CN1804037A - Expression method of glucosal related protein and application thereof - Google Patents
Expression method of glucosal related protein and application thereof Download PDFInfo
- Publication number
- CN1804037A CN1804037A CN 200510110575 CN200510110575A CN1804037A CN 1804037 A CN1804037 A CN 1804037A CN 200510110575 CN200510110575 CN 200510110575 CN 200510110575 A CN200510110575 A CN 200510110575A CN 1804037 A CN1804037 A CN 1804037A
- Authority
- CN
- China
- Prior art keywords
- related protein
- glucosal
- glucosal related
- cell
- tumor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The express and adjust method for GRP in bio-medicine field comprises: modifying the GRP into secretory protein to load into the tumor cell cultured externally; then, the altumen stimulates the body anti-tumor immunity function to prepare tumor-vaccine and cure tumor; while injecting directly the albumen adenovirus to infect the tumor cell and express the albumen for tumor treatment with chemotherapy and radiotherapy.
Description
Technical field
The invention belongs to biomedical sector, relate to the method for expressing glucosal related protein, relate in particular to a kind of method and application thereof of in tumour, expressing glucosal related protein.
Background technology
Include a large amount of transgenations in the tumour cell, about 11000 sudden change/cells, thereby each tumour all has its unique antigen peptide, has the function that potential causes tumor immunity.Yet tumour cell can not cause enough immune responses generally speaking, and a wherein very important reason is because antigen presenting cell insufficiency of function or discomfort.Therefore improve the submission of tumour antigen, may cause the effective antitumour immune response.
(as HSP 70, HSP 90, have the function of molecular chaperones (chaperon) for Heat Shock Protein, HSP) family member, and auxiliary new synthetic protein finishes two, tertiary structure for heat shock protein(HSP).Therefore the molecular chaperones structure is conservative relatively, and protein structure, function are had important effect.Simultaneously, it also has the activation antigen of inducing presenting cell submission antigen, and induces CD8
+Or/and CD4
+The effect of T-cytoactive.In recent years, do the fervent concern that the research of immunotherapy in experimentation on animals and clinical application is subjected to numerous investigators with HSP.
Glucosal related protein (Glucose-Regulated Protein) is a member of HSP90 family, is positioned at endocytoplasmic reticulum, and the folding and assembling in endoplasmic reticulum of its function and protein is closely related.It also has the submission antigen peptide simultaneously, stimulates the function of antitumor immunity of organism reaction.Glucosal related protein combines with antigen presenting cell (APC), activating macrophage or induce the maturation of dendritic cell, its oozy I type IFN, IL-12 and other cytokine can activate NK on the one hand, the activity of NKT and gamma delta T cells is killed and wounded or the cracking tumour cell; On the other hand, the chemokines of its generation such as NO etc. also participate in the cracking of tumour cell.Killed and wounded the tumour specific antigen that the cracked tumour discharges, can induce activated dendritic cell (DC) to activate tumour-specific CD8 through glucosal related protein again by the MHC-I path
+The T cell causes the adaptability anti tumor immune response.
At present HSP is applied to the research of immunotherapy of tumors, the general method that adopts is to extract HSP as vaccine from tumor tissues, in the injection ex vivo.This method has obtained comparatively satisfied effect, there are some researches show, makes vaccine with tumour self source glucosal related protein, can cause anti tumor immune response in about 50% treatment patient.But extracting HSP from tumor tissues has bigger limitation in actual applications.To the losing of tumor antigen peptide, the HSP extracted amount is subjected to the restriction of tumour size as purge process.And extract HSP at every kind of tumour, the expense costliness is difficult for setting up standardized scheme, and certain degree of difficulty is arranged in clinical application.
Summary of the invention
The objective of the invention is to set up a kind of method of new expression glucosal related protein.Further purpose of the present invention provides the method for the glucosal related protein of expression-secretion type in tumour cell.
But the present invention by with the glucosal related protein gene through being transformed into secreted protein, be loaded into the tumour cell of vitro culture, the preparation tumor vaccine stimulates the antineoplastic immune merit of body.Simultaneously, direct injection is expressed the adenovirus of glucosal related protein gene in tumour, and infected tumor's cell is expressed glucosal related protein, and combines with chemotherapy and radiotherapy, reaches the purpose of treatment tumour.
The present invention adopts adenovirus carrier to express glucosal related protein, utilizes the adenovirus characteristics high to the tumour cell efficiency of infection, obtains relatively large albumen.Simultaneously, the present invention is a secretor type with the glucosal related protein genetic modification, after being synthesized, it is secreted into the extracellular in tumour cell, in conjunction with and the submission tumor antigen peptide to antigen presenting cell, add the effect of the activation body innate immunity function that glucosal related protein itself has, thereby can obtain better effect, for effective treatment plan provides the basis.
Because glucosal related protein is positioned at endocytoplasmic reticulum, mostly existing treatment research is to extract from tumor tissues.The present invention adopts the adenovirus infection tumour cell of band secretor type glucosal related protein gene, makes it express glucosal related protein.Glucosal related protein portability specific tumour antigen in secreting the process of cell stimulates the antineoplastic immune of body to reflect on the one hand; On the other hand, glucosal related protein causes the innate immunity reaction of body, and tumor growth, transfer are produced restraining effect.
Purpose of the present invention realizes by following method and step:
1. adopt PCR or additive method to separate and clone's glucosal related protein gene, when design of primers, remove the sequence of coded protein C-terminal amino acid KDEL (Lys-Asp-Glu-Leu lysine-asparagicacid-glutamate-leu).
The method of described other separation and clone's glucosal related protein gene also can be selected screening cDNA library or the segmental method of artificial-synthetic DNA for use.
Glucosal related protein is the protein that is positioned at endocytoplasmic reticulum, and its c-terminal of protein contains the one section aminoacid sequence that is fixed on the endoplasmic reticulum, is called " anchor " (anchor), i.e. the KDEL small peptide.The present invention when clone gene, removes above-mentioned one section sequence with the method for gene clone, makes cell be secreted into the extracellular behind synthetic glucosal related protein.
The present invention adopts the people's glucosal related protein gene of sequence 1 and the mouse glucosal related protein gene of sequence 2.
Amplification people's glucosal related protein gene the primer sequence is:
Upstream primer 5 ' ACGCGTCGACATCGAAGGGGACTTGAGACTC 3 '
Downstream primer 5 ' ATAGTTTAGCGGCCGCTTATTCAGCTGTAGATTCCTTTGC 3 '
The glucosal related protein gene the primer sequence of amplification mouse is:
2. the secretor type glucosal related protein gene with amplification is inserted in the plasmid vector of packing replication-defective adenoviral, but the adenovirus of in viral packing cell, producing expression-secretion type glucosal related protein then.
3. utilize this adenovirus that the following mode of carrying out of laboratory animal tumor tissues or cell is tested:
A. with in the direct injection experiments animal tumor of the virus tissue; Or
B. after using the tumour cell of virus infection vitro culture, through the radiation exposure of lethal dose, or the chemicals processing, cell no longer divides but can express target protein, and collecting cell through abdominal injection, carries out immunotherapy.
4. with such scheme and radiotherapy or chemotherapy, or other physiatricies combine.
The present invention has following advantage:
1. adenovirus can make secretor type glucosal related protein albumen great expression to tumour cell efficiency of infection height.
The secretor type glucosal related protein can be when secreting cell the submission tumour antigen, stimulate the anti tumor immune response of body; And itself also cause the innate immunity reaction of body, tumor growth is produced restraining effect.
3. glucosal related protein inductive systemic immune response not only to local tumor generation effect, also has restraining effect to metastases.
Description of drawings
Fig. 1. the replication-defective adenoviral structural representation of band secretor type glucosal related protein gene,
Wherein, secretor type glucosal related protein gene has removed the C that proteinaceous solid is fixed on the endoplasmic reticulum and has held the KDEL sequence, constitutes fusion gene with green fluorescent protein (GFP) gene, is controlled by cytomegalovirus CMV promotor.
Fig. 2. the expression of adenovirus mediated secretor type glucosal related protein in mouse mastopathy cell strain 4T1,
Wherein, virus infection 4T1 cell with radiation exposure (the 0th day), continued to cultivate after 24 hours, collected culture supernatant every day, detected with Weastern Blot method.Negative control is the cells and supernatant that AdGFP infects.Positive control is the Ad293 cell pyrolysis liquid that AdsGRP-GFP infects.Anti-glucosal related protein antibody is available from StressGen company.
Fig. 3. the anti tumor immune response that secretor type glucosal related protein expressed in situ causes,
Wherein, A.4T1 after the AdsGRP-GFP virus or AdGFP virus infection of cell with 40MOI, by every mouse 1 * 10
5Cell inoculation is subcutaneous in homologous BALB/c mouse back, the next day measure gross tumor volume.Compare glucosal related protein infection group and viral infection group tumor growth obviously lag behind (P＜0.05) with control group.
B. from different treatment group tumor biopsy H﹠amp among the A; The E coloration result, the minicell prompting lymphocyte infiltration of engrain.
Fig. 4. the anti tumor immune response that the preventative inoculation of secretor type glucosal related protein causes,
The 4T1 cell is through AdsGRP-GFP (treatment group)) or AdGFP (control group) virus infection after, lethal dose irradiation is by every 5 * 10
6Cell inoculation is subcutaneous in mouse, after 4 immunity, A) in subcutaneous vaccination 1 * 10
7Gross tumor volume is observed and measured to the 4T1 cell.As seen, the glucosal related protein immune group can prevent the growth of 4T1 tumour cell fully among the figure; B) after the external activation of extracting spleen cell, detect Interferon, rabbit IFN-γ secretion with the ELISpot method, the glucosal related protein immune group is apparently higher than control group (P＜0.05); C) after the external activation of extracting spleen cell, with 4T1 cell co-cultivation, detection antitumor cell activity, when the ratio of splenocyte and tumour cell is 50: 1 when above, glucosal related protein immune group splenic lymphocyte to the specificity lytic activity of tumour cell apparently higher than control group (P＜0.01).
Fig. 5. the secretor type glucosal related protein is expressed the therapeutic action to mouse tumor,
With 1 * 10
5Individual 4T1 cell inoculation is subcutaneous in the mouse back leg, when treating that tumour is grown to the about 4～5mm of diameter, treats in the following manner: injecting virus 1 * 10 in the knurl body
8Pfu, 3 times; The 4T1 cell of the infective virus that abdominal injection shone, 5 * 10
6, 4 times; Radiation exposure tumour 10Gy, 2 times.A) measure gross tumor volume, AdsGRP-GEP treatment group tumour is subjected to obvious inhibition.B) Kaplan-Meier survival rate curve, AdsGRP-GEP treatment group survival rate significantly improves, and wherein 2 (20%) mouse tumors are cured fully.RT: radiotherapy.
Fig. 6 secretor type glucosal related protein is expressed the restraining effect that mouse tumor is shifted
In the above-mentioned different treatment group, the tail vein injects 1 * 10
6Fluorescein-labeled 4T1 cell is with the growth of XenogenIVIS systematic observation lung tumors.A) left side is the Fluirescence observation synoptic diagram, and the confirmation tumor growth is directly dissected for mouse lung in the last right side.B) in lung situation appears for Kaplan-Meier curve signal tumour.Glucosal related protein treatment group does not have metastases in whole observation process.
Embodiment
Below for applying the present invention to the example of laboratory animal tumor experiment.In the example below, the present invention with antigenicity a little less than, the mouse mastopathy cell strain 4T1 that transitivity is strong is a model, to adopt the 4T1 cell tumour of homology BALB/c mouse subcutaneous vaccination be model in experiment in the body.
Embodiment 1
1.PCR amplification mouse glucosal related protein gene
With the 4T1 cell DNA is template, adopts following primer, and pcr amplification glucosal related protein gene removes C end encoded K DEL aminoacid sequence (AAA GAT GAA TTA), is called secretor type glucosal related protein (sGRP).
Upstream primer 5 ' GCGTCGACACGCACCATGAGGGTCCTGTG 3 '
Downstream primer 5 ' ATAGTTTAGCGGCCGCTTACTCTGTAGATTCCTTTTCTG 3 '
2.PCR product is connected to fusion gene (sGRP-GFP) with enhanced green fluorescence protein (EGFP) gene of going up through pcr amplification from plasmid pEGFPN1 (Clontech) through the NotI site after restriction enzyme NotI enzyme is cut, can utilize the sign of the expression of fluorescin like this, be convenient to direct viewing as the glucosal related protein expression.
3. fusion gene is connected to the multiple clone site place of adenovirus packaging plasmid carrier pDC515 (Microbix company) after restriction enzyme Sal I and BamHI enzyme are cut.
With matter pDC515-sGRP-GFP and another helper plasmid (helper) pFLP (Microbix company) with the common transfection packing cell of liposome Ad293.Treat that collecting cell after the pathology appears in cell, multigelation 3 times, cells infected is once more taken turns plaque select through 3, selects the high adenovirus AdsGRP-GFP of duplicating efficiency.Its dna structure synoptic diagram as shown in Figure 1.
5. with the Ad293 cell adenovirus AdsGRP-GFP that increases in a large number.Cesium chloride density gradient centrifugation separation and purification virus, virus quantity reaches 1～10 * 10
11Pfu/ml.
In the experiment, control group virus all adopts the adenovirus AdGFP of band GFP gene in following external and body.
6. the detection in cell, expressed of secretor type glucosal related protein
Adenovirus infects and promptly observes green fluorescence with fluorescent microscope after 24 hours by 20～40MOI (multiplicity of infection) infecting mouse breast carcinoma cell strain 4T1, and prompting has the secretor type glucosal related protein synthetic.With lethal dose 100Gy radiation exposure cell, continue again to cultivate.Collect culture supernatant every day, continue 6 days.Detecting glucosal related protein with Western Blot method expresses.The result as shown in Figure 2.The expression of glucosal related protein just peaked from the 2nd day, and can stably express at least 6 days.
7. glucosal related protein is expressed the anti tumor immune response of mediation
1) immune response that causes of tumour cell expressed in situ glucosal related protein
Behind glucosal related protein virus infection 4T1 cell, by every mouse 1 * 10
5Individual cell inoculation is subcutaneous in the BALB/c mouse back leg, observes and measure tumour cell growing state in vivo.As shown in Figure 3A, experimental group tumour cell growth in vivo obviously lags behind control group (P＜0.05).Wherein there are 2 routine tumours to be repelled fully, once more to this 2 routine mouse inoculation 1 * 10
74T1 cell, tumour still can not be grown.
Get the tumor tissues of tumour cell after 2 weeks of virus inoculation infection and cut into slices, do HE dyeing.Visible a large amount of small lymphocytes are invaded profit in the experimental group tumor tissues, and only visible a small amount of lymphocyte in the control group.(Fig. 3 B)
2) protective immunological reaction that causes of preventative inoculation glucosal related protein
With the 4T1 cell of virus infection vitro culture, behind the radiation exposure of 100Gy, by 5 * 10
6/ only to be injected in mouse back subcutaneous, weekly, and immunity is 4 times altogether.Inoculate 4T1 cell (1 * 10 after one week
7/ only), its growing state observed.The results are shown in Figure 4A.AdsGRP-GFP cells infected mice immunized can suppress the 4T1 cell fully and grow in vivo.
3) cytokine secretion of glucosal related protein mediation and SC experiment
Through above-mentioned the same manner mice immunized, get mouse boosting cell and carry out cytokine secretion detection and cytotoxicity experiment.The results are shown in Figure 4B, C.The splenocyte of glucosal related protein immunity is after stimulated in vitro, and the secretion of Interferon, rabbit IFN-γ is significantly higher than control group (P＜0.05), cytotoxicity experiment show its to the specificity cracking of 4T1 cell apparently higher than contrast (P＜0.05).
8. adenovirus mediated secretor type glucosal related protein is expressed the restraining effect to mouse tumor
In BALB/c mouse back leg subcutaneous vaccination 1 * 10
5Individual 4T1 cell after one week, when treating that tumour is grown to the about 3～5mm of diameter, is treated.Therapeutic modality comprises the radiation exposure local tumor, direct injection virus (1 * 10 in tumor tissues
8Pfu/ is only), inject (5 * 10 with the cell of virus infection through lethal dose radiation exposure pneumoretroperitoneum
6Cell/only), the AdsGRP-GFP immunotherapy combines with radiotherapy, obviously suppresses tumor growth (P＜0.05), and obviously improve survival rate (P＜0.05), in this group mouse, there are 2 mouse (20%) to cure fully, no knurl survival is more than 1 year, and result such as Fig. 5 A are shown in the B.
9. adenovirus mediated secretor type glucosal related protein is expressed the restraining effect that mouse tumor is shifted
Be to estimate the effect of AdsGRP-GFP to metastases, the present invention adopts luciferase gene mark 4T1 cell (4T1-Luc), makes the growth of interior tumor cell dynamic observe and need not put to death experiment mice with instrument (Xenogen IVIS system).In above-mentioned different treatment group mouse, from tail vein injection 1 * 10
6Individual 4T1-Luc cell is observed tumour cell at lung's growing state.As Fig. 6 A, shown in the B, the AdsGRP-GFP experimental group does not have lung tumors to shift in whole observation process fully.
SEQUENCE?LISTING
＜110〉Li Chuanyuan
Liu Shanling
＜120〉a kind of method and application thereof of expressing glucosal related protein
<130>11
<160>2
<170>PatentIn?version 3.1
<210>1
<211>2409
<212>DNA
＜213〉mankind
<400>1
atgagggccc?tgtgggtgct?gggcctctgc?tgcgtcctgc?tgaccttcgg?gtcggtcaga 60
gctgacgatg?aagttgatgt?ggatggtaca?gtagaagagg?atctgggtaa?aagtagagaa 120
ggatcaagga?cggatgatga?agtagtacag?agagaggaag?aagctattca?gttggatgga 180
ttaaatgcat?cacaaataag?agaacttaga?gagaagtcgg?aaaagtttgc?cttccaagcc 240
gaagttaaca?gaatgatgaa?acttatcatc?aattcattgt?ataaaaataa?agagattttc 300
ctgagagaac?tgatttcaaa?tgcttctgat?gctttagata?agataaggct?aatatcactg 360
actgatgaaa?atgctctttc?tggaaatgag?gaactaacag?tcaaaattaa?gtgtgataag 420
gagaagaacc?tgctgcatgt?cacagacacc?ggtgtaggaa?tgaccagaga?agagttggtt 480
aaaaaccttg?gtaccatagc?caaatctggg?acaagcgagt?ttttaaacaa?aatgactgaa 540
gcacaggaag?atggccagtc?aacttctgaa?ttgattggcc?agtttggtgt?cggtttctat 600
tccgccttcc?ttgtagcaga?taaggttatt?gtcacttcaa?aacacaacaa?cgatactcag 660
cacatctggg?agtctgactc?caatgaattt?tctgtaattg?ctgacccaag?aggaaacact 720
ctaggacggg?gaacgacaat?tacccttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 780
ttggatacaa?ttaaaaatct?cgtcaaaaaa?tattcacagt?tcataaactt?tcctatttat 840
gtatggagca?gcaagactga?aactgttgag?gagcccatgg?aggaagaaga?agcagccaaa 900
gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aagaagaaga?agaaaagaaa 960
ccaaagacta?aaaaagttga?aaaaactgtc?tgggactggg?aacttatgaa?tgatatcaaa 1020
ccaatatggc?agagaccatc?aaaagaagta?gaagaagatg?aatacaaagc?tttctacaaa 1080
tcattttcaa?aggaaagtga?tgaccccatg?gcttatattc?actttactgc?tgaaggggaa 1140
gttaccttca?aatcaatttt?atttgtaccc?acatctgctc?cacgtggtct?gtttgacgaa 1200
tatggatcta?aaaagagcga?ttacattaag?ctctatgtgc?gccgtgtatt?catcacagac 1260
gacttccatg?atatgatgcc?taaatacctc?aattttgtca?agggtgtggt?ggactcagat 1320
gatctcccct?tgaatgtttc?ccgcgagact?cttcagcaac?ataaactgct?taaggtgatt 1380
aggaagaagc?ttgttcgtaa?aacgctggac?atgatcaaga?agattgctga?tgataaatac 1440
aatgatactt?tttggaaaga?atttggtacc?aacatcaagc?ttggtgtgat?tgaagaccac 1500
tcgaatcgaa?cacgtcttgc?taaacttctt?aggttccagt?cttctcatca?tccaactgac 1560
attactagcc?tagaccagta?tgtggaaaga?atgaaggaaa?aacaagacaa?aatctacttc 1620
atggctgggt?ccagcagaaa?agaggctgaa?tcttctccat?ttgttgagcg?acttctgaaa 1680
aagggctatg?aagttattta?cctcacagaa?cctgtggatg?aatactgtat?tcaggccctt 1740
cccgaatttg?atgggaagag?gttccagaat?gttgccaagg?aaggagtgaa?gttcgatgaa 1800
agtgagaaaa?ctaaggagag?tcgtgaagca?gttgagaaag?aatttgagcc?tctgctgaat 1860
tggatgaaag?ataaagccct?taaggacaag?attgaaaagg?ctgtggtgtc?tcagcgcctg 1920
acagaatctc?cgtgtgcttt?ggtggccagc?cagtacggat?ggtctggcaa?catggagaga 1980
atcatgaaag?cacaagcgta?ccaaacgggc?aaggacatct?ctacaaatta?ctatgcgagt 2040
cagaagaaaa?catttgaaat?taatcccaga?cacccgctga?tcagagacat?gcttcgacga 2100
attaaggaag?atgaagatga?taaaacagtt?ttggatcttg?ctgtggtttt?gtttgaaaca 2160
gcaacgcttc?ggtcagggta?tcttttacca?gacactaaag?catatggaga?tagaatagaa 2220
agaatgcttc?gcctcagttt?gaacattgac?cctgatgcaa?aggtggaaga?agagcccgaa 2280
gaagaacctg?aagagacagc?agaagacaca?acagaagaca?cagagcaaga?cgaagatgaa 2340
gaaatggatg?tgggaacaga?tgaagaagaa?acagcaaagg?aatctacagc?tgaaaaagat 2400
gaattgtaa 2409
<210>2
<211>2409
<212>DNA
＜213〉animal
<400>2
atgagggccc?tgtgggtgct?gggcctctgc?tgcgtcctgc?tgaccttcgg?gtcggtcaga 60
gctgacgatg?aagttgatgt?ggatggtaca?gtagaagagg?atctgggtaa?aagtagagaa 120
ggatcaagga?cggatgatga?agtagtacag?agagaggaag?aagctattca?gttggatgga 180
ttaaatgcat?cacaaataag?agaacttaga?gagaagtcgg?aaaagtttgc?cttccaagcc 240
gaagttaaca?gaatgatgaa?acttatcatc?aattcattgt?ataaaaataa?agagattttc 300
ctgagagaac?tgatttcaaa?tgcttctgat?gctttagata?agataaggct?aatatcactg 360
actgatgaaa?atgctctttc?tggaaatgag?gaactaacag?tcaaaattaa?gtgtgataag 420
gagaagaacc?tgctgcatgt?cacagacacc?ggtgtaggaa?tgaccagaga?agagttggtt 480
aaaaaccttg?gtaccatagc?caaatctggg?acaagcgagt?ttttaaacaa?aatgactgaa 540
gcacaggaag?atggccagtc?aacttctgaa?ttgattggcc?agtttggtgt?cggtttctat 600
tccgccttcc?ttgtagcaga?taaggttatt?gtcacttcaa?aacacaacaa?cgatactcag 660
cacatctggg?agtctgactc?caatgaattt?tctgtaattg?ctgacccaag?aggaaacact 720
ctaggacggg?gaacgacaat?tacccttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 780
ttggatacaa?ttaaaaatct?cgtcaaaaaa?tattcacagt?tcataaactt?tcctatttat 840
gtatggagca?gcaagactga?aactgttgag?gagcccatgg?aggaagaaga?agcagccaaa 900
gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aagaagaaga?agaaaagaaa 960
ccaaagacta?aaaaagttga?aaaaactgtc?tgggactggg?aacttatgaa?tgatatcaaa 1020
ccaatatggc?agagaccatc?aaaagaagta?gaagaagatg?aatacaaagc?tttctacaaa 1080
tcattttcaa?aggaaagtga?tgaccccatg?gcttatattc?actttactgc?tgaaggggaa 1140
gttaccttca?aatcaatttt?atttgtaccc?acatctgctc?cacgtggtct?gtttgacgaa 1200
tatggatcta?aaaagagcga?ttacattaag?ctctatgtgc?gccgtgtatt?catcacagac 1260
gacttccatg?atatgatgcc?taaatacctc?aattttgtca?agggtgtggt?ggactcagat 1320
gatctcccct?tgaatgtttc?ccgcgagact?cttcagcaac?ataaactgct?taaggtgatt 1380
aggaagaagc?ttgttcgtaa?aacgctggac?atgatcaaga?agattgctga?tgataaatac 1440
aatgatactt?tttggaaaga?atttggtacc?aacatcaagc?ttggtgtgat?tgaagaccac 1500
tcgaatcgaa?cacgtcttgc?taaacttctt?aggttccagt?cttctcatca?tccaactgac 1560
attactagcc?tagaccagta?tgtggaaaga?atgaaggaaa?aacaagacaa?aatctacttc 1620
atggctgggt?ccagcagaaa?agaggctgaa?tcttctccat?ttgttgagcg?acttctgaaa 1680
aagggctatg?aagttattta?cctcacagaa?cctgtggatg?aatactgtat?tcaggccctt 1740
cccgaatttg?atgggaagag?gttccagaat?gttgccaagg?aaggagtgaa?gttcgatgaa 1800
agtgagaaaa?ctaaggagag?tcgtgaagca?gttgagaaag?aatttgagcc?tctgctgaat 1860
tggatgaaag?ataaagccct?taaggacaag?attgaaaagg?ctgtggtgtc?tcagcgcctg 1920
acagaatctc?cgtgtgcttt?ggtggccagc?cagtacggat?ggtctggcaa?catggagaga 1980
atcatgaaag?cacaagcgta?ccaaacgggc?aaggacatct?ctacaaatta?ctatgcgagt 2040
cagaagaaaa?catttgaaat?taatcccaga?cacccgctga?tcagagacat?gcttcgacga 2100
attaaggaag?atgaagatga?taaaacagtt?ttggatcttg?ctgtggtttt?gtttgaaaca 2160
gcaacgcttc?ggtcagggta?tcttttacca?gacactaaag?catatggaga?tagaatagaa 2220
agaatgcttc?gcctcagttt?gaacattgac?cctgatgcaa?aggtggaaga?agagcccgaa 2280
gaagaacctg?aagagacagc?agaagacaca?acagaagaca?cagagcaaga?cgaagatgaa 2340
gaaatggatg?tgggaacaga?tgaagaagaa?acagcaaagg?aatctacagc?tgaaaaagat 2400
gaattgtaa 2409
Claims (7)
1, a kind of method of expressing glucosal related protein, but it is characterized in that glucosal related protein genetic modification one-tenth secretor type glucosal related protein, adopt adenovirus carrier in tumour cell, to express described glucosal related protein.
2, by the method for the described expression glucosal related protein of claim 1, it is characterized in that described glucosal related protein is selected from the people's glucosal related protein gene of sequence 1 and/or the mouse glucosal related protein gene of sequence 2; But described secretor type glucosal related protein is by separation and clones above-mentioned glucosal related protein gene, removes C end encoded K DEL aminoacid sequence AAA GAT GAA TTA during design of primers, gets the secretor type glucosal related protein,
Amplification people's glucosal related protein gene the primer sequence is:
Upstream primer 5 ' ACGCGTCGACATCGAAGGGGACTTGAGACTC 3 '
Downstream primer 5 ' ATAGTTTAGCGGCCGCTTATTCAGCTGTAGATTCCTTTGC 3 '
The glucosal related protein gene the primer sequence of amplification mouse is:
Upstream primer 5 ' GCGTCGACACGCACCATGAGGGTCCTGTG 3 '
Downstream primer 5 ' ATAGTTTAGCGGCCGCTTACTCTGTAGATTCCTTTTCTG 3 '.
3,, it is characterized in that described adenovirus carrier is the plasmid vector of the secretor type glucosal related protein gene insertion packing replication-defective adenoviral of above-mentioned amplification by the method for the described expression glucosal related protein of claim 1.
.4, by the method for the described expression glucosal related protein of claim 3, it is characterized in that described adenovirus carrier is the adenovirus packaging plasmid carrier pDC515-sGRP-GFP that the green fluorescent protein fusion gene connects.
5, the purposes of the method for claim 1 or 2 or 3 described expression glucosal related proteins in the preparation tumor vaccine.
6, the method for claim 1 or 2 or 3 described expression glucosal related proteins and radiotherapy bonded purposes.
7, the method for claim 1 or 2 or 3 described expression glucosal related proteins and chemotherapy bonded purposes.
8, the method for claim 1 or 2 or 3 described expression glucosal related proteins and thermotherapy bonded purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510110575XA CN100419078C (en) | 2005-11-18 | 2005-11-18 | Expression method of glucosal related protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510110575XA CN100419078C (en) | 2005-11-18 | 2005-11-18 | Expression method of glucosal related protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1804037A true CN1804037A (en) | 2006-07-19 |
| CN100419078C CN100419078C (en) | 2008-09-17 |
Family
ID=36866183
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200510110575XA Expired - Fee Related CN100419078C (en) | 2005-11-18 | 2005-11-18 | Expression method of glucosal related protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100419078C (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1430155A2 (en) * | 2001-09-05 | 2004-06-23 | Pride Proteomics A/S | Proteins in type 2 diabetes |
| JP2007504840A (en) * | 2003-05-12 | 2007-03-08 | ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィア | GRP94-based compositions and methods for their use |
| WO2005045428A2 (en) * | 2003-10-27 | 2005-05-19 | University Of Southern California | Methods and compositions for modulating apoptosis |
-
2005
- 2005-11-18 CN CNB200510110575XA patent/CN100419078C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN100419078C (en) | 2008-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1515319A (en) | Induction of cytotoxic T lymphocyte response | |
| CN1524583A (en) | Use of gene for expressing Notch-ligand in production of medicinal preparations for immunotherapy | |
| CN1314916A (en) | Cancer antigens based on tumor suppressor gene WT1 product | |
| CN1705739A (en) | T cell used for antigen transduction of antigen delivering system | |
| CN101076540A (en) | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand | |
| CN1282485C (en) | Dendron shaped cell tumour vaccine for loading withered heat shock tumour cell, its preparation method and application | |
| CN1668746A (en) | MUC-1 antigen with reduced number of VNTR repeat units | |
| CN1948333A (en) | New hPEBP4 protein source HLA-A2 limiting epi-polypeptide and its application | |
| CN101037475A (en) | Chimerical receptor and preparation method and usage | |
| CN1842346A (en) | Modulation of cytotoxic lymphocyte responses by macrophage migration inhibitory factor | |
| CN1966683A (en) | Recombinant adenovirus for expression of novel tumour suppressor gene p53 | |
| CN1607247A (en) | Dendritic cell tumor vaccine and its preparation and use | |
| CN1253469C (en) | Antigenic determinant polypeptide of human tumor-testis antigen HCA587 and use thereof | |
| CN1824325A (en) | Human nipple virus DNA inserted vaccine, its preparation method and application | |
| CN1867361A (en) | Cancer gene therapeutic drug | |
| CN1804037A (en) | Expression method of glucosal related protein and application thereof | |
| CN1191271C (en) | Thymic peptide fusion protein as one new interferon and its prepn. and use | |
| CN1468956A (en) | Recombinant virus of antibody for high-efficiency expression to treat tumor and its use | |
| CN1313151C (en) | Preparation of high-performance noncellular vaccine and usage | |
| CN1706495A (en) | New type of cell vaccine with heteroimmune cell as cell vector and its prepn process | |
| CN1440812A (en) | Method of strengthening immune response with CD137 conjugated excitomotor | |
| CN1709510A (en) | Vaccine composition containing modified dendritic cells | |
| CN1887296A (en) | Method of inducing antitumor immunity and its application in preparing medicine | |
| CN1891829A (en) | Alpha (1,3) galactosyl transferase recombinant vector, virosome and its preparation and use | |
| CN109790224A (en) | Tumor-antigen peptide and its application derived from CACNA1H |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080917 Termination date: 20141118 |
|
| EXPY | Termination of patent right or utility model |