transcribed to produce required sense-rna.This carrier can make up by the recombinant DNA technology of this area standard.Carrier can be plasmid known in the art, virus or other, is used for duplicating and expressing at mammalian cell.The expression of the sequence of encoding antisense RNA can be by known in the art at mammals, and any promotor that acts in preferred people's cell is carried out.These promotors can be derivable or compositions.These promotors include but not limited to: SV40 early promoter district (Bernoist and Chambon, Nature, 290,304-310, (1981), be included in the long promotor in terminal repetition of Rous sarcoma virus 3 ', Yamamoto etc., Cell, 22,787-797, (1980), bleb thymidine kinase promotor, Wagner etc., Proc.Natl.Acad.Sci.U.S.A.78,1441-1445, (1981), the regulating and controlling sequence of metallothionein gene etc., Brinster etc., Nature 296,39-42, (1982).The plasmid of any kind, clay, yeast artificial chromosome or virus vector may be used to prepare the recombinant DNA construction body that can directly introduce in the tissue site.Perhaps, can use selectivity to infect the virus vector of expectation tissue, wherein finish administration (for example, general ground) by another kind of approach.

Ribozyme is to have the RNA molecule of shearing the ability of other single stranded RNA with the mode specificity similar to the DNA restriction enzyme.By modifying the nucleotide sequence of these RNAs of coding, might be structured in the RNA molecule identification specificity nucleotide sequence and shear its molecule, Cech, J.Amer.Med.Assn., 260,3030, (1988).The principal benefits of this method is the mRNAs that a deactivation has particular sequence, because they are sequence-specific.

The both sides of described polynucleotide natural regulation and control (the express control) sequence that can distribute, or can be associated with heterologous sequence, comprise promotor, internal ribosome entry site (IRES) and other ribosome bind site sequence, enhanser, response element, inhibition, signal sequence, polyadenylic acid sequence, intron, 5 '-and 3 '-non-coding region or the like.Can also modify nucleic acid by several different methods known in the art.The non-limitative example of this modification comprise methylate, " cap ", replace the Nucleotide of one or more natural generations with analogue, and the modification between Nucleotide as, for example, (for example has modification that neutral connects, methyl phosphorodithioate, phosphotriester, phosphoramidate, carbamate etc.) with have the electrically charged modification that is connected (for example, thiophosphatephosphorothioate, phosphorodithioate etc.).Polynucleotide can comprise one or more extra covalently bound parts, as, for example, protein (for example, nuclease, toxin, antibody, signal peptide, poly-L-Lysine etc.), intercalator (for example, acridine, psoralene or the like), sequestrant is (for example, metal, radioactive metal, iron, oxidisability metal or the like), and alkylating agent.Can carry out derivatize to polynucleotide by the formation of methyl or ethyl phosphonic acid three esters or the connection of alkylamino phosphoric acid ester.In addition, can also modify the polynucleotide of this paper with a kind of mark of detectable signal that can directly or indirectly provide.Exemplary mark comprises radio isotope, fluorescence molecule, vitamin H etc.

" rna transcription thing " refers to the product that formed by transcribing of the catalytic dna sequence dna of RNA polymerase.When the rna transcription thing was the complementary copy of dna sequence dna, it was called primary transcript, and perhaps it can be to be derived from primary transcript to transcribe the RNA sequence of post-treatment and be called mature rna." messenger RNA(mRNA) (mRNA) " refers to not have intron also can be translated into the RNA of polypeptide by cell." cRNA " refers to the complementary RNA that transcribed by the recombinant cDNA template." cDNA " refers to complementary and be derived from the DNA of mRNA template with the mRNA template.CDNA can be maybe can utilizing of strand, and for example, the Klenow fragment of dna polymerase i changes double chain form into.

With the sequence of the part " complementation " of RNA, can hybridize with RNA thereby refer to have sufficient complementarity, form stable double-helical sequence; For double-stranded antisense nucleic acid, the strand of double-stranded DNA thereby can test maybe can be analyzed triplet and form.The hybridization ability depends on the complementary degree and the length of antisense nucleic acid.Usually, the nucleic acid of hybridization is long more, and it just can comprise many more and RNA mismatched bases and still form stable duplex (or triplet, depend on the circumstances).By utilizing standard method to measure the melting point of hybridization complex, those skilled in the art can determine the permission of mispairing.

" antisense " copy of specific polynucleotide refers to and can form the complementary sequence that therefore hydrogen bond also can regulate the expression of polynucleotide with polynucleotide.These are DNA, and RNA or its analogue comprise having the analogue that changes skeleton as mentioned above.Antisense copy bonded polynucleotide can be single stranded form also can be double chain form.The dna sequence dna that is connected in promotor with " antisense orientation " can be connected on this promotor, thus the coding mRNA complementary RNA molecule of generation and target gene.

Antisense polynucleotides can comprise the sugar moieties of at least a modification, and it is selected from pectinose, 2-fluoro-pectinose, xylulose and hexose.In one embodiment, antisense oligonucleotide can comprise the phosphoric acid ester skeleton of at least a modification, it is selected from sulfo-phosphide, phosphorodithioate, phosphorylated amino dithioesters, phosphoramidate, phosphordiamidate, methyl phosphorodithioate, alkyl phosphate, and first and second acetals (formacetal) or analogue.

Term " has justice " and refers to and the unidirectional nucleotide sequence of coding property mRNA nucleotide sequence.The dna sequence dna that is connected in promotor with " sense orientation " is connected, thereby transcribes a kind of RNA molecule, and this RNA molecule comprises the sequence identical with mRNA.But, the RNA molecule of generation does not need to be transcribed into functional protein.

Chain and " antisense " chain refer to complementary strand polynucleotide each other " justice to be arranged " when being used for same linguistic context.They can be the relative chains of double-stranded polynucleotide, or a chain can be predicted by another according to the base pairing rules of generally acknowledging.Unless otherwise or hint, specifying one or another chain is that " justice is arranged " or " antisense " is arbitrarily.

Term " nucleic acid ", " nucleotide sequence ", " nucleic acid molecule ", " nucleic acid fragment " or " polynucleotide " can exchange mutually with " gene ", " by the mRNA of genes encoding " and " cDNA " and use.

Term " polynucleotide of coded polypeptide " comprises polynucleotide that include only encoding sequence and the polynucleotide that can comprise extra coding or non-coding sequence.

When the single stranded form of nucleic acid can be annealed on other nucleic acid molecule under the condition of suitable temperature and solution ion strength, described nucleic acid molecule " can be hybridized " to another kind of nucleic acid molecule, as cDNA, genomic dna or RNA, Sambrook, J. wait editor, MolecularCloning:A Laboratory Manual (2d Ed.1989) Cold Spring HarborLaboratory Press, NY.Vols.1-3 (ISBN 0-87969-309-6).The conditional decision of temperature and ionic strength hybridization " strict degree ".For the preliminary screening of homology nucleic acid, can use corresponding to 55 ℃ of T _mLow strict degree hybridization conditions, for example, 5x SSC, 0.1%SDS, 0.25% milk, no methane amide; Or 30% methane amide, 5x SSC, 0.5%SDS.Medium strict degree hybridization conditions is corresponding to higher T _m, for example, 40% methane amide, 5x or 6x SSC.High strict degree hybridization conditions is corresponding to the highest T _m, for example, 50% methane amide, 5x or 6x SSC.Hybridization requires two nucleic acid to comprise complementary sequence, although according to the strict degree of hybridizing, the mispairing between the base is possible.The strict degree that is fit to for hybrid nucleic acid depends on the length and the complementary degree of nucleic acid, and its variation is well known in the art.Similarity between two nucleotide sequences or homology degree are big more, then have the T of crossbred of the nucleic acid of these sequences _mValue is just big more.The relative stability of nucleic acid hybridization is (corresponding to higher T _m) reduce with following order: RNA:RNA, DNA:RNA, DNA:DNA.For the crossbred of length, derived and calculated T greater than 100 Nucleotide _mEquation, editors such as Sambrook, Molecular Cloning:ALaboratory Manual (2d Ed.1989) Cold Spring Harbor LaboratoryPress, NY.Vols.1-3. (ISBN 0-87969-309-6), 9.50-9.51).For shorter nucleic acid, promptly, the hybridization of oligonucleotide, the position of mispairing becomes more important, and the length of oligonucleotide determines its specificity, editors such as Sambrook, Molecular Cloning:ALaboratory Manual (2d Ed.1989) Cold Spring Harbor LaboratoryPress, NY.Vols.1-3. (ISBN 0-87969-309-6,11.7-11.8).

Term " complementary " is used to describe the relation between can the nucleotide base of phase mutual cross.For example, for DNA, VITAMIN B4 is complementary to thymus pyrimidine and cytosine(Cyt) is complementary to guanine.

As known in the art, " identity " or " similarity " is as determined by comparative sequences, the relation between two or more peptide sequences or the two or more polynucleotide sequence.In the art, depend on the circumstances, as determined by the coupling between these sequence chains, identity also means the sequence degree of correlation between polypeptide or the polynucleotide sequence.Identity and similarity can be calculated easily by known method, as at ComputationalMolecular Biology, and Lesk, A.M. edits, Oxford University Press, NewYork, 1988; Biocomputing:Informatics and Genome Projects, Smith, D.W. edits, Academic Press, New York, 1993; Sequence Analysis inMolecular Biology, von Heinje, G., Academic Press, 1987; ComputerAnalysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G. edits, Humana Press, New Jersey, 1994; And Sequence AnalysisPrimer, Gribskov, M.and Devereux, J. edits, M Stockton Press, NewYork, the method for being introduced in 1991.The method that generally is used to measure identity between the sequence or similarity includes but not limited at .Carillo H., and Lipman, D., SIAM J AppliedMath., disclosed method among the 48:1073 (1988).The method of identity and similarity of measuring is compiled in the obtainable computer program of the public.Be used for preferably determining that the identity between two sequences and the computer program means of similarity include but not limited to GCG routine package, Devereux, J., etc., Nucleic Acids Research, 12 (1), 387 (1984)), BLASTP, BLASTN, with FASTA Atschul, S.F. etc., J Molec.Biol., 215,403 (1990)).

" homologous " refers to the degree of sequence similarity between two kinds of polymkeric substance (that is, peptide molecule or nucleic acid molecule).The mentioned percent homology numeral of this paper has reflected the homology of maximum possible between two kinds of polymkeric substance, that is, thus per-cent homology when two kinds of polymkeric substance are compared coupling (homologous) position with maximum number in some way.

Term " per-cent homology " refers to the degree of amino acid sequence identity between the polypeptide.Homology between any two polypeptide is the direct function of the amino acid whose sum of coupling on the position given in two sequences, for example, if half of amino acid sum is identical then these two sequences show 50% homology in two sequences.

When for polypeptide of the present invention (for example SEQ ID NOs:4,6,8,10 and 12), term " fragment ", " analogue " refer to keep biological function identical with this peptide species or active polypeptide basically with " derivative ".Thereby analogue comprises precursor protein, and it can obtain by the part of shearing precursor protein activating to produce activated mature polypeptide.Polypeptide of the present invention (SEQ ID NOs:4 for example, 6,8,10 and 12) fragment, analogue or derivative can be a kind of like this molecules, wherein one or more amino acid are with conservative or nonconservative amino-acid residue replaces and this amino-acid residue can be or can not be the residue of genetic codon coding, perhaps wherein one or more amino-acid residues comprise substituting group, perhaps wherein polypeptide with merge such as the compound of polyoxyethylene glycol to improve the half life of polypeptide, perhaps wherein extra amino acid is blended on the polypeptide or the sequence such as the polyhistidine mark such as signal peptide, described polyhistidine mark is used for purified polypeptide or precursor protein matter.These fragments, analogue or derivative are within the scope of the present invention.

" guarding " residue of polynucleotide sequence is those residues in the constant appearance of same position of the two or more correlated serieses that are compared.Bao Shou residue is a conservative residue in the more relevant sequence of other place occurs in than sequence residue relatively.

Related polynucleotides is polynucleotide of sharing the identical residue of remarkable ratio.

As want a polynucleotide ultimate source from the then different polynucleotide of another words " correspondence " each other.For example, messenger RNA(mRNA) is transcribed gene certainly corresponding to it.Corresponding its RNA that is originated from of cDNA, as by reverse transcription reaction, or the chemosynthesis by the DNA that carries out based on the knowledge of RNA sequence.CDNA is the gene of corresponding coding RNA also.If they exercise similar function, polynucleotide are " correspondence " also each other, as the relevant polypeptide of coding in the different plant species that is compared, strain or varient.

" analogue " of DNA, RNA or polynucleotide refers to go up the molecule similar to the polynucleotide of natural generation in form and/or function (for example carrying out the ability that the sequence-specific hydrogen bond is engaged in the base pair on the complementary polynucleotide sequence); but it for example has the skeleton of unusual or non-natural base or variation, is different from DNA or RNA in this respect.Referring to, for example, Uhlmann etal., Chemical Reviews 90,543-584, (1990).

" encoding sequence " or " coding " expression product, as the sequence of RNA, polypeptide, protein or enzyme be when expressing, produce as described in the nucleotide sequence of RNA, polypeptide, protein or enzyme, that is the nucleotide sequence of the aminoacid sequence of coding said polypeptide, protein or enzyme.

" codon degeneracy " refers to the difference of genetic code, and it allows the variation of polynucleotide sequence and can not influence the aminoacid sequence of coded polypeptide.Those skilled in the art fully realize " codon preference " that particular host cell shows, and it utilizes the Nucleotide codon to specify given amino acid.So, when in a kind of host cell, synthesizing a kind of gene, wish the described gene of design, thereby make the frequency of its codon usage frequency near the preferred codon use of host cell with the raising expression.

" essential part (the substantial portion) " of amino acid or nucleotide sequence is the part that comprises the nucleotide sequence of enough amino acid sequence of polypeptide or gene, so that this polypeptide of property evaluation putatively or gene, both can assess by those skilled in the art's artificial sequence, also can be by utilizing algorithm such as BLAST (Basic Local Alignment Search Tool; Altschul, S.F., etc., J.Mol.Biol.215,403-410, (1993); Also see www.ncbi.nlm.nih.gov/BLAST) the computer automatic sequence of carrying out is relatively and identify.

Therefore, " essential part " of nucleotide sequence comprises enough sequences so that specificity evaluation and/or separation comprise the nucleic acid fragment of this sequence.Having the technician that this paper reports the benefit of sequence can utilize the whole or essential part of open sequence to realize purpose well known by persons skilled in the art now.

" synthetic property gene " can make up piece (building blocks) by oligonucleotide and combine, and described oligonucleotide makes up piece and utilizes method known to those skilled in the art to carry out chemosynthesis.These are made up that pieces connect and annealing to form gene fragment, subsequently with its zymetology combination to make up complete genome.About the sequence of DNA, " chemosynthesis " meaning is about to form Nucleotide and assembles external.Can utilize known method to carry out the manual chemosynthesis of DNA, one of them that perhaps can utilize multiple commercially available machine carried out automatic chemosynthesis.Therefore, based on the optimization of nucleotide sequence, gene can be adapted to the codon preference of optimum genetic expression with the reflection host cell.If coding is used those codons of being partial to host's hobby, those skilled in the art will appreciate that successfully the possibility of genetic expression.Determine that preferred codon can be based on the research to the gene that is derived from host cell, wherein the sequence information of these genes is available.

" gene " refers to express the nucleic acid fragment of specified protein, is included in before the encoding sequence (5 ' non-coding sequence) and the regulating and controlling sequence of (3 ' non-coding sequence) afterwards." natural gene " refers to the gene with himself regulating and controlling sequence found at occurring in nature." mosaic gene " or " chimeric construct body " refers to not be any gene or the construct of natural gene, and comprising not is regulation and control and the encoding sequence of together finding at occurring in nature.Therefore, mosaic gene or chimeric construct body can comprise regulating and controlling sequence and the encoding sequence from different sources, or regulating and controlling sequence and the encoding sequence arranged from identical source but in the different mode of the arrangement mode of being found with occurring in nature." native gene " refers to the natural gene on the natural place in a kind of biological gene group." external source " gene refers to not be the normal gene of finding in host living beings, but by transgenosis it is imported in the host living beings.Foreign gene can comprise natural gene or the mosaic gene that inserts in the non-natural biology." transgenosis " is the gene by method for transformation quiding gene group.

" regulating and controlling sequence " refers to be positioned at the upstream (5 ' non-coding sequence), centre of encoding sequence or the nucleotide sequence of downstream (3 ' non-coding sequence), and its influence is transcribed, RNA processing or stable, or the translation of correlative coding sequence.Regulating and controlling sequence can comprise promotor, translation homing sequence, intron and polyadenylation recognition sequence.

" genetic control sequence " refers to that initial gene transcribes required dna sequence dna and add regulation and control initial generation rate required sequence.Thereby genetic control sequence can be by promotor (general herein transcription factor and polysaccharase assemble), add that all regulating and controlling sequences form, the gene regulating protein binding to the described regulating and controlling sequence to control the speed of these assembling processes on the promotor.For example, be suitable for procaryotic control sequence and can comprise promotor, randomly operon sequence, and ribosome bind site.Eukaryotic cell can utilize promotor, enhanser, and/or polyadenylation signal.

" promotor " refers to control the nucleotide sequence of encoding sequence or functional r NA expression.Usually, encoding sequence is positioned at 3 ' of promoter sequence.Promoter sequence by near-end or more the upstream element of far-end form, after element be commonly referred to enhanser.Therefore, " enhanser " is to stimulate the nucleotide sequence of promoter activity and can is the intrinsic element of promotor or is inserted into to strengthen promotor level or tissue-specific allos element.Promotor can integral body be derived from natural gene, or is made up of the different elements that is derived from the different promoters that nature finds, or even comprises the nucleotide fragments of synthetic property.Those skilled in the art are to be understood that different promotors can instruct gene in different tissues or cellular type, or are in different developmental conditions, or corresponding to the expression under the varying environment condition.

" 3 ' non-coding sequence " refers to be positioned at the nucleotide sequence in encoding sequence downstream, comprises that polyadenylation recognition sequence and other coding can influence the sequence of the adjustment signal of mRNA processing or genetic expression.The feature of polyadenylation signal normally influences polyadenylic acid fragment (tracts) to 3 ' of the mRNA precursor terminal interpolation.

" translation homing sequence " refers at the promoter sequence of gene and the nucleotide sequence between the encoding sequence.The translation homing sequence is present in the abundant finished mRNA of translation initiation sequence upstream.The translation homing sequence can influence primary transcript and be processed as mRNA, the stability of mRNA or translation efficiency.

Term " operability connects " thus referring to that two or more nucleic acid fragments are connected in makes a segmental function be subjected to another influence on the single nucleic acid fragment.For example, it is exactly (, this encoding sequence is transcribed under the control this promotor) who is connected with this encoding sequence operability when promotor can influence the expression of encoding sequence.Encoding sequence can operability be connected on the regulating and controlling sequence on justice or the antisense orientation having." exercisable promotor in osteocyte " refers to by the promotor of the RNA polymerase of this osteocyte identification.

" rna transcription thing " refers to by the catalytic product that forms of transcribing of a kind of RNA polymerase of dna sequence dna.When the rna transcription thing was the complete complementary copy of dna sequence dna, it is called primary transcript (primary transcript) or it can be to be derived from primary transcript to transcribe the RNA sequence of post-treatment and be called mature rna." messenger RNA(mRNA) (mRNA) " refers to not have intron also can translate into the RNA of polypeptide.CDNA " refer to be complementary to and be derived from the double-stranded DNA of mRNA.RNA refers to comprise that therefore mRNA also can be translated into the rna transcription thing of polypeptide by cell " justice "." sense-rna " refers to all or part of complementation of target primary transcript or mRNA and prevents the rna transcription thing (see U.S. Patent number 5,107,065, be incorporated herein by reference at this) of expression of target gene.The complementarity of sense-rna can be any part complementation with specific nucleotide sequence, that is, at 5 ' non-coding area sequence, 3 ' non-coding area sequence, intron, or encoding sequence." functional r NA " refers to have adopted RNA, sense-rna, and ribozyme rna, or other may not translated but the pair cell process has the RNA of effect.

Term " siRNA " or " RNAi " refer to little RNA interfering, and it can cause disturbs and can cause specific gene at cell, for example in the mammalian cell (comprising people's cell) and body, for example post-transcriptional silencing in the mammalian body (comprising the people).RNA interferential phenomenon is at Bass, Nature, 411,428-29, (2001); Elbahir etc., Nature, 411,494-98, (2001); With Fire etc., Nature, 391,806-11 introduces and discusses in (1998), and the method for preparing intervening rna wherein also has been discussed.Can prepare the siRNAs that discloses sequence based on this paper by methods known in the art, comprise and use complementary DNA chain or synthetic method.Exemplary siRNAs can have up to 29bps, 25bps, 22bps, 21bps, 20bps, 15bps, 10bps, 5bps or any close or intermediary integer.

What term " expression " referred to be derived from nucleic acid fragment of the present invention has transcribing and stable gathering of justice (mRNA) or sense-rna.Expression can also refer to mRNA and translates into polypeptide." Antisense Suppression " refers to suppress the generation of the sense-rna transcript that target protein expresses.

" cross express " refers to exceed the generation of the gene product of the generation level in the normal or unconverted biology in biology." inhibition " refers to suppress the expression of external source or native gene or rna transcription thing.

" level of variation " refers to that the gene product that is different from normal or unconverted biology on the amount of being created in of gene product in biology or the ratio produces.Can realize the expression of crossing of polypeptide of the present invention by at first making up a kind of mosaic gene or chimeric construct body, the coding region functionally is connected on the promotor in described mosaic gene or chimeric construct body, and described promotor can instruct the expression of gene or construct in the etap of expectation in desirable tissue.For convenience, mosaic gene or chimeric construct body can comprise promoter sequence and the translation homing sequence that is derived from homologous genes.3 ' non-coding sequence of encoding transcription termination signal can also be provided.Thereby mosaic gene of the present invention or chimeric construct body can also comprise one or more introns promotes genetic expression.Can make up the plasmid vector that comprises mosaic gene of the present invention or chimeric construct body subsequently.The selection of plasmid vector depends on the method that is used for transformed host cell.Those skilled in the art fully understand and must be present on the plasmid vector so that successfully transform, and select and propagation comprises the genetic elements of the host cell of mosaic gene or chimeric construct body.Those skilled in the art will recognize that also different independent transformation events will cause different expression levels and pattern, Jones etc., EMBO J., 4,2411-2418, (1985); De Almeida etc., Mol.Gen.Genetics, 218,78-86, (1989), thereby must screen so that obtain to present required expression level and pattern is (lines) a plurality of incidents.This screening can be by the nucleic acid blot analysis of DNA, the rna blot analysis that mRNA expresses, and the western blotting of protein expression or immunocytochemical assay, or phenotype analytical is finished.

" expression cassette " refers to encode the dna encoding sequence of expression product or the fragment of DNA, and it can be inserted in the carrier in the restriction site of determining.The box restriction site is designed to guarantee that described box inserts in the correct reading frame.Usually, foreign DNA inserts on one or more restriction sites of carrier DNA, carries in the host cell with transferable carrier DNA suppressed by vector subsequently.Dna fragmentation or the sequence of the DNA that has insertion or add as expression vector, can also be called " DNA construct ".

Term " polypeptide " refers to polymer of amino acid, no matter and the length of polymkeric substance how, thereby " peptide ", " oligopeptides " and " protein " are included in the definition of polypeptide and at this paper can exchange use mutually.This term does not also refer in particular to or gets rid of the chemistry of polypeptide of the present invention or express the back and modify, although the chemistry of these polypeptide or to express that the back modification can comprise or get rid of be particular.So, for example, the term polypeptide that is modified to of polypeptide being comprised especially, described modification comprises the covalently bound of glycosyl, ethanoyl, phosphate, fat base etc.In addition, having these modified polypeptides can be appointed as indivedual by the kind that the present invention includes or get rid of.Natural or other chemically modified can betide any position of polypeptide as listed those in the top example, comprises peptide backbone, amino acid side chain and amino or carbonyl end.The modification that is to be understood that same type can exist with identical or different degree on several sites of given polypeptide.In addition, a kind of given polypeptide can contain the modification of numerous species type.Polypeptide can be because of result's branch of ubiquitination, and they can have or not have to be ring-type under the branched situation.Modification comprises acetylize; acylation; the ADP-ribosylation; amidation; riboflavin covalently bound; heme moiety covalently bound; Nucleotide or nucleotide derivative covalently bound; lipid or lipid derivant covalently bound; phosphatidylinositols covalently bound; crosslinked; annularization; disulfide linkage forms; demethylation; the formation of covalent cross-linking; the formation of halfcystine; the formation of Pyrrolidonecarboxylic acid; formylation; γ is carboxylated; glucosidesization; the GPI grappling forms; hydroxylation; iodate; methylate; the Semen Myristicae acidylate; oxidation; pegylation; protein cleavage processing; phosphorylation; isoprenylation; racemization; selenizing; sulfation; on albumen, add amino acid such as arginylization and ubiquitination by what transfer RNA (tRNA) mediated.(referring to, for example, proteins--structure andmolecular properties, second edition, T.E.Creighton, W.H.Freeman andCompany, New York (1993); Posttranslational covalent modificationof proteins, b.c.Johnson, Ed., Academic Press, New York, 1-12 page or leaf, 1983; Seifter etc., Meth Enzymol 182:626-646,1990; Rattan etc., AnnNY Acad Sci 663:48-62,1992).Comprise also that in described definition containing one or more amino acid analogues (comprises, for example, the amino acid that non-natural takes place, the only natural amino acid that betides in the uncorrelated biosystem, from modified amino acid of mammlian system etc.), have the key of replacement and other modified polypeptides known in the art, comprise what natural generation or non-natural took place.Term " polypeptide " can also exchange mutually with term " protein " or " peptide " and use.

Term " peptide " refers to two or more amino acid whose any polymkeric substance, wherein the NH that all passes through at adjacent amino acid of each amino acid ₂And the peptide bond that forms between the COOH group (CONH-) is connected on one or two other the amino acid.Preferably, amino acid is the amino acid of natural generation, particularly the alpha amino acid of L-mirror image form.But, other amino acid, mirror image form and amino acid derivative can be included in the peptide.Peptide comprises " polypeptide ", and it produces plural amino acid after hydrolysis.Polypeptide can comprise protein, and it generally comprises 50 or more amino acid.

Term " varient " refers to the mutation of the nucleic acid or the aminoacid sequence of Ror molecule.Comprise Nucleotide and aminoacid replacement, interpolation or the deletion of Ror molecule in the term " varient ".In addition, also comprise the natural of chemically modified and synthetic Ror molecule in the term " varient ".For example, varient can refer to with reference to the different polypeptide of polypeptide.Usually, be limited at polypeptide different on the aminoacid sequence and with reference to the difference between the polypeptide with the reference polypeptide, be proximate on the whole thereby make the aminoacid sequence of reference and varient, and be identical in some zone.Varient and with reference to amino acid sequence of polypeptide can the one or more replacements of difference, deletion, interpolation, fusion and brachymemma, it can be conservative property or non-conservation and can any combination exist.For example, varient can be insert, replace or deleted with any combination several, for example 50-30,30-20,20-10,10-5,5-3,3-2,2-1 or 1 amino acid whose varient.In addition, varient can be the fragment of polypeptide of the present invention, and it is shorter than canonical sequence, is different from reference to peptide sequence as deleting owing to terminal or centre.The varient of polypeptide of the present invention also comprises and has kept identical biological function with this peptide species or active polypeptide substantially, for example, can activate to produce the precursor protein of active mature polypeptide by shearing precursor portions.These varients can be allelic variations, it is characterized in that the difference of the structure gene nucleotide sequence of coded protein, maybe can comprise difference shearing or posttranslational modification.Varient also comprises having identical biologic activity substantially but available from the associated protein of different plant species.Skilled can produce the varient with single or multiple aminoacid replacement, deletion, interpolation or replacement.These varients can comprise, particularly: (i) wherein one or more amino-acid residues are by the varient of conservative property or non-conservation amino-acid residue (preferred conservative amino acid residue) replacement, the residue that this substituted amino-acid residue can or can not encoded by genetic code, or (ii) wherein one or more amino acid by the varient of from polypeptide or protein, deleting, or (iii) wherein one or more amino acid are added to varient in polypeptide or the protein, or (iv) wherein one or more amino-acid residues comprise the varient of substituted radical, or (the v) varient that merges of mature polypeptide and another kind of compound wherein, described compound as the compound that improves the polypeptide half life (for example, polyoxyethylene glycol), or (vi) wherein extra amino acid is fused to the varient on the mature polypeptide, as guiding or secretion sequence or be used for the purifying mature polypeptide or the sequence of precursor protein matter sequence.The varient of polypeptide can also be the varient of natural generation, and as the allelic variant of natural generation, perhaps it can be the varient of unknown natural generation.All these varients defined above all are regarded as within the scope of this area teaching.

Polypeptide of the present invention or polynucleotide preferably provide with isolating form, and can be purified to homogeneity.

Term " isolating " means material and remove (for example, physical environment is if it is natural generation) from its primary or natural environment.So the polynucleotide or the polypeptide that are present in the natural generation in the animal of life are not isolating, be isolating but interfere the identical polynucleotide or the polypeptide that from natural system, isolate in some or all coexistence material by the mankind.For example, " isolating nucleic acid fragment " is the polymkeric substance of strand or double-stranded RNA or DNA, and it randomly comprises the nucleotide base of synthetic property, non-natural or variation.The isolating nucleic acid fragment that exists with the polymer form of DNA can comprise the fragment of one or more cDNA, genomic dna or the synthetic DNA of giving birth to and in conjunction with sugar, lipid, protein or other material.This polynucleotide can be that the part of carrier and/or this polynucleotide or polypeptide can be the parts of composition, and remain isolating, because examples of such carriers or composition are not its part at the found environment of occurring in nature.Similarly, term " purifying basically " refers to a kind of material, and it has been interfered by the mankind and has separated its direct chemical environment that is taken place from occurring in nature or remove.Can obtain or produce the polypeptide or the nucleic acid of purifying basically by multiple technology well known in the art and method.

Term " purifying " refers to improve the specific activity or the concentration of specific polypeptide in sample.In one embodiment, specific activity is expressed as sample hit the active of polypeptide and whole ratios between the peptide concentrations.In another embodiment, specific activity is expressed as sample the hit concentration of polypeptide and whole ratios between the peptide concentration.Purification process includes but not limited to dialysis known in those skilled in the art, centrifugal and column chromatography technology.See, for example, Young etc., 1997, " Productionof biopharmaceutical proteins in the milk of transgenic dairy animals, " BioPharm 10 (6): 34-38.

Term " pure basically " and " isolating " do not get rid of polynucleotide or polypeptide and at the mixture of the unconnected material of occurring in nature and described polynucleotide or polypeptide.

Term " cell ", " clone " and " cell culture " can exchange use mutually.All these terms also comprise their offspring, and it is any or all of generation subsequently.Be to be understood that since have a mind to or all offsprings that suddenly change unintentionally not necessarily identical.In the context of expressing heterologous nucleic acid, " host cell " (for example refers to protokaryon or eukaryotic cell, bacterial cell such as intestinal bacteria, yeast cell, mammalian cell, birds cell, Amphibians cell, vegetable cell, fish cell and insect cell), can be positioned at external or body.For example, but the host can comprise any inverting biological that can replicating cell, and cell can be arranged in transgenic animal.Host cell can and/or be expressed heterologous nucleic acids by vector encoded as the acceptor of carrier.

For example, Etchevcrry, " Expression of Engineered Proteins inMammalian Cell Culture; " in Protein Engineering:Principles andPractice, Cleland etc. (editor), 163 pages (Wiley-Liss Inc.1996) provides the general approach of expressing and reclaim exogenous protein, and described albumen is produced by the mammal cell line system.For example, Grisshammer etc. " Purification of over-produced proteinsfrom E.coli cells; " in DNA Cloning 2:Expression Systems, 2ndEdition, Glover etc. (editor), 59-92 page or leaf (Oxford University Press 1995) provide and have reclaimed the proteinic standard technique that is produced by bacterial system.Guarino etc., US5162222 and WIPO publication number W094/06463 disclose the conversion and the allogenic polypeptide production therein of insect cell.Richardson (editor), " Baculovirus ExpressionProtocols " (The Humana Press Inc.1995) has also introduced the method for separating recombinant proteins from baculovirus.In one embodiment, polypeptide of the present invention can utilize the baculovirus expression system expression (to see Luckow etc., Bio/Technology, 1988,6,47, " Baculovirus Expression Vectors:a Laboratory Manual ", O ' Rielly etc. (editor), W.H.Freeman and Company, New York, 1992, US4,879,236, all incorporate the full content of each piece into this paper as a reference).In addition, the complete baculovirus expression system of MAXBAC.TM. (Invitrogen) is passable, for example is used for the production of insect cell.

Polypeptide of the present invention can also separate by utilizing special properties.For example, can utilize fixing metal ions absorption (IMAC) chromatography to come purifying to be rich in the protein of Histidine, comprise the protein that contains the poly histidine mark.In brief, at first gel is powered up (charged) to form inner complex (Sulkowski, Trends in Biochem.3:1 (1985)) with divalent-metal ion.According to used metal ion, the protein that is rich in Histidine will be adsorbed onto with different affinities on this matrix, and be passed through to reduce pH or used the strong chelating agent wash-out by competitive elutriant.Other purification process comprises by the purifying of the glycosylated protein of lectin affinity chromatography and ion exchange chromatography (M.Deutscher, (editor), Meth.Enzymol.182:529 (1990)).In other embodiment of the present invention, can the establishing target polypeptide and the fusions of affinity labelling (for example, maltose binding protein, immunoglobulin domains) to promote purifying.

Host cell of the present invention can be used for the large scale production method of Ror polypeptide, wherein cell is grown in and also pass through purification process known in the art in the suitable medium from cell, or from the substratum that cell is grown, separate required polypeptide product, the chromatography method that described method is for example traditional comprises immunoaffinity chromatography, receptor affinity chromatography, hydrophobic interaction chromatography, lectin affinity chromatography, size exclusion filtration, positively charged ion or anion-exchange chromatography, high pressure liquid chromatography (HPLC), reversed-phase HPLC etc.Other method of purifying comprises that desirable proteins is expressed and purifying is the method with fusion rotein of specificity label, mark or chelating moiety, and described chelating moiety is by specific binding partner or reagent place's identification.The protein that can shear purifying to be producing required protein, or remains complete fusion rotein.The shearing of merging component can produce the form of desired protein, and it has the result of extra amino-acid residue as shearing treatment.

Term " original position " refers to and comprises term " in the body ", " exsomatizing " and " external " that these terms are discerned by those of ordinary skills usually and understood.And, this paper with its most wide in range indirect and direct implication use phrase " original position " with when finding or original position identify a kind of entity, cell or tissue, and be not subjected to its source or origin, its conditioned disjunction state or the influence in its perdurability or life-span on this place or position.

Term " external " refers to a kind of artificial environment or refers to betide reaction or process in the artificial environment.External environment includes but not limited to, test tube and cell culture.Term " in the body " refers to that natural surroundings (for example, animal or cell) also refers to betide process or the reaction in the natural surroundings.

Method of the present invention can be at external cell (cultured cells) and the cell lysate of utilizing, and comprises that nuclear extract implements.Consider to be used for identifying that the example of the cell of regulating osteoplastic reagent includes but not limited to braincap cell, scleroblast, osteoclast, chondrocyte, and the multipotency precursor cell, such as the versatility marrow stromal cell.The MC3T3-E1 that provides in the catalogue from ATCC (WO 01/19855) is provided the object lesson of scleroblast and skeletonization precursor cell system, C2C12, and the MG-63 cell, the U2OS cell, the UMR106 cell, the ROS17/2.8 cell, SaOS-2 cell etc., and

Bodine PV, Vernon S K, Komm BS., Endocrinology, 137,4592-4604, (1996), Bodine PVN, TrailSmith M, Komm BS., J Bone Min Res, 11,806-819, (1996), Bodine PV, Green J, Harris HA, Bhat RA, Stein GS, Lian JB, Komm BS., J CellBiochem, 65,368-387, (1997), Bodine PV, Komm BS., Bone, 25,535-43 (1999), Bodine PVN, Harris HA, Komm BS., Endocrinology, 140,2439-2451, (1999), Prince M, Banerjee C, Javed A, Green J, Lian JB, Stein GS, Bodine PV, Komm BS, JCell Biochem, 80,424-40, (2001). the HOB clone of middle description.

Method of the present invention can also utilize cell free system to implement.

Term " expression system " refers to host cell under conditions suitable and compatible carrier, for example, carries out being carried and being imported by carrier the expression of the foreign DNA encoded protein matter in the host cell.Expression system commonly used comprises intestinal bacteria (E.Coli) host cell and plasmid vector, insect host cell and baculovirus (Baculovirus) carrier, and mammalian host cell and carrier.

" conversion " refers to that nucleic acid fragment is transferred in the genome of host living beings, causes heredity to go up stable succession (inheritance).The host living beings that comprises the nucleic acid fragment of conversion is called " transgenosis " biology.

" clone " refers to by mitotic division by unicellular or common ancestor's deutero-cell mass." clone " refers to the clone of a primary cell, and it can be at external stable growth several generations.

Term " differentiation " refers to the different qualities or the function that are had by tissue or the starting type of cell.Thereby " differentiation " is process of differentiation or behavior.

Term " osteoblast differentiation " phalangeal cell is the process of growing the specialization function in the osteoblastic process in maturation.Osteoblast differentiation can comprise preosteoblast, early stage and ripe scleroblast, preceding osteocyte and ripe osteocyte stage (Bodine etc., Vitamins andHormones 65,101-151 (2002), .Endocrine Reviews 14 such as Stein, 424-442 (1993), Vitamins and Hormones 55 such as and Lian, 443-509 (1999)).

Term " propagation " refers to cytoid growth of class and production.

Term " phenotype " phalangeal cell or biological observable feature.This observable feature can comprise physical appearance and be present in cell or biology in the level of specific physiology component.Osteoblasts in vitro comprises several labelled proteins, as bone idiosyncratic transcription factor Cbfa1; Type i collagen albumen; Alkaline phosphatase, Bone Gla protein; Expression with bone sialoprotein.

The application of term " gene inducibility system " assignment body regulate gene expression.Developed several regulator control systems that utilize the small molecules inducible gene expression (at Clackson T., CurrOpin Chem Biol, 1,210-218, (1997); Lewandoski M., Nat Rev Genet., 2,743-755, summarize (2001)).Gene inducibility system is a kind of molecular tool, allows the low extremely undetectable primary expression of target gene when it is not activated in system, and improve the target gene expression level when activating.

" maturation " albumen refers to the polypeptide through the translation post-treatment, has promptly removed any propetide in the original translation product or a kind of form of former peptide of being present in." precursor " albumen refers to the primary product of mRNA translation, that is, propetide and former peptide still exist.Propetide and former peptide include but not limited to signal for locating in the cell.

As used herein, term " binding partners (binding partner) " or " interaction protein " refer to can specificity in conjunction with the molecule of another kind of molecule, for example, antigen and antigen-specific antibodies or enzyme and inhibitor thereof.Binding partners can comprise, for example, and vitamin H and avidin or streptavidin, IgG and albumin A, receptor-ligand binding substances, protein-protein interaction and complementary polynucleotide chain.Term " binding partners " can also refer in cell in conjunction with kinase whose polypeptide, lipid, small molecules or nucleic acid.Interactional variation can make the possibility that himself is shown as the interaction formation that improves or reduce between kinases and binding partners, or the kinases-binding partners complex concentration that improves or reduce.For example, Ror1 or Ror2 albumen the two can combine and form a kind of can cause regulating Ror1 or the active mixture of Ror2 with another kind of protein or polypeptide.

Term " signal transduction pathway " refers to the extracellular signal is become by the cytolemma transmission molecule of signal in the cell.The irritation cell reaction subsequently of described signal.The peptide molecule that participates in the signal transduction process can be acceptor and non-receptor protein tyrosine kinase.

In " acceptor " phalangeal cell or the molecular structure on the cell surface, its feature is generally optionally in conjunction with predetermined substance.Exemplary acceptor comprises cell surface receptor, neurotransmitter, antigen, complementary fragment and the immunoglobulin (Ig) of peptide hormone and the cytosol receptor of steroid hormone.

Term " adjusting " refer to function inhibition, strengthen or induce.For example, " adjusting " of genetic expression or " regulation and control " refer to the variation of gene activity.The adjusting of expressing can include but not limited to gene activation and gene inhibition." adjusting " or " regulation and control " also refers to improve or reduce method, the conditioned disjunction reagent of the biologic activity of protein, enzyme, inhibitor, signal transduction agent, acceptor, transcriptional activation agent, cofactor etc.This active variation can be mRNA translation, DNA transcribes and/or the raising of mRNA or protein degradation or reduction, and it is next corresponding to the raising or the reduction of biologic activity.This enhancing or to suppress may be along with particular event takes place and takes place conditionally as the activated of signal transduction pathway, and/or only shows in particular cell types.

" activity of being regulated " refers to any activity, situation, disease or the phenotype by proteinic biologic activity form adjusting.Can influence adjusting by the concentration that influences biologically active proteins, for example, by regulating and expressing or degraded, or by direct excitement or antagonistic effect, as inhibition, activation, combination or release by substrate, chemical or structural modification, or by relating to the direct or indirect interaction of other factor.

" conditioning agent " refers to change any reagent that given activity is expressed, as bone forming or Ror developed by molecule.For example, regulate osteoplastic reagent and change or change (improve or reduce) bone forming.Conditioning agent is intended to comprise any compound, for example, and antibody, small molecules, peptide, oligopeptides, polypeptide or protein.

Term " small molecules " refers to chemical compound synthetic property or natural generation, for example peptide or oligonucleotide, it can randomly be organic, the biological organic or inorganic compound of the lower molecular weight (being generally less than about 5kD) in deutero-, natural product or any other natural or synthetic source.But this small molecules can be treatment to be gone up substance for delivery or can further be derived and send promoting.

As used herein, term " inductor " refers to induce, strengthens, promotes or improves given activity, as any reagent of bone forming or Ror developed by molecule.

Term " inhibitor " or " co-inhibitor " refer to suppress, suppress, prevent or reduce given activity as used herein, as any reagent of bone forming or Ror developed by molecule.

As used herein, term " reagent (agent) " or " test agent " refer to any compound or molecule to be tested.

The example of reagent of the present invention includes but not limited to peptide, small molecules and antibody.Reagent can be selected randomly or select reasoningly or design.As used herein, do not consider when selecting described reagent randomly just to say that this reagent " is selected " at random when specificity between this reagent and target compound or the site interacts.As used herein, just say that when selecting described reagent on nonrandom basis this reagent " is selected or design " reasoningly, specificity interaction and/or the conformation relevant with the effect of this reagent between this reagent and target compound or the site considered on described nonrandom basis.

As used herein, term " antibody " refers to immunoglobulin molecules or its immunocompetence part, i.e. antigen-binding portion thereof.The example of the immunocompetence part of immunoglobulin molecules comprises F (ab), Fv and F (ab ') fragment, and it can be made by using such as pepsic enzyme shearing antibody.

As used herein, term " treatment " (noun), " treatment " (verb) and " therapy " refer to therapeutic treatment and preventative operation, or stimulate osteocyte differentiation or bone forming, delay the development of osteopathy symptom and/or reduce bone disorders seriousness and/or will or the operation of expection these symptoms of developing out by bone disorders.These terms further comprise the existing osteopathy symptom of improvement, prevent other symptom, the potential metabolism cause of improvement or prevention symptom, and the potential metabolism cause of prevention or reverse symptom, or prevent or the promotion bone forming.Thereby these terms are represented to give and are suffered from bone disorders, or have the experimenter's of the possibility that develops into this illness useful result.And, term " treatment " (for example is defined as reagent, therapeutical agent or therapeutic composition) or use or deliver medicine to the experimenter from experimenter's chorista or clone, described experimenter suffers from disease, has the symptom of disease or the susceptibility of disease, so that treat, cure, alleviate, slow down, change, remedy, improve, improve or influence the symptom of described disease, disease or the susceptibility of disease.As used herein, " therapeutical agent " refers to help to treat disease, for example, regulates the bone forming activity or induces the new osteoplastic any material or the combination of material.Therefore, therapeutical agent includes but not limited to, small molecules, peptide, antibody, ribozyme and antisense oligonucleotide.

Therapeutical agent or therapeutic composition can also comprise prevention and/or reduce the compound of the pharmaceutically acceptable form of specified disease symptom.For example therapeutic composition can be prevention and/or the pharmaceutical composition that reduces bone photo related disorders symptom.Desiring provides therapeutic composition of the present invention with any suitable form.The form of therapeutic composition depends on multiple factor, comprises the mode of administration.Therapeutic composition can comprise compositions such as thinner, adjuvant and vehicle.

Bone strength is by the bone density (cm of mineral substance gram number/volume ³) and bone mass (mineralising, bone structure, bone are upgraded, microfracture) determine.Usually (Bone MineralDensity is BMD) as the measurement of bone strength to use bone mineral density.For example, if the BMD of bone surpasses 2.5 standard deviations under young white race adult women's the average BMD, claim that then it is the osteoporotic (World Health Organization, 1994, Assessment of Fracture Risk and it ' s Applicationto Screening for Postmenopausal Osteoporosis.Technical Report Series843. Geneva: the World Health Organization).

" osseous tissue " refers to tissue (for example, skull, shin bone, femur, vertebra, tooth), bone trabecula, the medullary space of calcification, its be outside the bone trabecula cavity, cover the cortex bone of bone trabecula periphery and medullary space etc.Osseous tissue also refers to be usually located at the intramatrical osteocyte of mineralized collagen; The blood vessel of nutrition is provided for osteocyte; The bone marrow aspiration thing; Synovial fluid; Be derived from the osteocyte of osseous tissue; And can comprise fatty marrow.Osseous tissue comprises the bone product such as part, osteocomma, bone meal, osseous tissue biopsy samples, collagen product or its mixture of full bone, full bone.For the purposes of the present invention, term " osseous tissue " is used for comprising whole aforementioned osseous tissues and product, no matter be the human or animal, unless stated otherwise.

As used herein, " bone photo closes active " comprises bone forming activity and bone resorption activity.

The bone forming activity can be by Osteoblast Differentiation and the skeletonization propagation that is enhanced to bone active, is undertaken by osteoprogenitor cells, by reducing TNF-a Induced Apoptosis in Osteoblasts and inducing by its arbitrary combination.In addition, bone resorption activity can be by reducing osteoclast activity, osteoclast differentiation and propagation, by improving the osteoclast apoptosis and suppressing by its arbitrary combination.Can in various osseous tissues or cell, induce the bone forming activity.

As used herein, the raising or the reduction of the formation of phrase " adjusting bone forming " phalanges." bone forming of raising " means scleroblast or the scleroblast precursor is raised (recruitment) to position of bone point, this causes the secretion of the ripe osteoblastic differentiation of cell inot and their collagen stromas, this on this site mineralising inner (int) bone material and improved bone mass (mass).This term also comprises the enhanced production and the secretion of ripe scleroblast collagen stroma.In the increase of the raising of raising, cortical density or the thickness of the increase that the enhanced bone forming can be by the reduction of fracture rates, regional bone density, the internuncial raising of raising, girder of volume mineral substance bone density, girder density, the increase of bone diameter and inorganic bone composition one or more are determined.The bone forming that improves can originate from osteocyte, and for example the scleroblast enhanced adheres to, breeds, survives and/or breaks up and bone mineralization subsequently.

" bone photo related disorders " comprises the illness of bone forming and bone resorption.These diseases and situation include but not limited to the ANOMALOUS VARIATIONS of rickets, osteomalacia, osteopenia, osteosclerosis, renal osteodystrophy, osteoporosis (comprising senile and post-menopausal osteoporosis), scleromalacia, bone transfer, hypercalcemia, hyperparathyroidism, osteopetrosis, periodontitis and bone metabolism, and it may be accompanied by rheumatoid arthritis and osteoarthritis.Be characterized as bone forming deficiency or the bone of some this class disease run off, and other the osseous tissue that comprises thickens unusually or hardens.The example of the disease that will be benefited from the inhibition that bone thickens unusually includes but not limited to osteopetrosis (osteopetrosis) and osteosclerosis (osteosclerosis).

" bone photo pass reagent " refers to influence the reagent of bone forming or bone resorption." bone photo pass reagent " can induce anabolism or katabolism effect, can suppress bone resorption and cause bone mineral density to improve, and can strengthen bone forming, perhaps can keep the balance between bone forming and the bone resorption.

Term " compound " or " reagent " can exchange mutually at this paper and make the component that is used to refer to a kind of compound or multiple compound or material, induce required pharmacology or physiological action by part and/or systemic effect when being administered to experimenter (human or animal).

Term " experimenter " refers to any Mammals, comprises people or inhuman experimenter.Inhuman experimenter can comprise experimental, tentative, agriculture property, recreational or companion animals.

Term " biological sample " is a broad definition, comprises any cell, tissue, biological fluid, organ, multicellular organism etc.Biological sample can be derived from for example cell or vitro tissue culture.Perhaps, biological sample can be derived from living body biological or be derived from monadic population.Biological sample can be a biological tissue, as the live body bone.Term " biological sample " also is intended to comprise the sample such as separating from experimenter's cell, tissue or biological fluid, and is present in the intravital sample of experimenter.That is, detection method of the present invention can be used in Ror mRNA external and detection of biological sample in vivo, protein, genomic dna or activity.For example, the ex vivo technique of detection Ror mRNA comprises that TaqMan analyzes, RNA is hybridized and in situ hybridization.Detect the proteic ex vivo technique of Ror and comprise Enzyme Linked Immunoadsorbent Assay (ELISAs), western blotting, immunoprecipitation and immunofluorescence.The ex vivo technique that detects the Ror genomic dna comprises DNA hybridization.

" test sample " refers to the biological sample from target subject.

" body fluid " refers to any body fluid, includes, without being limited to serum, blood plasma, lymph liquid, synovia, liquor folliculi, seminal fluid, amniotic fluid, milk, whole blood, sweat, urine, cerebrospinal fluid, saliva, phlegm, tear, sweat, mucus, tissue culture medium (TCM), tissue extract and cell extract.It can also be applied to the fraction and the diluent of body fluid.The source of body fluid can be human body, animal body, laboratory animal, plant or other biology.

The introduction of specific embodiments of the present invention

Utilize the expression of adjusting Ror molecule or active reagent closes active regulator as bone photo method: the expression of adjusting Ror molecule or active reagent can be used for regulating bone photo and close active: numerous disease and situation are arranged, it is active to it is characterized in that needs are regulated the bone photo pass, for example strengthens bone forming.It is evident that most the situation of fracture, wherein need stimulation of bone growth and promote and finish the bone reparation.For example, strengthening osteoplastic reagent may be useful to facial restructuring procedure.Other bone defect condition includes but not limited to that the situation that bone segment defective, periodontopathy, metastatic bone disease, molten bone osteopathia and reticular tissue reparation will be useful is as the healing or the regeneration of cartilage defects or damage.Have the chronic condition that also has osteoporosis of very big meaning, comprise age related osteoporosis and the osteoporosis that is associated with hormone situation after the menopause.Other the situation that needs osteogenesis that is characterized as comprises primary and secondary hyperparathyroidism, osteoporosis, disuse osteoporosis and glucocorticosteroid dependency osteoporosis that diabetes are relevant.

The reagent that is used for the inventive method can be mixed the pharmaceutical composition that is suitable for administration.As used herein, term " reagent " includes but not limited to, Ror nucleic acid molecule, Ror polypeptide fragment and anti-Ror antibody, and the adjusting Ror developed by molecule of identifying, synthetic and/or active compound (organic molecule of for example little Orally active).But these compositions generally comprise described compound, nucleic acid molecule, protein, antibody and express the carrier of this nucleic acid molecule and the carrier of host cell and medicine.Composition of the present invention can comprise one or more in conjunction with the reagent that closes active reagent with one or more known adjusting bone photos.For example, the reagent of inducing Ror to express can be in conjunction with the reagent that suppresses bone resorption, as oestrogenic hormon, diphosphate or tissue selectivity oestrogenic hormon (that is, selective estrogen receptor modulators or SERMs).

Use one or more reagent to treat effective dosage.The treatment effective dose refers to be enough to show the amount of the reagent of benefit (for example, the symptom that is associated with the illness for the treatment of, disease or situation alleviates).When being applied to individually dosed indivedual composition, described term list refers to this composition.When being applied to make up, described term refers to produce the combined amount of the composition of benefit, and described composition both can combination medicine-feeding, sequential administration or administration simultaneously.For example, be the amount that comprises the combination of agents thing for the significant quantity of therepic use, described reagent is provided at the clinical significant raising on the curative ratio of fracture repair; The prevention of fracturing in reverse that bone runs off and the osteoporosis; The reverse of cartilage defects or illness; The prevention of osteoporosis morbidity or delay; Osteoplastic stimulation and/or inhibition in non-associating of fracture and tractive osteogenesis; Osteogenesis is gone into the enhancing of prosthetic device and/or is weakened; The reparation of defects in teeth etc.Particular condition to be treated, patient's the patient's condition, route of administration, ingredients and doctor's judgement and other conspicuous for those skilled in the art factor will be determined and depend on to this significant quantity with the optimization routine technology.The needed dosage of The compounds of this invention (for example, in osteoporosis, wherein needing to strengthen bone forming) is the dosage that guarantees significant difference on the statistics of bone mass between treatment and the control group.The difference of this bone mass can be considered as, for example, and bone mass 5-20% or more raising the in the treatment group.Clinical other measurement that significantly improves can comprise in treatment, for example, the internuncial test of enhanced in breaking tenacity and tension force, breaking tenacity and torsion, 4 bendings, the biopsy of bone and other be well known to a person skilled in the art the biomechanics test.The generality of treatment plan instructs and can obtain from the experiment of carrying out the target disease animal model.

The toxicity of reagent and treatment are renderd a service and can be measured by the standard pharmaceutical procedures in cell culture or laboratory animal, for example, measure LD ₅₀(to colony's 50% lethal dosage) and ED ₅₀(colony 50% in the treatment effective dosage).Dosage rate between toxicity and treatment are renderd a service is a therapeutic index, and it can be expressed as ratio LD ₅₀/ ED ₅₀Preferred reagent or the compound of showing big therapeutic index.The dosage that the data that obtain from cell culture analysis and zooscopy can be used to prepare certain limit is used for the mankind.The dosage of this reagent or bonded can comprise ED ₅₀And have only slightly or do not have within the toxic circulation composition scope.According to the formulation that adopts and the route of administration of utilization, dosage can change within this scope.

For any reagent that uses in the method for the invention, the treatment effective dose can be assessed by the cell culture analysis at first.For example, can prepare a kind of dosage to obtain the circulating plasma concentration range in animal model, this scope is included in the ED that measures in the cell culture ₅₀(that is, obtain the half maximal destruction of protein complex, or the concentration of the cell levels of mixture component and/or the maximum test compounds that suppresses of active half).This information can be used for determining more accurately the useful dosage the mankind.Level in the blood plasma can for example be measured by HPLC.Each doctor can select dosage according to patient's situation.How and when the doctor in charge can know stops, interrupts or regulate administration.Conversely, if the insufficient words of clinical response, the doctor in charge also can know treatment is adjusted to higher level (getting rid of toxicity in advance).To change in the control of target illness, for the quantity of amount of reagent along with the seriousness of the patient's condition to be treated.The seriousness of the patient's condition can, for example, partly assess by the prognosis evaluation method of standard.In addition, perhaps dosage also have dose frequency also will change according to each patient's age, body weight and reaction.The program suitable with program discussed above can be used for the animal doctor.

Mensuration for the suitable dosage of particular condition is the known technology of this area.Usually, with smaller dose initial treatment less than the compound optimal dose.Subsequently, can strengthen dosage in a small amount until the best effect that reaches under the described situation.For example, if desired, can with total every day dosage separately and in a part of ground administration on the same day.

According to particular condition to be treated, can reagent preparation and general or administration in addition locally.Pharmaceutical composition of the present invention is mixed with and its expection route of administration fit.The technology of ingredients and administration can be at Remington ' s Pharmaceutical Sciences, and the 18th edition, Mack Publishing Co., Easton, Pa. (1990) lining is found.Suitable way can comprise mouth, rectum, vagina, through skin, through mucous membrane or enteral administration; Parenteral is sent, and comprises intramuscular, subcutaneous and intramedullary injection; And in the sheath, directly in the ventricle, in the intravenously, intraperitoneal, nose or intraocular injection etc.More operable delivering methods include but not limited to be packaged in the liposome, the transduction by retrovirus vector, utilize that the nuclear target site that is found on most of nucleoprotein is positioned the nuclear district, the transfectional cell reimplantation or give cells transfected subsequently that exsomatizes, and the DNA transmission system.

When pharmaceutically using described composition, they combine with " pharmaceutically useful carrier " and are used for diagnosis and treatment.The ingredients of these compositions is known in those skilled in the art.Pharmaceutical composition of the present invention can comprise one or more extra reagent, and preferably includes pharmaceutically useful carrier.

Suitable pharmaceutically useful carrier and/or thinner comprise any and whole conventional solvent, dispersion medium, weighting agent, solid carrier, the aqueous solution, dressing, antibiotic and anti-mycotic agent, etc. blend absorption delay agent etc.Term " pharmaceutically useful carrier " refers to not cause the carrier of atopic reaction or other improper effect in patient's body that it is given.Suitable pharmaceutically acceptable carrier comprises, for example, one or more of water, salt solution, phosphate buffered saline (PBS), glucose, glycerine, ethanol etc., with and combination.Pharmaceutically acceptable carrier can further comprise a spot of auxiliary substance, and as wetting or emulsifying agent, sanitas or damping fluid, it improves the preservation period or the effectiveness of one or more reagent of described composition.This medium and reagent are well known in the art as medicine.

The solution or the suspension that are used for parenteral, intracutaneous or subcutaneous application can comprise following component: sterile diluent such as water for injection, salt solution, fixed oil, polyoxyethylene glycol, glycerine, propylene glycol or other synthetic property solvent; Antiseptic-germicide such as benzylalcohol or methyl p-hydroxybenzoate; Antioxidant such as xitix or sodium bisulfite; Sequestrant such as ethylenediamine tetraacetic acid (EDTA); Damping fluid such as acetate, Citrate trianion or phosphate buffered saline buffer and tension regulator such as sodium-chlor or glucose.Can use acid or alkali, example hydrochloric acid or sodium hydroxide are regulated pH.The parenteral goods can be packaged in the multiple dose vials that ampoule, disposable syringe or glass or plastics make.The pharmaceutical composition that is suitable for injecting comprises aseptic aqueous solution (wherein water miscible) or dispersion and the sterilized powder or the dispersion that are used for preparing immediately sterile injectable solution.For intravenous administration, suitable carriers comprise physiological saline, bacteriostatic water, Cremophor EL_ (BASF, Parsippany, N.J.) or phosphate buffered saline.Described carrier can be to comprise, for example, and the solvent or the dispersant media of water, ethanol, polyvalent alcohol (for example, glycerine, propylene glycol and liquid macrogol etc.) and suitable mixture thereof.For example, by using dressing such as Yelkin TTS, by keeping required granular size and passing through to use tensio-active agent, can keep suitable flowability for dispersion.By various antibiotic and anti-mycotic agents, for example, P-hydroxybenzoic acid, chlorobutanol, phenol, xitix, Thiomersalate etc. can be realized the effect of prophylaxis of microbial.In many cases, preferably in composition, comprise isotonic agent, for example, sugar or polyvalent alcohol such as N.F,USP MANNITOL, sorbyl alcohol, sodium-chlor.By comprise the reagent of delayed absorption in composition, for example aluminum monostearate and gelatin can cause that the prolongation of Injectable composition absorbs.

In addition, the treatment disease that the present invention identifies and the reagent of situation can also with the administration altogether of other therapeutical agent, described other therapeutical agent is selected because the special use of situation is being treated in their antagonism.For example, described reagent can be combined with oestrogenic hormon or oestrogenic hormon related compound or other bone resorption inhibitor.Estrogen compound includes but not limited to conjugated estrogen, estradiol and analogue thereof.Other bone photo closes therapeutic compound and includes but not limited to, diphosphate and related compound are (as at U.S. Patent number 5,312, those that provide in 814), calcium fill-in (Prince, R.L. etc., N.Engl.J.Med.325,1189, (1991), vitamins D fill-in (Chapuy M.C. etc., N.Engl.J.Med.327,1637, (1992), Sodium Fluoride (Riggs, B.L. etc., N.Engl.J.Med., 327,620, (1992), androgen (Nagent de Deuxchaisnes, C., in Osteoporosis, a Multi-DisciplinaryProblem, Royal Society of Medicine International Congress andSymposium Series No.55, Academic Press, London, p.291, (1983), and calcitonin (Christiansen, C., Bone 13 (Suppl.1): S35, (1992).

The Ror molecule is as pharmacy medicine target: the present invention confirms that by method in external and the body Ror molecule is osteoporotic medicine target.For example, can produce specificity and destroy the siRNA molecule that Ror expresses in the mammalian cell.These siRNAs can cross expression and can monitor the damage effect of Ror for cytodifferentiation and/or survival in having the early stage scleroblast of high-caliber relatively Ror mRNA.Can also carry out the gene chip analysis with identify the Ror dependent gene (US5795716, US5974164).Based on the Ror2 expression pattern and with the relation of SFRP-1 and Wnt signal (signaling), the Ror2 downward modulation can be quickened osteoblast differentiation and can promote apoptosis.A kind of complementary method comprises that the mistake of Ror in preceding osteocyte express and monitor the differentiation state of these cells, but osteocyte does not have the Ror2mRNA of detection level and has low-level Ror1 mRNA before described.After the external affirmation, can cross the transgenic mice of expressing Ror conditionally with tissue and/or time-dependent manner mode by generation and come to confirm in the body that Ror is the osteoporosis target.Can also generate the mouse with Ror expression, described being expressed in the growth course destroyed by conditionality ground in the different time.

Identify and regulate the compositions and methods that bone photo closes activity and/or Wnt signal pathway: the invention provides a kind of the evaluation and regulate the compositions and methods that bone photo closes activity and/or wnt signal, comprise medicine-feeding test reagent and monitor the Ror molecule expression or active with determine described reagent whether regulate bone photo close active, the wherein expression of Ror molecule or active raising or reduce the described reagent of expression and regulate bone photo and close activity and/or Wnt signal.

Determine whether a kind of reagent changes the expression of Ror molecule or active method and comprise and well known to a person skilled in the art and analyze and test.Example includes but not limited to organize fractional analysis, rna blot analysis, TaqMan analysis, western blot analysis, ELISA, and functional selection, for example comprises the measurement of Ror phosphorylation degree (the more high state of phosphorylation reflects more high reactivity).Other method that Ror expression and active test agent are regulated in the evaluation that the present invention considered comprises pcr analysis and reporter gene system.Can the coding fluorescence plain enzyme of described reporter gene and can, for example, under the control by the promotor of Wnt-3 signal activation.Because Ror1 and Ror2 suppress the Wnt-3 activity, the expression and/or the active variation of the expression reflection Ror molecule of reporter gene.

Can be any existing form improves or implements method of the present invention, comprises the high-throughput test.High throughput analysis is used in a large amount of compound of screening in given period.In one embodiment, can utilize the analysis of nucleic acid, its amplifying nucleic acid places on the DNA chip.In another embodiment, utilize analysis based on the screening of cell.U.S. Patent number 6,103,479 disclose small-scale cellular array method and the device that carries out based on the screening of cell.Introduced to other and used the method for preparing cell homogeneous tiny model array, for example photochemistry tolerance photolithography art (Mrksich and Whitesides, Ann.Rev.Biophys.Biomol.Struct., 25,55-78, (1996)).U.S. Patent number 6,096,509 provide a kind of apparatus and method of measuring in real time the cell response of test compound on the mobile cell suspending liquid, wherein with the unit for uniform suspension of each member in a series of cell types in conjunction with test compound with specific concentrations, directed by detection zone, and the cell response of when the stream of cells in the test mixture is distinguished after testing, measuring viable cell in real time.This patent disclosure described device be used for the automatic screening library of compounds.Can modify so that utilize such as the scleroblast (HOB, U2OS, SaOS-2 and other) or the cell of non-scleroblast (COS-7 and other) disclosed method in the United States Patent (USP) comes confirmed test reagent whether to regulate the expression or the activity of Ror molecule.

Identify to regulate gene or method of protein that bone photo closes activity and/or Wnt signal pathway: the present invention has also considered to identify and can be subjected to the Ror expression regulation and thereby can participate in bone photo and close active gene or method of protein.For example, can identify this gene or protein by crossing the variation of expressing Ror molecule and gene expression pattern.In addition, can study the influence of Ror downward modulation (by the method for sense-rna or siRNA) to gene expression pattern.And can the Wnt signal pathway be had by the gene of Ror expression regulation or protein influences.

In higher organism, some expression of gene has determined the vital process of being undertaken by cell in the cell, for example grows and differentiation, homeostasis, the reaction to all ingredients, cell cycle regulating, aging, apoptosis etc.Changes in gene expression has changed the process that normal cell is grown.So biological study is crucial to the method that analyzing gene is expressed for base molecule.The gene of identifying differential expression can be for animal, comprises that diagnosis, prognosis and the treatment of multiple disease among the mankind or state of an illness state given a clue.In addition, these methods can be used to identify the sequence of differential expression, because the variation of gene expression dose is associated with the susceptibility of disease or situation, for example, closes activity with bone photo and are associated.

For example, the differential gene expression analysis can in specific cells, carry out and can more different cells in expression of gene and identify any difference in expressing, wherein the existence of difference shows the difference of the gene classification of expressing in the cell that is compared.

As used herein, " differential gene expression " refers to the time of gene and/or difference amount and matter of tissue expression pattern.Thereby, under normally to unusual bone forming state or unusual body weight state, or in contrast under the experiment condition, the gene of differential expression can make its expression be activated or complete inactivation on matter.This gene of being regulated and control on matter is in one of them of contrast experimenter or ill experimenter, but not all is will be detectable.Perhaps, this gene of being regulated and control on matter is in contrast or one of them of experimental experimenter, but not all is will be detectable.Term " detectable " refers to, for example, can show by difference, and the rna expression pattern that the standard technique of RT-PCR and/or rna blot analysis detects, described technology is known in those skilled in the art.

Multiple normal and model of unusual animal or the gene that clone can be used to identify the differential expression that regulated by Ror or regulate and control.For example, the clone that is derived from normal individual and diseased individuals is used to study with Ror expresses the differential gene expression that is associated, described disease comprises, but be not limited to, osteoporosis, rickets, osteomalacia, osteopenia, osteosclerosis, hyperparathyroidism, osteopetrosis, periodontitis, renal osteodystrophy, scleromalacia, bone transfer, hypercalcemia, obesity, apocleisis, emaciation, and non-trembling property and trembling property thermogenesis.

In order to identify the gene of differential expression, can be total RNA or mRNA with RNA, from the tissue of animal or above-mentioned cell, separate.The RNA sample can be available from test experimenter's tissue with from the respective organization that contrasts the experimenter.Can utilize RNA isolation technique that any separation that can not deviate from mRNA selects so as this RNA sample of purifying (for example, Ausubel, editors such as F.M., (1987-1993), Current Protocols in MolecularBiology, JohnWiley ﹠amp; Sons, Inc.New York).In addition, utilize the technology that well known to a person skilled in the art to handle a large amount of tissue samples (for example U.S. Patent number 4,843,155) easily.

Can identify that by means commonly known in the art representative is by the transcript of the RNA of difference expression gene generation in the collected RNA sample.For example, and the gene chip analysis (US5795716, US5974164), the cDNA microarray analysis, see, for example, Ono K, Tanaka T, TsunodaT, KitaharaO, Kihara C, Okamoto A, Ochiaia K, Takagi T, NakamuraY., Cancer Res 60,5007-5011, (2000), subtractive hybrization (Hedrick etc., Nature 308,149-153, (1984); Lee etc., Proc.Natl.Acad.Sci.USA, 88,2825, (1984), or difference shows that (Liang etc., Science 257,967-971 (1992), U.S. Patent number 5,262,311) can be used to identify the nucleic acid that is derived from difference expression gene.

In case by above-mentioned technical evaluation gene order that may differential expression, can utilize method well known in the art such as TaqMan analysis, rna blot analysis or quantitative RT-PCR that the differential expression of these difference expression genes of inferring is made further characterized.

Preparation host cell:, can in different clone, cross and express the Ror nucleotide sequence to identify their effects in different cell functions by technology known in the art.For example, can in scleroblast system, express Ror and can monitor its effect in differentiation by standard technique subsequently excessively.And, but Ror can be used for the gene inducible system of transient transfection assays to determine whether a kind of reagent has influence to bone forming.

Can carry out through engineering approaches to host cell with the carrier that comprises the Ror nucleotide sequence.Host living beings (recombinant host cell) can be any eucaryon or prokaryotic cell prokaryocyte, or multicellular organism.They can be derived from Mammals, yeast, fungi or virus.Proper host cell can include but not limited to mammalian cell, for example non-scleroblast (monkey kidney COS-7, people's kidney 293, people's ovary CHO, people liver HepG2, human cervical cancer 1 HeLa, or l cell NIH3T3) or scleroblast (former generation scleroblast (primary osteoblasts), human osteoblast cell such as TE-85, U2OS, SaOS-2 or HOB, rat osteoblast such as UMR 106 or ROS 17/2.8, or mouse bone-forming cell such as MC3T3.And, colibacillary multiple bacterial strain (for example, DH5 α, BL21, DH10B), yeast cell (for example, Schizasaccharomyces, yeast saccharomyces cerevisiae (Saccharomyces Cerevisice), PichiaPastoris, Pichia Methanolica) and insect cell (SF9, SF21, fall army worm (Spodoptera Frugiperda), S2 Schneider cell is from the High Five Cells of cabbage looper (Trichoplusia ni) ovum) can be as the host cell of molecular biology operation.

Carrier can be cloning vector or expression vector, as existing with plasmid, clay or phage or any other form of carrier reproducible and survival in host cell.The host cell of through engineering approaches can be cultivated in traditional nutritive medium, and described substratum is in order to activate promotor, to select transformant or the polynucleotide of the present invention that increase improve.Culture condition such as pH, temperature etc. are the known conditions that are applicable to selected host cell expression polynucleotide of those of ordinary skills.

According to the standard naming convention that those skilled in the art were familiar with, herein plasmid is expressed as small letter " p " preceding with and/or heel capitalization and/or numeral.The plasmid of this paper both can be commercially available, the public is obtainable on the basis that does not add restriction, also can be by conventional application of known, the method delivered by obtainable plasmid construction.In addition, many plasmid and other clone and expression vectors that can be used according to the invention be that known and those skilled in the art can obtain easily.And those skilled in the art can make up being applicable to of any number other plasmid of the present invention easily.To those skilled in the art, according to this specification sheets, the character of these plasmids and other carrier, structure and use in the present invention will be conspicuous.

Can suitable dna sequence dna be inserted in the carrier by multiple methods known in the art.

Dna sequence dna in the expression vector functionally can be connected on the suitable expression controlling elements to instruct mRNA synthetic.Described expression controlling elements is well known in the art and includes but not limited to, inducible promoter, composition promotor, secretion signal and other controlling element.Preferably, described inducible promoter is controlled easily, as being reactive to the nutritive ingredient in the substratum of host cell.Suitable extrinsic (non-native) mammalian promoter can comprise cytomegalovirus (CMV), Rous sarcoma virus (RSV), from the early stage and late promoter (SV40 of simian virus 40, Fiers etc., Nature, 273,113, (1978)) or from the promotor of Moloney murine leukemia virus, mouse tumor virus, Avian sarcoma virus, adenovirus II, the perverse tumor virus of ox or polyoma.Preferred bone photo closes promotor and comprises CMV β Actin muscle or type i collagen protein promoter.Except promotor, gene can also be placed under the control of ribosome bind site (for bacterial expression), the genetic control sequence that is fit to or regulating and controlling sequence, thereby the dna sequence dna of code for said proteins is transcribed into RNA in host cell, described host cell is transformed by the carrier that comprises this expression construct.Need in some cases to add and cause and the sequence of polypeptide by secretory host cell cut off secretion signal subsequently.Expression vector can also comprise the suitable sequence of ribosome bind site, transcription terminator and the amplification expression of carrying out translation initiation.Expression vector can also comprise that one or more selectable marker gene carry out the screening of transformed host cells so that specific phenotype to be provided, as eukaryotic neomycin resistance or colibacillary amicillin resistance.In addition, construct can be connected on the gene that can increase and (for example, DHFR), thereby can make the gene of multiple copied.About suitable enhanser and other expression control sequenc, also see Enhaneers andEukaryotic Gene Expression (Cold Spring Harbor Press, Cold SpringHarbor, NY, (1983)).

Be applicable to that the carrier of yeast expression and promotor at EP 73, introduce among the 675A.The example that is suitable for the carrier of Mammals expression includes but not limited to pCMV SPORT6, pCDNA3.1DN5-His-TOPO and pCDNA3.1/CT-GFP-TOPO.

Suppress the method that Ror expresses: the invention provides and suppress Ror expression and/or active method, it includes but not limited to, uses antisense nucleic acid, siRNAs and ribozyme and antibody, peptide and small molecules.Sense-rna and dna molecular are gone up by the mRNA that hybridizes to target and are stoped protein translation directly to prevent the translation of mRNA.The antisense method comprises design and target gene mRNA complementary oligonucleotide.Antisense oligonucleotide will and stop translation in conjunction with complementary target gene mRNA transcript.

Identify the method for Ror interaction protein: can identify the Ror interaction protein by method known to those skilled in the art.For example, carry out mass spectroscopy (Hill etc., J.Biol.Chem.277,40735-40741 (2002)) and Mammals and yeast two-hybrid system after the immunoprecipitation and can be used to study protein-protein interaction.See, for example,

US 6,251,602，Chien etal.，Proc.Natl Acad.Sci.USA 88，9578-82(1991)；Fields et al.，Trends Genetics 10，286-92(1994)；Harper et al.，Cell 75，805-16(1993)；Vojtek et al.，Cell 74，205-14(1993)；Luban et al.，Cell 73，1067-78(1993)；Li et al.，FASEB J.7，957-63(1993)；Zang et al.，Nature 364，308-13(1993)；Golemis et al.，Mol.Cell.Biol.，12，3006-14(1992)；Sato et al.，Proc.Natl Acad.Sci.USA，91，9238-42(1994)；Coghlan et al.，Science，267：108-111，(1995)；Kalpana et al.，Science，266，2002-6(1994)；Helps etal.，FEBS Lett，340，93-8(1994)；Yeung et al.，Genes & Devel.，8，2087-9，(1994)；Durfee et al.，Genes & Devel.，7，555-569，(1993)；Paetkau et al.，Genes & Devel.，8，2035-45，(1994)，Spaargaren et al.，Proc.Natl.Acad.Sci.USA，91，12609-13，(19g4)；and Ye et al.，Proc.Natl Acad.Sd.USA，91，12629-33(1994).

The variant of this system can be used for screening the yeast phagemid (see, for example, Harper, CellularInteractions and Development:A Practical Approach, 153-179 (1993); Elledge etc., Proc.Natl Acad.Sci.USA, 88,1731-5 (1991)) or plasmid (Bartel, 1993 and Bartel, Cell, 14,920-4 (1993)); Finley etc., Proc.Natl Acad.Sci.USA, 91,12980-4 (1994)) the cDNA library is with clone's interaction protein, and research known protein plasmogamy is right.

Can the yeast strain of the integration copy of multiple reporter gene box will be had, as for example GAL.fwdarw.LacZ, GAL.fwdarw.HIS3, or GAL.fwdarw.URA3 (Bartel, in Cellular Interactions and Development:A Practical Approach, 153-179 (1993); Harper etc., Cell, 75,805-16, (1993); Fields etc., Trends Genetics, 10,286-92 (1994)) with two plasmids cotransformation together, each all expresses different fusion roteins described plasmid.Fusion between the DNA binding domains of plasmid-encoded albumen " X " and for example GAL4 yeast transcription activator (Brent etc., Cell 43,729-36 (1985); Ma etc., Cell, 48,847-53 (1987); Keegan etc., Science, 231,699-704 (1986)), another plasmid is the fusion (Keegan etc., 1986) between the RNA polymerase activation structure territory of proteins encoded " Y " and GAL4 then.Plasmid can be transformed in the zymic bacterial strain, described bacterial strain comprises reporter gene, and as lacZ, its control region comprises the GAL4 binding site.If albumin X and Y interact, they are just by abundant near coming functional GAL4 transcription activator albumen of reconstruct with activated transcription with two GAL4 components.Assess transcriptional activation by measuring the growth on the minimum medium that lacks the specific nutrition composition of beta galactosidase enzyme or transformant, described specific nutrition composition allows the auxotrophy of transcription product to select, for example, URA3 (uridylic selection) or HIS3 (Histidine selection).See, for example, Bartel, (1993); Durfee etc., Genes ﹠amp; Devel., 7,555-569 (1993); Fields etc., Trends Genet., 10,286-292 (1994); With U.S. Patent number 5,283,173.

Other double cross analysis or screening method are conspicuous for those of skill in the art.See, for example,

Finley et al.，″Two-Hybrid Analysisof Genetic Regulatory Networks，″ in The Yeast Two-Hybrid System(Paul L.Bartel etal.，eds.，Oxford，(1997))；Meijia Yang，”Use of a Combinatorial Peptide Library in theTwo-Hybrid Assay，”in The Yeast Two-Hybrid System(Paul L.Bartel et al.，eds.，Oxford，(1997))；Gietz et al.，”ldentification of proteins that interact with a protein ofinterest：Applications of the yeast two-hybrid system，″Mo1.& Cell.Biochem.，172，67-9(1997)；K.H.Young，″Yeast Two-Hybrid：So Many Interactions，(in)so Little Time，″Biol.Reprod.，58，302-311，(1998)；R.Brent et al.，”Understanding Gene and AlleleFunction with Two-Hybrid Methods，”Annu.Rev.Genet.，31，663-704(1997).

Total length or the different piece of Ror can be cloned into the yeast two-hybrid carrier.These carriers include but not limited to pAS, pAS2-1, pGBT9, pGBKT7.To present bait with known binding domains (for example, GAL4 or LexA) to known or unknown protein as the clone's of expressing fusion protein Ror (SerebriiskiiI.G. etc., BioTechniques, 30,634-655, (2001)).Be cloned into activation structure domain vector (for example, GAL4 or VP16) (Serebriiskiil.G. etc., BioTechniques, 30,634-655, (2001)) cDNA can be from the cDNA library, described library is made by different scleroblast system, bone, brain and other tissue of expressing Ror.

In case identified the interaction mating partner, just can separate and clone full-length cDNA.In addition, can in the Mammals two-hybrid system, confirm to interact.In addition, can experimentize, this will more clearly determine the binding domains among the Ror.

If the interaction mating partner of Ror is the new gene of expressing, can carry out other experimental technique so to determine the effect of this albumen in bone forming and/or absorption in scleroblast.But, if the interaction mating partner of Ror is to have the gene that known organism is learned function, it can show the effect of Ror interaction mating partner in the adjusting of bone forming and/or absorption.

Diagnostic uses: Ror molecule of the present invention can also be as the mark of bone photo related disorders or morbid state, the mark of morbid state omen, the mark of morbid state susceptibility, the mark of pharmaceutical activity, or the mark of experimenter's pharmacogenomics pattern.Utilize method as herein described, can detect existence, disappearance and/or the quantity of Ror molecule of the present invention, and can be relevant with intravital one or more biological conditions.For example, Ror molecule of the present invention can be used as one or more bone disorders or morbid state or cause morbid state situation biochemical marker and work.As used herein, the disappearance or the existence of biochemical marker and a kind of disease or illness, or relevant with the process (for example, with the bone mineral density (BMD) that reduces) of disease or illness.So whether these marks can be used for indicating a particular treatment process effective to state of palliating a disease or illness.

The invention provides a kind of in the patient method of diagnosis bone photo related disorders, comprise with the Ror developed by molecule among the patient and/or active level with compare from Ror developed by molecule in normal subjects's the comparable sample and/or active level.Sample can be patient tissue, cell or humoral sample.

In addition, the present invention proposes Ror Molecular Identification purposes to the cell or tissue of bone modifier reaction in standard state or morbid state, this is by before the administration reagent and measure in these cell or tissues the Ror developed by molecule afterwards and/or active level is carried out.Ror developed by molecule and/or active variation will reflect the reactivity of cell or tissue to described reagent.

For example, the Ror molecule can be as helping to design and/or the target of authenticating compound, the medicine of preventive therapy that described compound can be as the treatment of morbidity osteoporosis or women or other dangerous individual develop into the danger of fracture and osteoporosis before reducing menopause.

The osteoporosis treatment that these compounds can be used for women between climacteric is with the further deterioration of prevention bone and/or induce new bone forming.It can be used as independent therapy and/or provides in conjunction with the therapy that runs off with existing inhibition bone or as estrogenic extra therapy.

In addition, the invention provides evidence, i.e. people Ror2 peaking in the proliferative preosteoblast.So Ror2 can be as the mark of this cell type in culture or in the original position.

Utilize the effectiveness of Ror molecule assessment medicine: (for example the invention provides monitoring with reagent, agonist, pick anti-agent, peptide mimics, protein, peptide, nucleic acid, small molecules or other drug candidates of identifying by filler test described herein) method of treatment experimenter's effectiveness, comprise the sample step (i) obtains administration from the experimenter before administration reagent before; (ii) detect the expression or the activity level of Ror molecule in the preceding sample of administration; (iii) obtain sample after one or more administrations from the experimenter; (iv) detect the expression or the activity level of Ror molecule in the sample after the administration; (the v) relatively expression or the activity level of Ror molecule before the administration and in the sample after the administration; (vi) correspondingly change of the administration of described reagent to the experimenter.For example, strengthen expression or activity that the described reagent of administration is expected to regulate more strongly Ror, that is, improve the effectiveness of reagent.According to this embodiment, even the expression of Ror molecule or active can be used as the indication that reagent is renderd a service is when lacking a kind of observable phenotypic response.

The present invention further provides the method for assessment pharmaceutical efficacy and the patient's of the clinical trial of monitoring participation bone photo related disorders treatment progress.Monitoring reagent (for example medicine) not only can be applied to basic drug screening to the expression or the active influence of Ror molecule, can also be applied to during clinical trial or any other application.For example, the reagent of measuring by filler test as herein described improves the effectiveness of Ror gene or expression of polypeptides level, can monitor in the experimenter's of Ror gene that presents reduction or expression of polypeptides level clinical trial.Perhaps, the reagent of measuring by filler test reduces the effectiveness of Ror gene or expression of polypeptides level, can monitor in the experimenter's of Ror gene that presents raising or expression of polypeptides level clinical trial.In this clinical trial, Ror gene or polypeptide and other relate to the gene of the related illness of Ror for example and polypeptide expression or activity level can be used as specific cells, and for example, " readout " of phenotype (read-out) or mark in the osteocyte.In addition, Ror gene or expression of polypeptides can be used as certain drug or the reagent readout for the effect of bone photo related disorders state.

For example, and nonrestrictive, can identify the gene of the adjusting that is subjected to reagent (for example, compound, medicine or small molecules) treatment in cell, described reagent is regulated Ror developed by molecule or activity (for example, being identified) in filler test described herein.Thereby, in order to study the effect of reagent for the related illness of Ror (for example, bone photo closes), for example, in clinical trial, can isolated cell and prepare RNA and carry out gene array analysis (for example, gene chip analysis).The gene of expressing noticeable change between state of being untreated and treated state can be used as the mark of indicator cells to described reagent physiological response.Therefore, this response behaviour can be before with described reagent treatment individuality or during each time point measure.

Transgenic animal: the term in " transgenic animal " " animal " comprises all vertebratess, except the people.It also comprises the individual animals of whole etap, comprises embryo and the fetal state." transgenic animal " are the animals that comprises the one or more cells that are loaded with genetic information, and described genetic information is by the genetic manipulation of having a mind on subcellsular level, as directly or indirectly accepting by using recombinant virus microinjection or injection.The dna molecular of introducing can be integrated in the karyomit(e), and perhaps it can be the DNA of extrachromosomal replication.Term " transgenosis " means the dna sequence dna that imports animal kind system by the mode of human intervention.Term " germ line cell is transgenic animal (germ cell-line transgenic animal) " refers to a kind of transgenic animal, wherein genetic information is introduced germ line cell, gives the ability of the information of transmitting to the offspring thus.If these offsprings in fact have some or all these information, they also are transgenic animal so.

Can be external source the animal species of described information under acceptor, be external source to the particular individual acceptor only, and perhaps genetic information is had by described acceptor.In in the end a kind of situation, it can be differential expression that the gene of introducing is compared with intrinsic native gene.

Gene can be by separating them from genome source, by preparing cDNAs by isolating RNA template, by directly synthesizing, or obtain by its some combination.

In order to express, be connected on the control region to being operated property of gene.Control region as promotor, can be used to improve, the expression of reduction, regulatory gene or expression of gene limited (designate) to some tissue or some etap.Promotor needs not to be the promotor of natural generation.

Can be usually existing with the method in the DNA transfered cell and be well known in the art.Can use different importing transgenic methods.Usually, zygote is the best target of microinjection.For example, in mouse, the male pronucleus diameter reaches about 20 μ m, and this allows repeatably to inject the 1-2pl dna solution.Zygote has very big benefit as the target of transgenosis.In most of the cases, the DNA of injection will be integrated in the host cell (Brinster, etc., 1985) before the spilting of an egg first.As a result, most transgenic nonhuman animal cell all will carry the transgenosis of integration.Generally, this also will cause transgenosis effectively to pass to the offspring of initiator, because 50% spermoblast will have described transgenosis.The microinjection of zygote is to mix genetically modified preferred method in the embodiment of this invention.

Retroviral infection also can be used for transgenosis is imported the non-human animal.Can be with developmental non-human animal embryo in vitro culture to the blastular stage.Interim at this moment, blastomere can be the target of retroviral infection.Handle effective infection that the removal zona pellucida obtains blastomere by zymetology.Being used to import genetically modified virus carrier system generally is to carry genetically modified replication defect type retrovirus.By on the individual layer of virus producing cell, cultivate blastomere obtain easily and effectively transfection (Van der Putten, the same; Stewart etc., 1987).Perhaps, can infect in the stage of back.Virus or virus producing cell can be injected into segmentation cavity.Most of initial animals are inserted types to transgenosis, take place in group's cell because only mix, and described cell forms transgenic nonhuman animal.And described initial animal can comprise genetically modified retrovirus and insert on genomic a plurality of positions; These separate in the offspring usually.In addition, by the embryo's that becomes pregnant mid-term intrauterine retroviral infection, although poor efficiency also might import transgenosis in kind of the system (Jahner etc., (1982) are the same).

The target cell of the third type that transgenosis imports is that the embryo does (ES) cell.Embryo (Evans, M.J. etc., 1981 of ES cell before available from the transplanting of vitro culture; Bradley, A. etc., 1984; Gossler etc., 1986; With Robertson etc., 1986).Can effectively transgenosis be imported in the ES cell by the DNA transfection or by the retrovirus mediated by protein transduction.The Transformed E S cell that obtains can be combined with blastocyst from the non-human animal subsequently.The ES cell forms the embryo and conduces the kind system of the chimaeric animals that obtains (seeing summary Jaenisch, R., 1988).

The general method that produces transgenic animal is known in the art, and, for example,

Strategies in Transgenic Animal Science(Glenn M.Monastersky and James M.Robl eds., ASM Press; Washington, DC, 1995); Transgenic Animal Technology:A Laboratory Handbook(Carl A.Pinkert ed., Academic Press 1994): Transgenic Animals(Louis Marie Houdebine, ed., HarwoodAcademic Press, 1997); Overexpression and Knockout of Cytokines in Transgenic Mice(Chaim O.Jacob, ed., Academic Press 1994); Microinjection and Transgenesis: Strategies and Protocols(Springer Lab Manual) (Angel Cid-Arregui and AlejandroGarcia-Carranca, eds., Springer Verlag 1998); And Manipulating the Mouse Embryo: A Laboratory Manual(Brigid Hogan et al., eds., Cold Spring Harbor Laboratory Press1994). in introduce.The method that the existence of DNA and expression thereof are introduced in assessment be can obtain easily and be well known in the art.These methods include but not limited to that DNA hybridization (southern hybridization) or PCR are to detect foreign DNA or PAGE and western blotting to detect protein.

In order to determine whether Ror plays a role in the bone photo related disorders, be formed in whole tissues or only in bone, cross the transgenic mice of expressing full-length gene or its any fragment or varient or mutant.Express in order to set up extensive mistake of Ror in bone and non-bone tissue, use a kind of ubiquitous promotor (for example, CMV β Actin muscle).But it is opportunistic to utilize Mifepristone dependent gene inducible system the expression of Ror can be become.Cross expression by bone specificity such as the promoters driven rat cdna of rat 3.6kb type i collagen albumen or rat 1.7kb Bone Gla protein promotor.The early expression of bone is useful to rat 3.6kb type i collagen protein promoter in the growth for providing, and rat 1.7kb Bone Gla protein promotor can give stricter bone restricted expression pattern.Identical construct also is used to produce transgenic rat.Express for the conditionality of Ror, Bone Gla protein promotor (Capparelli, F.B., Endocrinol., 138,2109-2116, (1997)) but drive the gene inducible system and the Gal4 minimal promoter drives Ror.Independently transgenic lines is hybridized and is handled the double transgenic mouse with Mifepristone and express to regulate and control Ror as required.The phenotype analytical of transgenic animal comprises in the body and the combination of exsomatizing and testing.The BMD that improves is that such notion is produced evidence, and promptly the Ror molecule is the potential new target of bone photo related disorders really.And, these transgenic animal can be used for determining that Ror crosses expression and whether can save the osteopenia disease that ovariectomy brings out (.J.BoneMin.Res. such as Y.P.Kharode in the rat of the osteopenia disease model of these foundation and mouse, 14 (1), S523, (1999) .J.Bone Min.Res. such as Y.P.Kharode, 16 (1), S540, (2001)).

With various tissue morphology parameters known in the art, transgenic animal can be used for the bone phenotype of the various bones of analyzing bone, comprise flat bone (skull bone, shoulder blade, mandibular bone and ilium (ileum)) and long bone or axle bone (shin bone, femur and humerus) etc.

In addition, the protection of can be in various bone loss models Ror transgenic animal check bone being run off, described model comprises the osteopenia disease of oophorectomize inductive osteopenia disease, glucocorticoid inducible and various known in the art useless with model etc.Can be to various bone anabolic agents (for example, the small molecules of evaluation) thus the effect of combination study and measure further and change bone phenotype with adding an accepted way of doing sth in anabolic mode (cooperating type ground) or in catabolic mode.

In addition, can utilize the effect of Ror Study on Transgenic Animal Ror in osteoprogenitor cells and scleroblast activity, proliferation rate and apoptosis rate, described osteoprogenitor cells and scleroblast activity, proliferation rate and apoptosis rate influence the formation of bone together.

The Ror transgenic animal can be used to identify the treatment effective agents to the bone photo related disorders.Can be with reagent to transgenic animal administration of the present invention.Can measure that bone forming and other bone photo close active variation in the animal for the treatment of, and with untreated control animal in bone forming and other bone photo close activity and compare.

The conditionality knock-out animal:

Alternatively, as the native gene of the described gene of coding with import the result of homologous recombination between the genomic dna of change of coding phase homopolypeptide of animal embryo cell, can make up " knocking out " animal, it has the defective type of genes identified in the screening of being coded in or the gene of change.For example, according to recognized techniques, can come the genomic dna of this polypeptide of clones coding with the cDNA of a kind of gene of identifying of coding.The part of the genomic dna of the gene identified of coding can be deleted or with another kind of gene replacement, but can be used in the gene of the selective marker of monitoring integration as coding.Generally, the not change flanking DNA (at 5 ' and 3 ' end) of several thousand bases is included in the carrier (for example see, Thomas and Capecchi, Cell, 51 (3), 503-12, (1987) are to the introduction of homologous recombination vector).Carrier imported (for example, pass through electroporation) in the embryonic stem cell line and select the DNA that wherein imports (for example to see Li etc., Cell, 69 (6), 915-26, (1992) with the cell of endogenous dna homologous recombination.Subsequently the injection cell of selecting (is for example gone into animal, mouse or rat) blastocyst in (for example see to form aggregation chimera, Bradley, in Teratocarcinomas and EmbryonicStem Cells:A Practical Approach, E.J.Robertson, ed.IRL, Oxford, 113-1521, (1987).Subsequently chimeric embryo is implanted in the suitable false pregnancy foster animal body of female generation, and described embryo is used for producing " knocking out " animal.Can identify to have the offspring of homologous recombination DNA and be used for breeding animals in its germ line cell by standard technique, whole cells of wherein said animal all comprise the DNA of homologous recombination.Being characterized as of knock-out animal, for example, they can be defendd some pathological condition and pathological condition owing to the disappearance of institute's identified gene develops.

Knock-out animal can be used for screening the medicine that can influence biochemical parameter and pathological parameter, and described parameter is relevant with the specific physiological disorder of studying.Clone also can be derived from these animals with as physiological disorder, or the cell model in the drug screening.For example, by import sudden change in Ror1 or Ro2 sequence, the animal of making a kind of no longer expressive function Ror1 or Ro2 gene thus knock-out animal and develop.This knock-out animal, for, for example, research Ror1 or Ro2 are useful in the effect that bone photo closes in active or other relevant physiological function.

The invention provides the Ror gene by the animal of conditionality deactivation.The conditionality deactivation refers to that gene is in the selected tissue (that is, in bone) and/or the deactivation of the specified time between the growth period.The gene of conditionality deactivation is all being expressed with normal endogenous levels on all other tissue neutralization institutes are free before the deactivation.In one embodiment, the invention provides gene information with development condition Ror knock-out mice.

Make and to depend on Cre recombinase specific expressed conditionality mouse in bone and knock out.By being hybridized with the transgenic mice of specific expressed Cre in bone, the target gene animal carries out the allelic deletion of target in the bone.For example, make transgenic mice, wherein Cre can be by rat 3.6kb type i collagen protein promoter or rat 1.7kb Bone Gla protein promoters driven.

The phenotype of expection is the phenotype that bone forming is changed.The phenotype analytical of target animals comprises in the body and the combination of exsomatizing and testing.Can't develop into normal bone or can't normally reinvent bone provide Ror in bone development effect and as the purposes of the new target of bone photo related disorders.

With various tissue morphology parameters known in the art, the conditionality knock-out animal can be used for the bone phenotype of various bones of analyzing bone, comprises flat bone (skull bone, shoulder blade, mandibular bone and ilium) and long bone or axle bone (shin bone, femur and humerus) etc.

And, osteoprogenitor cells and scleroblast activity, proliferation rate and apoptosis rate when conditionality Ror knock-out animal can be used for being evaluated at disappearance Ror.

The present invention incorporates known method and technology in molecule and the cytobiology field into by reference.These technology include but not limited to the technology described in following publication:

Old，R.W.& S.B.Primrose，Principles of Gene Manipulation：An Introduction To GeneticEngineering(3d Ed.1985)Blackwell Scientific Publications，Boston.Studies inMicrobiology；V.2：409pp.(ISBN 0-632-01318-4)，Sambrook，J.et al.eds.，MolecularCloning：A Laboratory Manual(2d Ed.1989)Cold Spring Harbor Laboratory Press，NY.Vols.1-3.(ISBN 0-87969-309-6)，Miller，J.H.& M，P.Calos eds.，Gene TransferVectors For Mammalian Cells(1987)Cold Spring Harbor Laboratory Press.NY.169pp.(ISBN 0-87969-198-0).

Embodiment

In the following example the present invention is done further definition, wherein all parts and per-cent are all calculated by weight, and degree is degree centigrade, unless stated otherwise.Be to be understood that these embodiment, although show embodiment preferred of the present invention, just the mode by illustration provides.By above discussion, embodiment and these embodiment, those skilled in the art will understand easily that many improvement are possible in exemplary embodiment, and can not deviate from new instruction of the present invention in itself, and can not deviate from its spirit and scope.And, can make various changes and modifications of the present invention so that it adapts to various uses and condition.Therefore, all these improvement all are intended to be included in as within the defined scope of the present invention in following claims.

The full content of hereby that this paper is mentioned patent, application, test method and publication is incorporated this paper by reference into.

General method

Material and tissue culture

Unless indicate, tissue culture reagent available from Invitrogen company (Carlsbad, CA); Other reagent and chemical available from Sigma Chemical Co. (St.Louis, MO) or Invitrogen.Anti--flag M2 mouse monoclonal antibody, anti-V5 rabbit polyclonal antibody and anti--flagM2 affinity agarose are available from Sigma; Anti--HA label and anti--beta-catenin white rabbit polyclonal antibody and anti--Tyrosine O-phosphate mouse monoclonal antibody, clone 4G10, from Upstate CellSignaling Solutions (Charlottesville, VA); Anti--his mouse monoclonal antibody from BD Biosciences Clontech (Palo Alto, CA); Anti--beta-actin mouse monoclonal antibody is from Sigma; Horseradish peroxidase (HRP)-put together two anti-available from SantaCruz Biotechnology, Inc. (Santa Cruz, CA) or Amersham Biosciences (Buckinghamshire, England).

Utilization comprises the DMEM/F-12 substratum of 10% heat-inactivated fetal bovine serum, 1% penicillin-Streptomycin sulphate and 2mMglutaMAX-I at 5%CO ₂Keep HOB clone in 34 ℃ in/95% humidifying air incubator.In comprising the McCoy ' s 5A improvement substratum of 10% heat-inactivated fetal bovine serum, 1% penicillin-Streptomycin sulphate and 2mM glutaMAX-I, the U2OS human osteosarcoma cell is remained in 37 ℃.In the DMEM that comprises 10% heat-inactivated fetal bovine serum, 1% penicillin-Streptomycin sulphate and 2mM glutaMAX-I, keep the COS-7 cell in 37 ℃.

Plasmid

The people Wnt-1 (Wnt-1-HA) of HA epi-position mark in pUSEamp, the people Wnt-3 (Wnt-3-HA) of HA epi-position mark and pUSEamp (+) are available from UpstateBiotechnology in pUSEamp; PcDNA3.1 (+) is from Invitrogen; The beta galactosidase enzyme reporter gene of CMV promoters driven (pCMV β) is from BD Biosciences Clontech.People SFRP-1 had carried out introduction in WO 01/19855.

The luciferase reporter gene (16xTCF-luc) that comprises T cytokine (TCF) the DNA binding site of 16 copies makes up as follows, and described binding site is blended on minimum thymidine kinase (TK) promotor by 5 '.Make and comprise the TCF DNA binding site of in TCR-α enhanser, identifying at first, Waterman, M.L. etc., Genes Dev., 5,656-669, (1991), the CD3-e enhanser, van de Wetering M. etc., EMBO J., 10,123-132, (1991), and common (consensus) TCF DNA binding site Korinek, V. etc., Science, 275,1784-1787, the oligonucleotide of (1997).

These oligonucleotide are (the TCF binding site is by underscore):

5’-

CTAGCGAGAACAAAGGAGATTCAAAGGAGATCAAAGGAGATCAAAGGACTAGTT

C-3’，(SEQ ID NO：1)and，

5’-TCGAGAACTAG TCCTTTGATC TCCTTTGATC TCCTTTGAATC TCCTTTGTTCTC

G-3’(SEQ ID NO：2)

Utilize the T4 polynucleotide kinase with the oligonucleotide phosphorylation, in 80 ℃ of heating 10 minutes and make its annealing.The annealed double chain oligonucleotide comprises NheI and the compatible fragment of XhoI respectively in 5 ' and 3 ' end.The annealed oligonucleotide is cloned into by the upstream of TK-luciferase reporter gene (Promega Corporation, Madison is WI) to generate 4xTCF-luc among the pGL3 of NheI and XhoI digestion.Confirm TCF binding site and TK promotor by dna sequencing.Develop the plasmid that to have 8 copies of TCF DNA binding site (8xTCF-luc) by Nhel-BamHl and the Spel-BamHl fragment that connects from 4xTCF-luc subsequently.Similarly, utilize the 8xTCF-luc preparation to have the plasmid of 16 copies of TCF DNA binding site.By all plasmids of order-checking conclusive evidence.

The people Ror1 (Ror1-flag) of Flag-mark makes up as follows.From the RNA of people uterus human cloning Ror1 and insert the Kpnl of pcDNA3.1 (+) and the Notl site to obtain hRor1-pcDNA3.Further modify this clone by the PCR mediated mutagenesis.Remove 3 ' non-translational region and utilize strand primer down flag epi-position label (codon of underscore) to be added to the 3 ' end of cDNA before terminator codon and the Notl site:

5’-

TGAGCGCGGCCGCTGCTCA CTTGTCATCGTCGTCCTTGTAGTCCAGTTCTGCA

GAAATCATAGAT-3’(SEQ ID NO：14).

The inner area complementation of last strand primer and Ror1, it comprises a BamHl site:

5’-CTCATCAGGATCCAATCAGG-3’(SEQ ID NO：13).

Shear the DNA of amplification and be cloned into BamHI and the hRor1-pcDNA3 of NotI digestion with BamHI and NotI.Prove conclusively the change of being planned by order-checking.

The people Ror2 (Ror2-flag-pcDNA3) of Flag-mark is prepared as follows.The part clone who comprises the people Ror2 of codon 58-2296 proves conclusively available from the clone of the Invitrogen ' sIMAGE among pCMV-Sport6 set (clone ID 3146587) and by whole two chains that check order.Utilize HOB-03-C5RNA to produce 3 ' partly (codon 2297-2832) by RT-PCR as template and Ror2 Auele Specific Primer.The codon 2192-2216 complementation of last strand primer and Ror2 also comprises an inner Xmnl site:

5’-AGTTCCCCAGCCGGCGGCCCCGCTT-3’(SEQ ID NO：15)

And strand primer comprises an Xbal site (runic font) adjacent with terminator codon down:

5′-TACGATTCTAGATGTCAAGCTTCCAGCTGGACTTGGG-3’(SEQ ID NO：16).

DNA with Xmnl and Xbal digest amplification holds to obtain 3 ' of Ror2., two fragments all are cloned among the pcDNA3.1 (+) of Notl-and Xbal-digestion the excision from the IMAGE clone of 5 ' part with Notl and Xmnl to obtain Ror2-3 '-pcDNA3.Also utilize HOB-03-C5RNA to produce 57 codons of beginning of Ror2 by RT-PCR as template and Ror2 Auele Specific Primer.Last strand primer comprises Kpnl site (runic font) at 5 ' of ATG codon:

5’-GACCTTGGTACCATGGCCCGGGGCTCGGCGCT-3’(SEQ ID NO：17)；

The inner area complementation of following strand primer and Ror2, it comprises the BamHI site:

5’-TCGTTCGGATCCAGAACCTCCAC-3’(SEQ ID NO：18).

With the DNA of Kpnl and BamHI digest amplification and be cloned into Kpnl and the Ror2-3 '-pcDNA3 of BamHI digestion in to obtain Ror2-pcDNA3.By the complete coding region of whole two chains conclusive evidences of checking order.Subsequently, the people Ror2 for preparing the flag-mark by the PCR mediated mutagenesis.Strand primer adds to flag epi-position label (codon of underscore) at the 3 ' end of terminator codon (runic font) and XbaI site hRor2cDNA before under utilizing:

5’-

CTGGAATCTAGATCA CTTGTCATCGTCGTCCTTGTAGTCAGCTTCCAGCTGGAC

TTGGGCC-3’(SEQ ID NO：20).

The inner area complementation of last strand primer and Ror2, it comprises the AleI site:

5’-GCTCACACCACAGTGGCAGTGG-3’(SEQ ID NO：19).

With AleI and XbaI shear the DNA of amplification and be cloned into AleI and the Ror2-pcDNA3 of XbaI digestion in.Change by the plan of order-checking conclusive evidence.

Ror2 ' kinases-deactivation ' mutant (Ror2KD-flag) based on illustrated Flag-mark among disclosed evidence (Hikasa H, Shibata M, HiratiI, Taira M, Development, 129,5227-5239, (2002)) the schema A5.Specification sheets according to the manufacturer utilizes QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, LaJolla, CA) by the PCR mediated mutagenesis Methionin 507,510 and 512 three point mutation to Isoleucine are imported among the Ror2-Flag-pcDNA3.The last strand primer that comprises plan sudden change (black matrix) is:

5’-

GGCTGTGGCCATCATAACGCTGATAGACATAGCGGAGGGGC-3’(SEQ ID NO：21)

And strand primer and cochain complementation down:

5’-

GCCCCTCCGCTATGTCTATCAGCGTTATGATGGCCACAGCC-3’(SEQ ID NO：22).

After the change by order-checking conclusive evidence plan, with BsrGI and EcoRI cut out the part of sudden change and be cloned into BsrGI and Ror2-flag-pcDNA3 that EcoRI digests in.

Ror2 truncated mutant (Ror2 Δ C-flag) by illustrated Flag-mark among the PCR mediated mutagenesis design of graphics A5.Utilizing down, strand primer is directed in the COOH end that codon 1284 just exceeds membrane spaning domain afterwards with flag epi-position label (codon of underscore), heel terminator codon (runic font) and XbaI site:

5’-

GACCTTTCTAGATTA CTTGTCATCGTCGTCCTTGTAGTCGCACATGCAAACCAA

GAAGAAAAGGC-3’(SEQ ID NO：24).

The inner area complementation of last strand primer and Ror2, in 5 ' of SphI site:

5’-CCTTCTGCCACTTCGTGTTTCCTCT-3’(SEQ ID NO：23).

With the DNA of SphI and XbaI digest amplification, be cloned among the Ror2-pcDNA3 of SphI and XbaI digestion, and prove conclusively the change of plan by order-checking.

Make up born of the same parents' intracellular domain (bp 5125-7431) of the people Notch2 of V5-and his-mark by the PCR mediated mutagenesis.Utilization comprises the last strand primer of EcoRI site heel ATG codon and produces 5 ' terminal (base 5125-5906) by RT-PCR from human fetal brain and lung RNA:

5’-

CATATGAATTCATGACCAAGCATGGCTCTCTCTGGCTGCCT-3’(SEQ ID NO：45)；

Following strand primer and the inner area complementation that comprises the Notch2 in BclI site:

5′-CGCTTGGCAGTTGATCAGTTCTG-3’(SEQ ID NO：46).

3 ' the part that comprises codon 5907-7425 increases available from Invitrogen ' s IMAGE clone set (clone ID 5529009) and by PCR.The last strand primer that comprises the BclI site is 5 '-GAATGGTGGCAGAACTGATCAACTG-3 ' (SEQ ID NO:47);

And the following strand primer that comprises the NotI site is

5’-GATATGCGGCCGCCGCATAAACCTGCATGTTGTTGTGTG-3’(SEQ ID NO：48).

5 ' and 3 ' part is cloned in frame among the EcoRI and NotI site of pcDNA3.1/V5-His (Invitrogen), V5 and His label are incorporated in the protein sequence.

RNA separates

With 9.8 * 10 ⁴Cell/cm ²Inoculation HOB cell makes it in 34 ℃ of attachings of spending the night, and transfers in 39 ℃ the DMEM/F-12 substratum, described substratum comprises bovine serum albumin (Serologicals Proteins, Inc, the Kankakee of 0.25% (wt/v), IL), 1% penicillin-Streptomycin sulphate, 2mM glutaMAX-I, 50 μ g/ml ascorbate salts-2-phosphoric acid salt (WakoPure ChemicalIndustries, Ltd., Osaka, Japan) and 10nM sodium menadione sulfate (vitamin K ₃).After 48 hours, cell washed in phosphate buffer soln (PBS) and separate whole-cell rna with TRlzol reagent (Invitrogen) according to manufacturer's specification sheets.Subsequently, the explanation according to the manufacturer utilizes Oligorex mRNA Maxi test kit (Qiagen, Valencia, CA) extraction polyA (+) RNA fraction.

Transient transfection and protein immunoblotting

With COS-7 or U2OS cell with～80% converge that density (confluentdensity) is inoculated and after 24 hours the explanation according to the manufacturer utilize FuGENE 6 transfection reagents (Roche Molecular Biochemicals, Indianapolis is IN) with total plasmid DNA/143cm of 40 μ g ²Carry out transfection.After the 24-72h, with cytolysis (pH 7.5 for 150mM NaCl, 50mM Tris-HCI, 1mM EDTA, 1% Triton X100,20mM NaF, 2mM vanadic acid sodium, protease inhibitor cocktail (Sigma), 250 μ M phenylmethylsulfonyl fluorides) in lysis buffer.In order to analyze HOB-01-09 clone, in lysis buffer, between the dissolving cell grown into and converge.By in 4 ℃ with 500, the centrifugal 30min clarified extract of 000xg.In order to assess the white stability of beta-catenin, utilize the total plasmid DNA of 6.9 μ g and Lipofectamine 2000 transfection reagents to carry out transfection the explanation according to the manufacturer in 6 orifice plates and behind 24h of U2OS cell inoculation with～80% the density of converging.Behind the 24h, by at hypotonic buffer liquid (10mM Tris-HCl, pH 7.4,200 μ M MgCl ₂Proteolytic enzyme and inhibitors of phosphatases mixture (the two is all from Sigma)) in dissolving subsequently in the Dounce homogenizer through 40 times and in 4 ℃ with 100, the centrifugal 90min of 000xg and prepare the cytoplasm protein extract.In order to carry out immunoblotting, before transferring to 0.45 μ m nitrocellulose filter, the tenuigenin extract of the total cell lysate of 50 μ g or 19 μ g is separated (resolve) by SDS-PAGE under sex change and reductive condition.Film is sealed in the PBS that comprises 0.1% Tween-20 and 5% blotto (SantaCruz), resist with one subsequently (to resist-flag epi-position label 10 μ g/ml; Anti--the his label, 1.4 μ g/ml; Anti--the HA label, 2 μ g/ml; Anti--Tyrosine O-phosphate, 2 μ g/ml; Anti--the white 1.5 μ g/ml of beta-catenin; Anti--beta-actin 1: 5000; Anti--V5,3 μ g/ml; Or anti--Ror2,1 μ g/ml) in 25 ℃ of incubations 2 hours.25 ℃ added with 1: 2000 that HRP puts together two after anti-1 hour, (Amersham Biosciences, Buckinghamshire England), are exposed to the X ray film subsequently and come analyzing film by the enhanced chemoluminescence.When indicating, (0.1% (beta-mercaptoethanol) peeled off 30 minutes and surveyed again with next group antibody in 55 ℃ for 62.5mM Tris-HCI (pH 7.5), 2%SDS in strip buffer with film.

Immunoprecipitation and external autophosphorylation function analysis

The U2OS cell transfecting carried out protein immunoblotting and after 24 hours in lysis buffer cracking and by in 4 ℃ with 500,000xg is centrifugal, and 30min clarifies.The M2 flag affinity agarose (Sigma) one of one milligram total cell lysate and 50 μ l is arised from 4 ℃ of rotation incubations 1 hour.By centrifugal collection pearl, in the lysis buffer that comprises 350mM NaCl, wash three times and in lysis buffer, wash three times, in 50 μ l 2x LDS-PAGE damping fluids, boil, and pass through the protein of SDS-PAGE separate dissolved with reductive agent (Invitrogen).Before detecting, gel is transferred on the nitrocellulose filter of 0.45 μ m with every strain specific antibodies.

In order to carry out the autophosphorylation function analysis, the M2 flag affinity agarose (Sigma) of the total cell lysate of the 3mg in the kinases lysis buffer (lysis buffer of no EDTA) and 50 μ l is arised from 4 ℃ of rotation incubations 1 hour.By in 4 ℃ with 500,000xg is centrifugal, and 30min clarifies extract.The M2 flag affinity agarose (Sigma) one of total cell lysate of 3mg and 50 μ l is arised from 4 ℃ of rotation incubations 1 hour.By centrifugal collection pearl, washing is three times in comprising the kinases lysis buffer of 350mM NaCl, and washing is three times and at kinase reaction damping fluid (10mM MgCl in the kinases lysis buffer ₂, 50mM Tris-HCI pH7.5,1mM dithiothreitol (DTT)) and middle washed twice.Get that 10% pearl carries out that SDS-PAGE analyzes and with residuum be resuspended in comprise 1mM ATP and 15 μ Ci[γ- ³²P] in the 50 μ l kinase reaction damping fluids of ATP.Allow kinase reaction carry out 30 minutes and to stop by adding that in the 1xLDS damping fluid reductive agent (Invitrogen) boils in 30 ℃.By the SDS-PAGE isolated protein, transfer on the nitrocellulose filter of 0.45 μ m and and be exposed to the X ray film 12 hours with intensifying screen in-80 ℃.When indicating, be used in the anti-flag antibody described in the protein immunoblotting subsequently film is surveyed.

Statistical analysis

Data are expressed as mean+/-standard error (SE).Utilize Student ' st check to determine significance,statistical.The result is considered to different on the statistics when p＜0.05.

Embodiment 1

Break up Ror2 genetic expression reduction in late period and suppressed by SFRP-1 the human osteoblast cell

Utilize biochip technology to find Ror2 participant's osteoblast differentiation.For these experiments, to represent the osteoblast differentiation different steps (to be respectively proliferative, early stage and ripe osteoblastic, preceding osteocyte, with osteocyte) from proprietary HOB clone (HOB-03-C5, HOB-03-CE6, HOB-02-C1, HOB-01-C1 and HOB-05-T1) polyA ( ⁺) the RNA sample utilization GLHuman1a chip that is rich in bone and cartilage cDNAs carries out the gene chip analysis.Basic as at Hill AA etc., Genome Biol., 2, (2001), and Hill AA etc., Science, 290,809-12, the preparation target complementary RNA (cRNA) described in (2000) also hybridizes on the Affymetrix GeneChips.11 kinds of biotin labeled contrast cRNA transcripts are added the working curve that is used to generate in the hybridization solution between mean difference (AD) value and the picomole concentration with known concentration.The hypothesis that is 1kB based on average cRNA length is converted to Frequency Per Million with the picomole concentration value.Utilize Affymetrix MAS 4.0 softwares that chip is scanned and analyzes and (Santa Clara CA) calculates the AD value of each probe groups according to the Affymetrix specification sheets.Utilize the working curve that obtains by control transcripts to derive the Frequency PerMillion value of each probe groups with the AD value subsequently.This Analysis and Identification goes out 29 kinds and change the kinases that surpasses twice during osteoblast differentiation.

Once showed the anti-agent of picking of Wnt signal before the Bodine etc., SFRP-1 promotes TNF-a Induced Apoptosis in Osteoblasts (Bodine, P.V.N. etc., WO 01/19855, Bodine, P.V.N. etc., The23rd Meeting of the ASBMR.Phoenix, AZ, 2001), and be engineered to lack SFRP-1 mouse (with Lexicon Genetics, Inc., Woodlands, TX cooperation is made) have a bone forming of raising, Bodine, P.V.N. etc., The 24 ^ThMeeting ofthe ASBMR, San Antonio, TX, 2002.For the SFRP-1 mechanism of action is made characterized, to from the polyA of osteocyte before the HOB-01-09 ( ⁺) RNA carries out the gene chip analysis, expression SFRP-1 or control vector are crossed in described prebone cytotostatic ground.Biochip technology also is used for studying the transcriptional profile that the SFRP-1 knock-out mice is compared with the wild-type contrast.

Icp gene chip results of screening, the applicant finds that a kind of kinase whose expression not only changes during osteoblast differentiation, also be subjected to the regulation and control that SFRP-1 expresses.This is the Ror2 kinases, and its mRNA expresses along with scleroblast reduces (Figure 1A) to the development of osteocyte phenotype, and the expression of SFRP-1 simultaneously improves.Confirm the variation (figure lA) of Ror2 mRNA level by RT-PCR.(Applied Biosystems, Foster City CA) will be used for identical PolyA (+) the RNA sample that gene chip analyzes and carry out real-time RT-PCR to utilize ABI PRISM 7700 Sequence DetectionSystem according to manufacturer's specification sheets.The sequence of the primer and probe is listed in the table 1.

Table 1

Used primer and probe in the real-time RT-PCR of people Ror1 is analyzed

Forward primer, 2993-3013	5’-GTCGACTAGCACTGGCCATGT-3’	SEQ ID NO：25
			Reverse primer, 3049-3074	5’-CATGTGTGGTAGTAAAGGAATATTTGC-3’	SEQ ID NO：26
Probe, 3018-3044	5’-AGCTTGCCCTCATCAGGATCCAATCAG-3’	SEQ ID NO：27

Used primer and probe in the real-time RT-PCR of people Ror2 is analyzed

Forward primer, 1149-1169	5’-CGTACGCATGGAACTGTGTGA-3’	SEQ ID NO：28
			Reverse primer, 1239-1259	5’-CAAGCGATGACCAGTGGAATT-3’	SEQ ID NO：29
Probe, 1174-1198	5’-CCCTCGTGTAGTCCCCGAGACAGCA-3’	SEQ ID NO：30

Probe carries out mark available from Applied Biosystems and with report thing fluorescence dye FAM.With to the primer of the special report thing fluorescence dye VlC mark of 18SrRNA and probe available from Applied Biosystems and be included in the reaction as internal contrast.The ThermoScript II step in 48 ℃ carried out 30 minutes and with cDNA in 40 circulations of following condition amplification: 95 ℃ of 15 seconds and 60 ℃ 1 minute.The expression of 18SrRNA is measured and is standardized as in utilization at the mRNA of every kind of gene of the calculating of the typical curve method described in the User Bulletin#2 (Applied Biosystems).

Also utilize the expression (Figure 1A) of RT-PCR conclusive evidence Ror2 in the primary human osteoblast cell.The Ror2 expression level is similar in the HOB model observed level in the early stage scleroblast in the human osteoblast cell.Crossing of SFRP-1 expressed the strongly inhibited that causes the Ror2mRNA level in the HOB-01-09 cell, and the cranium of SFRP-1 destructive mouse is expressed the Ror2 information (Fig. 2) that twice is Duoed than the wild-type contrast.As if the expression of other known member Rorl that Ror family is unique also reduces (Figure 1B) during osteoblast differentiation, but not regulated and control by SFRP-1.In fact, the Ror1 level be lower than in the two the cranium of wild-type and the invalid mouse of SFRP-1-limit of detection and in the HOB-01-09 cell SFRP-1 cross and do not change (Fig. 2) after expressing.

DeChiara etc., Nature Genetics, 24,271-4, (2000) and Takeuchi etc., Genes to Cells, 5,71-8, (2000) are reported in the mouse and destroy the Ror2 gene and cause that bone is unusual widely.In addition, Masiakowski etc., Journal of BiologicalChemistry, 267,26181-90, (1992) report Ror1 has the relevant structural domain with SFRP-1 homologous Frizzled-with 2 kinases, and its mediation combines (Fig. 3) with Wnt is proteic.Roszmusz etc., Journal of Biological Chemistry, 276,18485-90, it is identical with SFRP-1 that (2001) are reported in the location of disulfide linkage in the relevant structural domain of the Frizzled-of Ror1.These Notes of Key Datas Ror2 participates in osteoblast differentiation and it participates in Wnt and SFRP-1 signal pathway.

Embodiment 2

The Ror2 expression of gene strengthens during the initial sum late stage that breaks up with mouse bone-forming cell during the initial period of human osteoblast cell's differentiation

For the kinase whose expression of Ror during the commitment that is evaluated at human osteoblast cell differentiation, to the pluripotent human interstital stem cell (hMSC, BioWhittaker, Inc., San Diego, Osteoblast Differentiation CA) is analyzed.Utilization comprises the no phenol red DMEM substratum of 10% heat-inactivated fetal bovine serum (BioWhittaker), 1% penicillin-Streptomycin sulphate and 2mM glutaMAX-I (growth medium) at 5%CO ₂Keep hMSC clone in 37 ℃ in/95% humidifying air incubator.Be inoculated in 96 orifice plates with 992 cells/well hMSC and after 24 hours (0 day) induced osteogenesis 21 days by adding skeletonization substratum (0.1uM dexamethasone, 0.05mM xitix and 10mM β-glycerophosphate are in growth medium).Per 7 days, separate total cell RNA and assess the Ror expression of gene by primer listed in the real-time RT-PCR analysis and utilization table 1 as described in example 1 above and probe.As shown in Fig. 4 A, Ror2 is expressed in differentiation and significantly improves period, observes by the 21st day to surpass 300 times induce.On the contrary, Ror1 is expressed in whole differentiation interior do not change (Fig. 4 A) in period.

In addition, the expression of Ror between the xitix inductive differentiation phase of mouse MC3T3-E1 osteoblast-like cells is monitored.In the MEM substratum that comprises 10% heat-inactivated fetal bovine serum, 1% penicillin-Streptomycin sulphate and 2mM glutaMAX-I in 5%CO ₂Keep the MC3T3-E1 cell for 37 ℃ in/95% humidifying air incubator.With 3 * 10 ⁶Cell/ware is induced differentiation with the cell inoculation growth medium that (when converging, 0 day) added 10mM β-glycerophosphate and xitix (for the first time reinforced (feeding) adds 12.5 μ g/ml and subsequently reinforced 25 μ g/ml that add) by adding in the 100mm plastic culture dish and after 72 hours.Changed substratum in per 48 hours.Per 3 days, separate whole-cell rna and implement as described in example 1 above real-time RT-PCR, except utilizing probe to special primer of rodents GAPDH (Applied Biosystems) and VIC mark as internal reference.

List in the table 2 as the primer of Ror analysis and the sequence of probe.

Table 2

Used primer and probe in the real-time RT-PCR of mouse Ror1 is analyzed

Forward primer, 2350-2370	5’-CCCCGATTTCCCAATTACATG-3’	SEQ ID NO：31
			Reverse primer, 2402-2421	5’-GCCAATGAAACCAGCGATCT-3’	SEQ ID NO：32
Probe, 2373-2395	5’-CCCGAGCCAAGGGATTACACCCC-3’	SEQ ID NO：33

Used primer and probe in the real-time RT-PCR of mouse Ror2 is analyzed

Forward primer, 364-386	5’-ATCCAAGACCTGGACACAACAGA-3’	SEQ ID NO：34
			Reverse primer, 429-448	5’-GAACCCCAGTGGCAGTGATG-3’	SEQ ID NO：35
Probe, 400-424	5’-TCAGCCCGTTGGTAGCCACACACTG-3’	SEQ ID NO：36

Monitor the process that MC3T3 is divided into osteoblasts in vitro by RT-PCR with the expression of primer listed in the table 3 and the following two specific specificity scleroblast marks of probe analysis: alkaline phosphatase (AP) and Bone Gla protein (OC).

Table 3

Used primer and probe in the real-time RT-PCR of mouse alkaline phosphatase is analyzed

Forward primer, 1354-1373	5’-GAGACCCACGGTGGAGAAGA-3’	SEQ ID NO：37
			Reverse primer, 1445-1464	5’-GGAGGCATACGCCATCACAT-3’	SEQ ID NO：38
Probe, 1416-1442	5’-CGGCGTCCATGAGCAGAACTACATTCC-3’	SEQ ID NO：39

Used primer and probe in the real-time RT-PCR of mouse Bone Gla protein is analyzed

Forward primer, 78-96	5’-CGGCCCTGAGTCTGACAAA-3’	SEQID NO：40
			Reverse primer, 124-145	5’-GCCGGAGTCTGTTCACTACCTT-3’	SEQID NO：41
Probe, 98-121	5’-CCTTCATGTCCAAGCAGGAGGGCA-3’	SEQID NO：42

The time course that AP shown in Fig. 4 B and OC express shows that the MC3T3 cell reached the ripe osteoblasts in vitro that is characterized as highest level AP expression and entered the matrix mineralization stage after 9 days after 6 days in the skeletonization substratum, and OC raises.Ror2 is expressed in and improves (Fig. 4 B) in the whole differentiation time course.On the contrary, Ror1 is expressed in about 20% (Fig. 4 B) that reduces and reduced at the 19th day its initial value on the identical time course gradually.

Thereby in the human osteoblast cell, Ror2 is expressed in the early stage raising of differentiation, reaches peak value and descend in the osteocyte atomization in latter stage subsequently in the proliferative preosteoblast.In the mouse scleroblast, it is early stage and all improve late period that Ror2 is expressed in whole differentiation.

Embodiment 3

People Ror1 and Ror2 cloning and expression

With Invitrogen Corporation (Carlsbad, CA) cooperation human cloning Ror1 and Ror2, and be expressed as SEQ ID NO:3 and 5 respectively.The Ror1 sequence has following replacement: T590C (silence), T1580G (silence), T1963C (M518T), and A3142G (K911R).Disclosed sequence has two Nucleotide difference: C2088T (silence) and G2455A (V8191) among Ror2 sequence and the US 5,843,749.Because the row number among the variation US 5,843,749 of 5 ' UTRs length is different and can be by Ror1 being deducted 35 and obtain by Ror2 is added 199.

Preparation is for total length Ror1 and Ror2 and for the expression plasmid (Fig. 5 A) of two kinds of Ror2 mutant.In first kind of Ror2 mutant (Ror2KD), with position 504 (in the ATP binding domains of inferring), 3 Methionins on 507 and 509 substitute with Isoleucine and in second kind of mutant (Ror2 Δ C) deleted the intact cell matter part that comprises the Tyrosylprotein kinase homologous region.Whole four kinds of expression plasmids all comprise the terminal flag epi-position of COOH-label and are used for proteinic evaluation.Protein immunoblotting shows Ror1-flag, and Ror2flag and Ror2KD-flag be high level expression in the U2OS osteosarcoma cell, and Ror2 Δ C-flag shows lower level expression (Fig. 5 B).The two can both be precipitated out (Fig. 5 C, bottom column) Ror2-flag and Ror2KD-flag from the U2OS extract on flag affinity agarose.But, the Ror2KD mutant can not make himself phosphorylation (Fig. 5 C, top column) confirm that it has lost its kinase activity in the test of external autophosphorylation.As testing at enforcement Flag immunoprecipitation described in the general method and external autophosphorylation.

Embodiment 4

Ror2 kinase inhibition Wnt-3, but the Wnt-1 activity strengthened

Whether participate in the Wnt signal in order to assess the Ror2 kinases, implement the test of a kind of luciferase report thing.With 20,000 cells/well the U2OS cell inoculation is carried out transfection according to manufacturer's explanation in 96 orifice plates and in Lipofectamine 2000 transfection reagents (Invitrogen) that utilize 0.16 μ l/ hole after 24 hours in not containing antibiotic substratum.The combination of following DNAs is used in every hole, is adjusted to 230ng:180ng 16xTCF-luc (plasmid at general method partly is described) with pcDNA3.1 (+); 5ngWnt-1-HA or Wnt-3-HA; 15ngSFRP-1; 5ngpCMV; The Ror1-flag of specified amount, Ror2-flag or Ror2 Δ C-flag.4 hours replacing substratum behind the adding DNA, and after 24 hours, at the sucking-off substratum with in PBS after the rinsing, utilize Luciferase Assay Reagent (Promega) test luciferase activity and utilize Galacto-Light (AppliedBiosystems) test beta-galactosidase enzymes (activity of β-gal) with lysis and to extract.By MicroLumat LB 96P luminometer (EG ﹠amp; GBerthold, Bandoora, Australia) measuring light emission is 5 second for the integration above 10 seconds to β-gal to luciferase.To be standardized as the value of β-gal for the light emission value that luciferase obtains.The expression of luciferase reporter gene is stimulated and is surpassed 20 times behind U2OS cell and Wnt-3-HA construct cotransfection, described gene comprise 16 copies in 5 ' the reactive TCF binding site (Fig. 6 A) of Wnt-that is fused on the minimum thymidine kinase promotor.Suppressed Wnt-3-inductive promotor with Ror2-flag cotransfection dose-dependently ground and activated, the hole of IC50=5.8ng/96 orifice plate, maximum 68% (Fig. 6 A) that suppress.IC50 refers to that observed realization 50% maximum activity suppresses required amount of reagent when only having Wnt.Ror2-flag self is for not influence (Fig. 6 A) of promoter activity.SFRP-1, the potent inhibitor of Wnt signal suppresses the Wnt-3-HA activity, and SFRP-l and Ror2-flag further suppress it together.On the contrary, when identical promotor was activated by Wnt-1-HA, Ror2-flag strengthened the Wnt-1 activity, with two stage dose response (Fig. 6 B).Adding SFRP-1 has overcome this enhancing and luciferase activity has been suppressed to level (Fig. 6 B) identical when only having Wnt-1-HA.

Embodiment 5

Ror1 kinase inhibition Wnt-3, but to the active not effect of Wnt-1

In order to assess the effect of Ror1, carry out the analysis of luciferase report thing as described in example 4 above for the Wnt pathway activities.As shown in Figure 7A, Rorl-flag itself does not have activity for the TCF promotor, but suppresses signal by Wnt-3-HA, IC50=5ng/ hole, maximum inhibition 37%..The Ror1-flag that adds with any dosage that is checked does not influence (Fig. 7 B) to transcribing of Wnt-1-HA-stimulation.

Embodiment 6

Active most of inhibition is essential to the tyrosine kinase activity of Ror2 for the enhancing of Wnt-1 with for Wnt-3

Whether in order to study the Ror2 kinase activity is essential for the adjusting of Wnt signal, utilizes the Ror2KD point mutation that does not have tyrosine kinase activity to carry out luciferase report thing analysis (seeing Fig. 5 C) as described in example 4 above.This mutant does not strengthen the signal (Fig. 8 A) of Wnt-1 to TCF promotor and only faintly suppresses the Wnt-3 inductive activation (Fig. 8 B) of promotor.

The Ror2 mutant (Ror2 Δ C-flag) that utilization lacks complete cytoplasmic structure territory obtains similar result.Ror2 Δ C-flag does not strengthen Wnt-1-HA activity (Fig. 9 B) and has lost it yet and suppress the part ability (Fig. 9 A) of Wnt-3 signal in the U2OS cell.Thereby active most of inhibition is essential to the tyrosine kinase activity of Ror2 for the enhancing of Wnt-1 signal with for Wnt-3.

Embodiment 7

Ror2 and Ror2KD are in conjunction with Wnt-1 and Wnt-3

Ror2 distinguishes between different Wnts

In order to assess the Ror2 direct combination possible to Wnts, as at the enforcement immunoprecipitation experiment described in the general method, the COS-7 or the U2OS cell of cotransfection carried out in described experiment utilization with the Wnts1 and 3 of Ror2-flag and HA-mark.Figure 10 show Wnt-1 and Wnt-3 the two all with the mixture of Ror2 in immunoprecipitation.Interactional specificity proved by such fact, promptly anti--flag can not be when disappearance Ror2-flag coexpression immunoprecipitation Wnts.Losing kinase activity does not influence the ability of Ror2 in conjunction with Wnts because Wnt-1 and Wnt-3 the two all with the mixture of Ror2KD in immunoprecipitation (Figure 10).

For the interactional specificity of Ror2-Wnt is described, implement a kind of immunoprecipitation experiment, described experiment utilizes a different set of Wnt albumen (Figure 11).In this experiment, when lacking or having Ror2, in the COS7 cell, cross the Wnts that expresses ten kinds of different HA-marks.As shown in Figure 11, observe Ror2, follow by Wnt3 optimally in conjunction with Wnt3a, 4,2,1,5b and 5a.Ror2 does not have other Wnts height (Figure 11, bottom column) only faintly in conjunction with Wnt6 and 7a although the Wnt6 in the COS7 cell expresses.Ror2 not under our experiment condition in conjunction with Wnt7b.Thereby Ror2 shows specificity in the interaction of itself and Wnts.

Embodiment 8

Crossing of Wnt-1 and Wnt-3 expressed the not influence of Ror2 autophosphorylation

When the Ror2 immunoprecipitation went out the U2OS extract, it was had the ability in external himself phosphorylation (seeing Fig. 5 C) that makes, and may be because its inherent tyrosine kinase activity.For whether the coexpression of determining Wnts influences the degree of Ror2 autophosphorylation, have Wnt-1, under the situation of Wnt-3 or control plasmid with Ror2 transient transfection U2OS cell.Separate full cell extract after 24 hours.Immunoprecipitation Ror2-flag and as carrying out the test of external autophosphorylation described in the general method (General Methods) on flag affinity agarose.Figure 12 A shows a kind of exemplary radioautograph, after connect the western blotting of same film.In Figure 12 B, (Bio-Rad, Hercules CA) quantize the result of three independent experiments and radiated signal is standardized as the total amount that is present in the immunoreactivity Ror2 in each reaction at least to utilize Quantity One 1-D image analysis software.Lacking or existing Wnts 1 and 3 o'clock Ror2 autophosphorylations not to have marked difference.

Embodiment 9

Ror2 suppresses the white stabilization of Wnt inductive beta-catenin

For where Ror2 in the Wnt signal pathway that illustrates at classics acts in, the ability that the Ror2 kinases is influenced the white stabilization of endochylema beta-catenin of Wnt mediation is assessed.After Wnt1 or 3 was transfected into the U2OS cell, the tenuigenin level that beta-catenin is white had increased 1.7-or 2.8 times (Figure 13) respectively repeatablely.The Ror2 that consumption increases gradually carries out cotransfection dose-dependently ground to be suppressed Wnt1 and Wnt3 the two makes the ability of the white stabilization of tenuigenin beta-catenin.Interesting is that the same white stabilization of beta-catenin that effectively suppresses with Ror2 of the Ror2 mutant of kinases deactivation shows that kinase activity is optional for this effect.Thereby Ror2 inductive Wnt3 can be at least in part owing to the white degraded of beta-catenin to the inhibition of TCF promotor signal.But Ror2 must strengthen the signal effect of Wnt3 to the TCF promotor by the downstream effects in the white stabilization of beta-catenin.And this other approach of Ror2 signal must overcome the reduction of Ror2 inductive beta-catenin white level.

Embodiment 10

The model of Ror2 function in the Wnt signal pathway

Figure 14 shows that Ror2 regulates the working model of classical Wnt signal pathway.Ror2 separates from its FZ acceptor with Wnt3 and with them in conjunction with Wnt1, causes the white degraded of beta-catenin to strengthen.This process does not need the tyrosine kinase activity of Ror2 acceptor.In addition, in conjunction with the Wnt1 activation Ror2 kinases dependent signals approach of Ror2, it finally causes the enhancing of TCF promoter activity.As if Wnt is initial to active necessary some other incident of Ror2 in conjunction with the fact prompting Wnt1 that does not regulate the Ror2 kinase activity, i.e. the background level of receptor dimerization, and Ror2 autophosphorylation is enough to functionating.As if Wnt3 do not suppress the activity of Wnt3 to the TCF promotor in conjunction with not activating this other signal pathway and Ror2.But, be essential in the other kinases dependency incident in the white downstream of beta-catenin for this inhibition, because the white stabilization of Ror2 antagonism beta-catenin of kinases deactivation, but lose the ability that it suppresses the TCF promotor.Therefore, Ror2 is determined by the specific Wnts that expresses in cell the net effect of Wnt signal pathway.

Embodiment 11

Identify Ror2 binding partners in the U2OS cell

By immunoprecipitation, carry out mass spectroscopy subsequently and identify the Ror2 binding partners.For this reason, at first will on anti-flag affinity agarose, carry out immunoprecipitation and on the SDS-PAGE of different weight percentage gel, separate with the protein extract of the U2OS cell of pcDNA3.1 (+) or Ror2-flag transient transfection.Silver dyes has identified several the bands (using the arrow mark in Figure 15 A-C) that only are present in the extract that comprises Ror2-flag, may be included in the Ror2-flag itself about 100kDa.Importantly, do not discerned (comparison diagram 15A and D), shown that these albumen are different from Ror2-flag or its proteolysis fragment by anti-flag antibody by several bands that arrow indicates.And some are discerned (Figure 15 E) certain in these protein by anti-phosphotyrosine antibody.Following Ror2-flag and control sample to immunoprecipitation carries out mass spectrum (MS) analysis.SDS is added to from the sample of immunoprecipitation resin elution to 0.05% (w/v).Subsequently sample is dialysed with respect to 0.05% SDS and volume is reduced to about 1/50 of initial volume by evaporation.Subsequently the tricine glue (Invitrogen) of sample application in 10% is gone up and glue is carried out silver dye.Downcut thin slice from glue, across the whole swimming lane of each sample.Reduce protein in each gel thin slice with DTT, use the iodo-acid amide alkylation, and utilize ProGestInvestigator (Promega) to carry out digestion in the tryptic gel.Reduce the volume of sample digestion and return to about 20 μ l subsequently by evaporation, comprise 0.1M acetate and 2% acetonitrile.

Subsequently every kind of sample of 10 microlitres is loaded into the 10cm * 75 μ mC that adorned the Pieofrit syringe needle ₁₈(New Objectives on the reversed-phase column; Woburn, MA), itself and LCQ Deca XP add mass spectrograph (Finnigan; San Jose CA) links together.Write down the peptide quality by scanning m/z scope 375 to 1200.Mode with data dependency obtains fragment ions spectrum (tandem mass spectrum analysis (MS/MS)), connects after wherein each MS scanning all the strongest ionic continuity MS/MS experiment of first three kind from MS scanning.Utilize Sequest program (Finnigan) the MS/MS data that obtain to be retrieved with respect to the Non-redundant data storehouse of NCBI.

Be found by the sedimentary protein of Ror2-flag specific immunity and list in the table 4.

Table 4

Potential Ror2 interaction protein

Potential Ror2 interaction protein	Accession number
		ADP/ATP carrier proteins (adenine nucleotide translocon 2)	AAB96347.1
UDP-glucose ceramide glycosyltransferase sample 1	AAH41098.1
		14-3-3 albumen beta/alpha	NP_003395.1
14-3-3 albumen γ	AAD48408.1
		Ribophorin I	NP_002941.1
Arginine N-methyltransgerase 1	NP_062804.1
		The apoptosis susceptible protein	AAC35008.1
NOTCH2 albumen	AAG37073.1
		SLIM3 (SLIM3)	Q14192

Embodiment 12

The cell intracellular domain of Ror2 and Notch2 acceptor interacts

In order to confirm the interaction between Ror2 and the Notch2, as the construct that comprises people Notch2 cell intracellular domain (Notch21C, bp 5125-7431) at prepared mark described in the general method terminal V5 of COOH and his label.Notch2lC-V5-His and Ror2-Flag cotransfection are gone into the U2OS cell, and as described in the general method with total cell lysate immunoprecipitation of 1mg on M2 flag affinity agarose and on SDS-PAGE, separate.

Figure 16 shows that Notch2lC becomes mixture with the Ror2 immunoprecipitation.Can not under the situation of disappearance Ror2-flag coexpression, the fact of immunoprecipitation Notch2lC show interactional specificity by anti-flag.

Embodiment 13

The preceding osteocyte of the HOB-01-09 that expresses Ror2 and Ror1 was stablized in preparation

In order to study the Ror kinases to the physiological effect of scleroblast, we stablized expression Ror2, Ror2-Flag and Ror1-Flag in a kind of our human osteoblast cell system.We use the preceding osteocyte of the HOB-01-09 with low-level endogenous Ror2 (being similar to the preceding osteocyte of HOB-01-C1 among Fig. 1).Once introduced the HOB-01-09 cell before

(Bodine，P.V.N.(Wyeth Corp.)Composition comprising asecreted frizzled related protein-useful for the treatment of e.g.osteoarthritis.PCT#WO200119855-A2；2000)，

The ATCC preservation of this cell.Ror2 among the pcDNA3.1 (+), Ror2-Flag and Ror1-flag or empty pcDNA3.1 (+) go in the HOB-01-09 cell by electroporation transfection.To transfection each time, all in PBS 8 * 10 ⁶Cell adds the plasmid DNA of 10 μ g and incubation on ice 5 minutes.With following parameters: 100 μ F, 48Ohms, 150V (pulse duration-10msec), (BTX, SanDiego carry out electroporation to mixture in CA) at the cuvette in 2mm gap to utilize ECM 600 electroporation apparatuss (BTX).With cell in cooled on ice 5 minutes, transfer in the culturing bottle of 150mm, and utilize the DMEM/F-12 substratum (HOB growth medium) of 2mM glutaMAX-I comprise 10% heat-inactivated fetal bovine serum, 1% penicillin-Streptomycin sulphate and to have added 500 μ g/ml G418 (Invitrogen) at 5%CO ₂Keep in 34 ℃ in/95% humidifying air incubator, up to the separation colony that forms the G418 resistant cell.Colony is transferred on 96 orifice plates with tryptic digestion and ground, every hole.Colony is grown in the HOB growth medium that has added 125 μ g/ml G418 and by real-time RT-PCR and western blotting assessment Ror expression levels in 34 ℃.This operation has produced several clones, and described clone has 3-5 times of Ror2 when expressing the HOB-01-09 cell comparison of blank carrier with mistake, and Ror2-Flag and Ror1-Flag mRNA cross expression (Figure 17 A).These clones also demonstrate the expression (Figure 17 B) of the immunoreactive protein of suitable size.Our these clones of inference are crossed and are expressed Ror2 and Ror1 and can be used for assessing the effect of Ror kinases to osteoblasts in vitro, comprise apoptosis, alkaline phosphatase activities and Bone Gla protein excretory effect.

Embodiment 14

Conclusive evidence Ror2 is the medicine for treating osteoporosis target

By method conclusive evidence Ror2 in external and the body is the medicine for treating osteoporosis target.Preparation specificity in mammalian cell is destroyed the siRNA molecule that Ror2 expresses.In having the early stage scleroblast of high-level relatively Ror2mRNA, cross and express siRNA and monitor the effect that Ror2 destroys pair cell differentiation and/or survival.Carry out the gene chip analysis to identify in the scleroblast gene by the Ror2 expression regulation.Based on the Ror2 expression pattern and with the relation of SFRP-1 and Wnt signal, the downward modulation of Ror2 strengthens osteoblast differentiation and also promotes apoptosis.Cross expression Ror2-flag in the preceding osteocyte with detection level Ror2mRNA but a kind of compensation process is included in, and monitor the differentiation state of these cells.After the external conclusive evidence, by generating transgenic mice and being undertaken proving conclusively in the body of Ror2 as the osteoporosis target by formation condition Ror knock-out mice, described transgenic mice is crossed expression Ror2 with tissue and/or time dependent mode conditionality ground.

Embodiment 15

High flux screening is identified the Ror2 adjusting control agent

With the Ror2 phosphorylation as the basis of high flux screening (HTS) to identify the small molecules agonist or to pick anti-agent.Discovery by external target conclusive evidence determines whether to seek activator or the inhibitor of Ror2 and screen receptor stimulant.It is believed that the general mechanism of receptor tyrosine kinase activatory be by acceptor oligomerization and autophosphorylation (referring to, Forrester, W.C., Cellular ﹠amp; Molecular Life Sciences, 59,83-96, (2002), and reference wherein), so can expect its activity of molecular regulation of regulating receptor phosphorylation.Make the people Ror2 expression plasmid that comprises the terminal GST label of COOH and produce the protein in the bacterial cell and be attached on the porous plate of gluthatione coating.Behind unconjugated protein flush away,, utilize the chemoluminescence agent to detect subsequently and measure the phosphorylation level of Ror2 tyrosine by for example anti-phosphotyrosine antibody.Under the situation that has ATP and divalent cation, library of compounds is screened the molecule that strengthens the Ror2 phosphorylation level subsequently.This is a kind of not celliferous HTS, general still may produce " false positive " than strong more based on the screening of cell and be easy to set up, i.e. invalid compound in intact cell.Perhaps, can utilize other based on cell and do not set up HTS based on the method for cell.These include, but not limited to, and it picks the possibility that anti-Ror2 destroys the ability of Wnt-3 signal pathway to screening compound in the test of TCF promotor luciferase report thing.

Embodiment 16

Confirm to influence the composition of Ror2 kinase activity

The compound that will change the Ror2 kinase activity in HTS is proceeded other analyzed in vitro subsequently.First kind of desk-top affirmation test is included in crosses expression Ror2 and handles with candidate compound in the mammal cell line, carry out protein immunoblotting with anti-phosphotyrosine antibody subsequently.This test also is used to measure and is identified compound for the ability and the effectiveness of regulating the Ror2 kinase activity.Other test is designed to measure the ability that these compounds are prevented human osteoblast cell's death in the mode of Ror2 dependency or dependent/non-dependent or promoted Osteoblast Differentiation, and measures ability and the effectiveness of these compounds for these effects.Other test also is used for measuring the cell selective (for example, by utilizing Hela or other to express the clone of Ror2) of these compounds and these compounds for Ror2 and to the specificity of another kind of family member Ror1.Also adopt other to test and measure the signal event whether these compounds regulate and control the downstream, described incident (for example relates to apoptosis, the caspase activity), differentiation (for example, alkaline phosphatase activities or Bone Gla protein are expressed), or Wnt activity (for example, the beta-catenin white level and the function of testing) by the TCF-luciferase.At last, can in the animal model (for example, OO rat or mouse) of multiple bone forming, osteopenia or osteoporosis, utilize the compound that in these vitro test, presents suitable active.The integrity that can imagine the amount of life-span that the compound that is suppressed to osteocyte/osteocyte apoptosis or promotes osteoblast differentiation will be by prolonging these cells and the ground substance of bone that improves synthetic and mineralising thus and/or keep bone becomes a kind of anabolism bone reagent.

Embodiment 17

High flux screening is identified the Ror2 adjusting control agent

The basis that the Ror2 phosphorylation is used as high flux screening (HTS) is to identify the small molecules agonist or to pick anti-agent.Discovery by external target conclusive evidence determines whether to seek activator or the inhibitor of Ror2 and screen receptor stimulant.It is believed that the general mechanism of receptor tyrosine kinase activatory be by acceptor oligomerization and autophosphorylation (referring to, Forrester, W.C., Cellular ﹠amp; Molecular Life Sciences, 59,83-96, (2002), and reference wherein), so can expect its activity of molecular regulation of regulating receptor phosphorylation.Make the people Ror2 expression plasmid that comprises the terminal GST label of COOH and produce the protein in the bacterial cell and be attached on the porous plate of gluthatione coating.Behind unconjugated protein flush away, utilize the chemoluminescence agent to detect subsequently by for example anti-phosphotyrosine antibody and measure the phosphorylation level of Ror2 tyrosine.Under the situation that has ATP and divalent cation, library of compounds is screened the molecule that strengthens the Ror2 phosphorylation level subsequently.This is a kind of not celliferous HTS, general still may produce " false positive " than strong more based on the screening of cell and be easy to set up, i.e. invalid compound in intact cell.Perhaps, can utilize other based on cell and do not set up HTS based on the method for cell.These include, but not limited to, and it picks the possibility that anti-Ror2 destroys the ability of Wnt-3 signal pathway to screening compound in the test of TCF promotor luciferase report thing.

Embodiment 18

Confirm to influence the composition of Ror2 kinase activity

The compound that will change the Ror2 kinase activity in HTS is proceeded other analyzed in vitro subsequently.First kind of desk-top affirmation test is included in crosses expression Ror2 and handles with candidate compound in the mammal cell line, carry out protein immunoblotting with anti-phosphotyrosine antibody subsequently.This test also is used to measure and is identified compound for the ability and the effectiveness of regulating the Ror2 kinase activity.Other test is designed to measure the ability that these compounds are prevented human osteoblast cell's death in the mode of Ror2 dependency or dependent/non-dependent or promoted Osteoblast Differentiation, and measures ability and the effectiveness of these compounds for these effects.Other test also is used for measuring the cell selective (for example, by utilizing Hela and other to express the clone of Ror2) of these compounds and these compounds for Ror2 and to the specificity of another kind of family member Ror1.Also adopt other to test and measure the signal event whether these compounds regulate and control the downstream, described incident (for example relates to apoptosis, the caspase activity), differentiation (for example, alkaline phosphatase activities or Bone Gla protein are expressed), or Wnt activity (for example, the beta-catenin white level and the function of testing) by the TCF-luciferase.At last, can in the animal model (for example, OO rat or mouse) of multiple bone forming, osteopenia or osteoporosis, utilize the compound that in these vitro test, presents suitable active.The integrity that can imagine the amount of life-span that the compound that is suppressed to osteocyte/osteocyte apoptosis or promotes osteoblast differentiation will be by prolonging these cells and the ground substance of bone that improves synthetic and mineralising thus and/or keep bone becomes a kind of anabolism bone reagent.

Sequence table

<110>Wyeth

Bodine，Peter V.N.

Billard，Julia

＜120〉regulate bone photo and close active novel method

<130>AM101291

<150>US 60/463,364

<151>2003-04-16

<150>US 60/501,340

<151>2003-09-09

<160>48

<170>PatentIn version 3.2

<210>1

<211>55

<212>DNA

＜213〉homo sapiens

<400>1

ctagcgagaa caaaggagat tcaaaggaga tcaaaggaga tcaaaggact agttc 55

<210>2

<211>55

<212>DNA

＜213〉homo sapiens

<400>2

tcgagaacta gtcctttgat ctcctttgat ctcctttgaa tctcctttgt tctcg 55

<210>3

<211>3458

<212>DNA

＜213〉homo sapiens

<400>3

ggtaccggtc cggaattccc gggatggagc gtggagagct ggagcagccg ccaccgccgc 60

cgccgaggga gccccgggac ggcagcccct gggcgcaggg tgcgctgttc tcggagtccg 120

acccagggcg actcacgccc actggtgcga cccggacagc ctgggactga cccgccggcc 180

caggcgaggc tgcagccaga gggctgggaa gggatcgcgc tcgcggcatc cagaggcggc 240

caggcggagg cgagggagca ggttagaggg acaaagagct ttgcagacgt ccccggcgtc 300

ctgcgagcgc cagcggccgg gacgaggcgg ccgggagccc gggaagagcc cgtggatgtt 360

ctgcgcgcgg cctgggagcc gccgccgccg ccgcctcagc gagaggagga atgcaccggc 420

cgcgccgccg cgggacgcgc ccgccgctcc tggcgctgct ggccgcgctg ctgctggccg 480

cacgcggggc tgctgcccaa gaaacagagc tgtcagtcag tgctgaatta gtgcctacct 540

catcatggaa catctcaagt gaactcaaca aagattctta cctgaccctt gatgaaccaa 600

tgaataacat caccacgtct ctgggccaga cagcagaact gcactgcaaa gtctctggga 660

atccacctcc caccatccgc tggttcaaaa atgatgctcc tgtggtccag gagccccgga 720

ggctctcctt tcggtccacc atctatggct ctcggctgcg gattagaaac ctcgacacca 780

cagacacagg ctacttccag tgcgtggcaa caaacggcaa ggaggtggtt tcttccactg 840

gagtcttgtt tgtcaagttt ggcccccctc ccactgcaag tccaggatac tcagatgagt 900

atgaagaaga tggattctgt cagccataca gagggattgc atgtgcaaga tttattggca 960

accgcaccgt ctatatggag tctttgcaca tgcaagggga aatagaaaat cagatcacag 1020

ctgccttcac tatgattggc acttccagtc acttatctga taagtgttct cagttcgcca 1080

ttccttccct gtgccactat gccttcccgt actgcgatga aacttcatcc gtcccaaagc 1140

cccgtgactt gtgtcgcgat gaatgtgaaa tcctggagaa tgtcctgtgt caaacagagt 1200

acatttttgc aagatcaaat cccatgattc tgatgaggct gaaactgcca aactgtgaag 1260

atctccccca gccagagagc ccagaagctg cgaactgtat ccggattgga attcccatgg 1320

cagatcctat aaataaaaat cacaagtgtt ataacagcac aggtgtggac taccggggga 1380

ccgtcagtgt gaccaaatca gggcgccagt gccagccatg gaattcccag tatccccaca 1440

cacacacttt caccgccctt cgtttcccag agctgaatgg aggccattcc tactgccgca 1500

acccagggaa tcaaaaggaa gctccctggt gcttcacctt ggatgaaaac tttaagtctg 1560

atctgtgtga catcccagct tgcgattcaa aggattccaa ggagaagaat aaaatggaaa 1620

tcctgtacat actagtgcca agtgtggcca ttcccctggc cattgcttta ctcttcttct 1680

tcatttgcgt ctgtcggaat aaccagaagt catcgtcggc accagtccag aggcaaccaa 1740

aacacgtcag aggtcaaaat gtggagatgt caatgctgaa tgcatataaa cccaagagca 1800

aggctaaaga gctacctctt tctgctgtac gctttatgga agaattgggt gagtgtgcct 1860

ttggaaaaat ctataaaggc catctctatc tcccaggcat ggaccatgct cagctggttg 1920

ctatcaagac cttgaaagac tataacaacc cccagcaatg gacggaattt caacaagaag 1980

cctccctaat ggcagaactg caccacccca atattgtctg ccttctaggt gccgtcactc 2040

aggaacaacc tgtgtgcatg ctttttgagt atattaatca gggggatctc catgagttcc 2100

tcatcatgag atccccacac tctgatgttg gctgcagcag tgatgaagat gggactgtga 2160

aatccagcct ggaccacgga gattttctgc acattgcaat tcagattgca gctggcatgg 2220

aatacctgtc tagtcacttc tttgtccaca aggaccttgc agctcgcaat attttaatcg 2280

gagagcaact tcatgtaaag atttcagact tggggctttc cagagaaatt tactccgctg 2340

attactacag ggtccagagt aagtccttgc tgcccattcg ctggatgccc cctgaagcca 2400

tcatgtatgg caaattctct tctgattcag atatctggtc ctttggggtt gtcttgtggg 2460

agattttcag ttttggactc cagccatatt atggattcag taaccaggaa gtgattgaga 2520

tggtgagaaa acggcagctc ttaccatgct ctgaagactg cccacccaga atgtacagcc 2580

tcatgacaga gtgctggaat gagattcctt ctaggagacc aagatttaaa gatattcacg 2640

tccggcttcg gtcctgggag ggactctcaa gtcacacaag ctctactact ccttcagggg 2700

gaaatgccac cacacagaca acctccctca gtgccagccc agtgagtaat ctcagtaacc 2760

ccagatatcc taattacatg ttcccgagcc agggtattac accacagggc cagattgctg 2820

gtttcattgg cccgccaata cctcagaacc agcgattcat tcccatcaat ggatacccaa 2880

tacctcctgg atatgcagcg tttccagctg cccactacca gccaacaggt cctcccagag 2940

tgattcagca ctgcccacct cccaagagtc ggtccccaag cagtgccagt gggtcgacta 3000

gcactggcca tgtgactagc ttgccctcat caggatccaa tcaggaagca aatattcctt 3060

tactaccaca catgtcaatt ccaaatcatc ctggtggaat gggtatcacc gtttttggca 3120

acaaatctca aaaaccctac agaattgact caaagcaagc atctttacta ggagacgcca 3180

atattcatgg acacaccgaa tctatgattt ctgcagaact gtaaaatgca caacttttgt 3240

aaatgtggta tacaggacaa actagacggc cgtagaaaag atttatattc aaatgttttt 3300

attaaagtaa ggttctcatt tagcagacat cgcaacaagt accttctgtg aagtttcact 3360

gtgtcttacc aagcaggaca gacactcggc cagaaaaaaa aaaaaaaaaa aaaaaaaagg 3420

gcggccgctc tagagtatcc ctcgaggggc ccaagctt 3458

<210>4

<211>937

<212>PRT

＜213〉homo sapiens

<400>4

Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Leu Leu Ala Leu

1 5 10 15

Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Ala Ala Gln Glu Thr

20 25 30

Glu Leu Ser Val Ser Ala Glu Leu Val Pro Thr Ser Ser Trp Asn Ile

35 40 45

Ser Ser Glu Leu Asn Lys Asp Ser Tyr Leu Thr Leu Asp Glu Pro Met

50 55 60

Asn Asn Ile Thr Thr Ser Leu Gly Gln Thr Ala Glu Leu His Cys Lys

65 70 75 80

Val Ser Gly Asn Pro Pro Pro Thr Ile Arg Trp Phe Lys Asn Asp Ala

85 90 95

Pro Val Val Gln Glu Pro Arg Arg Leu Ser Phe Arg Ser Thr Ile Tyr

100 105 110

Gly Ser Arg Leu Arg Ile Arg Asn Leu Asp Thr Thr Asp Thr Gly Tyr

115 120 125

Phe Gln Cys Val Ala Thr Asn Gly Lys Glu Val Val Ser Ser Thr Gly

130 135 140

Val Leu Phe Val Lys Phe Gly Pro Pro Pro Thr Ala Ser Pro Gly Tyr

145 150 155 160

Ser Asp Glu Tyr Glu Glu Asp Gly Phe Cys Gln Pro Tyr Arg Gly Ile

165 170 175

Ala Cys Ala Arg Phe Ile Gly Asn Arg Thr Val Tyr Met Glu Ser Leu

180 185 190

His Met Gln Gly Glu Ile Glu Asn Gln Ile Thr Ala Ala Phe Thr Met

195 200 205

Ile Gly Thr Ser Ser His Leu Ser Asp Lys Cys Ser Gln Phe Ala Ile

210 215 220

Pro Ser Leu Cys His Tyr Ala Phe Pro Tyr Cys Asp Glu Thr Ser Ser

225 230 235 240

Val Pro Lys Pro Arg Asp Leu Cys Arg Asp Glu Cys Glu Ile Leu Glu

245 250 255

Asn Val Leu Cys Gln Thr Glu Tyr Ile Phe Ala Arg Ser Asn Pro Met

260 265 270

Ile Leu Met Arg Leu Lys Leu Pro Asn Cys Glu Asp Leu Pro Gln Pro

275 280 285

Glu Ser Pro Glu Ala Ala Asn Cys Ile Arg Ile Gly Ile Pro Met Ala

290 295 300

Asp Pro Ile Asn Lys Asn His Lys Cys Tyr Asn Ser Thr Gly Val Asp

305 310 315 320

Tyr Arg Gly Thr Val Ser Val Thr Lys Ser Gly Arg Gln Cys Gln Pro

325 330 335

Trp Asn Ser Gln Tyr Pro His Thr His Thr Phe Thr Ala Leu Arg Phe

340 345 350

Pro Glu Leu Asn Gly Gly His Ser Tyr cys Arg Asn Pro Gly Asn Gln

355 360 365

Lys Glu Ala Pro Trp Cys Phe Thr Leu Asp Glu Asn Phe Lys Ser Asp

370 375 380

Leu Cys Asp Ile Pro Ala Cys Asp Ser Lys Asp Ser Lys Glu Lys Asn

385 390 395 400

Lys Met Glu Ile Leu Tyr Ile Leu Val Pro Ser Val Ala Ile Pro Leu

405 410 415

Ala Ile Ala Leu Leu Phe Phe Phe Ile Cys Val cys Arg Asn Asn Gln

420 425 430

Lys Ser Ser Ser Ala Pro Val Gln Arg Gln Pro Lys His Val Arg Gly

435 440 445

Gln Asn Val Glu Met Ser Net Leu Asn Ala Tyr Lys Pro Lys Ser Lys

450 455 460

Ala Lys Glu Leu Pro Leu Ser Ala Val Arg Phe Met Glu Glu Leu Gly

465 470 475 480

Glu Cys Ala Phe Gly Lys Ile Tyr Lys Gly His Leu Tyr Leu Pro Gly

485 490 495

Met Asp His Ala Gln Leu Val Ala Ile Lys Thr Leu Lys Asp Tyr Asn

500 505 510

Asn Pro Gln Gln Trp Thr Glu Phe Gln Gln Glu Ala Ser Leu Met Ala

515 520 525

Glu Leu His His Pro Asn Ile Val Cys Leu Leu Gly Ala Val Thr Gln

530 535 540

Glu Gln Pro Val Cys Met Leu Phe Glu Tyr Tle Asn Gln Gly Asp Leu

545 550 555 560

His Glu Phe Leu Ile Met Arg Ser Pro His Ser Asp Val Gly Cys Ser

565 570 575

Ser Asp Glu Asp Gly Thr Val Lys Ser Ser Leu Asp His Gly Asp Phe

580 585 590

Leu His Ile Ala Ile Gln Tle Ala Ala Gly Met Glu Tyr Leu Ser Ser

595 600 605

His Phe Phe Val His Lys Asp Leu Ala Ala Arg Asn Ile Leu Ile Gly

610 615 620

Glu Gln Leu His Val Lys Ile Ser Asp Leu Gly Leu Ser Arg Glu Ile

625 630 635 640

Tyr Ser Ala Asp Tyr Tyr Arg Val Gln Ser Lys Ser Leu Leu Pro Ile

645 650 655

Arg Trp Met Pro Pro Glu Ala Ile Met Tyr Gly Lys Phe Ser Ser Asp

660 665 670

Ser Asp Ile Trp Ser Phe Gly Val Val Leu Trp Glu Tle Phe Ser Phe

675 680 685

Gly Leu Gln Pro Tyr Tyr Gly Phe Ser Asn Gln Glu Val Ile Glu Met

690 695 700

Val Arg Lys Arg Gln Leu Leu Pro Cys Ser Glu Asp Cys Pro Pro Arg

705 710 715 720

Met Tyr Ser Leu Met Thr Glu Cys Trp Asn Glu Ile Pro Ser Arg Arg

725 730 735

Pro Arg Phe Lys Asp Ile His Val Arg Leu Arg Ser Trp Glu Gly Leu

740 745 750

Ser Ser His Thr Ser Ser Thr Thr Pro Ser Gly Gly Asn Ala Thr Thr

755 760 765

Gln Thr Thr Ser Leu Ser Ala Ser Pro Val Ser Asn Leu Ser Asn Pro

770 775 780

Arg Tyr Pro Asn Tyr Met Phe Pro Ser Gln Gly Ile Thr Pro Gln Gly

785 790 795 800

Gln Ile Ala Gly Phe Ile Gly Pro Pro Ile Pro Gln Asn Gln Arg Phe

805 810 815

Ile Pro Ile Asn Gly Tyr Pro Ile Pro Pro Gly Tyr Ala Ala Phe Pro

820 825 830

Ala Ala His Tyr Gln Pro Thr Gly Pro Pro Arg Val Ile Gln His Cys

835 840 845

Pro Pro Pro Lys Ser Arg Ser Pro Ser Ser Ala Ser Gly Ser Thr Ser

850 855 860

Thr Gly His Val Thr Ser Leu Pro Ser Ser Gly Ser Asn Gln Glu Ala

865 870 875 880

Asn Ile Pro Leu Leu Pro His Met Ser Ile Pro Asn His Pro Gly Gly

885 890 895

Met Gly Ile Thr Val Phe Gly Asn Lys Ser Gln Lys Pro Tyr Arg Tle

900 905 910

Asp Ser Lys Gln Ala Ser Leu Leu Gly Asp Ala Asn Ile His Gly His

915 920 925

Thr Glu Ser Met Ile Ser Ala Glu Leu

930 935

<210>5

<211>2832

<212>DNA

＜213〉homo sapiens

<400>5

atggcccggg gctcggcgct cccgcggcgg ccgctgctgt gcatcccggc cgtctgggcg 60

gccgccgcgc ttctgctctc agtgtcccgg acttcaggtg aagtggaggt tctggatccg 120

aacgaccctt taggacccct tgatgggcag gacggcccga ttccaactct gaaaggttac 180

tttctgaatt ttctggagcc agtaaacaat atcaccattg tccaaggcca gacggcaatt 240

ctgcactgca aggtggcagg aaacccaccc cctaacgtgc ggtggctaaa gaatgatgcc 300

ccggtggtgc aggagccgcg gcggatcatc atccggaaga cagaatatgg ttcacgactg 360

cgaatccagg acctggacac gacagacact ggctactacc agtgcgtggc caccaacggg 420

atgaagacca ttaccgccac tggcgtcctg tttgtgcggc tgggtccaac gcacagccca 480

aatcataact ttcaggatga ttaccacgag gatgggttct gccagcctta ccggggaatt 540

gcctgtgcac gcttcattgg caaccggacc atttatgtgg actcgcttca gatgcagggg 600

gagattgaaa accgaatcac agcggccttc accatgatcg gcacgtctac gcacctgtcg 660

gaccagtgct cacagttcgc catcccatcc ttctgccact tcgtgtttcc tctgtgcgac 720

gcgcgctccc gggcacccaa gccgcgtgag ctgtgccgcg acgagtgcga ggtgctggag 780

agcgacctgt gccgccagga gtacaccatc gcccgctcca acccgctcat cctcatgcgg 840

cttcagctgc ccaagtgtga ggcgctgccc atgcctgaga gccccgacgc tgccaactgc 900

atgcgcattg gcatcccagc cgagaggctg ggccgctacc atcagtgcta taacggctca 960

ggcatggatt acagaggaac ggcaagcacc accaagtcag gccaccagtg ccagccgtgg 1020

gccctgcagc acccccacag ccaccacctg tccagcacag acttccctga gcttggaggg 1080

gggcacgcct actgccggaa ccccggaggc cagatggagg gcccctggtg ctttacgcag 1140

aataaaaacg tacgcatgga actgtgtgac gtaccctcgt gtagtccccg agacagcagc 1200

aagatgggga ttctgtacat cttggtcccc agcatcgcaa ttccactggt catcgcttgc 1260

cttttcttct tggtttgcat gtgccggaat aagcagaagg catctgcgtc cacaccgcag 1320

cggcgacagc tgatggcctc gcccagccaa gacatggaaa tgcccctcat taaccagcac 1380

aaacaggcca aactcaaaga gatcagcctg tctgcggtga ggttcatgga ggagctggga 1440

gaggaccggt ttgggaaagt ctacaaaggt cacctgttcg gccctgcccc gggggagcag 1500

acccaggctg tggccatcaa aacgctgaag gacaaagcgg aggggcccct gcgggaggag 1560

ttccggcatg aggctatgct gcgagcacgg ctgcaacacc ccaacgtcgt ctgcctgctg 1620

ggcgtggtga ccaaggacca gcccctgagc atgatcttca gctactgttc gcacggcgac 1680

ctccacgaat tcctggtcat gcgctcgccg cactcggacg tgggcagcac cgatgatgac 1740

cgcacggtga agtccgccct ggagcccccc gacttcgtgc accttgtggc acagatcgcg 1800

gcggggatgg agtacctatc cagccaccac gtggttcaca aggacctggc cacccgcaat 1860

gtgctagtgt acgacaagct gaacgtgaag atctcagact tgggcctctt ccgagaggtg 1920

tatgccgccg attactacaa gctgctgggg aactcgctgc tgcctatccg ctggatggcc 1980

ccagaggcca tcatgtacgg caagttctcc atcgactcag acatctggtc ctacggtgtg 2040

gtcctgtggg aggtcttcag ctacggcctg cagccctact gcgggtattc caaccaggat 2100

gtggtggaga tgatccggaa ccggcaggtg ctgccttgcc ccgatgactg tcccgcctgg 2160

gtgtatgccc tcatgatcga gtgctggaac gagttcccca gccggcggcc ccgcttcaag 2220

gacatccaca gccggctccg agcctggggc aacctttcca actacaacag ctcggcgcag 2280

acctcggggg ccagcaacac cacgcagacc agctccctga gcaccagccc agtgagcaat 2340

gtgagcaacg cccgctacgt ggggcccaag cagaaggccc cgcccttccc acagccccag 2400

ttcatcccca tgaagggcca gatcagaccc atggtgcccc cgccgcagct ctacatcccc 2460

gtcaacggct accagccggt gccggcctat ggggcctacc tgcccaactt ctacccggtg 2520

cagatcccaa tgcagatggc cccgcagcag gtgcctcctc agatggtccc caagcccagc 2580

tcacaccaca gtggcagtgg ctccaccagc acaggctacg tcaccacggc cccctccaac 2640

acatccatgg cagacagggc agccctgctc tcagagggcg ctgatgacac acagaacgcc 2700

ccagaagatg gggcccagag caccgtgcag gaagcagagg aggaggagga aggctctgtc 2760

ccagagactg agctgctggg ggactgtgac actctgcagg tggacgaggc ccaagtccag 2820

ctggaagctt ga 2832

<210>6

<211>943

<212>PRT

＜213〉homo sapiens

<400>6

Met Ala Arg Gly Ser Ala Leu Pro Arg Arg Pro Leu Leu Cys Ile Pro

1 5 10 15

Ala Val Trp Ala Ala Ala Ala Leu Leu Leu Ser Val Ser Arg Thr Ser

20 25 30

Gly Glu Val Glu Val Leu Asp Pro Asn Asp Pro Leu Gly Pro Leu Asp

35 40 45

Gly Gln Asp Gly Pro Ile Pro Thr Leu Lys Gly Tyr Phe Leu Asn Phe

50 55 60

Leu Glu Pro Val Asn Asn Ile Thr Ile Val Gln Gly Gln Thr Ala Ile

65 70 75 80

Leu His Cys Lys Val Ala Gly Asn Pro Pro Pro Asn Val Arg Trp Leu

85 90 95

Lys Asn Asp Ala Pro Val Val Gln Glu Pro Arg Arg Ile Ile Ile Arg

100 105 110

Lys Thr Glu Tyr Gly Ser Arg Leu Arg Ile Gln Asp Leu Asp Thr Thr

115 120 125

Asp Thr Gly Tyr Tyr Gln Cys Val Ala Thr Asn Gly Met Lys Thr Ile

130 135 140

Thr Ala Thr Gly Val Leu Phe Val Arg Leu Gly Pro Thr His Ser Pro

145 150 155 160

Asn His Asn Phe Gln Asp Asp Tyr His Glu Asp Gly Phe Cys Gln Pro

165 170 175

Tyr Arg Gly Ile Ala Cys Ala Arg Phe Ile Gly Asn Arg Thr Tle Tyr

180 185 190

Val Asp Ser Leu Gln Met Gln Gly Glu Ile Glu Asn Arg Ile Thr Ala

195 200 205

Ala Phe Thr Met Ile Gly Thr Ser Thr His Leu Ser Asp Gln Cys Ser

210 215 220

Gln Phe Ala Ile Pro Ser Phe Cys His Phe Val Phe Pro Leu Cys Asp

225 230 235 240

Ala Arg Ser Arg Ala Pro Lys Pro Arg Glu Leu Cys Arg Asp Glu Cys

245 250 255

Glu Val Leu Glu Ser Asp Leu Cys Arg Gln Glu Tyr Thr Ile Ala Arg

260 265 270

Ser Asn Pro Leu Ile Leu Met Arg Leu Gln Leu Pro Lys Cys Glu Ala

275 280 285

Leu Pro Met Pro Glu Ser Pro Asp Ala Ala Asn Cys Met Arg Ile Gly

290 295 300

Ile Pro Ala Glu Arg Leu Gly Arg Tyr His Gln Cys Tyr Asn Gly Ser

305 310 315 320

Gly Met Asp Tyr Arg Gly Thr Ala Ser Thr Thr Lys Ser Gly His Gln

325 330 335

Cys Gln Pro Trp Ala Leu Gln His Pro His Ser His His Leu Ser Ser

340 345 350

Thr Asp Phe Pro Glu Leu Gly Gly Gly His Ala Tyr Cys Arg Asn Pro

355 360 365

Gly Gly Gln Met Glu Gly Pro Trp Cys Phe Thr Gln Asn Lys Asn Val

370 375 380

Arg Met Glu Leu Cys Asp Val Pro Ser Cys Ser Pro Arg Asp Ser Ser

385 390 395 400

Lys Met Gly Ile Leu Tyr Ile Leu Val Pro Ser Ile Ala Ile Pro Leu

405 410 415

Val Ile Ala Cys Leu Phe Phe Leu Val Cys Met Cys Arg Asn Lys Gln

420 425 430

Lys Ala Ser Ala Ser Thr Pro Gln Arg Arg Gln Leu Met Ala Ser Pro

435 440 445

Ser Gln Asp Met Glu Met Pro Leu Ile Asn Gln His Lys Gln Ala Lys

450 455 460

Leu Lys Glu Ile Ser Leu Ser Ala Val Arg Phe Met Glu Glu Leu Gly

465 470 475 480

Glu Asp Arg Phe Gly Lys Val Tyr Lys Gly His Leu Phe Gly Pro Ala

485 490 495

Pro Gly Glu Gln Thr Gln Ala Val Ala Ile Lys Thr Leu Lys Asp Lys

500 505 510

Ala Glu Gly Pro Leu Arg Glu Glu Phe Arg His Glu Ala Met Leu Arg

515 520 525

Ala Arg Leu Gln His Pro Asn Val Val Cys Leu Leu Gly Val Val Thr

530 535 540

Lys Asp Gln Pro Leu Ser Met Ile Phe Ser Tyr Cys Ser His Gly Asp

545 550 555 560

Leu His Glu Phe Leu Val Met Arg Ser Pro His Ser Asp Val Gly Ser

565 570 575

Thr Asp Asp Asp Arg Thr Val Lys Ser Ala Leu Glu Pro Pro Asp Phe

580 585 590

Val His Leu Val Ala Gln Ile Ala Ala Gly Met Glu Tyr Leu Ser Ser

595 600 605

His His Val Val His Lys Asp Leu Ala Thr Arg Asn Val Leu Val Tyr

610 615 620

Asp Lys Leu Asn Val Lys Ile Ser Asp Leu Gly Leu Phe Arg Glu Val

625 630 635 640

Tyr Ala Ala Asp Tyr Tyr Lys Leu Leu Gly Asn Ser Leu Leu Pro Ile

645 650 655

Arg Trp Met Ala Pro Glu Ala Ile Met Tyr Gly Lys Phe Ser Ile Asp

660 665 670

Ser Asp Ile Trp Ser Tyr Gly Val Val Leu Trp Glu Val Phe Ser Tyr

675 680 685

Gly Leu Gln Pro Tyr Cys Gly Tyr Ser Asn Gln Asp Val Val Glu Met

690 695 700

Ile Arg Asn Arg Gln Val Leu Pro Cys Pro Asp Asp Cys Pro Ala Trp

705 710 715 720

Val Tyr Ala Leu Met Ile Glu Cys Trp Asn Glu Phe Pro Ser Arg Arg

725 730 735

Pro Arg Phe Lys Asp Ile His Ser Arg Leu Arg Ala Trp Gly Asn Leu

740 745 750

Ser Asn Tyr Asn Ser Ser Ala Gln Thr Ser Gly Ala Ser Asn Thr Thr

755 760 765

Gln Thr Ser Ser Leu Ser Thr Ser Pro Val Ser Asn Val Ser Asn Ala

770 775 780

Arg Tyr Val Gly Pro Lys Gln Lys Ala Pro Pro Phe Pro Gln Pro Gln

785 790 795 800

Phe Ile Pro Met Lys Gly Gln Ile Arg Pro Met Val Pro Pro Pro Gln

805 810 815

Leu Tyr Val Pro Val Asn Gly Tyr Gln Pro Val Pro Ala Tyr Gly Ala

820 825 830

Tyr Leu Pro Asn Phe Tyr Pro Val Gln Ile Pro Met Gln Met Ala Pro

835 840 845

Gln Gln Val Pro Pro Gln Met Val Pro Lys Pro Ser Ser His His Ser

850 855 860

Gly Ser Gly Ser Thr Ser Thr Gly Tyr Val Thr Thr Ala Pro Ser Asn

865 870 875 880

Thr Ser Met Ala Asp Arg Ala Ala Leu Leu Ser Glu Gly Ala Asp Asp

885 890 895

Thr Gln Asn Ala Pro Glu Asp Gly Ala Gln Ser Thr Val Gln Glu Ala

900 905 910

Glu Glu Glu Glu Glu Gly Ser Val Pro Glu Thr Glu Leu Leu Gly Asp

915 920 925

Cys Asp Thr Leu Gln Val Asp Glu Ala Gln Val Glr Leu Glu Ala

930 935 940

<210>7

<211>3248

<212>DNA

＜213〉homo sapiens

<400>7

ggtaccggtc cggaattccc gggatggagc gtggagagct ggagcagccg ccaccgccgc 60

cgccgaggga gccccgggac ggcagcccct gggcgcaggg tgcgctgttc tcggagtccg 120

acccagggcg actcacgccc actggtgcga cccggacagc ctgggactga cccgccggcc 180

caggcgaggc tgcagccaga gggctgggaa gggatcgcgc tcgcggcatc cagaggcggc 240

caggcggagg cgagggagca ggttagaggg acaaagagct ttgcagacgt ccccggcgtc 300

ctgcgagcgc cagcggccgg gacgaggcgg ccgggagccc gggaagagcc cgtggatgtt 360

ctgcgcgcgg cctgggagcc gccgccgccg ccgcctcagc gagaggagga atgcaccggc 420

cgcgccgccg cgggacgcgc ccgccgctcc tggcgctgct ggccgcgctg ctgctggccg 480

cacgcggggc tgctgcccaa gaaacagagc tgtcagtcag tgctgaatta gtgcctacct 540

catcatggaa catctcaagt gaactcaaca aagattctta cctgaccctt gatgaaccaa 600

tgaataacat caccacgtct ctgggccaga cagcagaact gcactgcaaa gtctctggga 660

atccacctcc caccatccgc tggttcaaaa atgatgctcc tgtggtccag gagccccgga 720

ggctctcctt tcggtccacc atctatggct ctcggctgcg gattagaaac ctcgacacca 780

cagacacagg ctacttccag tgcgtggcaa caaacggcaa ggaggtggtt tcttccactg 840

gagtcttgtt tgtcaagttt ggcccccctc ccactgcaag tccaggatac tcagatgagt 900

atgaagaaga tggattctgt cagccataca gagggattgc atgtgcaaga tttattggca 960

accgcaccgt ctatatggag tctttgcaca tgcaagggga aatagaaaat cagatcacag 1020

ctgccttcac tatgattggc acttccagtc acttatctga taagtgttct cagttcgcca 1080

ttccttccct gtgccactat gccttcccgt actgcgatga aacttcatcc gtcccaaagc 1140

cccgtgactt gtgtcgcgat gaatgtgaaa tcctggagaa tgtcctgtgt caaacagagt 1200

acatttttgc aagatcaaat cccatgattc tgatgaggct gaaactgcca aactgtgaag 1260

atctccccca gccagagagc ccagaagctg cgaactgtat ccggattgga attcccatgg 1320

cagatcctat aaataaaaat cacaagtgtt ataacagcac aggtgtggac taccggggga 1380

ccgtcagtgt gaccaaatca gggcgccagt gccagccatg gaattcccag tatccccaca 1440

cacacacttt caccgccctt cgtttcccag agctgaatgg aggccattcc tactgccgca 1500

acccagggaa tcaaaaggaa gctccctggt gcttcacctt ggatgaaaac tttaagtctg 1560

atctgtgtga catcccagct tgcgattcaa aggattccaa ggagaagaat aaaatggaaa 1620

tcctgtacat actagtgcca agtgtggcca ttcccctggc cattgcttta ctcttcttct 1680

tcatttgcgt ctgtcggaat aaccagaagt catcgtcggc accagtccag aggcaaccaa 1740

aacacgtcag aggtcaaaat gtggagatgt caatgctgaa tgcatataaa cccaagagca 1800

aggctaaaga gctacctctt tctgctgtac gctttatgga agaattgggt gagtgtgcct 1860

ttggaaaaat ctataaaggc catctctatc tcccaggcat ggaccatgct cagctggttg 1920

ctatcaagac cttgaaagac tataacaacc cccagcaatg gacggaattt caacaagaag 1980

cctccctaat ggcagaactg caccacccca atattgtctg ccttctaggt gccgtcactc 2040

aggaacaacc tgtgtgcatg ctttttgagt atattaatca gggggatctc catgagttcc 2100

tcatcatgag atccccacac tctgatgttg gctgcagcag tgatgaagat gggactgtga 2160

aatccagcct ggaccacgga gattttctgc acattgcaat tcagattgca gctggcatgg 2220

aatacctgtc tagtcacttc tttgtccaca aggaccttgc agctcgcaat attttaatcg 2280

gagagcaact tcatgtaaag atttcagact tggggctttc cagagaaatt tactccgctg 2340

attactacag ggtccagagt aagtccttgc tgcccattcg ctggatgccc cctgaagcca 2400

tcatgtatgg caaattctct tctgattcag atatctggtc ctttggggtt gtcttgtggg 2460

agattttcag ttttggactc cagccatatt atggattcag taaccaggaa gtgattgaga 2520

tggtgagaaa acggcagctc ttaccatgct ctgaagactg cccacccaga atgtacagcc 2580

tcatgacaga gtgctggaat gagattcctt ctaggagacc aagatttaaa gatattcacg 2640

tccggcttcg gtcctgggag ggactctcaa gtcacacaag ctctactact ccttcagggg 2700

gaaatgccac cacacagaca acctccctca gtgccagccc agtgagtaat ctcagtaacc 2760

ccagatatcc taattacatg ttcccgagcc agggtattac accacagggc cagattgctg 2820

gtttcattgg cccgccaata cctcagaacc agcgattcat tcccatcaat ggatacccaa 2880

tacctcctgg atatgcagcg tttccagctg cccactacca gccaacaggt cctcccagag 2940

tgattcagca ctgcccacct cccaagagtc ggtccccaag cagtgccagt gggtcgacta 3000

gcactggcca tgtgactagc ttgccctcat caggatccaa tcaggaagca aatattcctt 3060

tactaccaca catgtcaatt ccaaatcatc ctggtggaat gggtatcacc gtttttggca 3120

acaaatctca aaaaccctac agaattgact caaagcaagc atctttacta ggagacgcca 3180

atattcatgg acacaccgaa tctatgattt ctgcagaact ggactacaag gacgacgatg 3240

acaagtga 3248

<210>8

<211>945

<212>PRT

＜213〉homo sapiens

<400>8

Met His Arg Pro Arg Arg Arg Gly Thr Arg Pro Pro Leu Leu Ala Leu

1 5 10 15

Leu Ala Ala Leu Leu Leu Ala Ala Arg Gly Ala Ala Ala Gln Glu Thr

20 25 30

Glu Leu Ser Val Ser Ala Glu Leu Val Pro Thr Ser Ser Trp Asn Ile

35 40 45

Ser Ser Glu Leu Asn Lys Asp Ser Tyr Leu Thr Leu Asp Glu Pro Met

50 55 60

Asn Asn Ile Thr Thr Ser Leu Gly Gln Thr Ala Glu Leu His Cys Lys

65 70 75 80

Val Ser Gly Asn Pro Pro Pro Thr Ile Arg Trp Phe Lys Asn Asp Ala

85 90 95

Pro Val Val Gln Glu Pro Arg Arg Leu Ser Phe Arg Ser Thr Ile Tyr

100 105 110

Gly Ser Arg Leu Arg Ile Arg Asn Leu Asp Thr Thr Asp Thr Gly Tyr

115 120 125

Phe Gln Cys Val Ala Thr Asn Gly Lys Glu Val Val Ser Ser Thr Gly

130 135 140

Val Leu Phe Val Lys Phe Gly Pro Pro Pro Thr Ala Ser Pro Gly Tyr

145 150 155 160

Ser Asp Glu Tyr Glu Glu Asp Gly Phe Cys Gln Pro Tyr Arg Gly Ile

165 170 175

Ala Cys Ala Arg Phe Ile Gly Asn Arg Thr Val Tyr Met Glu Ser Leu

180 185 190

His Met Gln Gly Glu Ile Glu Asn Gln Ile Thr Ala Ala Phe Thr Met

195 200 205

Ile Gly Thr Ser Ser His Leu Ser Asp Lys Cys Ser Gln Phe Ala Ile

210 215 220

Pro Ser Leu Cys His Tyr Ala Phe Pro Tyr Cys Asp Glu Thr Ser Ser

225 230 235 240

Val Pro Lys Pro Arg Asp Leu Cys Arg Asp Glu Cys Glu Ile Leu Glu

245 250 255

Asn Val Leu Cys Gln Thr Glu Tyr Ile Phe Ala Arg Ser Asn Pro Met

260 265 270

Ile Leu Met Arg Leu Lys Leu Pro Asn Cys Glu Asp Leu Pro Gln Pro

275 280 285

Glu Ser Pro Glu Ala Ala Asn Cys Ile Arg Ile Gly Ile Pro Met Ala

290 295 300

Asp Pro Ile Asn Lys Asn His Lys Cys Tyr Asn Ser Thr Gly Val Asp

305 310 315 320

Tyr Arg Gly Thr Val Ser Val Thr Lys Ser Gly Arg Gln Cys Gln Pro

325 330 335

Trp Asn Ser Gln Tyr Pro His Thr His Thr Phe Thr Ala Leu Arg Phe

340 345 350

Pro Glu Leu Asn Gly Gly His Ser Tyr Cys Arg Asn Pro Gly Asn Gln

355 360 365

Lys Glu Ala Pro Trp Cys Phe Thr Leu Asp Glu Asn Phe Lys Ser Asp

370 375 380

Leu Cys Asp Tle Pro Ala Cys Asp Ser Lys Asp Ser Lys Glu Lys Asn

385 390 395 400

Lys Met Glu Ile Leu Tyr Ile Leu Val Pro Ser Val Ala Ile Pro Leu

405 410 415

Ala Ile Ala Leu Leu Phe Phe Phe Ile Cys Val Cys Arg Asn Asn Gln

420 425 430

Lys Ser Ser Ser Ala Pro Val Gln Arg Gln Pro Lys His Val Arg Gly

435 440 445

Gln Asn Val Glu Met Ser Met Leu Asn Ala Tyr Lys Pro Lys Ser Lys

450 455 460

Ala Lys Glu Leu Pro Leu Ser Ala Val Arg Phe Met Glu Glu Leu Gly

465 470 475 480

Glu Cys Ala Phe Gly Lys Ile Tyr Lys Gly His Leu Tyr Leu Pro Gly

485 490 495

Met Asp His Ala Gln Leu Val Ala Tle Lys Thr Leu Lys Asp Tyr Asn

500 505 510

Asn Pro Gln Gln Trp Thr Glu Phe Gln Gln Glu Ala Ser Leu Met Ala

515 520 525

Glu Leu His His Pro Asn Ile Val Cys Leu Leu Gly Ala Val Thr Gln

530 535 540

Glu Gln Pro Val Cys Met Leu Phe Glu Tyr Ile Asn Gln Gly Asp Leu

545 550 555 560

His Glu Phe Leu Ile Met Arg Ser Pro His Ser Asp Val Gly Cys Ser

565 570 575

Ser Asp Glu Asp Gly Thr Val Lys Ser Ser Leu Asp His Gly Asp Phe

580 585 590

Leu His Ile Ala Ile Gln Ile Ala Ala Gly Met Glu Tyr Leu Ser Ser

595 600 605

His Phe Phe Val His Lys Asp Leu Ala Ala Arg Asn Ile Leu Ile Gly

610 615 620

Glu Gln Leu His Val Lys Ile Ser Asp Leu Gly Leu Ser Arg Glu Ile

625 630 635 640

Tyr Ser Ala Asp Tyr Tyr Arg Val Gln Ser Lys Ser Leu Leu Pro Ile

645 650 655

Arg Trp Met Pro Pro Glu Ala Ile Met Tyr Gly Lys Phe Ser Ser Asp

660 665 670

Ser Asp Ile Trp Ser Phe Gly Val Val Leu Trp Glu Ile Phe Ser Phe

675 680 685

Gly Leu Gln Pro Tyr Tyr Gly Phe Ser Asn Gln Glu Val Ile Glu Met

690 695 700

Val Arg Lys Arg Gln Leu Leu Pro Cys Ser Glu Asp Cys Pro Pro Arg

705 710 715 720

Met Tyr Ser Leu Met Thr Glu Cys Trp Asn Glu Ile Pro Ser Arg Arg

725 730 735

Pro Arg Phe Lys Asp Ile His Val Arg Leu Arg Ser Trp Glu Gly Leu

740 745 750

Ser Ser His Thr Ser Ser Thr Thr Pro Ser Gly Gly Asn Ala Thr Thr

755 760 765

Gln Thr Thr Ser Leu Ser Ala Ser Pro Val Ser Asn Leu Ser Asn Pro

770 775 780

Arg Tyr Pro Asn Tyr Met Phe Pro Ser Gln Gly Ile Thr Pro Gln Gly

785 790 795 800

Gln Ile Ala Gly Phe Ile Gly Pro Pro Ile Pro Gln Asn Gln Arg Phe

805 810 815

Ile Pro Ile Asn Gly Tyr Pro Ile Pro Pro Gly Tyr Ala Ala Phe Pro

820 825 830

Ala Ala His Tyr Gln Pro Thr Gly Pro Pro Arg Val Ile Gln His Cys

835 840 845

Pro Pro Pro Lys Ser Arg Ser Pro Ser Ser Ala Ser Gly Ser Thr Ser

850 855 860

Thr Gly His Val Thr Ser Leu Pro Ser Ser Gly Ser Asn Gln Glu Ala

865 870 875 880

Asn Ile Pro Leu Leu Pro His Met Ser Ile Pro Asn His Pro Gly Gly

885 890 895

Met Gly Ile Thr Val Phe Gly Asn Lys Ser Gln Lys Pro Tyr Arg Ile

900 905 910

Asp Ser Lys Gln Ala Ser Leu Leu Gly Asp Ala Asn Ile His Gly His

915 920 925

Thr Glu Ser Met Ile Ser Ala Glu Leu Asp Tyr Lys Asp Asp Asp Asp

930 935 940

Lys

945

<210>9

<211>2856

<212>DNA

＜213〉homo sapiens

<400>9

atggcccggg gctcggcgct cccgcggcgg ccgctgctgt gcatcccggc cgtctgggcg 60

gccgccgcgc ttctgctctc agtgtcccgg acttcaggtg aagtggaggt tctggatccg 120

aacgaccctt taggacccct tgatgggcag gacggcccga ttccaactct gaaaggttac 180

tttctgaatt ttctggagcc agtaaacaat atcaccattg tccaaggcca gacggcaatt 240

ctgcactgca aggtggcagg aaacccaccc cctaacgtgc ggtggctaaa gaatgatgcc 300

ccggtggtgc aggagccgcg gcggatcatc atccggaaga cagaatatgg ttcacgactg 360

cgaatccagg acctggacac gacagacact ggctactacc agtgcgtggc caccaacggg 420

atgaagacca ttaccgccac tggcgtcctg tttgtgcggc tgggtccaac gcacagccca 480

aatcataact ttcaggatga ttaccacgag gatgggttct gccagcctta ccggggaatt 540

gcctgtgcac gcttcattgg caaccggacc atttatgtgg actcgcttca gatgcagggg 600

gagattgaaa accgaatcac agcggccttc accatgatcg gcacgtctac gcacctgtcg 660

gaccagtgct cacagttcgc catcccatcc ttctgccact tcgtgtttcc tctgtgcgac 720

gcgcgctccc gggcacccaa gccgcgtgag ctgtgccgcg acgagtgcga ggtgctggag 780

agcgacctgt gccgccagga gtacaccatc gcccgctcca acccgctcat cctcatgcgg 840

cttcagctgc ccaagtgtga ggcgctgccc atgcctgaga gccccgacgc tgccaactgc 900

atgcgcattg gcatcccagc cgagaggctg ggccgctacc atcagtgcta taacggctca 960

ggcatggatt acagaggaac ggcaagcacc accaagtcag gccaccagtg ccagccgtgg 1020

gccctgcagc acccccacag ccaccacctg tccagcacag acttccctga gcttggaggg 1080

gggcacgcct actgccggaa ccccggaggc cagatggagg gcccctggtg ctttacgcag 1140

aataaaaacg tacgcatgga actgtgtgac gtaccctcgt gtagtccccg agacagcagc 1200

aagatgggga ttctgtacat cttggtcccc agcatcgcaa ttccactggt catcgcttgc 1260

cttttcttct tggtttgcat gtgccggaat aagcagaagg catctgcgtc cacaccgcag 1320

cggcgacagc tgatggcctc gcccagccaa gacatggaaa tgcccctcat taaccagcac 1380

aaacaggcca aactcaaaga gatcagcctg tctgcggtga ggttcatgga ggagctggga 1440

gaggaccggt ttgggaaagt ctacaaaggt cacctgttcg gccctgcccc gggggagcag 1500

acccaggctg tggccatcaa aacgctgaag gacaaagcgg aggggcccct gcgggaggag 1560

ttccggcatg aggctatgct gcgagcacgg ctgcaacacc ccaacgtcgt ctgcctgctg 1620

ggcgtggtga ccaaggacca gcccctgagc atgatcttca gctactgttc gcacggcgac 1680

ctccacgaat tcctggtcat gcgctcgccg cactcggacg tgggcagcac cgatgatgac 1740

cgcacggtga agtccgccct ggagcccccc gacttcgtgc accttgtggc acagatcgcg 1800

gcggggatgg agtacctatc cagccaccac gtggttcaca aggacctggc cacccgcaat 1860

gtgctagtgt acgacaagct gaacgtgaag atctcagact tgggcctctt ccgagaggtg 1920

tatgccgccg attactacaa gctgctgggg aactcgctgc tgcctatccg ctggatggcc 1980

ccagaggcca tcatgtacgg caagttctcc atcgactcag acatctggtc ctacggtgtg 2040

gtcctgtggg aggtcttcag ctacggcctg cagccctact gcgggtattc caaccaggat 2100

gtggtggaga tgatccggaa ccggcaggtg ctgccttgcc ccgatgactg tcccgcctgg 2160

gtgtatgccc tcatgatcga gtgctggaac gagttcccca gccggcggcc ccgcttcaag 2220

gacatccaca gccggctccg agcctggggc aacctttcca actacaacag ctcggcgcag 2280

acctcggggg ccagcaacac cacgcagacc agctccctga gcaccagccc agtgagcaat 2340

gtgagcaacg cccgctacgt ggggcccaag cagaaggccc cgcccttccc acagccccag 2400

ttcatcccca tgaagggcca gatcagaccc atggtgcccc cgccgcagct ctacatcccc 2460

gtcaacggct accagccggt gccggcctat ggggcctacc tgcccaactt ctacccggtg 2520

cagatcccaa tgcagatggc cccgcagcag gtgcctcctc agatggtccc caagcccagc 2580

tcacaccaca gtggcagtgg ctccaccagc acaggctacg tcaccacggc cccctccaac 2640

acatccatgg cagacagggc agccctgctc tcagagggcg ctgatgacac acagaacgcc 2700

ccagaagatg gggcccagag caccgtgcag gaagcagagg aggaggagga aggctctgtc 2760

ccagagactg agctgctggg ggactgtgac actctgcagg tggacgaggc ccaagtccag 2820

ctggaagctg actacaagga cgacgatgac aagtga 2856

<210>10

<211>951

<212>PRT

＜213〉homo sapiens

<400>10

Met Ala Arg Gly Ser Ala Leu Pro Arg Arg Pro Leu Leu Cys Ile Pro

1 5 10 15

Ala Val Trp Ala Ala Ala Ala Leu Leu Leu Ser Val Ser Arg Thr Ser

20 25 30

Gly Glu Val Glu Val Leu Asp Pro Asn Asp Pro Leu Gly Pro Leu Asp

35 40 45

Gly Gln Asp Gly Pro Ile Pro Thr Leu Lys Gly Tyr Phe Leu Asn Phe

50 55 60

Leu Glu Pro Val Asn Asn Ile Thr Ile Val Gln Gly Gln Thr Ala Ile

65 70 75 80

Leu His Cys Lys Val Ala Gly Asn Pro Pro Pro Asn Val Arg Trp Leu

85 90 95

Lys Asn Asp Ala Pro Val Val Gln Glu Pro Arg Arg Ile Ile Ile Arg

100 105 110

Lys Thr Glu Tyr Gly Ser Arg Leu Arg Ile Gln Asp Leu Asp Thr Thr

115 120 125

Asp Thr Gly Tyr Tyr Gln Cys Val Ala Thr Asn Gly Met Lys Thr Ile

130 135 140

Thr Ala Thr Gly Val Leu Phe Val Arg Leu Gly Pro Thr His Ser Pro

145 150 155 160

Asn His Asn Phe Gln Asp Asp Tyr His Glu Asp Gly Phe Cys Gln Pro

165 170 175

Tyr Arg Gly Ile Ala Cys Ala Arg Phe Ile Gly Asn Arg Thr Ile Tyr

180 185 190

Val Asp Ser Leu Gln Met Gln Gly Glu Ile Glu Asn Arg Ile Thr Ala

195 200 205

Ala Phe Thr Met Ile Gly Thr Ser Thr His Leu Ser Asp Gln Cys Ser

210 215 220

Gln Phe Ala Ile Pro Ser Phe Cys His Phe Val Phe Pro Leu Cys Asp

225 230 235 240

Ala Arg Ser Arg Ala Pro Lys Pro Arg Glu Leu Cys Arg Asp Glu Cys

245 250 255

Glu Val Leu Glu Ser Asp Leu Cys Arg Gln Glu Tyr Thr Ile Ala Arg

260 265 270

Ser Asn Pro Leu Ile Leu Met Arg Leu Gln Leu Pro Lys Cys Glu Ala

275 280 285

Leu Pro Met Pro Glu Ser Pro Asp Ala Ala Asn Cys Met Arg Ile Gly

290 295 300

Ile Pro Ala Glu Arg Leu Gly Arg Tyr His Gln Cys Tyr Asn Gly Ser

305 310 315 320

Gly Met Asp Tyr Arg Gly Thr Ala Ser Thr Thr Lys Ser Gly His Gln

325 330 335

Cys Gln Pro Trp Ala Leu Gln His Pro His Ser His His Leu Ser Ser

340 345 350

Thr Asp Phe Pro Glu Leu Gly Gly Gly His Ala Tyr Cys Arg Asn Pro

355 360 365

Gly Gly Gln Met Glu Gly Pro Trp Cys Phe Thr Gln Asn Lys Asn Val

370 375 380

Arg Met Glu Leu Cys Asp Val Pro Ser cys Ser Pro Arg Asp Ser Ser

385 390 395 400

Lys Met Gly Ile Leu Tyr Ile Leu Val Pro Ser Ile Ala Ile Pro Leu

405 410 415

Val Ile Ala Cys Leu Phe Phe Leu Val Cys Met Cys Arg Asn Lys Gln

420 425 430

Lys Ala Ser Ala Ser Thr Pro Gln Arg Arg Gln Leu Met Ala Ser Pro

435 440 445

Ser Gln Asp Met Glu Met Pro Leu Ile Asn Gln His Lys Gln Ala Lys

450 455 460

Leu Lys Glu Ile Ser Leu Ser Ala Val Arg Phe Met Glu Glu Leu Gly

465 470 475 480

Glu Asp Arg Phe Gly Lys Val Tyr Lys Gly His Leu Phe Gly Pro Ala

485 490 495

Pro Gly Glu Gln Thr Gln Ala Val Ala Ile Lys Thr Leu Lys Asp Lys

500 505 510

Ala Glu Gly Pro Leu Arg Glu Glu Phe Arg His Glu Ala Met Leu Arg

515 520 525

Ala Arg Leu Gln His Pro Asn Val Val Cys Leu Leu Gly Val Val Thr

530 535 540

Lys Asp Gln Pro Leu Ser Met Ile Phe Ser Tyr Cys Ser His Gly Asp

545 550 555 560

Leu His Glu Phe Leu Val Met Arg Ser Pro His Ser Asp Val Gly Ser

565 570 575

Thr Asp Asp Asp Arg Thr Val Lys Ser Ala Leu Glu Pro Pro Asp Phe

580 585 590

Val His Leu Val Ala Gln Ile Ala Ala Gly Met Glu Tyr Leu Ser Ser

595 600 605

His His Val Val His Lys Asp Leu Ala Thr Arg Asn Val Leu Val Tyr

610 615 620

Asp Lys Leu Asn Val Lys Ile Ser Asp Leu Gly Leu Phe Arg Glu Val

625 630 635 640

Tyr Ala Ala Asp Tyr Tyr Lys Leu Leu Gly Asn Ser Leu Leu Pro Ile

645 650 655

Arg Trp Met Ala Pro Glu Ala Ile Met Tyr Gly Lys Phe Ser Ile Asp

660 665 670

Ser Asp Ile Trp Ser Tyr Gly Val Val Leu Trp Glu Val Phe Ser Tyr

675 680 685

Gly Leu Gln Pro Tyr Cys Gly Tyr Ser Asn Gln Asp Val Val Glu Met

690 695 700

Ile Arg Asn Arg Gln Val Leu Pro Cys Pro Asp Asp Cys Pro Ala Trp

705 710 715 720

Val Tyr Ala Leu Met Ile Glu Cys Trp Asn Glu Phe Pro Ser Arg Arg

725 730 735

Pro Arg Phe Lys Asp Ile His Ser Arg Leu Arg Ala Trp Gly Asn Leu

740 745 750

Ser Asn Tyr Asn Ser Ser Ala Gln Thr Ser Gly Ala Ser Asn Thr Thr

755 760 765

Gln Thr Ser Ser Leu Ser Thr Ser Pro Val Ser Asn Val Ser Asn Ala

770 775 780

Arg Tyr Val Gly Pro Lys Gln Lys Ala Pro Pro Phe Pro Gln Pro Gln

785 790 795 800

Phe Ile Pro Met Lys Gly Gln Ile Arg Pro Met Val Pro Pro Pro Gln

805 810 815

Leu Tyr Val Pro Val Asn Gly Tyr Gln Pro Val Pro Ala Tyr Gly Ala

820 825 830

Tyr Leu Pro Asn Phe Tyr Pro Val Gln Ile Pro Met Gln Met Ala Pro

835 840 845

Gln Gln Val Pro Pro Gln Met Val Pro Lys Pro Ser Ser His His Ser

850 855 860

Gly Ser Gly Ser Thr Ser Thr Gly Tyr Val Thr Thr Ala Pro Ser Asn

865 870 875 880

Thr Ser Met Ala Asp Arg Ala Ala Leu Leu Ser Glu Gly Ala Asp Asp

885 890 895

Thr Gln Asn Ala Pro Glu Asp Gly Ala Gln Ser Thr Val Gln Glu Ala

900 905 910

Glu Glu Glu Glu Glu Gly Ser Val Pro Glu Thr Glu Leu Leu Gly Asp

915 920 925

Cys Asp Thr Leu Gln Val Asp Glu Ala Gln Val Gln Leu Glu Ala Asp

930 935 940

Tyr Lys Asp Asp Asp Asp Lys

945 950

<210>11

<211>1311

<212>DNA

＜213〉homo sapiens

<400>11

atggcccggg gctcggcgct cccgcggcgg ccgctgctgt gcatcccggc cgtctgggcg 60

gccgccgcgc ttctgctctc agtgtcccgg acttcaggtg aagtggaggt tctggatccg 120

aacgaccctt taggacccct tgatgggcag gacggcccga ttccaactct gaaaggttac 180

tttctgaatt ttctggagcc agtaaacaat atcaccattg tccaaggcca gacggcaatt 240

ctgcactgca aggtggcagg aaacccaccc cctaacgtgc ggtggctaaa gaatgatgcc 300

ccggtggtgc aggagccgcg gcggatcatc atccggaaga cagaatatgg ttcacgactg 360

cgaatccagg acctggacac gacagacact ggctactacc agtgcgtggc caccaacggg 420

atgaagacca ttaccgccac tggcgtcctg tttgtgcggc tgggtccaac gcacagccca 480

aatcataact ttcaggatga ttaccacgag gatgggttct gccagcctta ccggggaatt 540

gcctgtgcac gcttcattgg caaccggacc atttatgtgg actcgcttca gatgcagggg 600

gagattgaaa accgaatcac agcggccttc accatgatcg gcacgtctac gcacctgtcg 660

gaccagtgct cacagttcgc catcccatcc ttctgccact tcgtgtttcc tctgtgcgac 720

gcgcgctccc gggcacccaa gccgcgtgag ctgtgccgcg acgagtgcga ggtgctggag 780

agcgacctgt gccgccagga gtacaccatc gcccgctcca acccgctcat cctcatgcgg 840

cttcagctgc ccaagtgtga ggcgctgccc atgcctgaga gccccgacgc tgccaactgc 900

atgcgcattg gcatcccagc cgagaggctg ggccgctacc atcagtgcta taacggctca 960

ggcatggatt acagaggaac ggcaagcacc accaagtcag gccaccagtg ccagccgtgg 1020

gccctgcagc acccccacag ccaccacctg tccagcacag acttccctga gcttggaggg 1080

gggcacgcct actgccggaa ccccggaggc cagatggagg gcccctggtg ctttacgcag 1140

aataaaaacg tacgcatgga actgtgtgac gtaccctcgt gtagtccccg agacagcagc 1200

aagatgggga ttctgtacat cttggtcccc agcatcgcaa ttccactggt catcgcttgc 1260

cttttcttct tggtttgcat gtgcgactac aaggacgacg atgacaagta a 1311

<210>12

<211>436

<212>PRT

＜213〉homo sapiens

<400>12

Met Ala Arg Gly Ser Ala Leu Pro Arg Arg Pro Leu Leu Cys Ile Pro

1 5 10 15

Ala Val Trp Ala Ala Ala Ala Leu Leu Leu Ser Val Ser Arg Thr Ser

20 25 30

Gly Glu Val Glu Val Leu Asp Pro Asn Asp Pro Leu Gly Pro Leu Asp

35 40 45

Gly Gln Asp Gly Pro Ile Pro Thr Leu Lys Gly Tyr Phe Leu Asn Phe

50 55 60

Leu Glu Pro Val Asn Asn Ile Thr Ile Val Gln Gly Gln Thr Ala Ile

65 70 75 80

Leu His Cys Lys Val Ala Gly Asn Pro Pro Pro Asn Val Arg Trp Leu

85 90 95

Lys Asn Asp Ala Pro Val Val Gln Glu Pro Arg Arg Ile Ile Ile Arg

100 105 110

Lys Thr Glu Tyr Gly Ser Arg Leu Arg Ile Gln Asp Leu Asp Thr Thr

115 120 125

Asp Thr Gly Tyr Tyr Gln Cys Val Ala Thr Asn Gly Met Lys Thr Ile

130 135 140

Thr Ala Thr Gly Val Leu Phe Val Arg Leu Gly Pro Thr His Ser Pro

145 150 155 160

Asn His Asn Phe Gln Asp Asp Tyr His Glu Asp Gly Phe Cys Gln Pro

165 170 175

Tyr Arg Gly Ile Ala Cys Ala Arg Phe Ile Gly Asn Arg Thr Ile Tyr

180 185 190

Val Asp Ser Leu Gln Met Gln Gly Glu Ile Glu Asn Arg Ile Thr Ala

195 200 205

Ala Phe Thr Met Ile Gly Thr Ser Thr His Leu Ser Asp Gln Cys Ser

210 215 220

Gln Phe Ala Ile Pro Ser Phe Cys His Phe Val Phe Pro Leu Cys Asp

225 230 235 240

Ala Arg Ser Arg Ala Pro Lys Pro Arg Glu Leu Cys Arg Asp Glu Cys

245 250 255

Glu Val Leu Glu Ser Asp Leu Cys Arg Gln Glu Tyr Thr Ile Ala Arg

260 265 270

Ser Asn Pro Leu Ile Leu Met Arg Leu Gln Leu Pro Lys Cys Glu Ala

275 280 285

Leu Pro MeT Pro Glu Ser Pro Asp Ala Ala Asn Cys Met Arg Ile Gly

290 295 300

Ile Pro Ala Glu Arg Leu Gly Arg Tyr His Gln Cys Tyr Asn Gly Ser

305 310 315 320

Gly Met Asp Tyr Arg Gly Thr Ala Ser Thr Thr Lys Ser Gly His Gln

325 330 335

Cys Gln Pro Trp Ala Leu Gln His Pro His Ser His His Leu Ser Ser

340 345 350

Thr Asp Phe Pro Glu Leu Gly Gly Gly His Ala Tyr Cys Arg Asn Pro

355 360 365

Gly Gly Gln Met Glu Gly Pro Trp Cys Phe Thr Gln Asn Lys Asn Val

370 375 380

Arg Met Glu Leu Cys Asp Val Pro Ser Cys Ser Pro Arg Asp Ser Ser

385 390 395 400

Lys Met Gly Ile Leu Tyr Ile Leu Val Pro Ser Ile Ala Ile Pro Leu

405 410 415

Val Ile Ala Cys Leu Phe Phe Leu Val Cys Met Cys Asp Tyr Lys Asp

420 425 430

Asp Asp Asp Lys

435

<210>13

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror1-flag

<400>13

ctcatcagga tccaatcagg 20

<210>14

<211>65

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror1-flag

<400>14

tgagcgcggc cgctgctcac ttgtcatcgt cgtccttgta gtccagttct gcagaaatca 60

tagat 65

<210>15

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror2-flag

<400>15

agttccccag ccggcggccc cgctt 25

<210>16

<211>37

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror2-flag

<400>16

tacgattcta gatgtcaagc ttccagctgg acttggg 37

<210>17

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror2-flag

<400>17

gaccttggta ccatggcccg gggctcggcg ct 32

<210>18

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror2-flag

<400>18

tcgttcggat ccagaacctc cac 23

<210>19

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror2-flag

<400>19

gctcacacca cagtggcagt gg 22

<210>20

<211>61

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror2-flag

<400>20

ctggaatcta gatcacttgt catcgtcgtc cttgtagtca gcttccagct ggacttgggc 60

c 61

<210>21

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror2KD-flag

<400>21

ggctgtggcc atcataacgc tgatagacat agcggagggg c 41

<210>22

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror2KD-flag

<400>22

gcccctccgc tatgtctatc agcgttatga tggccacagc c 41

<210>23

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the last strand primer of Ror2deltac-flag

<400>23

ccttctgcca cttcgtgttt cctct 25

<210>24

<211>65

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to make up the following strand primer of Ror2deltac-flag

<400>24

gacctttcta gattacttgt catcgtcgtc cttgtagtcg cacatgcaaa ccaagaagaa 60

aaggc 65

<210>25

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of identifier Ror1

<400>25

gtcgactagc actggccatg t 21

<210>26

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of identifier Ror1

<400>26

catgtgtggt agtaaaggaa tatttgc 27

<210>27

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of identifier Ror1

<400>27

agcttgccct catcaggatc caatcag 27

<210>28

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of identifier Ror2

<400>28

cgtacgcatg gaactgtgtg a 21

<210>29

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of identifier Ror2

<400>29

caagcgatga ccagtggaat t 21

<210>30

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of identifier Ror2

<400>30

ccctcgtgta gtccccgaga cagca 25

<210>31

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of evaluation mouse Ror1

<400>31

ccccgatttc ccaattacat g 21

<210>32

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of evaluation mouse Ror1

<400>32

gccaatgaaa ccacggatct 20

<210>33

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of evaluation mouse Ror1

<400>33

cccgagccaa gggattacac ccc 23

<210>34

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of evaluation mouse Ror2

<400>34

atccaagacc tggacacaac aga 23

<210>35

<211>20

<212>DNA

＜213〉reverse primer of evaluation mouse Ror2

<400>35

gaaccccagt ggcagtgatg 20

<210>36

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of evaluation mouse Ror2

<400>36

tcagcccgtt ggtagccaca cactg 25

<210>37

<211>20

<212>DNA

＜213〉forward primer of evaluation mouse alkaline phosphatase

<400>37

gagacccacg gtggagaaga 20

<210>38

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of evaluation mouse alkaline phosphatase

<400>38

ggaggcatac gccatcacat 20

<210>39

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of evaluation mouse alkaline phosphatase

<400>39

cggcgtccat gagcagaact acattcc 27

<210>40

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of evaluation mouse Bone Gla protein

<400>40

cggccctgag tctgacaaa 19

<210>41

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of evaluation mouse Bone Gla protein

<400>41

gccggagtct gttcactacc tt 22

<210>42

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉probe of evaluation mouse Bone Gla protein

<400>42

ccttcatgtc caagcaggag ggca 24

<210>43

<211>2000

<212>DNA

＜213〉homo sapiens

<400>43

gggctgggag tctggagtcc atgacctgct gggacatact ttgggctgca ttttttcccc 60

cttctaatgt ctcagctctc agggatctgc ttttcctggt gccaaggagt atggatgaaa 120

ttttgtccct cctccatgca cccctataaa acaaatatga tgagaaatta atattttcca 180

aatggtgacc taacctttgt tcattaattg agctcctatt gcattccagg tactgttaga 240

ggccagcaag atacctagat gattgagaca gagtcctcgc cctccatgaa gtgactgttc 300

attttaaaac cctaaagctg ggttcttaga ggctactgca acagcaacaa ctcccgagtg 360

agtgcttatc atgtgccagg ctctggttac aggctttaac tctctcagtg gaaacagcct 420

gagtgctggc ttggctaccc catgtctgtg agactgtggg caagtcattt actttccctt 480

tgagtttcaa tttctaaaac tgtaatatgg ggataatata tgtaaaacag ctaagaagta 540

tatactttta atgactcttt ttagtgtcaa tggaggattt gtgagcaaat gcatataaaa 600

cacaaggcaa acaggaggta tttagtaagt ggccaagtga ttattgagag actatgggct 660

tcttcctgtt cctccagagc aagactgaca ggtgtcctat tacccttgca tcttcagagc 720

ctagagcaca gccctgaaaa cagcaggcgc tcaccacttt ttatgatcaa aggcagtctc 780

tacagggaaa gtcaaatcat tatgggtatt tatgaattac aaaatccata aagttaaacc 840

aggagaaatg gacaaaaaca cactcattgt agaggtcttt aatgatccct tggctcatgg 900

cagagcagct agacaaaaaa caaacaaaca aacaaacatg caaagattca gaaggcctga 960

aaaaataatg aatacaaaga agataaatcg atacagtatt ctatcttcac attcggaaga 1020

caaaaacacc tttcaaaaaa ccatgggaca ttggcaaaaa taaccacaga taatcctcaa 1080

taaatcttgc caggaggcag tacagatgac attgaattca gtgagactac aaattaaaga 1140

caaaaaggcg aagtataaat tacttgtgta agaactctct caactcttgg gtccaagaag 1200

aaagcaaaag ggaaattgta tgatagcaat aaatgtgcca ttacccagag tcacacagct 1260

aacagtgaca cagctgaggc tgctagaacc tgggtctact gtcgtccagc cacgaactgg 1320

cttgagatcc cggataagtc tctctgagcc tcggtttccc cttctgtcaa gtagcctcga 1380

aggtccccgg cgctcggttc ggtggcgagt ttgaggagtg tgggggaggg gaggggaggg 1440

agcgtgcccg agacgcggga gccgcgaccg ctttctgcga agtcggggag ggtgcgggcg 1500

ttgagaggct gcagcagagg gcgctgggtc gccagcctgg gccgcgtctc ccattggtcg 1560

gggctggggc gctgggctgg agagttggtg gaaagtgaca agttgagcga gagagggagc 1620

gtggagagct ggagcagccg ccaccgccgc cgccgaggga gccccgggac ggcagcccct 1680

gggcgcaggg tgcgctgttc tcggagtccg acccagggcg actcacgccc actggtgcga 1740

cccggacagc ctgggactga cccgccggcc caggcgaggc tgcagccaga gggctgggaa 1800

gggatcgcgc tcgcggcatc cagaggcggc caggcggagg cgagggagca ggttagaggg 1860

acaaagagct ttgcagacgt ccccggcgtc ctgcgagcgc cagcggccgg gacgaggcgg 1920

ccgggagccc gggaagagcc cgtggatgtt ctgcgcgcgg cctgggagcc gccgccgccg 1980

ccgcctcagc gagaggagga 2000

<210>44

<211>2000

<212>DNA

＜213〉mouse

<220>

<221>misc_feature

<222>(1848)..(1867)

＜223〉n is A, C, T or G

<400>44

ctttataaaa gttgccctgg tcttggtttc atggcaatga aaccctcaat aagtggcttg 60

ggtggaatta tttgtgaatt tggtctttgg cagtaacctg tctgggcttc atatgggtgc 120

actcctgcag cacaggggaa ggtttccaaa ctatagcaac agataacatg actactgggg 180

catgtgtctg tggtgggagt cctgctactc tacctgaagc cctgtggggt tgtggattga 240

caatgacaaa aacagtgcca tctttacctg gtattaaaaa gttactaaat tctttttttc 300

tctctttttt tctcccctcc cccacttttt aaatttttgt cttttttttt ttggagtctg 360

tctcattatg taggtctgga tatcctggag ctgattctgc agcccaggct ggtctcagac 420

tcacagagct ctgcctgcct ctgcctccca agttcatcaa agacacatgc caccgtgact 480

agctacaaat aactcttaaa gtcataaaaa aaaccaagac tacaggcaac ccaattaaaa 540

ccaaatgtgg ggctggagct atgccttcgt gggtgagtgc ttgcctaaca ttcgagaggt 600

tctgggctca gtctccagca ccatctgcac atgcctgcaa tccaagcgct caggaggcaa 660

aggcagggta cactcgaggt tatctttggc tacataacaa ctttgaagtt agtctaggat 720

tcatgtgcct ctgtttaaaa acaacatcaa caacaatgaa aacaactgaa ccaaataaga 780

ccaaccttgg tccttggcaa caccctgtca aagaggagtg atgctgccgg ggctggagag 840

acagctggct cagcagttaa gagcaccgac tgctcttgca gaggaccctg gttcagtccc 900

cagcactccc aacgaagctc acaatcatct gcaaccttag cttaagggga tgtaaagccc 960

tcttctgacc tcctctgtca ctgcacacat ctaggtcaca gccatgcacg caggtactca 1020

cacatgcatg taaaataaaa atgagcacat ctcaaagcag caacaacaaa ggctggggat 1080

gtagatcaaa ctgtttgcct aatatgtaga agaccttgaa ttaaactacc cagcctcctg 1140

cctttcaaat atttgaagtg atatttccca gaagaagttt aggctgttgg tgaacaaagg 1200

aaagatacta ccgtgcaaag gcacataaca ttcattagga aaatacacgt taacacatac 1260

attgtcgacg ccctggtctc cagtgtgttc ttgggatact ccaggacccc tcgctcaagc 1320

tctgccccag gacccttcac ttccctgatg tgtgctggct gttgtcatag ccttggttgg 1380

ctcccatcct actaccctca ttaatggggc gtgtgctgac tttttgctag attcccggag 1440

ggtcctgatc ctcccaaggg gcttggcagg acgcccatgg ggacgcagcc ggctatattc 1500

tggaaaatct gtgttcgaag accatacctc atctctcact ttgggcccag gatttcgaag 1560

aactgacaac tgaattcccc tcgtggggct tcatcaaggg acgcctagtt aatgatttgt 1620

gtggtccagg tccccaagtt tccaggcttc tgatggtggg tggcaacact gctgcaagag 1680

cagatgaacc ggaggctcca cctttgtgcc tagaagtccc ggaggcgctg gcgggagggc 1740

gggtgctgca ggcggctccc tggacgcagg ggcggacccg gctccttccc gctcactcgg 1800

gtcgctgccc ttgagtcact ccggcagagg gcgcccggcg ccggcctnnn nnnnnnnnnn 1860

nnnnnnngcc ctcgaaggga ccagcctgcg aagcgcgagg aaggaagaag cggacgcgtg 1920

gcggggaggg gttgaggcgc cccggcccga agcccaaagc cgagcgcgcg gtaggcgacc 1980

gggcacccac ggcccgcagc 2000

<210>45

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used for making up Notch2IC 5 ' last strand primer partly

(1-782)

<400>45

catatgaatt catgaccaag catggctctc tctggctgcc t 41

<210>46

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used for making up Notch2IC 5 ' following strand primer partly

(1-782)

<400>46

cgcttggcagttgatcagtt ctg 23

<210>47

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used for making up Notch2IC 3 ' last strand primer partly

(783-2307)

<400>47

gaatggtggc agaactgatc aactg 25

<210>48

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used for making up Notch2IC 3 ' following strand primer partly

(783-2307)

<400>48

gatatgcggc cgccgcataa acctgcatgt tgttgtgtg 39

Claims (92)

1. expression cassette that comprises the polynucleotide of coding Ror polypeptide or its homologue or derivative or fragment or varient or mutant, wherein said polynucleotide are in osteocyte under the exercisable promotor control.

2. the expression cassette of claim 1, wherein the Ror polypeptide is the Ror1 polypeptide.

3. the expression cassette of claim 1, wherein the Ror polypeptide is the Ror2 polypeptide.

4. the expression cassette of claim 1, wherein said promotor and described encoding sequence allos.

5. the expression cassette of claim 1, wherein said promotor is the bone specificity promoter.

6. the expression cassette of claim 5, wherein said bone specificity promoter is rat 3.6kb type i collagen albumen or rat 1.7kb Bone Gla protein promotor.

7. each expression cassette of claim 1-6, wherein said promotor is an inducible promoter.

8. one kind comprises each the carrier of expression cassette of claim 1-7.

9. the carrier of claim 8, wherein said carrier is a virus vector.

10. the carrier of claim 9, wherein said virus vector is selected from retrovirus vector, adenovirus carrier, gland relevant viral vector, vaccinia virus vector and herpesvirus vector.

11. the expression cassette of claim 1, wherein said expression cassette further comprises polyadenylation signal.

12. host cell that comprises expression cassette, described expression cassette comprises the polynucleotide of coding Ror polypeptide or its homologue or derivative or fragment or varient or mutant, wherein said polynucleotide are under exercisable promotor is controlled in eukaryotic cell, described promotor and described polynucleotide allos.

13. the host cell of claim 12, wherein the Ror polypeptide is the Ror1 polypeptide.

14. the host cell of claim 12, wherein the Ror polypeptide is the Ror2 polypeptide.

15. regulate bone photo and close active composition for one kind, comprise Ror molecule or its homologue or derivative or fragment or the varient or the mutant of significant quantity.

16. the composition of claim 15, wherein the Ror molecule is the Ror1 molecule.

17. the composition of claim 15, wherein the Ror molecule is the Ror2 molecule.

18. the composition of claim 15, but further comprise the carrier of medicine.

19. the composition of claim 15, wherein bone photo pass activity is osteoblast differentiation, osteoclast differentiation, scleroblast survival, osteoclast survival, scleroblast activity or osteoclast activity.

20. the method for a screening reagent, this method comprises: (a) with reagent and Ror molecular combinations; (b) detect described reagent to the active influence of Ror; Active reduction of wherein detected Ror or raising are that reagent is the indication that bone photo closes reagent.

21. the method for claim 20, wherein Ror is active reduces or improves that the reduction that is by Ror inductive Wnt-3 signal suppressing or raising detect.

22. the method for claim 20, wherein the Ror molecule is that Ror1 molecule and Ror activity are the Ror1 activity.

23. the method for claim 20, wherein the Ror molecule is that Ror2 molecule and Ror activity are the Ror2 activity.

24. the method for claim 20, wherein the Ror molecule is that Ror2 molecule and the active reduction of Ror or raising are that activated by Ror2 inductive Wnt-1 signal reduces or improves and detect.

25. the method for claim 20, wherein the Ror molecule is that Ror polypeptide and active reduction of Ror or raising are that reduction or raising by the Ror autophosphorylation detects.

26. the method for claim 25, wherein to be that Ror1 polypeptide and Ror are active be the Ror1 activity to the Ror polypeptide.

27. the method for claim 25, wherein to be that Ror2 polypeptide and Ror are active be the Ror2 activity to the Ror polypeptide.

28. the method for a screening reagent, this method comprises: (a) with reagent and the isolated cells combination that comprises the Ror promoter sequence that may be operably coupled on the reporter gene; (b) detect described reagent to the active influence of report thing; Wherein the reduction or the detecting of raising of the Ror promoter activity by report thing determination of activity are that reagent is the indication that bone photo closes reagent.

29. the method for claim 28, wherein the Ror promotor is the Ror1 promotor.

30. the method for claim 29, wherein Ror1 promotor behaviour Ror1 promotor.

31. the method for claim 28, wherein the Ror promotor is the Ror2 promotor.

32. the method for claim 31, wherein the Ror2 promotor is a mouse Ror2 promotor.

33. one kind is screened and regulates the bonded compositions and methods of Ror polypeptide to binding partners, this method comprises: (a) Ror polypeptide and Ror binding partners are contacted existing under the situation of reagent; (b) the Ror polypeptide is contacted when having contrast or not having described reagent with the Ror binding partners; (c) by to Ror polypeptide described in the step (a) and described binding partners combine and step (b) described in the Ror polypeptide compare the bonded reagent of selecting to regulate Ror polypeptide and Ror binding partners with combining of binding partners.

34. the method for claim 33, wherein the Ror polypeptide is a Ror2 polypeptide and the Ror binding partners is the Ror2 binding partners.

35. the method for claim 34, wherein the Ror2 binding partners is selected from ADP/ATP carrier proteins, UDP-glucose ceramide glycosyltransferase sample 1,14-3-3 albumen beta/alpha, 14-3-3 albumen γ, ribophorin 1, arginine N-methyltransgerase 1, cellular apoptosis susceptibility albumen, NOTCH2 albumen and people's skeletal muscle LIM-albumen 3.

36. in the experimenter, regulate bone photo and close active method for one kind, comprise to experimenter's administration and regulate target Ror developed by molecule or active reagent.

37. the method for claim 36, wherein said reagent comprise one or more Ror molecules or its homologue or derivative or fragment or varient or mutant.

38. the method for claim 36, wherein said reagent comprise one or more Ror molecule binding partners or its homologue or derivative or fragment or varient or mutant.

39. the method for claim 36, its Ror molecule that hits is the Ror1 molecule.

40. the method for claim 36, its Ror molecule that hits is the Ror2 molecule.

41. the method for claim 36, its Ror molecular activity that hits is a tyrosine kinase activity.

42. the method for claim 36, wherein bone photo pass activity is osteoblast differentiation, osteoclast differentiation, scleroblast survival, osteoclast survival, scleroblast activity or osteoclast activity.

43. the method for claim 36, wherein said reagent is selected from antibody, small molecules, peptide, oligopeptides and polypeptide.

44. the method for claim 36, wherein said reagent comprises the antisense nucleic acid of Ror gene specific or siRNA molecule and wherein antisense nucleic acid or siRNA molecular recognition and bind nucleic acid, one or more Ror polypeptide of this nucleic acid encoding or its homologue or derivative or fragment or varient or mutant.

45. the method for claim 44, wherein the Ror gene is a Ror1 gene and the Ror polypeptide is the Ror1 polypeptide.

46. the method for claim 44, wherein the Ror gene is a Ror2 gene and the Ror polypeptide is the Ror2 polypeptide.

47. the method for claim 36, wherein said reagent is by regulating the expression and/or the activity of target Ror molecule or its homologue or derivative or fragment or varient or mutant in conjunction with the Ror binding partners.

48. the method for claim 47, wherein said reagent is by suppressing the expression and/or the activity of target Ror molecule or its homologue or derivative or fragment or varient or mutant in conjunction with the Ror binding partners.

49. the method for claim 47, wherein said reagent is by the expression and/or the activity of intensifier target Ror molecule or homologue or derivative or fragment or varient or mutant in conjunction with the Ror binding partners.

50. as the method in each of claim 47-49, its Ror molecule that hits is a Ror2 molecule and the Ror binding partners is the Ror2 binding partners.

51. the method for claim 50, wherein the Ror2 binding partners is selected from ADP/ATP carrier proteins, UDP-glucose ceramide glycosyltransferase sample 1,14-3-3 albumen beta/alpha, 14-3-3 albumen γ, ribophorin 1, arginine N-methyltransgerase 1, cellular apoptosis susceptibility albumen, NOTCH2 albumen and people's skeletal muscle LIM-albumen 3.

52. the method for claim 36, wherein said reagent adjusting Ror molecule or its homologue or derivative or fragment or varient or mutant are in conjunction with the Ror binding partners.

53. the method for claim 52, wherein said reagent enhancing Ror molecule or its homologue or derivative or fragment or varient or mutant are in conjunction with the Ror binding partners.

54. increasing, the method for claim 52, wherein said reagent suppress Ror molecule or its homologue or derivative or fragment or varient or mutant in conjunction with the Ror binding partners.

55. as the method in each of claim 52, wherein the Ror molecule is a Ror2 molecule and the Ror binding partners is the Ror2 binding partners.

56. the method for claim 55, wherein the Ror2 binding partners is selected from ADP/ATP carrier proteins, UDP-glucose ceramide glycosyltransferase sample 1,14-3-3 albumen beta/alpha, 14-3-3 albumen γ, ribophorin 1, arginine N-methyltransgerase 1, cellular apoptosis susceptibility albumen, NOTCH2 albumen and people's skeletal muscle LIM-albumen 3.

57. the method for claim 36 is wherein with the isolated cell of described agent administration in culture.

58. the method for claim 57, wherein said cell are former generation scleroblast, immortalized cell line of scleroblast origin or the immortalized cell line of non-scleroblast origin.

59. the method for claim 58, wherein the immortalized cell line of scleroblast origin is selected from HOB, U2OS and SaOS-2 cell.

60. the method for claim 36, wherein with described agent administration in the non-human transgenic animal.

61. the method for claim 60, wherein said transgenic animal are mouse.

62. the method for claim 60, wherein with described agent administration in inhuman knock-out animal.

63. the method for claim 36, wherein said experimenter is vertebra or invertebral living creature.

64. the method for claim 36, wherein said experimenter is a Mammals.

65. the method for claim 64, wherein said Mammals is behaved.

66. in the experimenter, regulate Wnt-1 and the active method of Wnt-3 for one kind, comprise with effective regulation and control Wnt-1 and the active amount administration of Wnt-3 and regulate target Ror2 developed by molecule or active reagent.

67. identify that regulating bone photo closes active compositions and methods, comprising for one kind: (a) in cell, express the Ror molecule or utilize endogenous Ror to express; (b) described cell is contacted with described reagent; (c) expression or the activity of monitoring Ror molecule, wherein Ror developed by molecule or active increase or reduce described reagent is accredited as and regulate bone photo and close active when having described reagent.

68. the method for claim 67, wherein the Ror molecule is the Ror1 molecule.

69. the method for claim 67, wherein the Ror molecule is the Ror2 molecule.

70. the method for claim 67, wherein the Ror molecular activity is a tyrosine kinase activity.

71. the method for claim 67, wherein bone photo pass activity is osteoblast differentiation, osteoclast differentiation, scleroblast survival, osteoclast survival, scleroblast activity or osteoclast activity.

72. the method for claim 67, wherein said reagent is selected from antibody, small molecules, peptide, oligopeptides, ribozyme and polypeptide.

73. the method for claim 67, wherein said reagent comprises the antisense nucleic acid of Ror gene specific or siRNA molecule and wherein antisense nucleic acid or siRNA molecular recognition and bind nucleic acid, one or more Ror polypeptide of this nucleic acid encoding or its homologue or derivative or fragment or varient or mutant.

74. the method for claim 73, wherein the Ror gene is a Ror1 gene and the Ror polypeptide is the Ror1 polypeptide.

75. the method for claim 73, wherein the Ror gene is a Ror2 gene and the Ror polypeptide is the Ror2 polypeptide.

76. the method for claim 67, wherein said reagent is by regulating the expression and/or the activity of Ror molecule or its homologue or derivative or fragment or varient or mutant in conjunction with the Ror binding partners.

77. the method for claim 76, wherein the Ror molecule is a Ror2 molecule and the Ror binding partners is the Ror2 binding partners.

78. the method for claim 77, wherein the Ror2 binding partners is selected from ADP/ATP carrier proteins, UDP-glucose ceramide glycosyltransferase sample 1,14-3-3 albumen beta/alpha, 14-3-3 albumen γ, ribophorin 1, arginine N-methyltransgerase 1, cellular apoptosis susceptibility albumen, NOTCH2 albumen and people's skeletal muscle LIM-albumen 3.

79. the method for claim 67, wherein said reagent adjusting Ror molecule or its homologue or derivative or fragment or varient or mutant are in conjunction with the Ror binding partners.

80. the method for claim 79, wherein the Ror molecule is a Ror2 molecule and the Ror binding partners is the Ror2 binding partners.

81. the method for claim 67, wherein said cell are former generation scleroblast, immortalized cell line of scleroblast origin or the immortalized cell line of non-scleroblast origin.

82. the method for claim 81, wherein the immortalized cell line of scleroblast origin is selected from HOB, U2OS and SaOS-2 cell.

83. the method for claim 67, wherein described reagent is further delivered medicine to expression or the activity of vertebra biology, the wherein expression of Ror molecule or active raising or reduce described reagent is accredited as and regulate bone photo and close active when described reagent exists with monitoring Ror molecule.

84. the method for claim 83, wherein said vertebra biology is a Mammals.

85. the method for claim 83, wherein said vertebra biology is the non-human transgenic animal.

86. identify the compositions and methods of regulating the Wnt signal pathway for one kind, one or more can regulate Ror developed by molecule or active reagent to comprise screening, wherein saidly can regulate the Ror developed by molecule or active reagent is the reagent of regulating the Wnt signal pathway.

87. method that bioactive molecules is connected on the cell of expressing the Wnt polypeptide, described method comprises cell is contacted with the Ror2 polypeptide of binding bioactive molecule, and allow Wnt polypeptide and described Ror2 polypeptide to be bonded to each other, thereby described bioactive molecules is connected on the described cell.

88. the method for claim 87, wherein the Wnt polypeptide is selected from Wnt-1 and Wnt-2.

89. method of the experimenter being screened the bone photo related disorders, comprise the following steps: to measure the expression of Ror molecule in the experimenter and determine the polypeptide of Ror described in the experimenter and its relative expression who in the normal subjects, compares, or the relative expression who compares with the activity among its same experimenter after carrying out the treatment of bone photo related disorders.

90. identify the method that participates in osteoplastic gene, comprising for one kind: a) in cell, cross expression Ror molecule, b) variation of gene expression pattern and c) determine which gene is subjected to the Ror expression regulation, identify thus to participate in osteoplastic gene.

91. a method of identifying the gene of regulating the Wnt signal pathway comprises: a) in cell, cross expression Ror molecule, b) variation of gene expression pattern and c) determine which gene is subjected to the Ror expression regulation, identify the gene of regulating the Wnt signal pathway thus.

92. one kind is utilized Ror2 to serve as a mark and identifies the method for people's preosteoblast of breeding, and comprises and determine Ror2 expression of gene in the human osteoblast cell that wherein the Ror2 that improves expresses described cell is accredited as the preosteoblast of breeding.

Images