CN1786195A - Transgene agricultural product DNA detection chip, its preparation method and application - Google Patents

Abstract

The invention relates to a transgene farm product DNA detecting chip. The chip includes film base and nucleic acid probe. The probe contains target detection probe. The target detection probe is a series of nucleotide sequence showed as SEQ ID NOs.1-50. The invention offers the making method, application, kit and detecting method.

Description

Transgene agricultural product DNA detection chip and its production and application

Technical field

The present invention relates to biological technical field, relate to a kind of transgene agricultural product DNA detection chip and its production and application particularly.

Background technology

Adopt modern biotechnology, cultivate the genetically modified crops (genetically modifiedorganism brief note is GMO) that are different from traditional breeding method, for having started a brand-new era in the farming research aspect, for the mankind improve the door that food quantity and quality have been opened fan unprecedented opportunities.Modern biotechnology claims the DNA recombinant technology again, and it is improving the nutritional quality of food, improves crop yield and disease-resistant, insect resistance capacity, minimizing pesticide dosage and human communicable disease vaccine inoculation aspect and has much potentiality.Transgenic crop becomes the focus that various countries competitively research and develop in recent years.In recent years, transgenic plant are rapid in global cultivated area and sale growth.The country of plantation genetically modified crops is increased to present 17 by 1 in 1992.The portion report that international Agricultural biotechnologies application devices (ISAAA) are announced shows that global transgenic corns, soybean, cotton and other crop sown area had reached 200,000,000 acres in 2004, has increased by 20% than 1.67 hundred million acres in 2003.Global genetically modified crops cultivated areas in 2004 account for per-cent soybean 56%, cotton 28%, rape 19%, the corn 14% of its total cultivated area.The U.S. is the maximum countries of plantation genetically modified crops, and its genetically engineered soybean output has accounted for the over half of soybean ultimate production.The Chinese government attaches great importance to the research of biotechnology, and the genetically modified organism of studying has kind more than 130, and the gene kind that relates to is above 100 kinds.Particularly at the forefront in the world in the achievement in research in fields such as transgenic cotton against pests, transgenic paddy rice, recombinant vaccine, 2002, China's genetically modified crops cultivated area breaks through 2,100,000 hectares, becomes the genetically modified crops plantation big country after the U.S., Canada, Brazil, Argentina.From 1997 in September, 2003, through safety evaluation, more than 10 kind of transgenic plant such as Ministry of Agriculture approval paddy rice, corn, cotton, soybean, rape, potato enter the field environment and discharge, and plant such as approval transgene cotton, tomato, pimento and microbiological genetic engineering vaccine for animals enter to be commercially produced.

Be accompanied by continually developing and utilization and extention of transgene agricultural product, the safety problem of genetically modified food is still undetermined, and national governments, academia and human consumer are continuous about the dispute of genetically modified food safety.Fears are entertained that thisly carries out " revise arbitrarily " and creates the novel gene and the biology that come out and may be harmful to the mankind biology, and ecotope is caused new pollution, and promptly so-called transgenosis is polluted, and this new source of pollution are to be difficult to eliminate.In addition, the means of transgenic technology still are incomplete at present, and the insertion of new gene is at random, reach the directed degree of inserting far away.Face numerous human consumers to the doubt of GMO and the crunch of anti-GMO tissue, food manufacturer and national governments make a response.In Europe, in June, 1998, the European Community (EU) regulation will indicate it to farm crop and whether contain GMO.EU in 2000 proposes the upper limit of sneaking into of GMO again must be below 0.9%.China joins WTO, and unavoidably can face the trade dispute of genetically modified food.External transgene agricultural product enters China market by trade in a large number under the situation that is not having sign and statement, agriculture production, economic interests, people's health and the ecotope of China brought very big potential risk.At the situation of current China reinforcement food safety management, set up the detection method that China's food safety is badly in need of, be convenient to administrative authority genetically modified food is carried out tracking and managing, and then protection human consumer's health and rights and interests.Study and define as early as possible standard to its carry out accurately, rapid detection seems very urgent.Calendar year 2001, country formulated " agriculture genetically modified organism security control regulations ".For ensureing the enforcement of " regulations ", the Ministry of Agriculture issued " agriculture genetically modified organism safety evaluation management method ", " agriculture genetically modified organism import security management method " and " agriculture genetically modified organism identity management way " three supporting regulations in 2002.From 2002.3.20 day execution.Requirement identifies soybean, corn, rape genetically modified food.

GMOs in the food is detected, and the official method of European Union's recommendation at present has two kinds.One detection that is based on DNA is PCR (polymerase chain reaction), and two is LISA (enzyme linked immunoassay) based on proteic detection.Protein Detection sensitivity, quick.But sex change easily takes place in albumen in processed food, and in addition, some albumen is only expressed in a certain particular organization of crop.With respect to protein, DNA is more stable.Even in deep processed product, can both detect the existence of DNA as salad oil.Ten fens sensitivities of PCR, but primary first-order equation can only detect a kind of transgene component.The genetically modified crops new along with world wide continue to bring out, and existing detection technique can not satisfy the needs of the genetically modified food detection of a large amount of different strains.Press for new technology and equipment and satisfy high-throughput and the low cost detection of the range gene modifier of increase day by day.

The DNA chip technology is one of the most promising field of detecting of genetically modified food.The DNA chip technology is the Microarray technology again, it has been fast-developing molecular biology new and high technology of getting up since the mid-90, its principle is to adopt method such as the synthetic or micro-printing of photoconduction original position, a large amount of dna probe fragments are solidified surface in upholder in an orderly manner, then with the biological sample of mark in dna molecule hybridize, again hybridization signal is carried out check and analysis, can obtain bulk information at short notice quickly and accurately.The DNA chip technology has the same advantage of PCR method.Can accurately carry out the qualitative detection of genetic modification thing.Difference is can be at fixing thousands of the specific probes of solid surface.Can examination in once independent analysis, a large amount of different types of genetic modification thing in the qualitative sample.In addition, the DNA chip technology is very flexible, can increase in array when new genetic modification thing occurs and layout, and new gene order is included in the examination program.

English periodical " AGRICULTURAL AND FOOD CHEMISTRY " has been delivered one piece about make the chip technology article of probe in detecting genetically engineered soybean of peptide nucleic acid(PNA) in November, 2004.Set up a chip model and verified but just designed five oligopeptides nucleic acid probes, be not enough to be used for practical application at the house-keeping gene of genetically engineered soybean and foreign gene.

Chinese invention patent CN1584049A discloses the oligonucleotide chip technology that transgene agricultural product detects that is used for.But the designed detection probes of this technology is the oligonucleotide probe of length about 20 bases.And the foreign gene of the transgene agricultural product that will detect is generally all at hundreds of more than the base, have at 1000 more than the base.Only go to detect at a foreign gene, be not enough to guarantee the specificity of detected result with an oligonucleotide probe.In addition, sterically hindered when reducing the chip solid-phase hybridization, this technology has connected one section connecting arm at 5 of oligonucleotide ' end.For oligonucleotide probe is fixed on the slide, also 5 of oligonucleotide ' end has been carried out the modification of chemical group.This makes chip can't break away from expensive cost.There are the problems referred to above equally in one piece of one piece of article using 5 kinds of transgene agricultural products of DNA chip platform technology for detection that " AGRICULTURAL AND FOOD CHEMISTRY " delivers at the beginning of 2005.

Summary of the invention

Problem at the middle existence of prior art an object of the present invention is to provide a kind of transgene agricultural product DNA detection chip.

Another object of the present invention provides a kind of preparation method of transgene agricultural product DNA detection chip of the present invention.

Another object of the present invention provides the application of transgene agricultural product DNA detection chip of the present invention in detecting transgene agricultural product.

Another object of the present invention provides a kind of transgene agricultural product DNA detection kit.

Another object of the present invention provides a kind of method that detects transgene agricultural product.

The present invention is in the universal primer and Auele Specific Primer that use the official recognition, according to designing genetically engineered soybean Round-upready voluntarily from the sequence data that Relational database is collected and number of ways is obtained, transgenic corns MON810, transgenic corns GA21, transgenic corns NK603, transgenic rapeseed MS1RF1, the universal primer and the special primer of the foreign gene of 7 strains of transgenic rapeseed T45 and four kinds of genetically modified crops of transgenosis rice SCK carry out annealing temperature consistence and specific screening, have set up stable PCR system by a large amount of screening operations.Make up the plasmid that contains exogenous genetic fragment by the DNA recombinant technology, and do template with plasmid and carry out pcr amplification, the purified higher double-stranded DNA stationary probe of specificity that is prepared into of product, after every index is optimized, stationary probe is layouted on amidized slide, be prepared into and be applied to transgene agricultural product detection DNA chip.The testing sample hybridization of the Cy5 mark of chip and the amplification of multiplex PCR system is carried out scanning analysis by chip scanner after 12 hours, according to the external source target gene situation that is contained in this sample of hybridization signal interpretation intuitively.

Therefore, according to an aspect of the present invention, a kind of transgene agricultural product DNA detection chip is provided, this chip comprises sheet base and the nucleic acid probe that is positioned on the sheet base, this chip comprises sheet base and the nucleic acid probe that is positioned on the sheet base, this nucleic acid probe comprises the target detect probe of following a series of detection target genes: at least one in SEQ ID NOs:1～4 of detection hpt, in SEQ ID NOs:5～9 of detection nptII at least one, in NOs:10～13 of detection pnos at least one, in SEQ ID NOs:l4～16 of detection no at least one, in SEQ ID NOs:17～19 of detection camv35s at least one, detect the SEQ ID NO:20 of mdb484-mdb501, in SEQ ID NOs:21～23 of detection barstar at least one, in SEQ ID NOs:24～26 of detection barnase at least one, in SEQID NOs:27～30 of detection cpti at least one, in SEQ ID NOs:31～34 of detection mcp4epsps at least one, in SEQ ID NOs:35～37 of detection cryIA (b) at least one, in SEQ ID NOs:38～40 of detection cp4epsps at least one, detect the SEQ ID NO:41 of rbcl, in SEQ ID NOs:42～44 of detection lectin at least one, in SEQ ID NOs:45～47 of detection zein at least one, at least one in SEQ ID NOs:48～50 of detection napin.The detection probes sequence sees Table 1.

Table 1

Gene	Probe length bp	SEQ ID NO	Gene	Probe length bp	SEQ ID NO
						hpt①	283	1	cpti①	315	27
hpt②	215	2	cpti②	352	28
						hpt③	488	3	cpti③	209	29
hpt④	441	4	cpti④	370	30
						nptII①	486	5	mcp4epsp①	337	31
nptII②	364	6	mcp4epsps②	236	32
						nptIU③	489	7	mcp4epsps③	335	33
nptII④	325	8	mcp4epsps④	378	34
						nptII⑤	466	9	cryIA(b)①	488	35
pnos①	283	10	cryIA(b)②	473	36
						pnos②	231	11	cryIA(b)③	354	37
pnos③	219	12	cp4epsps①	294	38
						pnos④	225	13	cp4epsps②	236	39
nos①	213	14	cp4epsps③	427	40
						nos②	180	15	rbcl	433	41
nos③	104	16	lectin①	414	42
						camv35s①	162	17	lectin②	407	43
camv35s②	195	18	lectin③	348	44
						camv35s③	239	19	zein①	485	45
mdb484-mdb501	220	20	zein②	277	46
						barstar①	224	21	zein③	329	47
barstar②	216	22	napin①	369	48
						barstar③	248	23	napin②	488	49
barnase①	300	24	napin③	325	50
						barnase②	213	25	spvc	484	51
barnase③	237	26

As described in SEQ ID NOs.1～50, the probe that the present invention uses mostly is the above long sequence of 200 Nucleotide, and this long sequence is compared with the oligonucleotide probe that has only 20 Nucleotide in the prior art, has guaranteed the specificity of hybridization, and the result is more reliable.

In addition, in order to monitor the hybridization result, be provided with strict Quality Control.50% DMSO (dimethyl sulfoxide (DMSO)) sampling liquid is done negative control, and blank is done in non-point sample district.If hybridization back negative control point and blank point detect no signal, show normal; If signal is arranged, show the hybridization failure.

In order to monitor false-negative appearance in the hybridization, ad hoc upright positive control, this positive control probe be one section with the irrelevant nucleotide fragments of target detect gene (for example, Salmonella typhimurium spvc gene fragment, SEQ ID NO.51 for example), and consistent with the hybridization conditions of all stationary probe, can together be fixed on the chip with other probes.When each hybridization detects, the Salmonella typhimurium spvc gene fragment that is marked with Cy5 is mixed than hybridizing with chip in target gene to be measured, if the hybridization back is detected signal is arranged, show normal; If no signal shows the hybridization failure.

House-keeping gene wherein (lectin, zein, napin and rbcl) detection probes can be used as another positive control, not only can monitor the false negative that the hybridization system occurs, and can also monitor before the hybridization false negative that sample occurs through multiplex PCR mark system.The accurate source of the foreign gene that simultaneously can also explain in the testing sample to be detected.Because many crop products can be by the bacterial contamination in the soil, and promotor of being inserted in most of transgene agricultural products and terminator are from the bacterium in the soil, so the signal of house-keeping gene can pick out the particularly source of promotor and terminator of foreign gene exactly.Avoided false positive results.

Non-special signal occurs in the hybridization in order to monitor, and the different probe on the chip in each matrix can contrast each other.Verify that through known sample the detected result that shows the hybridization signal demonstration is accurate.Described probe structuring the formation on chip has no particular limits, can be to structure the formation arbitrarily, for the convenience that helps detecting, probe can be carried out matrix by the difference in functionality of the foreign gene that detects arranges, the probe that for example detection is had the same detection function is divided into a matrix, as described in embodiment 7, probe can be divided into the A of screening effect matrix is arranged; The B matrix that qualitative effect is arranged detects the C matrix of house-keeping gene etc.; Certainly, also described probe can be carried out matrix according to the difference of the agricultural-food that detected arranges, for example will be used for detecting and identify that the probe of same agricultural-food is placed on a matrix, shown in embodiment 6, for example can will detect the probe of soybean as a matrix, all probes of detecting corn as a matrix, certainly, also can be detected the probe of rape as a matrix.

In order to monitor the reliability of results of hybridization, each probe repeats 2 points at least on chip, for example repeats 3 points at least, at least 4 points, and at least 5 points, at least 6 points are taken into account economic factors and easy to operate simultaneously, preferably repeat 3,4 or 5 points.Have a few of same probe shows normal as if the signal unanimity after hybridization; As if the signal that has that has, the no signal that has then result is insincere, need experimentize again further to verify.

Agricultural-food of the present invention comprise agricultural-food starting material and processed food thereof, described agricultural-food starting material comprise soybean, corn, rice or rape, and other contain the agricultural-food that maybe may contain the correlation detection target gene, include but not limited to fresh or exsiccant root, stem, leaf, flower, fruit, seed etc.; Described processing of farm products food comprises the product that carries out simple mechanical workout acquisition, the for example soybean of the flour that obtains by seed, rice, shelling, Semen Brassicae campestris etc., also comprise and carry out the product that deep processing obtained, for example soybean oil, Semen Maydis oil, vegetable seed wet goods, also comprise the food of making by the agricultural-food starting material, for example cake, sausage etc.

Sensing range of the present invention contains the external source target gene of at present common genetically modified crops: camv35vs promotor, no promotor, no terminator, marker gene hpt, nptII, external source target gene cp4epsps, cryIA (b), mcp4epsps, cpti, barnase, barstar, mdb484-mdb501 and as house-keeping gene lectin, zein, napin and the rbcl of endogenous reference gene.

On the other hand, the invention provides a kind of preparation method of transgene agricultural product DNA detection chip, this method comprises:

(1) according to the target gene sequences Design and the synthesized polymer polymerase chain reaction primer of transgene agricultural product, the melting temperature(Tm) of these polymerase chain reaction primers is roughly the same;

(2) utilize (1) described polymerase chain reaction primer target detect probe that from the DNA of transgene agricultural product, increases;

(3) with described probe stationary on the sheet base.

The present invention is being the unique distinction on the chip probe primer design: common gene such as promotor, terminator, antibiotics resistance gene and marker gene will design universal primer as far as possible in detecting for screening, and designed primer will have excellent specificity and will be as far as possible in the coding region of target gene when qualitative detection, avoiding having homology, thereby reduce the false positive of detected result with other probes.But in order to increase the quantity of information of detection, provide further support for judging genetically modified crops kind or strain, can design some primers of joining region, the probe that makes the joining region is layouted on chip, according to the situation of combination the result of chip is carried out interpretation.In addition, all primers must guarantee basically that in same annealing temperature the length requirement of PCR product is relatively more consistent, and amplification efficiency is good.Very favourable for the control of temperature and other conditions in the crossover process of mixing PCR amplification, labeling process and the chip of sample like this, simultaneously between primer influence each other and the influence of amplification efficiency drops to minimum.

At above principle, this research is in universal primer that as far as possible uses the official recognition and Auele Specific Primer (seeing table 2 for details), also design universal primer and Auele Specific Primer (seeing table 3 for details) according to the experiment needs voluntarily by the sequence data that obtains, these primers are important replenishing to unfounded detection target gene still.In 170 pairs of primers designing, filter out the primer of 50 pairs of primers of 16 genes as preparation probe and multiplex PCR mark.In the practical application of chip from now on, the expressed quantity of information of these 50 pairs of primers can satisfy the present methods for detecting transgenic foods standard of studying substantially.Sensing range has contained the external source target gene of following at present common genetically modified crops: camv35S promotor, no promotor, no terminator, marker gene hpt, nptII, external source target gene cp4epsps, cryIA (b), mcp4epsps, cpti, barnase, barstar, mdb484-mdb501 and as house-keeping gene lectin, zein, napin and the rbcl of endogenous reference gene.

Through a large amount of experiment and the research of contriver, the present invention has finally determined to be applicable to primer sequence of the present invention, and has been listed as follows:

The primer of reference

Table 2

Target gene	The primer sequence of target gene is used to increase	SEQ ID NO
			Nos (Ti rouge alkali synthetase terminator) 1.	U5′GATTGAATCCTGTTGCCGGT3′	52
L5′GTAACATAGATGACACCGCG3′	53
nos②	U5′GAATCCTGTTGCCGGTCTTG3′		54
		L5′TTATCCTAGTTGCGCGC3′		55
nos③		U5′GAATCCTGTTGCCGGTCTTG3′		56
	L5′CCCATCTCATAAATAACGTC3′		57
Camv35s (cauliflower mosaic virus 35S promoter) 1.	U5′CCGACAGTGGTCCCAAAGATGGAC3′		58
		L5′ATATAGAGGAAGGGTCTTGCGAAGG3′		59
camv35s②		U5′GCTCCTACAAATGCCATCA3′		60
	L5′GATAGTGGGATTGTGCGTCA3′		61
camv35s③	U5′ATTGCCCAGCTATCTGTCACTT3′		62
		L5′GGATTGTGCGTCATCCCTTAC3′		63

			Mdb484-mdb501 (Semen Brassicae campestris T45 qualitative detection gene)	U5′GTGGATATACAACACGTGACTG3′	64
L5′GTGAGTAGTTCCCAGATAAGG3′	65
The general house-keeping gene of rbcl eukaryote (coding 1, the big subunit of 5-Diphosphonate carboxylase)	U5′AATCTTCTACTGGTACATGGAC3′		66
		L5′TCATCATCTTTGGTAAAATCAAG3′		67
Lectin soybean house-keeping gene is (coded plant hemagglutinin) 1.		U5′TGCCGAAGCAACCAAACATGATCCT3′		68
	L5′TGATGGATCTGATAGAATTGACGTT3′		69
lectin②	U5′GAAGCAACCAAACATGATCCTC3′		70
		L5′ATGGATCTGATAGAATTGACGTTA3′		71
lectin③		U5′TGCCGAAGCAACCAAACATGATCCT3′		72
	L5′AAGTGTCAAACTCAACAGCGACGAC3′		73
Zein corn house-keeping gene is (coding zein) 1.	U5′GCTTGCATTGTTCGCTCTC3′		74
		L5′CGATGGCATGTCAACTCATTA3′		75
zein②		U5′AGTGCGACCCATATTCCAG3′		76
	L5′GACATTGTGGCATCATCATTT3′		77
zein③	U5′TGCTTGCATTGTTCGCTCTCCTAG3′		78
		L5′GTCGCAGTGACATTGTGGCAT3′		79

She Ji primer voluntarily

Table 3

Target gene	The primer sequence of target gene is used to increase	Length bp	TM value ℃	Probe length bp	SEQ ID NO
						1. nptII (derives from intestinal bacteria E.coli, the coding neomycin phosphotransferase)	U5′ATACCGTAAAGCACGAGGAAG3′	21	56.7	486	80
L5′CACTGAAGCGGGAAGGGACT3′	20	61.4		81
nptII②	U5′CCTTGAGCCTGGCGAACA3′	18	61.1	364		82
					L5′GGTGCCCTGAATGAACTGC3′		19	57.9		83
nptII③					U5′ATACCGTAAAGCACGAGGAAG3′		21	56.7	489	84
	L5′TGTCACTGAAGCGGGAAGG3′	19	59.0			85
nptII④	U5′GATGTTTCGCTTGGTGGTCG3′	20	61.1	325		86
					L5′TCTGATGCCGCCGTGTTCC3′		19	64.7		87
nptII⑤					U5′CCTTGAGCCTGGCGAACAGTT3′		21	64.0	466	88
	L5′GGCTATGACTGGGCACAACA3′	20	59.0			89
Hpt is (hygromycin phosphotransferase gene) 1.	U5′TGTCCTGCGGGTAAATAGC3′	19	56.1	283		90
					L5′TCCTTGCGGTCCGAATGG3′		18	62.2		91
hpt②					U5′CACTGGCAAACTGTGATGG3′		19	54.7	215	92
	L5′ATGTTGGCGACCTCGTATT3′	19	55.2			93

						hpt③	U5′CGTTATGTTTATCGGCACTTTG3′	22	40.9	488	94
L5′CCGAACATCGCCTCGCTCCAGT3′	22	63.6		95
hpt④	U5′ACGACACCGTCAGTGCGTCC3′	20	63.7	441		96
					L5′CGCTTCTGCGGGCGATTTGT3′		20	67.9		97
Pnos is (nopaline synthase promoter, no promotor) 1.					U5′GAGCGGAGAATTAAGGGAGTC3′		21	57.5	283	98
	L5′TTGGATTGAGAGTGAATATGAG3′	22	52.1			99
pnos②	U5′GCGGAGAATTAAGGGAGTCAG3′	21	58.4	231		100
					L5′TGGAACGTCAGTGGAGCATT3′		20	58.5		101
pnos③					U5′TTAAGGGAGTCACGTTATG3′		19	48.0	219	102
	L5′ACGTCAGTGGAGCATTTT3′	l8	50.1			103
pnos④	U5′GGAACTGACAGAACCGCAACG3′	21	62.8	225		104
					L5′GCAGATTATTTGGATTGAGAG3′		21	52.0		105
1. cp4epsps (derives from edaphic bacillus Agrobacterium, coding 5-enol pyruvoyl oxalic acid-3-phosphate synthase)					U5′GGAGTTCTTCCAGACCGTTCAT3′		22	59.8	294	106
	L5′TTGCGGCCCTGCTTGTT3′	17	60.4			107
cp4epsps②	U5′GTCGGAGCCCGGAACAAGCA3′	20	67.7	236		108
					L5′GCCTCAACACGCCCGGCATCA3′		21	72.6		109
cp4epsps③					U5′TCGCCCTCATCGCAATCC3′		18	62.2	427	110
	L5′TCACCGGCCAAGTCATCG3′	18	60.4			111
1. mcp4epsp (derives from corn, coding 5-enol pyruvoyl oxalic acid-3-phosphate synthase)	U5′CAACGGTGGAAGAGTTCAATG3′	21	58.0	337		112
					L5′GGCGGCGAGTAGGAGGAT3′		18	59.7		113
mcp4epsps② (					U5′ACGACTTCTCCACCCTT3′		17	48.4	236	114
	L5′GCCGTTGCTGACGTTGC3′	17	58.5			115
mcp4epsps③	U5′CTTGGTAGTTTGGGTGGG3′	18	53.0	335		116
					L5′GATGAACAATGCTGAGGGA3′		19	53.3		117
mcp4epsps④					U5′CTTGGTAGTTTGGGTGGG3′		18	53.0	378	118
	L5′CACGAGGCTGCATTTGTC3′	18	54.9			119
CryIA (b) 1. (derives from the Bacillus thuringiensis toxoprotein gene of Bacillus thuringiensis Bacillusthuringiensissubs p.Kurstaki)	U5′TCGTCCGTGAGCATCATCAGAGC3′	23	67.0	488		120
					L5′ACGAACTCAATGCGGTCAAT3′		20	57.8		121
cryIA(b)②					U5′CAAGTCCCGCTCCTGTCCGTGTA3′		23	68.1	473	122
	L5′CGGTGGGCATCGGTGTAGATAGTG3′	24	67.5			123

						cryIA(b)③	U5′GCAACGCCGCTCCACAACAACGCAT3′	25	77.1	354	124
L5′CGCTGCGATGAATCCAGGAGAAC3′	23	61.8		125
Cpti is (cowpea trypsinase suppressor gene) 1.	U5′AAGGTGTGTGTGCTGGTACTTTTC3′	24	62.3	315		126
					L5′ATCTTTCTCATCATCTTCATCCCT3′		24	58.2		127
cpti②					U5′CCACCTCATACCTACCTT3′		18	46.1	352	128
	L5′TTCTCATCATCTTCATCCCT3′	20	51.3			129
cpti③	U5′CCACCTCGGAAGTAATCA3′	18	50.6	209		130
					L5′AATCACGAATGTCAAGGCAACG3′		22	62.6		131
cpti④					U5′CTCTGTTGTGCCTTCACCACCT3′		22	61.5	370	132
	L5′CTTTCTCATCATCTTCATCCCT3′	22	55.2			133
1. barnase (derives from bacillus amyloliquefaciens (Bacillusamylolique faciens) and expresses male sterile albumen)	U5′GGTTATCAACACGTTTGACGGGGT3′	24	66.1	300		134
					L5′TGGTCCGTTGTTTTGTAAATCAGC3′		24	63.3		135
barnase②					U5′CACGTTTGACGGGGTTGCGGATTAT3′		25	71.7	213	136
	L5′ATATCCGCTTCACGCCATGTTCGTC3′	25	71.2			137
barnase③	U5′AATCAGAAGCACAAGCCCTCG3′	21	61.9	237		138
					L5′AGGTCTGATAATGGTCCGTTGTT3′		23	56.6		139
1. barstar (derives from bacillus amyloliquefaciens (Bacillusamylolique faciens) and expresses fertility restorer albumen)					U5′TCAGCGACCTCCACCAGACAT3′		21	62.5	224	140
	L5′TATGATGGTGATGTCGCAGC3′	20	57.3			141
barstar②	U5′AAGTATCAGCGACCTCCACCAG3′	22	60.8	216		142
					L5′TCGCAGCCTTCCGCTTTCG3′		19	66.8		143
barstar③					U5′GGGGAACAAATCAGAAGTAT3′		20	50.8	248	144
		L5′GAAAGTATGATGGTGATGTCGC3′	22	57.2							145
	Napin is (rape house-keeping gene) 1.	U5′CTCGCCTTGTTCTTCCTTC3′	19	54.7		369					146
L5′CTGTTGTCTAACGGCTTTG3′					19		54.1		147
napin②	U5′CTCGCCTTGTTCTTCCTTCTC3′				21		58.4	488	148
		L5′CAAATGCTAACTTGCCTGATG3′	21	56.3						149
napin③		U5′CTTCCTTCTCACCAATGCCTC3′	21	58.8		325				150
	L5′GGTTGGGCAAACGCAAAGTG3′				20		63.6		151
Spvc (deriving from the Salmonella typhimurium plasmid, the gene of coding virulence)	U5′GTAGCTGCTATGATGGG3′				18		48.8	484	152
		L5′ATTGCCGTGTCTTGTGGAG3′	19	56.0						153

In the preparation method of transgene agricultural product DNA detection chip of the present invention, preferably utilize the polymerase chain reaction target detect probe that from the DNA of transgene agricultural product, increases, the condition of polymerase chain reaction is well known by persons skilled in the art.A kind of preferred polymerase chain reaction is provided in the present invention, and its condition is: 94～95 ℃ of pre-sex change 3～5min; 94 ℃ of sex change 40s; 58～60 ℃ of annealing 40s; 72 ℃ are extended 60s; Carry out 40 circulations; 72 ℃ are extended 5～10min.

The method of described probe stationary on the sheet base can be adopted this area point sample method commonly used.The mode of point sample is divided two kinds, and one is the contact point sample, and promptly point needle directly contacts with the solid support surface, and the DNA sample is stayed on the solid support; It two is contactless point sample, i.e. specking, and it is with piezoelectric principle the DNA sample directly to be sprayed onto the solid support surface by kapillary.Now there has been the spot sample device of comparison moulding to sell Pix-Sys NQ/PA series " printing " instrument of for example " spray printing " instrument of U.S. Biodot company, and Cartesian Technologies company.In the present invention, preferred contact point sample.For the purposes of the present invention, the sheet base can use known in the art base, preferably uses amidized base.

On the other hand, the invention provides the application of a kind of transgene agricultural product DNA detection chip in detecting transgene agricultural product.Transgene agricultural product DNA detection chip of the present invention can be used to carry out the detection (referring to embodiment 4) of kind, can be used to carry out the detection (referring to embodiment 5) of external source target gene, can be used to carry out strain and identify (referring to embodiment 6), and can be used for one or more combine detection or evaluation wherein, what is more important the invention provides a kind ofly can carry out preliminary screening to transgene agricultural product, kind detects, strain is identified incorporate DNA chip, this is for simplifying procedures, fast, high-throughput ground carries out the detection of transgene agricultural product and identifies significant.

In an embodiment of the invention, described application can specifically may further comprise the steps: (1) extracts the DNA of agricultural-food to be measured; (2) utilize primer of the present invention that the DNA of agricultural-food to be measured is carried out pcr amplification and mark; (3) will be through the amplified production and the transgene agricultural product DNA detection chip of the present invention hybridization of mark; (4) determine whether described agricultural-food to be measured are transgene agricultural product.In above-mentioned steps, can described primer be divided at least two groups, and then carry out pcr amplification and mark respectively as described in the embodiment 7 with each group, can reduce many like this to the interference between primer.To remix hybridization behind these two groups of primers difference marks, the purifying, so both do not lost detection information, and still can embody the high-throughout characteristics of chip.In addition, the method for in the above-mentioned steps sample being carried out mark can adopt fluorescence labeling method.Fluorescence labeling method is divided into 2 kinds substantially, a kind ofly is to use fluorescently-labeled primer, a kind ofly is to use fluorescently-labeled triphosphate deoxyribose nucleotide.The normal at present fluorescent substance that uses has: fluorescein, rhodamine, HEX, TMR, FAM, Cy3, Cy5 etc.According to the method difference of mark, the isolating method of amplified production is also different: carry out single primer mark, its amplified production is separated by polyacrylamide gel electrophoresis usually; To a primer biotin labeling, another primer is generally caught its amplified production with the plain link coupled magnetic bead of affinity with fluorescein-labeled, by denaturing treatment fluorescently-labeled product is unwind.In addition, the also plain residue marker primer of useful organisms, with biotin labeled amplified production and chip hybridization, the washing back adds the plain fluorescence that connects of affinity, by vitamin H and affinity element combine and target sequence produces fluorescent signal with combining of probe, utilize fluorescence detecting system that fluorescent signal is detected then.Use Cy5-dUTP to carry out mark in an embodiment of the present invention, use present known detection technique of fluorescence to detect.How to it be known to those skilled in the art that and to determine whether to be transgene agricultural product according to the hybridization detected result.Specifically can be referring to embodiment 3,4,5,6,7.

In addition, the present invention also provides a kind of transgene agricultural product DNA detection kit, this transgene agricultural product DNA detection kit except comprising transgene agricultural product DNA detection chip of the present invention, can also comprise in the primer shown in SEQ ID NOs.52～153 partly or entirely.These primers can be contained in the container, also can be divided into several groups, are contained in respectively in the different containers, or also can all be contained in the independent container.In addition, can also comprise in this test kit and be used to one or more components of detecting or increasing.According to the difference of concrete detection method and amplification method, test kit can contain different components.What provide simultaneously with it can be through medication management mechanism of government audit, relevant medicine or biological products manufacturing, the information using and sell.

In addition, the present invention also provides a kind of method that detects transgene agricultural product, and this method comprises:

1) DNA of extraction agricultural-food to be measured;

2) utilize the DNA of the described product to be measured of target detect probe in detecting of the present invention;

3) judge with the situation that combines of described transgene agricultural product DNA whether these agricultural-food to be measured are transgene agricultural product according to described probe.

The DNA method of extracting agricultural-food to be measured can be that a class is fit to the required any extracting method of this detection, the extracting method that those skilled in the art is can be according to the type selecting of agricultural-food suitable.Can with described target detect probe stationary on the sheet base, make transgene agricultural product DNA detection chip of the present invention, and then detect in the method; Also can not be fixed on the sheet base, directly detect.

Advantage of the present invention and effect

Transgene agricultural product detect the DNA chip be with the DNA chip be platform set up in order to the change the line of production new technology of external source insertion gene in the product of detection.Be different from regular-PCR and once can only detect a gene, a large amount of different types of genetic modification thing that the DNA chip can be in high-throughput ground test sample.The hybridization detection of comparing the DNA chip with multiplex PCR is sensitiveer, and interpretation is more accurate as a result.

What is more important, the probe that the present invention uses mostly are the above long sequence of 200 Nucleotide, and this long sequence is compared with the oligonucleotide probe that has only 20 Nucleotide, have guaranteed the specificity of hybridization, and the result is more reliable.And the present invention makes up the detection probes that plasmid is done template and the preparation of pcr amplification technology by recombinant DNA technology, owing to there is not the sterically hindered problem between oligonucleotide probe and slide, so need not do any chemically modified again to probe, reduce the cost of chip preparation, helped following industrialized development.

The probe of DNA chip is higher to primer requirement, promptly except the rule that will follow design of primers, the primer annealing temperature is consistent as far as possible, the length of amplified fragments is consistent as far as possible, reduce complementary sequence between each primer, this has increased the difficulty of design of primers and screening.The present invention is by a large amount of experiments, 50 pairs of high specific primer PCR amplification efficiencies that filter out are higher, the probe homology of amplification is lower, carry out probe that pcr amplification prepares this chip with these 50 pairs of primers and can satisfy that the preliminary examination, the kind that detect genetically modified food detect, the requirement of strain evaluation different levels.For example camv35s promotor, no terminator, no promotor, hpt probe, nptII position positive signal occurs and can point out that the food of detection is suspicious to be genetically modified food.Whether house-keeping gene lectin, the signal of zein and napin and rbcl probe can help us to know this genetically modified food is from soybean, corn, Semen Brassicae campestris, rice or other contains the agricultural-food that maybe may contain the correlation detection target gene.From foreign structural gene cp4epsps, cryIA (b), mcp4epsps, cpti, barstar and barnase, the signal of mdb484-mdb501 probe can know this genetically modified food has which kind of moral character of characteristics such as antiweed, pest-resistant or male sterile.The multiple information that all provide on the composite chip can further be differentiated the strain of genetically modified food, knows that this genetically modified food is which company is commercially available, contains which external source and inserts gene, is convenient to administrative authority to its spike management.

In addition, because probe stationary of the present invention on a slice base, can be obtained multiple information simultaneously by hybridization once.Contrast primary dcreening operation that present round pcr carries out, qualitative etc. detect step by step, have high-throughput, fast advantage.

Application result demonstration genetically modified food DNA detection chip of the present invention can be discerned detection to a plurality of target genes of above-mentioned 7 kinds of genetically modified crops, has higher specificity and better repeatability.Strict Quality Control promise the chip results interpretation accurately, also be of the present invention one big advantage.

The SCK paddy rice is the transgenic pest-resistant rice that has independent intellectual property right of Chinese Academy of Sciences's heredity and biological development Research Institute.Inserted the foreign gene of expression Cowpea Trypsin Inhibitor (CPTI), hygromix phosphotransferase (HPT) etc.This research is research object with the S86 product of SCK paddy rice processing back product SCK rice, has set up the chip detecting method of S86 first, and through checking, detected result has good accuracy, specificity and repeatability.For having China's characteristic and having the transgenic paddy rice of industrialization prospect that the basic data of safety research is provided and set up the genetic marker method of cpti and hpt.

Description of drawings

Fig. 1 is a chip manufacturing schema of the present invention;

Fig. 2 and Fig. 3 are the result that chip of the present invention detects kind.Fig. 2 is a corn; Fig. 3 is a Semen Brassicae campestris; Symbol 1.rbcl among the figure, 2.zein, 3.lectin, 4.napin; The positive signal at four angles is localized marker among the figure;

The result that Fig. 4-Fig. 7 detects the external source target gene for chip of the present invention, wherein, Fig. 4 is transgenosis rice S86; Fig. 5 is a transgenosis rice S86 negative control sample; Fig. 6 is a transgenosis Ms1Rf1 Semen Brassicae campestris; Fig. 7 is a transgenic rapeseed negative control sample; Symbol 1.barnase among the figure, 2.mdb484-mdb501,3.cryIA (b), 4.mcp4epsps, 5.cp4epsps, 6.cpti; The positive signal at four angles is localized marker among the figure;

Fig. 8-Figure 11 carries out strain identification and detection result for chip of the present invention, and wherein, Fig. 8 is a genetically engineered soybean RRS40-3-2 strain, symbol 1.lectin among Fig. 8,2.camv35s, 3.nos, 4.cp4epsps; Fig. 9 is transgenic corns GA21; Figure 10 is transgenosis rice S86; Symbol 1.zein among Fig. 9, Figure 10,2.camv35s, 3.nos, 4.mcp4epsps, 5.rbcl, 6.cpti, 7.hpt; Figure 11 is transgenic corns MON810, symbol 1.zein among Figure 11,2.camv35s, 3.nos, 4.mcp4epsps, 5.cryIA (b), 6.cp4epsps, 7.lectin;

Figure 12-Figure 15 is the synoptic diagram and the detected result of the integrated DNA detection chip of the present invention, and wherein Figure 12 is the detected result synoptic diagram of genetically engineered soybean RRS40-3-2; Figure 13 is the detected result scintigram of genetically engineered soybean RRS40-3-2; Figure 14 is the detected result synoptic diagram of Semen Brassicae campestris MS1RF1; Figure 15 is the detected result scintigram of Semen Brassicae campestris MS1RF1.Symbol 1.Hpt among Figure 12～Figure 15,2.nptII, 3.pnos, 4.nos, 5.35s1,6.35s2,7.mdb501-484,8.barstar, 9.barnase, 10.cpti, 11.mcp4epsps, 12.cryIA (b), 13.cp4epsps, 14.50%DMSO (negative control), 15.spvc (positive control), 16.rbcl, 17.napin, 18.zein, 19.lectin.

Embodiment

The preparation of embodiment 1, transgene agricultural product detection chip

1, the extraction of transgene agricultural product genomic dna (CTAB method and silicagel column method of purification)

Transgene agricultural product sample and source: the positive and the negative sample of genetically engineered soybean 40-3-2, transgenic corns MON810, GA21, NK603 are provided by Monsanto company.The positive of transgenic rapeseed Ms1Rf1 and T45 and negative sample are provided by Bayer company.The S86 positive and the negative sample of transgenosis rice SCK are provided by Inst. of Genetics and Development Biology, CAS.

Cetyltrimethylammonium (CTAB) extraction buffer compound method: 20g/l CTAB, 4.0g; 4M NaCl, 16.4g; 0.1M Tris-HCl, 3.15g; 20mM sodium ethylene diamine tetracetate (Na ₂EDTA), 1.5g; Add the 100ml aseptic deionized water, transfer PH to 8.0 with 1M NaOH, last constant volume was preserved 6 months for 4 ℃ to the 200ml autoclaving.

CTAB precipitation buffering liquid making method: 5g/l CTAB, 1g; 0.04M NaCl, 0.5g; Add the 100ml aseptic deionized water, transfer PH to 8.0 with 1M NaOH, last constant volume was preserved 6 months for 4 ℃ to the 200ml autoclaving.

Operation steps:

(1) sample is ground in ceramic mortar gently, add liquid nitrogen and continue to grind to form fine powder.

(2) dip in the 1.5ml centrifuge tube that the ground sample powder of about 100mg changes sterilization over to spoon, add 500～800 μ lCTAB and extract the damping fluid mixing.Add 20 μ l Proteinase Ks (Promega, 20mg/ml) mixing, 65 ℃ of water-bath 30～90min.Stir 1 time every 10min.

(3) add 20 μ l/RNA enzyme (10mg/mL) mixings, 65 ℃ of water-bath 5～10min.

The centrifugal 10min of (4) 16,000rpm.After centrifugal supernatant is transferred in the 1.5ml centrifuge tube.

(5) Xiang Guanzhong adds isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1), the centrifugal 10min of 16000rpm behind the mixing gently.After centrifugal supernatant is transferred in the 1.5ml centrifuge tube.

(6) Xiang Guanzhong adds isopyknic chloroform: primary isoamyl alcohol (24: 1), the centrifugal 5min of 16000rpm behind the mixing gently.After centrifugal supernatant is transferred in the 1.5ml centrifuge tube.

(7) repeating step (6) once.

(8) add the CTAB precipitation buffering liquid of 2 times of volumes, behind the mixing, room temperature leaves standstill 60min gently.

The centrifugal 5min of (9) 16,000rpm abandons supernatant.Add the dissolving of 350 μ l 1.2M NaCl solution.

(10) add 350 μ l chloroforms, mixing is 30 seconds gently, the centrifugal 10min of 16000rpm.

After centrifugal supernatant is transferred in the 1.5ml centrifuge tube.

(11) in centrifuge tube, add NaAc (3M) mixing of 1/10 volume, add the ice dehydrated alcohol of 2 times of volumes again, place 30min for-20 ℃.

(12) the centrifugal 5min of 16000rpm abandons supernatant.Add the centrifugal 5min of 300ml 70% ethanol 16000rpm, abandon supernatant.

(13) dry centrifuge tube, Xiang Guanzhong add 100 μ l aseptic deionized water dissolving DNAs.

(14) with cellular genome clean-up test kit (Promega company) purifying (operation steps is seen the test kit working instructions).

(15) the DNA sample crossed of purifying place-20 ℃ or more low-temperature environment preserve standby.

Get DNA electrophoresis in 1.0% sepharose of 2 μ l preparation, the quality of Detection and Extraction genomic dna and content.

2. the preparation of detection probes

With the transgene agricultural product genomic dna of the foregoing description 1 as template, adopt the corresponding primer (synthetic) of table 2 and table 3 to carry out pcr amplification (TaqDNA polysaccharase by match Parkson, Beijing gene engineering company limited, the living worker biotechnology company limited in Shanghai and Beijing AudioCodes biotechnology limited liability company, purchase vast Tyke biological gene technology limited liability company) in Beijing, the product that obtains is cut on the PMD-18T that recombinates after glue reclaims (the precious biotechnology (Dalian) of the Takara company limited) carrier, be transformed in the bacillus coli DH 5 alpha.Extract colibacillary plasmid, do template with the plasmid of dilution again and carry out pcr amplification, obtain layouting on chip as stationary probe behind the product purification.

Operation steps:

(1), PCR reaction amplification external source target gene fragment

PCR reaction system 20 μ l:PCR damping fluids, 2.0 μ l; Primer (each 5 μ M of upstream and downstream), 1.6～2.0 μ l; DNTP (10mM), 0.4 μ l; Template DNA (above-mentioned a certain transgene agricultural product genomic dna), 1.0～2.0 μ l; Taq (5U/ μ l), 0.1～0.2 μ l; Deionized water polishing to 20 μ l.

PCR reaction conditions: 94～95 ℃ of pre-sex change 3～5min; 94 ℃ of sex change 40s; 58～60 ℃ of annealing 40s; 72 ℃ are extended 60s; Carry out 40 circulations; 72 ℃ are extended 5～10min.

The detection of PCR product: after amplification finishes, get 2.0 μ l reaction solutions and mix with 0.4 μ l6 * tetrabromophenol sulfonphthalein damping fluid, electrophoresis in 2% sepharose (containing EB0.5 μ g/ml) is with reading glue instrument observations and taking a picture.

The fragment of institute's syllabus is cut glue reclaim (cut glue recovery test kit and purchase company) purifying in QIAGEN.

(2), CaCl ₂Legal system is equipped with the competence intestinal bacteria.Operation steps is seen " molecular cloning experiment guide " (third edition).

(3), make up the recombinant plasmid that contains this dna sequence dna.Operation steps is seen " molecular cloning experiment guide " (third edition).

(4), extracting plasmid.Operation steps is seen " molecular cloning experiment guide " (third edition).

(5), carry out PCR prepared in reaction stationary probe with being used as template after 1000 times of the institute extracting plasmid dilutions.

PCR reaction system 20 μ l:PCR damping fluids, 2.0 μ l; Primer (each 5 μ M of upstream and downstream primer), 1.6～2.0 μ l; DNTP (10mM), 0.4 μ l; Template DNA (plasmid), 0.4～1.0 μ l; Taq (5U/ μ l), 0.1～0.2 μ l; Deionization, polishing to 20 μ l.

The same step of PCR reaction conditions (1).

(6), the purifying of detection probes and quantitative

Ethanol precipitation purification assays probe, concrete operations are as follows:

(a) get 200 μ l PCR reaction solutions, add 400 μ l dehydrated alcohols and 20 μ l sodium acetates (final concentration is 0.3mol/L) ,-20 ℃ 1 hour.

(b) 4 ℃ 12, the centrifugal 10min of 000rpm abandons supernatant.

(c) 70% ethanol, 4 ℃ 12, the centrifugal 2min of 000rpm abandons supernatant.

(d) after 37 ℃ of dryings, be dissolved in the 10 μ l aseptic deionized waters.

(e) get 1 μ l solution, 2% agarose gel electrophoresis, the check probe mass.

(f) get 2 μ l solution dilutions and under ultraviolet spectrophotometer, measure concentration and probe concentration to 50 μ l.

(g) with aseptic deionized water concentration and probe concentration is diluted to 500～1000ng/ μ l.

(h)-20 ℃ of preservations are standby behind adding isopyknic 100%DMSO solution (100%DMSO is a sampling liquid) mixing.

3. detection probes fixing on the amination slide

Operation steps:

(1) stationary probe is put into 384 orifice plates, every hole 5 μ l, concentration is 250～500ng/ μ l.

(2) 384 orifice plates and the good slide (amination sheet glass (purchasing hundred companies difficult to understand in Shanghai)) of silanization are placed on specified location.

(3) point sample program point sample instrument (Perkin Elmer company, the U.S.) point sample is set.

(4) point sample aftertreatment: humidifying: 50～60 ℃ of steam humidifying 30～50s; Do roasting: 80 ℃ 1 hour; UV-crosslinked: as to have facing up of DNA, ultraviolet to release energy printing on the slide and be DNA to be fixed on the slide 250mJ; 2% sodium cetanesulfonate (SDS) is washed 2～10min.Ultrapure water (Ω 〉=17 megaohms) flushing 2～10min; Sex change: boil 1～5min in 90 ℃ of water, immerse 3min in the ice dehydrated alcohol immediately; Dry and wait to hybridize.

(5) arranged can manifest in the process of humidifying, can judge whether chip has the situation of leak source by naked eyes thus.After the sample hybridization with chip and standard reference materials or known transgene component, can judge, show that chip has prepared success if the result meets expection by the result and the detected result of Quality Controls such as positive reference, negative reference and blank reference.

The preparation of embodiment 2, testing sample

1, testing sample genome DNA extracting method

Method is referring to " extracting method of transgene agricultural product genomic dna " among the embodiment 1.

2, the mark of testing sample (multiplex PCR is fluorescein-labelled)

25 μ l volumes: PCR damping fluid, 2.5 μ l; Primer (mix primer) table 2 and 3 listed mix primer concentration and blending ratio be mask body embodiment as follows); DNTP (10mM, no dTTP), 0.5 μ l; Cy5-dUTP (1mM) (Pharmacia company), 0.5 μ l; DTTP (1mM), 2.0 μ l; Template DNA (genomic dna of above-mentioned testing sample), 1.0～2.0 μ l; Taq (5U/ μ l), 0.3～0.5 μ l; DH ₂O, polishing to 25 μ l.

PCR reaction conditions: with embodiment 1.

The detection of embodiment 3, product to be measured

1, the hybridization of slide and washing

Operation steps:

(1) slide is placed in the hybridization storehouse.

(2) the micro-centrifuge tube heat denatured of label probe will be housed: 100 ℃ of boiling water boil 3min.

(3) Xiang Guanzhong adds the efficient hybridization solution of 100 μ l (ancient cooking vessel state company), injects the hybridization storehouse behind the piping and druming mixing.Hybridized 12～18 hours for 42 ℃.

After (4) 12～18 hours slide is taken out, put into and wash film I liquid (2 * SSC, 0.1%SDS) washing 2min.

(5) wash film II liquid (0.1 * SSC, 0.1%SDS) washing 2min.

(6) aseptic high purity water washing 2min dries to be scanned.

2, scanner is observed results of hybridization down

Detected result is judged according to the signal that scanner (Perkin Elmer company, the U.S.) reads.Positive signal determining is positive on the basis of background correction signal, and negative signal determining is negative.

Embodiment 4, house-keeping gene DNA detection chip

Method: prepare transgenosis detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.Wherein with the 414bp gene fragment (SEQ ID NO.42) of genetically engineered soybean specificity house-keeping gene lectin, the 277bp gene fragment (SEQ ID NO.46) of transgenic corns specificity house-keeping gene zein, the 325bp gene fragment (SEQ ID NO.50) of transgenic rapeseed specificity house-keeping gene napin, the 433bp gene fragment of eukaryote specificity house-keeping gene rbcl (SEQ ID NO.41) is probe (concentration is 250～500ng/ μ l) preparation chip.Arranging of described probe is as shown in table 4 below:

Table 4, house-keeping gene detect the matrix probe and arrange

⑤			⑤
				①	②	③	④
①	②	③	④
				①	②	③	④
①	②	③	④
				⑤			⑤

①rbcl②zein③lectin④napin⑤marker

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (system is referring to " mark of the testing sample " part among the embodiment 2);

Wherein primer is mix primer 12.5 μ M: be used to detect the primer (SEQ ID NO.66 and 67) of rbcl, each 0.1 μ l; Be used to detect the primer (SEQ ID NO.68 and 69) of lectin, each 0.1 μ l; Be used to detect the primer (SEQ ID NO.76 and 77) of zein, each 0.1 μ l; Be used to detect the primer (SEQ ID NO.146 and 147) of napin, each 0.1 μ l.Template DNA is an agricultural product DNA to be measured; Amplification conditions etc. are seen embodiment 1 equally.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

Utilize this chip detection transgenic corns NK603, detected result shows: the house-keeping gene zein of transgenic corns NK603 and the hybridization signal of rbcl is positive and house-keeping gene signal genetically engineered soybean and transgenic rapeseed is negative; Consistent with expected results, see Fig. 2.Detected result to transgenic rapeseed T45 shows: the house-keeping gene napin of transgenic rapeseed and the hybridization signal of rbcl is positive and house keeper's signal genetically engineered soybean and transgenic corns is negative; Consistent with expected results, see Fig. 3.Source reference effect in house-keeping gene plays when genetically modified food detects usually.In order to the extracting quality of test sample DNA and as the positive control of the hybridization system of chip system.Particularly particularly important when detection chip detects biased sample in actual applications or do not know the sample in crop source, it can be identified the kind of sample.

Embodiment 5, external source target gene DNA detection chip

Method: prepare external source target gene DNA detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.The 213bp gene fragment (SEQID NO.25) of the barnase gene by filtering out transgenic rapeseed Ms1Rf1 wherein, the 220bp gene fragment of the mdb484-mdb501 gene of transgenic rapeseed T45 (SEQ ID NO.20), the 354bp gene fragment of the cryIA of transgenic corns MON810 (b) gene (SEQ ID NO.37), the 236bp gene fragment of the mcp4epsps gene of transgenic corns GA21 (SEQ ID NO.32), the 294bp gene fragment (SEQ ID NO.38) of the cp4epsps gene that transgenic corns NK603 and genetically engineered soybean are total, the 209bp gene fragment of the cpti gene of transgenosis rice S86 are probe (SEQ ID NO.29) (concentration is 250～500ng/ μ l) preparation chip.Arranging of described probe is as follows:

Table 5, external source target gene detection chip matrix probe are arranged

⑦					⑦
						①	②	③	④	⑤	⑥
①	②	③	④	⑤	⑥
						①	②	③	④	⑤	⑥
①	②	③	④	⑤	⑥
						⑦					⑦

①barnase②mdb484-mdb501③crylA(b)④mcp4epsps⑤cp4epsps⑥cpti⑦marker

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (seeing also " mark of the testing sample " part among the embodiment 2);

Primer wherein is mix primer 12.5 μ M: the primer (SEQ ID NO.136 and 137) of the barnase that is used to increase, each 0.1 μ l; Be used to the to increase primer (SEQ ID NO.64 and 65) of mdb484-mdb501, each 0.1 μ l; Be used to the to increase primer (SEQ ID NO.124 and 125) of cryIA (b), each 0.1 μ l; Be used to the to increase primer (SEQID NO.114 and 115) of mcp4epsps, each 0.1 μ l; Be used to the to increase primer (SEQ ID NO.106 and 107) of cp4epsps, each 0.1 μ l; Be used to the to increase primer (SEQ ID NO.130 and 131) of cpti, each 0.1 μ l.Template DNA is an agricultural product DNA to be measured; Amplification conditions etc. are seen embodiment 1 equally.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

The result: this chip shows the detected result of transgenosis rice S86: the hybridization signal of the foreign structural gene of positive and other crops of the hybridization signal that has only transgenosis rice S86 foreign structural gene cpti is negative, sees Fig. 4.Detection to transgenosis rice S86 negative control sample simultaneously shows that foreign structural gene cpti does not detect, and sees Fig. 5.The detected result of the foreign structural gene of this chip transgenic rapeseed Ms1Rf1 shows: the hybridization signal of the foreign structural gene of positive and other crops of the hybridization signal that has only foreign gene barnase is negative, sees Fig. 6.Detection to transgenic rapeseed Ms1Rf1 negative control sample simultaneously shows that foreign structural gene barnase does not detect, and sees Fig. 7.Most important detection target gene is a foreign structural gene in the genetically modified food qualitative detection, promptly introduces the gene that proteins encoded render transgenic crop in a certain genetically modified crops has antiweed or new proterties such as pest-resistant.

Embodiment 6, strain authentication chip

1) genetically engineered soybean RRS40-3-2 strain

Method: prepare transgenosis detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.The 195bp gene fragment (SEQ ID NO.18) by the camv35s promotor that filters out wherein, the 213bp gene fragment of no terminator (SEQ ID NO.14), the 294bp gene fragment of cp4epsps (SEQ ID NO.38) detects genetically engineered soybean 40-3-2 for probe (concentration is 250～500ng/ μ l).414bp gene fragment (SEQ ID NO.42) with soybean house-keeping gene lectin is interior source reference simultaneously.It is as shown in table 6 below to arrange:

Table 6, genetically engineered soybean RRS strain

①	①
		②	②
③	③
		④	④

①lectin②camv35s③nos④cp4epsps

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (seeing also " mark of the testing sample " part among the embodiment 2);

Primer wherein is mix primer 2 μ M: the primer (SEQ ID NO.68 and 69) of the lectin that is used to increase, each 1.0 μ l; The 1. primer of (SEQ ID NO.58 and 59) of camv35s, respectively 1.0 μ l are used to increase; Be used to the to increase primer (SEQ ID NO.52 and 53) of no, each 1.0 μ l; Be used to the to increase primer (SEQ ID NO.106 and 107) of cp4epsps, each 1.0 μ l.Template DNA is an agricultural product DNA to be measured; Amplification conditions etc. are seen embodiment 1 equally.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

The result shows that this chip can detect camv35s promotor, no terminator, cp4epsps and soybean house-keeping gene lectin from Roundup Ready genetically engineered soybean 40-3-2 (RRS).Consistent with expected results.Results of hybridization is seen Fig. 8.

2) transgenic corns GA21 detection chip matrix A and transgenosis rice S86 detection chip matrix B probe are arranged

Method: prepare transgenosis detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.Wherein, 195bp gene fragment (SEQ ID NO.18) by the camv35s promotor that filters out, the 213bp gene fragment of no (SEQ ID NO.14), the 236bp gene fragment (SEQ ID NO.32) of the primer mcp4epsps amplification of foreign structural gene mcp4epsps detects transgenic corns GA21 for probe (concentration is 250～500ng/ μ l); 277bp gene fragment (SEQ ID NO.46) with corn house keeper zein is interior source reference simultaneously.In this chip, also will detect the probe (250～500ng/ μ l) of transgenosis rice S86 studies in the lump at this simultaneously: the 209bp gene fragment (SEQ ID NO.29) that is about to foreign structural gene cpti, the 433bp gene fragment (SEQ ID NO.41) of the 215bp gene fragment of antibiotic marker gene hpt (SEQ ID NO.2) and house-keeping gene rbcl is also layouted on chip, with the probe reference each other that detects the GA21 corn, verify the specificity of probe mutually.Arranging of described probe is as shown in table 7 below:

Table 7

A					B
										⑨				⑨	⑨				⑨
①	②	③	④	⑤	⑥	⑦	⑧		①
										①	②	③	④	⑤	⑥	⑦	⑧		①
①	②	③	④	⑤	⑥	⑦	⑧		①
										①	②	③	④	⑤	⑥	⑦	⑧		①
⑨				⑨	⑨				⑨

1. 2. 3. 4. 5. 6. 7. 8. 9. marker of hpt of cpti of rbcl of mcp4epsps of no of camv35s of zein of sampling liquid: 50%DMSO

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (seeing also " mark of the testing sample " part among the embodiment 2);

Primer is mix primer 2 μ M: the primer (SEQ ID NO.76 and 77) of the zein that is used to increase, each 1.0 μ l; Camv35s primer (SEQ ID NO.60 and 61) 2., respectively 1.0 μ l are used to increase; Be used to the to increase primer (SEQ ID NO.52 and 53) of no, each 1.0 μ l; Be used to the to increase primer (SEQ ID NO.114 and 115) of mcp4epsps, each 1.0 μ l.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

The result: this chip can detect no terminator, mcp4epsps and corn house-keeping gene zein from transgenic corns GA21, this expected results with transgenic corns GA21 is consistent; The hybridization signal of the probe of Dui Zhao SCK is then negative each other, illustrates that the probe that detects GA21 has excellent specificity.See Fig. 9.

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (seeing also " mark of the testing sample " part among the embodiment 2);

Primer wherein is mix primer 2 μ M: the primer (SEQ ID NO.130 and 131) of the cpti that is used to increase, 1.0 μ l; Be used to the to increase primer (SEQ ID NO.66 and 67) of rbcl, 1.0 μ l; Be used to the to increase primer (SEQ ID NO.92 and 93) of hpt, 1.0 μ l.Template DNA is an agricultural product DNA to be measured; Amplification conditions etc. are seen embodiment 1 equally.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

Can detect cpti, hpf and house-keeping gene rbcl from transgenosis rice S86, this expected results with transgenosis rice S86 is consistent; The hybridization signal of the probe of Dui Zhao GA21 is then negative each other, illustrates that the probe that detects S86 has excellent specificity.See Figure 10.

3) transgenic corns MON810 detection chip matrix probe is arranged

Method: prepare transgenosis detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.Wherein, 195bp gene fragment (SEQ ID NO.18) by the camv35x promotor that filters out, the 213bp gene fragment of no terminator (SEQ ID NO.14), the 354bp gene fragment of the primer cryIA (b) of foreign structural gene cryIA (b) (SEQ ID NO.37) is a probe (concentration is 250～500ng/ μ l), and transgenic corns MON810 is detected; The 277bp gene fragment (SEQ ID NO.46) of while with the primer zein of corn house keeper zein is interior source reference.Meanwhile, to detect transgenic corns GA21 probe (the same), transgenic corns NK603 probe (comprises the 195bp gene fragment of camv35s promotor, the 213bp gene fragment of no terminator, the 277bp gene fragment (SEQ ID NO.46) of the primer zein of the 294bp gene fragment of foreign structural gene cp4epsps (SE9 ID NO.38) and corn house keeper zein) and the probe (the same) of genetically engineered soybean 40-3-2 layout on chip, with the probe reference each other that detects the MON810 corn, verify the specificity of probe mutually.Arranging of described probe sees Table 8.

Table 8

A matrix: GA21 corn B matrix: MON810 corn

⑥					⑥
						①	②	③	④	⑤	①
①	②	⑨	④	⑤	①
						①	②	③	④	⑤	①
①	②	③	④	⑤	①
						⑥					⑥

⑥					⑥
						①	②	⑨	④	⑦	①
①	②	③	④	⑦	①
						①	②	⑨	④	⑦	①
①	②	③	④	⑦	①
						⑥					⑥

C matrix: NK603 corn D matrix: 40-3-2 soybean

⑥					⑥
						①	②	③	④	⑧	①
①	②	③	④	⑧	①
						①	②	③	④	⑧	①
①	②	③	④	⑧	①
						⑥					⑥

⑥					⑥
						①	⑨	③	④	⑧	①
①	⑨	③	④	⑧	①
						①	⑨	③	④	⑧	①
①	⑨	⑧	④	⑥	①
						⑥					⑥

1. 2. 3. 4. 5. mcp4epsps of no of camv35s of zein of sampling liquid: 50%DMSO

⑥marker⑦cryIA(b)⑧cp4epsps⑨lectin

The fluorescein-labelled sample P CR reaction system 25 μ l of multiplex PCR (referring to " mark of the testing sample " part among the embodiment 2);

Wherein primer is mix primer 2 μ M: the primer (SEQ ID NO.76 and 77) of the zein that is used to increase, each 1.0 μ l; Camv35s primer (SEQ ID NO.60 and 61) 2., respectively 1.0 μ l are used to increase; Be used to the to increase primer (SEQID NO.52 and 53) of no, each 1.0 μ l; Be used to the to increase primer (SEQ ID NO.114 and 115) of m cp4epsps, each 1.0 μ l; Be used to the to increase primer (SEQ ID NO.124 and 125) of cryIA (b), 1.0 μ l; Be used to the to increase primer (SEQ ID NO.106 and 107) of cp4epsps, each 1.0 μ l; Be used to the to increase primer (SEQ ID NO.68 and 69) of lectin, each 1.0 μ l.Template DNA is an agricultural product DNA to be measured; Amplification conditions etc. are seen embodiment 1 equally.

Sample behind multiplex PCR amplification label, purifying with chip hybridization.

The result shows that this chip can detect camv35s promotor, no terminator, cryIA (b) and corn house-keeping gene zein from transgenic corns MON810.And the same probe hybridization signal positive in the matrix that contrasts each other, the hybridization signal feminine gender of different probe illustrates that each detection probes has excellent specificity.See Figure 11.

Embodiment 7, integrated DNA detection chip

Method: prepare transgenosis detection chip, preparation testing sample and detect according to the method for embodiment 1,2,3.Institute's cloth probe sequence on the chip sees Table 1.Probe is that the difference in functionality by foreign gene carries out matrix and arranges.See Table 9.The A matrix that the screening effect is arranged mainly is promotor, terminator and the marker gene that detects transgene agricultural product.The B matrix that qualitative effect is arranged is determined the main sex character of this crop.The C matrix mainly is the kind that a little house-keeping genes are used for distinguishing species, can determine the source of foreign gene.Also has strict Quality Control matrix simultaneously.50% DMSO sampling liquid is done negative control, and Salmonella typhimurium spvc does positive control, and blank is done in non-point sample district.Different probe in each matrix can contrast each other.Sensing range contains the external source target gene that has covered following at present common transgene agricultural product: camv35S promotor, no promotor, no terminator, marker gene hpt, nptII, external source target gene cp4 epsps, crylA (b), mcp4 epsps, cpti, barnase, barstar, mdb484-mdb501 and as house-keeping gene lectin, zein, napin and the rbcl of endogenous reference gene.

Table 9, transgene agricultural product DNA detection chip matrix design

1) detection of genetically engineered soybean Roundup Ready 40-3-2

Upstream and downstream mix primer Comparative Examples, system are seen embodiment 2 in the fluorescein-labelled system of multiplex PCR.

Primer 1 (each primer concentration is 2 μ M): the primer of camv35s (the SEQ ID NO.58 and 59) that be used to increase, 1.5 μ l; Be used to the to increase primer (SEQ ID NO.52 and 53) of no, 1.0 μ l; Be used to the to increase primer (SEQ IDNO.106 and 107) of cp4 epsps, 1.5 μ l; With with the amplification rbcl primer (SEQ ID NO.66 and 67), 0.5 μ l; Be used to the to increase primer (SEQ ID NO.68 and 69) of lectin, 0.5 μ l.

Primer 2 (each primer concentration is 5 μ M): the primer (SEQ ID NO.98 and 99) of the pnos that is used to increase, 0.5 μ l; Be used to the to increase primer of camv35s (SEQ ID NO.60 and 61), 0.5 μ l; Be used to the to increase primer (SEQ IDNO.92 and 93) of hpt, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.82 and 83) of nptII, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.142 and 143) of barstar, 0.5 μ l; Be used to the to increase primer of barnase (SEQ ID NO.136 and 137), 0.5 μ l; Be used to the to increase primer (SEQ ID NO.114 and 115) of mcp4 epsps, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.124 and 125) of cryIA (b), 0.5 μ l; Be used to the to increase primer (SEQ ID NO.64 and 65) of mdb501-mdb484,0.5 μ l; Be used to the to increase primer (SEQ ID NO.130 and 131) of cpti, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.76 and 77) of zein, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.146 and 147) of napin, 0.5 μ l.

The plain mark 25 μ l of positive control spvcPCR amplification fluorescent: system PCR buffer, 2.5 μ l; Be used to the to increase primer (SEQ ID NO.152 and 153) (upstream and downstream mix primer 5 μ M) of spvc, 2.5 μ l; DNTP (10mM, no dTTP), 0.5 μ l; Cy5-dUTP (1mM), 0.5 μ l; DTTP (1mM), 2.0 μ l; Template DNA (Salmonella typhimurium STM), 0.5 μ l; Taq (5U/ μ l), 0.5 μ l; DH ₂O, 16 μ l.

Primer 1 and primer 2 are that 17 pairs of primers split into two groups primer to mixed system.Purpose is that minimizing is many to the interference between primer.The present invention is to remix hybridization behind these two groups of primers difference marks, the purifying, has not so both lost detection information, and still can embody the high-throughout characteristics of chip.In like manner to be single primer with reference to probe play the positive control effect to being blended in the testing sample that mark is good with 1/5 ratio behind fluorescein-labelled, the purifying to the spvc positive.The step 2 of embodiment 7) also is same procedure.

The result show have in the A2 matrix camv35s 1., 2. camv35s positive signal occurs with 3 detection probes of no, shows the existence that camv35s promoter gene and no terminator gene are arranged.Can judge tentatively that testing sample is the transgenosis sample.Have only 1 inspection probe of cp4 epsps positive signal to occur in the B2 matrix, show that this transgenosis sample is the transgenosis sample with anti-careless glycosides phosphorus herbicide resistance trait.Have only 2 probes of rbcl and lectin positive signal to occur in the C2 matrix, can judge exogenous genetic fragment thus from the eukaryote soybean, but not other species.Positive signal appears in the positive control probe of C1 matrix, and what negative control probe showed is negative signal.The equal no signal of blank space.The multiplex PCR system is described, it is reliable that crossbred binds fruit.The result of comprehensive all matrixes can judge that testing sample is genetically engineered soybean Roundup Ready 40-3-2.Result schematic diagram is seen Figure 12.Scintigram is seen Figure 13 as a result.

2) detection of MS1RF1 Semen Brassicae campestris

Upstream and downstream mix primer Comparative Examples, system are seen embodiment 2 in the fluorescein-labelled system of multiplex PCR.

Primer 1 (each primer concentration is 5 μ M): the primer (SEQ ID NO.58 and 59) of the camv35s that is used to increase, 0.4 μ l; Be used to the to increase primer (SEQ ID NO.52 and 53) of no, 0.4 μ l; Be used to the to increase primer (SEQ ID NO.98 and 99) of pnos, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.82 and 83) of nptII, 0.4 μ l; The primer SEQ ID NO.142 and 143 of barstar is used to increase), 0.5 μ l; The primer SEQ ID NO.136 and 137 of barnase is used to increase), 0.5 μ l; Be used to the to increase primer (SEQ ID NO.146 and 147) of napin, 0.2 μ l; Be used to the to increase primer (SEQID NO.66 and 67) of rbcl, 0.2 μ l.

Primer 2 (each primer concentration is 5 μ M): the camv35s primer (SEQ ID NO.60 and 61) 2. that is used to increase, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.92 and 93) of hpt, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.106 and 107) of cp4 epsps, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.114 and 115) of mcp4 epsps, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.124 and 125) of cryIA (b), 0.5 μ l; The primer SEQ ID NO.64 and 65 of mdb501-mdb484 is used to increase), 0.5 μ l; Be used to the to increase primer (SEQ ID NO.130 and 131) of cpti, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.76 and 77) of zein, 0.5 μ l; Be used to the to increase primer (SEQ ID NO.68 and 69) of lectin, 0.5 μ l.

Method and operation steps are seen the step 1 of embodiment 1,2,3 and 7.

The result show have in the A2 matrix camv35s 1., camv35s 2., positive signal appears in no and 4 detection probes of pnos, show the camv35s promoter gene is arranged, the existence of no terminator gene and no promotor.Can judge tentatively that testing sample is the transgenosis sample.Have only 1 inspection probe of barstar positive signal to occur in the B1 matrix, show that this transgenosis sample is the transgenosis sample with fertility restorer proterties.Have only 2 probes of rbcl and napin positive signal to occur in the C2 matrix, can judge exogenous genetic fragment thus from the eukaryote rape, but not other species.Positive signal appears in the positive control probe of C1 matrix, and what negative control probe showed is negative signal.The equal no signal of blank space.The multiplex PCR system is described, it is reliable that crossbred binds fruit.The result of comprehensive all matrixes can judge that testing sample is transgenic rapeseed MS1RF1.Result schematic diagram is seen Figure 14.Scintigram is seen Figure 15 as a result.

Sequence table

＜110〉Nutrition and Food Safety Office of China Disease Prevention and control Centre

＜120〉transgene agricultural product DNA detection chip and its production and application

<130>GBI05CN0369

<160>153

<170>PatentIn version 3.3

<210>1

<211>283

<212>DNA

＜213〉the unknown

<220>

＜223〉hygromycin gene

<400>1

tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa gatcgttatg tttatcggca 60

ctttgcatcg gccgcgctcc cgattccgga agtgcttgac attggggagt ttagcgagag 120

cctgacctat tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac 180

cgaactgccc gctgttctac aaccggtcgc ggaggctatg gatgcgatcg ctgcggccga 240

tcttagccag acgagcgggt tcggcccatt cggaccgcaa gga 283

<210>2

<211>215

<212>DNA

＜213〉the unknown

<220>

＜223〉hygromycin gene

<400>2

cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 60

ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 120

tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 180

atgttcgggg attcccaata cgaggtcgcc aacat 215

<210>3

<211>488

<212>DNA

＜213〉the unknown

<220>

＜223〉hygromycin gene

<400>3

cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 60

ggggagttta gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 120

caagacctgc ctgaaaccga actgcccgct gttctacaac cggtcgcgga ggctatggat 180

gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 240

atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 300

cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 360

ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 420

tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 480

atgttcgg 488

<210>4

<211>441

<212>DNA

＜213〉the unknown

<220>

＜223〉hygromycin gene

<400>4

acgacaccgt cagtgcgtcc gtcgcgcagg ctctcgatga gctgatgctt tgggccgagg 60

actgccccga agtccggcac ctcgtgcacg cggatttcgg ctccaacaat gtcctgacgg 120

acaatggccg cataacagcg gtcattgact ggagcgaggc gatgttcggg gattcccaat 180

acgaggtcgc caacatcttc ttctggaggc cgtggttggc ttgtatggag cagcagacgc 240

gctacttcga gcggaggcat ccggagcttg caggatcgcc acgactccgg gcgtatatgc 300

tccgcattgg tcttgaccaa ctctatcaga gcttggttga cggcaatttc gatgatgcag 360

cttgggcgca gggtcgatgc gacgcaatcg tccgatccgg agccgggact gtcgggcgta 420

cacaaatcgc ccgcagaagc g 441

<210>5

<211>486

<212>DNA

＜213〉intestinal bacteria E.coli

<400>5

ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc agcaatatca 60

cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc acagtcgatg 120

aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc gccatgggtc 180

acgacgagat cctcgccgtc gggcatgcgc gccttgagcc tggcgaacag ttcggctggc 240

gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc ttccatccga 300

gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt agccggatca 360

agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc aggagcaagg 420

tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc ccttcccgct 480

tcagtg 486

<210>6

<211>364

<212>DNA

＜213〉intestinal bacteria E.coli

<400>6

ccttgagcct ggcgaacagt tcggctggcg cgagcccctg atgctcttcg tccagatcat 60

cctgatcgac aagaccggct tccatccgag tacgtgctcg ctcgatgcga tgtttcgctt 120

ggtggtcgaa tgggcaggta gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca 180

tgatggatac tttctcggca ggagcaaggt gagatgacag gagatcctgc cccggcactt 240

cgcccaatag cagccagtcc cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag 300

gaacgcccgt cgtggccagc cacgatagcc gcgctgcctc gtcctgcagt tcattcaggg 360

cacc 364

<210>7

<211>489

<212>DNA

＜213〉intestinal bacteria E.coli

<400>7

ataccgtaaa gcacgaggaa gcggtcagcc cattcgccgc caagctcttc agcaatatca 60

cgggtagcca acgctatgtc ctgatagcgg tccgccacac ccagccggcc acagtcgatg 120

aatccagaaa agcggccatt ttccaccatg atattcggca agcaggcatc gccatgggtc 180

acgacgagat cctcgccgtc gggcatgcgc gccttgagcc tggcgaacag ttcggctggc 240

gcgagcccct gatgctcttc gtccagatca tcctgatcga caagaccggc ttccatccga 300

gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt agccggatca 360

agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc aggagcaagg 420

tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc ccttcccgct 480

tcagtgaca 489

<210>8

<211>325

<212>DNA

＜213〉intestinal bacteria E.coli

<400>8

gatgtttcgc ttggtggtcg aatgggcagg tagccggatc aagcgtatgc agccgccgca 60

ttgcatcagc catgatggat actttctcgg caggagcaag gtgagatgac aggagatcct 120

gccccggcac ttcgcccaat agcagccagt cccttcccgc ttcagtgaca acgtcgagca 180

cagctgcgca aggaacgccc gtcgtggcca gccacgatag ccgcgctgcc tcgtcctgca 240

gttcattcag ggcaccggac aggtcggtct tgacaaaaag aaccgggcgc ccctgcgctg 300

acagccggaa cacggcggca tcaga 325

<210>9

<211>466

<212>DNA

＜213〉intestinal bacteria E.coli

<400>9

ccttgagcct ggcgaacagt tcggctggcg cgagcccctg atgctcttcg tccagatcat 60

cctgatcgac aagaccggct tccatccgag tacgtgctcg ctcgatgcga tgtttcgctt 120

ggtggtcgaa tgggcaggta gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca 180

tgatggatac tttctcggca ggagcaaggt gagatgacag gagatcctgc cccggcactt 240

cgcccaatag cagccagtcc cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag 300

gaacgcccgt cgtggccagc cacgatagcc gcgctgcctc gtcctgcagt tcattcaggg 360

caccggacag gtcggtcttg acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca 420

cggcggcatc agagcagccg attgtctgtt gtgcccagtc atagcc 466

<210>10

<211>283

<212>DNA

＜213〉Agrobacterium tumefaciems (Agrobacterium tumefaciens)

<400>10

gagcggagaa ttaagggagt cacgttatga cccccgccga tgacgcggga caagccgttt 60

tacgtttgga actgacagaa ccgcaacgtt gaaggagcca ctcagccgcg ggtttctgga 120

gtttaatgag ctaagcacat acgtcagaaa ccattattgc gcgttcaaaa gtcgcctaag 180

gtcactatca gctagcaaat atttcttgtc aaaaatgctc cactgacgtt ccataaattc 240

ccctcggtat ccaattagag tctcatattc actctcaatc caa 283

<210>11

<211>231

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>11

gcggagaatt aagggagtca cgttatgacc cccgccgatg acgcgggaca agccgtttta 60

cgtttggaac tgacagaacc gcaacgttga aggagccact cagccgcggg tttctggagt 120

ttaatgagct aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt 180

cactatcagc tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc a 231

<210>12

<211>219

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>12

ttaagggagt cacgttatga cccccgccga tgacgcggga caagccgttt tacgtttgga 60

actgacagaa ccgcaacgtt gaaggagcca ctcagccgcg ggtttctgga gtttaatgag 120

ctaagcacat acgtcagaaa ccattattgc gcgttcaaaa gtcgcctaag gtcactatca 180

gctagcaaat atttcttgtc aaaaatgctc cactgacgt 219

<210>13

<211>225

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>13

ggaactgaca gaaccgcaac gttgaaggag ccactcagcc gcgggtttct ggagtttaat 60

gagctaagca catacgtcag aaaccattat tgcgcgttca aaagtcgcct aaggtcacta 120

tcagctagca aatatttctt gtcaaaaatg ctccactgac gttccataaa ttcccctcgg 180

tatccaatta gagtctcata ttcactctca atccaaataa tctgc 225

<210>14

<211>213

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>14

gtaacataga tgacaccgcg cgcgataatt tatcctagtt tgcgcgctat attttgtttt 60

ctatcgcgta ttaaatgtat aattgcggga ctctaatcat aaaaacccat ctcataaata 120

acgtcatgca ttacatgtta attattacat gcttaacgta attcaacaga aattatatga 180

taatcatcgc aagaccggca acaggattca atc 213

<210>15

<211>180

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>15

gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca 60

tgtaataatt aacatgtaat gcatgacgtt atttatgaga tgggttttta tgattagagt 120

cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa actaggataa 180

<210>16

<211>104

<212>DNA

＜213〉Agrobacterium tumefaciems

<400>16

gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca 60

tgtaataatt aacatgtaat gcatgacgtt atttatgaga tggg 104

<210>17

<211>162

<212>DNA

＜213〉cauliflower mosaic virus

<400>17

ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg 60

ttccaaccac gtcttcaaag caagtggatt gatgtgatat ctccactgac gtaagggatg 120

acgcacaatc ccactatcct tcgcaagacc cttcctctat at 162

<210>18

<211>195

<212>DNA

＜213〉cauliflower mosaic virus

<400>18

gctcctacaa atgccatcat tgcgataaag gaaaggctat cattcaagat ctctctgccg 60

acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 120

caaccacgtc ttcaaagcaa gtggattgat gtgacatctc cactgacgta agggatgacg 180

cacaatccca ctatc 195

<210>19

<211>239

<212>DNA

＜213〉cauliflower mosaic virus

<400>19

ttgcccagct atctgtcact tcatcaaaag gacagtagaa aaggaaggtg gcacctacaa 60

atgccatcat tgcgataaag gaaaggctat cgttcaagat gcctctgccg acagtggtcc 120

caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc 180

ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg cacaatccc 239

<210>20

<211>220

<212>DNA

＜213〉Semen Brassicae campestris

<400>20

gtggatatac aacacgtgac tgtattccat atgagtaaac tatatgtaaa accaagcttg 60

aattcgagct cggtacccct ggattttggt tttaggaatt agaaatttta ttgatagaag 120

tattttacaa atacaaatac atactaaggg tttcttatat gctcaacaca tgagcgaaac 180

cctataagaa ccctaattcc cttatctggg aactactcac 220

<210>21

<211>224

<212>DNA

＜213〉bacillus amyloliquefaciens (Bacillusamylolique faciens)

<400>21

tcagcgacct ccaccagaca ttgaaaaagg agcttgccct tccggaatac tacggtgaaa 60

acctggacgc tttatgggat tgtctgaccg gatgggtgga gtacccgctc gttttggaat 120

ggaggcagtt tgaacaaagc aagcagctga ctgaaaatgg cgccgagagt gtgcttcagg 180

ttttccgtga agcgaaagcg gaaggctgcg acatcaccat cata 224

<210>22

<211>216

<212>DNA

＜213〉bacillus amyloliquefaciens

<400>22

aagtatcagc gacctccacc agacattgaa aaaggagctt gcccttccgg aatactacgg 60

tgaaaacctg gacgctttat gggattgtct gaccggatgg gtggagtacc cgctcgtttt 120

ggaatggagg cagtttgaac aaagcaagca gctgactgaa aatggcgccg agagtgtgct 180

tcaggttttc cgtgaagcga aagcggaagg ctgcga 216

<210>23

<211>248

<212>DNA

＜213〉bacillus amyloliquefaciens

<400>23

ggggaacaaa tcagaagtat cagcgacctc caccagacat tgaaaaagga gcttgccctt 60

ccggaatact acggtgaaaa cctggacgct ttatgggatt gtctgaccgg atgggtggag 120

tacccgctcg ttttggaatg gaggcagttt gaacaaagca agcagctgac tgaaaatggc 180

gccgagagtg tgcttcaggt tttccgtgaa gcgaaagcgg aaggctgcga catcaccatc 240

atactttc 248

<210>24

<211>300

<212>DNA

＜213〉bacillus amyloliquefaciens

<400>24

ggttatcaac acgtttgacg gggttgcgga ttatcttcag acatatcata agctacctga 60

taattacatt acaaaatcag aagcacaagc cctcggctgg gtggcatcaa aagggaacct 120

tgcagacgtc gctccgggga aaagcatcgg cggagacatc ttctcaaaca gggaaggcaa 180

actcccgggc aaaagcggac gaacatggcg tgaagcggat attaactata catcaggctt 240

cagaaattca gaccggattc tttactcaag cgactggctg atttacaaaa caacggacca 300

<210>25

<211>213

<212>DNA

＜213〉bacillus amyloliquefaciens

<400>25

cacgtttgac ggggttgcgg attatcttca gacatatcat aagctacctg ataattacat 60

tacaaaatca gaagcacaag ccctcggctg ggtggcatca aaagggaacc ttgcagacgt 120

cgctccgggg aaaagcatcg gcggagacat cttctcaaac agggaaggca aactcccggg 180

caaaagcgga cgaacatggc gtgaagcgga tat 213

<210>26

<211>237

<212>DNA

＜213〉bacillus amyloliquefaciens

<400>26

aatcagaagc acaagccctc ggctgggtgg catcaaaagg gaaccttgca gacgtcgctc 60

cggggaaaag catcggcgga gacatcttct caaacaggga aggcaaactc ccgggcaaaa 120

gcggacgaac atggcgtgaa gcggatatta actatacatc aggcttcaga aattcagacc 180

ggattcttta ctcaagcgac tggctgattt acaaaacaac ggaccattat cagacct 237

<210>27

<211>315

<212>DNA

＜213〉cowpea

<400>27

aaggtgtgtg tgctggtact tttccttgta ggggttacta ctgcagccat ggatctgaac 60

cacctcggaa gtaatcatca tgatgactca agcgatgaac cttctgagtc ttcagaacca 120

tgctgcgatt catgcatctg cactaaatca atacctcctc aatgccattg tacagatatc 180

aggtggaatt cgtgtcactc ggcttgcaaa tcctgcatgt gtacacgatc aatgccaggc 240

aagtgtcgtt gccttgacat tgctgatttc tgttacaaac cttgcaagtc cagggatgaa 300

gatgatgaga aagat 315

<210>28

<211>352

<212>DNA

＜213〉cowpea

<400>28

ccacctcata cctaccttca gccatcgctg atttcgtttt aaaggtgtgt gtgctggtac 60

ttttccttgt aggggttact actgcagcca tggatctgaa ccacctcgga agtaatcatc 120

atgatgactc aagcgatgaa ccttctgagt cttcagaacc atgctgcgat tcatgcatct 180

gcactaaatc aatacctcct caatgccatt gtacagatat caggtggaat tcgtgtcact 240

cggcttgcaa atcctgcatg tgtacacgat caatgccagg caagtgtcgt tgccttgaca 300

ttgctgattt ctgttacaaa ccttgcaagt ccagggatga agatgatgag aa 352

<210>29

<211>209

<212>DNA

＜213〉cowpea

<400>29

ccacctcgga agtaatcatc atgatgactc aagcgatgaa ccttctgagt cttcagaacc 60

atgctgcgat tcatgcatct gcactaaatc aatacctcct caatgccatt gtacagatat 120

caggtggaat tcgtgtcact cggcttgcaa atcctgcatg tgtacacgat caatgccagg 180

caagtgtcgt tgccttgaca ttgctgatt 209

<210>30

<211>370

<212>DNA

＜213〉cowpea

<400>30

ctctgttgtg ccttcaccac ctcataccta ccttcagcca tcgctgattt cgttttaaag 60

gtgtgtgtgc tggtactttt ccttgtaggg gttactactg cagccatgga tctgaaccac 120

ctcggaagta atcatcatga tgactcaagc gatgaacctt ctgagtcttc agaaccatgc 180

tgcgattcat gcatctgcac taaatcaata cctcctcaat gccattgtac agatatcagg 240

tggaattcgt gtcactcggc ttgcaaatcc tgcatgtgta cacgatcaat gccaggcaag 300

tgtcgttgcc ttgacattgc tgatttctgt tacaaacctt gcaagtccag ggatgaagat 360

gatgagaaag 370

<210>31

<211>337

<212>DNA

＜213〉corn

<400>31

caacggtgga agagttcaat gtatgcaggt gtggccggcc tacggcaaca agaagttcga 60

gacgctgtcg tacctgccgc cgctgtctat ggcgcccacc gtgatgatgg cctcgtcggc 120

caccgccgtc gctccgttcc aggggctcaa gtccaccgcc agcctccccg tcgcccgccg 180

ctcctccaga agcctcggca acgtcagcaa cggcggaagg atccggtgca tggccggcgc 240

cgaggagatc gtgctgcagc ccatcaagga gatctccggc accgtcaagc tgccggggtc 300

caagtcgctt tccaaccgga tcctcctact cgccgcc 337

<210>32

<211>236

<212>DNA

＜213〉corn

<400>32

acgacttctc cacccttccc agcaacggtg gaagagttca atgtatgcag gtgtggccgg 60

cctacggcaa caagaagttc gagacgctgt cgtacctgcc gccgctgtct atggcgccca 120

ccgtgatgat ggcctcgtcg gccaccgccg tcgctccgtt ccaggggctc aagtccaccg 180

ccagcctccc cgtcgcccgc cgctcctcca gaagcctcgg caacgtcagc aacggc 236

<210>33

<211>335

<212>DNA

＜213〉corn

<400>33

cttggtagtt tgggtgggcg agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg 60

ggcgggatct cgcggctggg gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa 120

tggggctctc ggatgtagat ctgcgatccg ccgttgttgg gggagatgat ggggggttta 180

aaatttccgc catgctaaac aagatcagga agaggggaaa agggcactat ggtttatatt 240

tttatatatt tctgctgctt cgtcaggctt agatgtgcta gatctttctt tcttcttttt 300

gtgggtagaa tttgaatccc tcagcattgt tcatc 335

<210>34

<211>378

<212>DNA

＜213〉corn

<400>34

cttggtagtt tgggtgggcg agaggcggct tcgtgcgcgc ccagatcggt gcgcgggagg 60

ggcgggatct cgcggctggg gctctcgccg gcgtggatcc ggcccggatc tcgcggggaa 120

tggggctctc ggatgtagat ctgcgatccg ccgttgttgg gggagatgat ggggggttta 180

aaatttccgc catgctaaac aagatcagga agaggggaaa agggcactat ggtttatatt 240

tttatatatt tctgctgctt cgtcaggctt agatgtgcta gatctttctt tcttcttttt 300

gtgggtagaa tttgaatccc tcagcattgt tcatcggtag tttttctttt catgatttgt 360

gacaaatgca gcctcgtg 378

<210>35

<211>488

<212>DNA

＜213〉Bacillus thuringiensis (Bacillus thuringiensis subsp.Kurstaki)

<400>35

tcgtccgtga gcatcatcag agctcctatg ttctcctgga ttcatcgcag cgcggagttc 60

aacaatatca ttccgtcctc ccaaatcacc caaatccccc tcaccaagtc caccaacctg 120

ggcagcggca cctccgtggt gaagggccca ggcttcacgg gcggcgacat cctgcgcagg 180

acctccccgg gccagatcag caccctccgc gtcaacatca ccgctcccct gtcccagagg 240

taccgcgtca ggattcgcta cgctagcacc accaacctgc aattccacac ctccatcgac 300

ggcaggccga tcaatcaggg taacttctcc gccaccatgt ccagcggcag caacctccaa 360

tccggcagct tccgcaccgt gggtttcacc acccccttca acttctccaa cggctccagc 420

gttttcaccc tgagcgccca cgtgttcaat tccggcaatg aggtgtacat tgaccgcatt 480

gagttcgt 488

<210>36

<211>473

<212>DNA

＜213〉Bacillus thuringiensis

<400>36

caagtcccgc tcctgtccgt gtacgtccag gccgccaacc tgcacctcag cgtgctgagg 60

gacgtcagcg tgtttggcca gaggtggggc ttcgacgccg ccaccatcaa cagccgctac 120

aacgacctca ccaggctgat cggcaactac accgaccacg ctgtccgctg gtacaacact 180

ggcctggagc gcgtctgggg ccctgattct agagactgga ttcgctacaa ccagttcagg 240

cgcgagctga ccctcaccgt cctggacatt gtgtccctct tcccgaacta cgactcccgc 300

acctacccga tccgcaccgt gtcccaactg acccgcgaaa tctacaccaa ccccgtcctg 360

gagaacttcg acggtagctt caggggcagc gcccagggca tcgagggctc catcaggagc 420

ccacacctga tggacatcct caacagcatc actatctaca ccgatgccca ccg 473

<210>37

<211>354

<212>DNA

＜213〉Bacillus thuringiensis

<400>37

gcaacgccgc tccacaacaa cgcatcgtcg ctcagctggg ccagggcgtc taccgcaccc 60

tgagctccac cctgtaccgc aggcccttca acatcggtat caacaaccag cagctgtccg 120

tcctggatgg cactgagttc gcctacggca cctcctccaa cctgccctcc gctgtctacc 180

gcaagagcgg cacggtggat tccctggacg agatcccacc acagaacaac aatgtgcccc 240

ccaggcaggg tttttcccac aggctcagcc acgtgtccat gttccgctcc ggcttcagca 300

actcgtccgt gagcatcatc agagctccta tgttctcctg gattcatcgc agcg 354

<210>38

<211>294

<212>DNA

＜213〉edaphic bacillus (Agrobacterium)

<400>38

ggagttcttc cagaccgttc atcacggtcg ccccttccgc gaaggcggcg gcgacagcga 60

gaatcggata ttcgtcgatc atcgaaggcg cgcggtcttc cggcaccgtg acgcccttca 120

gcgtggagga gcgaacgcgc aggtccgcca cgtcttcgcc gccggcaagg cgcgggttga 180

tgacttcgat gtcggcgccc atttcctgca gcgtcaggat gaggccggtg cgggtggggt 240

tcatcagcac gttgaggatg gtgacgtcgg agcccggaac aagcagggcc gcaa 294

<210>39

<211>236

<212>DNA

＜213〉edaphic bacillus

<400>39

gtcggagccc ggaacaagca gggccgcaac cagcgggaag gccgtcgagg acgggtcgcc 60

cggcacgtcg atgacttggc cggtgagctt gccgcggcct tccaggcgga tggtgcgcac 120

gccgtccgca tccgtctcga cggtaaggtt ggcgccaaag ccctgcagca tcttttccgt 180

atgatcgcgc gtcatgatcg gctcgatgac cgtcgtgatg ccgggcgtgt tgaggc 236

<210>40

<211>427

<212>DNA

＜213〉edaphic bacillus

<400>40

tcgccctcat cgcaatccac gccattgagc ttgaggccat tggcgacggc cgagaggcgg 60

tcgctttcct tgacgcggag ttcttccaga ccgttcatca cggtcgcccc ttccgcgaag 120

gcggcggcga cagcgagaat cggatattcg tcgatcatcg aaggcgcgcg gtcttccggc 180

accgtgacgc ccttcagcgt ggaggagcga acgcgcaggt ccgccacgtc ttcgccgccg 240

gcaaggcgcg ggttgatgac ttcgatgtcg gcgcccattt cctgcagcgt caggatgagg 300

ccggtgcggg tggggttcat cagcacgttg aggatggtga cgtcggagcc cggaacaagc 360

agggccgcaa ccagcgggaa ggccgtcgag gacgggtcgc ccggcacgtc gatgacttgg 420

ccggtga 427

<210>41

<211>433

<212>DNA

＜213〉eukaryote

<400>41

aatcttctac tggtacatgg acaactgtat ggactgacgg gcttaccagt cttgatcgtt 60

acaaaggtcg atgctaccac atcgagcccg ttgctggaga agaaagtcaa tttattgctt 120

atgtagctta ccccttagac ctttttgaag aaggttctgt tactaacatg tttacttcca 180

ttgtgggtaa tgtatttggg ttcaaggccc tgcgcgctct acgtctggag gatttgcgaa 240

tcccccctgc ttatactaaa actttccaag gcccgcctca tggcatccaa gttgagagag 300

ataagttgaa caagtatggc cgccccctat tgggatgtac tattaaacct aaattggggt 360

tatccgctaa gaattacggt agagccgttt atgaatgtct tcgcggtgga cttgatttta 420

ccaaagatga tga 433

<210>42

<211>414

<212>DNA

＜213〉soybean

<400>42

tgccgaagca accaaacatg atcctccaag gagacgctat tgtgacctcc tcgggaaagt 60

tacaactcaa taaggttgac gaaaacggca ccccaaaacc ctcgtctctt ggtcgcgccc 120

tctactccac ccccatccac atttgggaca aagaaaccgg tagcgttgcc agcttcgccg 180

cttccttcaa cttcaccttc tatgcccctg acacaaaaag gcttgcagat gggcttgcct 240

tctttctcgc accaattgac actaagccac aaacacatgc aggttatctt ggtcttttca 300

acgaaaacga gtctggtgat caagtcgtcg ctgttgagtt tgacactttc cggaactctt 360

gggatccacc aaatccacac atcggaatta acgtcaattc tatcagatcc atca 414

<210>43

<211>408

<212>DNA

＜213〉soybean

<400>43

gaagcaacca aacatgatcc tccaaggaga cgctattgtg acctcctcgg gaaagttaca 60

actcaataag gttgacgaaa acggcacccc aaaaccctcg tctcttggtc gcgccctcta 120

ctccaccccc atccacattt gggacaaaga aaccggtagc gttgccagct tcgccgcttc 180

cttcaacttc accttctatg cccctgacac aaaaaggctt gcagatgggc ttgccttctt 240

tctcgcacca attgacacta agccacaaac acatgcaggt tatcttggtc ttttcaacga 300

aaacgagtct ggtgatcaag tcgtcgctgt tgagtttgac actttccgga actcttggga 360

tccaccaaat ccacacatcg gaattaacgt caattctatc agatccat 408

<210>44

<211>348

<212>DNA

＜213〉soybean

<400>44

tgccgaagca accaaacatg atcctccaag gagacgctat tgtgacctcc tcgggaaagt 60

tacaactcaa taaggttgac gaaaacggca ccccaaaacc ctcgtctctt ggtcgcgccc 120

tctactccac ccccatccac atttgggaca aagaaaccgg tagcgttgcc agcttcgccg 180

cttccttcaa cttcaccttc tatgcccctg acacaaaaag gcttgcagat gggcttgcct 240

tctttctcgc accaattgac actaagccac aaacacatgc aggttatctt ggtcttttca 300

acgaaaacga gtctggtgat caagtcgtcg ctgttgagtt tgacactt 348

<210>45

<211>485

<212>DNA

＜213〉corn

<400>45

gcttgcattg ttcgctctcc tagctctttg tgcaagcgcc actagtgcga cccatattcc 60

agggcacttg ccaccagtca tgccattggg taccatgaac ccatgcatgc agtactgcat 120

gatgcaacag gggcttgcca gcttgatggc gtgtccgtcc ctgatgctgc agcaactgtt 180

ggccttaccg cttcagacga tgccagtgat gatgccacag atgatgacgc ctaacatgat 240

gtcaccattg atgatgccga gcatgatgtc accaatggtc ttgccgagca tgatgtcgca 300

aataatgatg ccacaatgtc actgcgacgc cgtctcgcag attatgctgc aacagcagtt 360

accattcatg ttcaacccaa tggccatgac gattccaccc atgttcttac agcaaccctt 420

tgttggtgct gcattctaga tagaaatatt tgtgttgtat cgaataatga gttgacatgc 480

catcg 485

<210>46

<211>277

<212>DNA

＜213〉corn

<400>46

agtgcgaccc atattccagg gcacttgcca ccagtcatgc cattgggtac catgaaccca 60

tgcatgcagt actgcatgat gcaacagggg cttgccagct tgatggcgtg tccgtccctg 120

atgctgcagc aactgttggc cttaccgctt cagacgatgc cagtgatgat gccacagatg 180

atgacgccta acatgatgtc accattgatg atgccgagca tgatgtcacc aatggtcttg 240

ccgagcatga tgtcgcaaat aatgatgcca caatgtc 277

<210>47

<211>329

<212>DNA

＜213〉corn

<400>47

tgcttgcatt gttcgctctc ctagctcttt gtgcaagcgc cactagtgcg acccatattc 60

cagggcactt gccaccagtc atgccattgg gtaccatgaa cccatgcatg cagtactgca 120

tgatgcaaca ggggcttgcc agcttgatgg cgtgtccgtc cctgatgctg cagcaactgt 180

tggccttacc gcttcagacg atgccagtga tgatgccaca gatgatgacg cctaacatga 240

tgtcaccatt gatgatgccg agcatgatgt caccaatggt cttgccgagc atgatgtcgc 300

aaataatgat gccacaatgt cactgcgac 329

<210>48

<211>369

<212>DNA

＜213〉rape

<400>48

ctcgccttgt tcttccttct caccaatgcc tccgtctaca ggacggttgt ggaagtcgac 60

gaagacgatg ccacaaatcc agccggccca tttaggattc caaaatgtag aaaggagttt 120

cagcaagcac aacacctaag agcttgccaa caatggctcc acaagcaggc aatgcagccc 180

ggtggtggta gtggtccaag ctggactctc gacggtgagt ttgattttga agacgacgtg 240

gagaaccaac aacagggccc acagcagagg ccaccgccac cccagcagtg ctgcaacgag 300

ctccaccagg aagagccact ttgcgtttgc ccaaccttga aaggagcatc caaagccgtt 360

agacaacag 369

<210>49

<211>488

<212>DNA

＜213〉rape

<400>49

ctcgccttgt tcttccttct caccaatgcc tccgtctaca ggacggttgt ggaagtcgac 60

gaagacgatg ccacaaatcc agccggccca tttaggattc caaaatgtag aaaggagttt 120

cagcaagcac aacacctaag agcttgccaa caatggctcc acaagcaggc aatgcagccc 180

ggtggtggta gtggtccaag ctggactctc gacggtgagt ttgattttga agacgacgtg 240

gagaaccaac aacagggccc acagcagagg ccaccgccac cccagcagtg ctgcaacgag 300

ctccaccagg aagagccact ttgcgtttgc ccaaccttga aaggagcatc caaagccgtt 360

agacaacagg ttcgacaaca acagggacaa caaatgcagg gacagcagat gcagcaagta 420

attagccgtg tctaccagac tgctacgcac ttacctagag tttgcaacat caggcaagtt 480

agcatttg 488

<210>50

<211>325

<212>DNA

＜213〉rape

<400>50

cttccttctc accaatgcct ccgtctacag gacggttgtg gaagtcgacg aagacgatgc 60

cacaaatcca gccggcccat ttaggattcc aaaatgtaga aaggagtttc agcaagcaca 120

acacctaaga gcttgccaac aatggctcca caagcaggca atgcagcccg gtggtggtag 180

tggtccaagc tggactctcg acggtgagtt tgattttgaa gacgacgtgg agaaccaaca 240

acagggccca cagcagaggc caccgccacc ccagcagtgc tgcaacgagc tccaccagga 300

agagccactt tgcgtttgcc caacc 325

<210>51

<211>484

<212>DNA

＜213〉Salmonella typhimurium

<400>51

gtagctgctt atgatggggc ggaaatacca tctacaaata agcacctgaa aaataatttc 60

aactccttgc acaaccaaat gcggaagatg ccggtatccc actttaaaga ggcgctggat 120

gtgcctgact attcagggat gcgccagagt ggtttctttg ctatgagcca aggttttcag 180

ctgaataacc atggttacga tgttttcatc catgctcgtc gagaatcacc tcagtctcag 240

ggcaaatttg ccggtgacaa gttccacatc agtgtgctca gggatatggt gccacaagca 300

tttcaagcgc tgtccggatt gctgttttca gaggacagtc cggtagataa gtggaaagtg 360

accgatatgg agaaggtcgt tcaacaagcc cgtgttagcc tgggcgctca gttcacgttg 420

tatataaaac cagaccagga aaattcgcag tacagtgcgt cgtttctcca caagacacgg 480

caat 484

<210>52

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>52

gattgaatcc tgttgccggt 20

<210>53

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>53

gtaacataga tgacaccgcg 20

<210>54

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>54

gaatcctgtt gccggtcttg 20

<210>55

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>55

ttatcctagt tgcgcgc 17

<210>56

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>56

gaatcctgtt gccggtcttg 20

<210>57

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>57

cccatctcat aaataacgtc 20

<210>58

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>58

ccgacagtgg tcccaaagat ggac 24

<210>59

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>59

atatagagga agggtcttgc gaagg 25

<210>60

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>60

gctcctacaa atgccatca 19

<210>61

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>61

gatagtggga ttgtgcgtca 20

<210>62

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>62

attgcccagc tatctgtcac tt 22

<210>63

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>63

ggattgtgcg tcatccctta c 21

<210>64

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>64

gtggatatac aacacgtgac tg 22

<210>65

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>65

gtgagtagtt cccagataag g 21

<210>66

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>66

aatcttctac tggtacatgg ac 22

<210>67

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>67

tcatcatctt tggtaaaatc aag 23

<210>68

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>68

tgccgaagca accaaacatg atcct 25

<210>69

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>69

tgatggatct gatagaattg acgtt 25

<210>70

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>70

gaagcaacca aacatgatcc tc 22

<210>71

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>71

atggatctga tagaattgac gtta 24

<210>72

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>72

tgccgaagca accaaacatg atcct 25

<210>73

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>73

aagtgtcaaa ctcaacagcg acgac 25

<210>74

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>74

gcttgcattg ttcgctctc 19

<210>75

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>75

cgatggcatg tcaactcatt a 21

<210>76

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>76

agtgcgaccc atattccag 19

<210>77

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>77

gacattgtgg catcatcatt t 21

<210>78

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>78

tgcttgcatt gttcgctctc ctag 24

<210>79

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>79

gtcgcagtga cattgtggca t 21

<210>80

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>80

ataccgtaaa gcacgaggaa g 21

<210>81

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>81

cactgaagcg ggaagggac t 20

<210>82

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>82

ccttgagcct ggcgaaca 18

<210>83

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>83

ggtgccctga atgaactgc 19

<210>84

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>84

ataccgtaaa gcacgaggaa g 21

<210>85

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>85

tgtcactgaa gcgggaagg 19

<210>86

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>86

gatgtttcgc ttggtggtcg 20

<210>87

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>87

tctgatgccg ccgtgttcc 19

<210>88

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>88

ccttgagcct ggcgaacagt t 21

<210>89

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>89

ggctatgact gggcacaaca 20

<210>90

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>90

tgtcctgcgg gtaaatagc 19

<210>91

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>91

tccttgcggt ccgaatgg 18

<210>92

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>92

cactggcaaa ctgtgatgg 19

<210>93

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>93

atgttggcga cctcgtatt 19

<210>94

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>94

cgttatgttt atcggcactt tg 22

<210>95

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>95

ccgaacatcg cctcgctcca gt 22

<210>96

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>96

acgacaccgt cagtgcgtcc 20

<210>97

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>97

cgcttctgcg ggcgatttgt 20

<210>98

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>98

gagcggagaa ttaagggagt c 21

<210>99

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>99

ttggattgag agtgaatatg ag 22

<210>100

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>100

gcggagaatt aagggagtca g 21

<210>101

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>101

tggaacgtca gtggagcatt 20

<210>102

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>102

ttaagggagt cacgttatg 19

<210>103

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>103

acgtcagtgg agcatttt 18

<210>104

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>104

ggaactgaca gaaccgcaac g 21

<210>105

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>105

gcagattatt tggattgaga g 21

<210>106

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>106

ggagttcttc cagaccgttc at 22

<210>107

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>107

ttgcggccct gcttgtt 17

<210>108

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>108

gtcggagccc ggaacaagca 20

<210>109

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>109

gcctcaacac gcccggcatc a 21

<210>110

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>110

tcgccctcat cgcaatcc 18

<210>111

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>111

tcaccggcca agtcatcg 18

<210>112

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>112

caacggtgga agagttcaat g 21

<210>113

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>113

ggcggcgagt aggaggat 18

<210>114

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>114

acgacttctc caccctt 17

<210>115

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>115

gccgttgctg acgttgc 17

<210>116

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>116

cttggtagtt tgggtggg 18

<210>117

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>117

gatgaacaat gctgaggga 19

<210>118

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>118

cttggtagtt tgggtggg 18

<210>119

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>119

cacgaggctg catttgtc 18

<210>120

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>120

tcgtccgtga gcatcatcag agc 23

<210>121

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>121

acgaactcaa tgcggtcaat 20

<210>122

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>122

caagtcccgc tcctgtccgt gta 23

<210>123

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>123

cggtgggcat cggtgtagat agtg 24

<210>124

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>124

gcaacgccgc tccacaacaa cgcat 25

<210>125

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>125

cgctgcgatg aatccaggag aac 23

<210>126

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>126

aaggtgtgtg tgctggtact tttc 24

<210>127

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>127

atctttctca tcatcttcat ccct 24

<210>128

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>128

ccacctcata cctacctt 18

<210>129

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>129

ttctcatcat cttcatccct 20

<210>130

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>130

ccacctcgga agtaatca 18

<210>131

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>131

aatcacgaat gtcaaggcaa cg 22

<210>132

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>132

ctctgttgtg ccttcaccac ct 22

<210>133

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>133

ctttctcatc atcttcatcc ct 22

<210>134

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>134

ggttatcaac acgtttgacg gggt 24

<210>135

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>135

tggtccgttg ttttgtaaat cagc 24

<210>136

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>136

cacgtttgac ggggttgcgg attat 25

<210>137

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>137

atatccgctt cacgccatgt tcgtc 25

<210>138

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>138

aatcagaagc acaagccctc g 21

<210>139

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>139

aggtctgata atggtccgtt gtt 23

<210>140

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>140

tcagcgacct ccaccagaca t 21

<210>141

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>141

tatgatggtg atgtcgcagc 20

<210>142

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>142

aagtatcagc gacctccacc ag 22

<210>143

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>143

tcgcagcctt ccgctttcg 19

<210>144

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>144

ggggaacaaa tcagaagtat 20

<210>145

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>145

gaaagtatga tggtgatgtc gc 22

<210>146

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>146

ctcgccttgt tcttccttc 19

<210>147

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>147

ctgttgtcta acggctttg 19

<210>148

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>148

ctcgccttgt tcttccttct c 21

<210>149

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>149

caaatgctaa cttgcctgat g 21

<210>150

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>150

cttccttctc accaatgcct c 21

<210>151

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>151

ggttgggcaa acgcaaagtg 20

<210>152

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>152

gtagctgctt atgatggg 18

<210>153

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>153

attgccgtgt cttgtggag 19

Claims (13)

1. transgene agricultural product DNA detection chip, this chip comprises sheet base and the nucleic acid probe that is positioned on the sheet base, this nucleic acid probe comprises the target detect probe of following a series of detection target genes: at least one in SEQ ID NOs:1～4 of detection hpt, in SEQ ID NOs:5～9 of detection nptII at least one, in NOs:10～13 of detection pnos at least one, in SEQ ID NOs:14～16 of detection no at least one, in SEQID NOs:17～19 of detection camv35s at least one, detect the SEQ ID NO:20 of mdb484-mdb501, in SEQ ID NOs:21～23 of detection barstar at least one, in SEQ ID NOs:24～26 of detection barnase at least one, in SEQ ID NOs:27～30 of detection cpti at least one, in SEQ ID NOs:31～34 of detection mcp4epsps at least one, in SEQ ID NOs:35～37 of detection cryIA (b) at least one, in SEQ ID NOs:38～40 of detection cp4epsps at least one, detect the SEQ ID NO:41 of rbcl, in SEQID NOs:42～44 of detection lectin at least one, in SEQ ID NOs:45～47 of detection zein at least one, at least one in SEQ ID NOs:48～50 of detection napin.

2. transgene agricultural product DNA detection chip as claimed in claim 1, this chip also comprises negative control and positive control, this positive control is the sequence shown in SEQ ID NO.51.

3. as claim 1 or 2 each described transgene agricultural product DNA detection chips, wherein said transgene agricultural product is soybean, corn, paddy rice or rape, and other contain the agricultural-food that maybe may contain the correlation detection target gene.

4. transgene agricultural product DNA detection chip as claimed in claim 3, wherein said paddy rice are the SCK paddy rice.

5. preparation method as each described transgene agricultural product DNA detection chip of claim 1～4, this method comprises:

(1) according to the target gene sequences Design and the synthesized polymer polymerase chain reaction primer of transgene agricultural product, the melting temperature(Tm) of these polymerase chain reaction primers is roughly the same;

(2) utilize (1) described polymerase chain reaction primer target detect probe that from the DNA of transgene agricultural product, increases; With

(3) with described probe stationary on the sheet base.

6. the preparation method of transgene agricultural product DNA detection chip as claimed in claim 5, wherein said polymerase chain reaction primer comprises: at least one pair of of the following primer centering of the hpt that is used to increase: SEQ ID NO:90 and SEQ ID NO:91, SEQ ID NO:92 and SEQ ID NO:93, SEQ ID NO:94 and SEQ ID NO:95, SEQ ID NO:96 and SEQ ID NO:97; At least one pair of of following primer centering of nptII is used to increase: SEQ IDNO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ ID NO:83, SEQ ID NO:84 and SEQ IDNO:85, SEQ ID NO:86 and SEQ ID NO:87, SEQ ID NO:88 and SEQ ID NO:89; At least one pair of of following primer centering of pnos is used to increase: SEQ ID NO:98 and SEQ ID NO:99, SEQ ID NO:100 and SEQ ID NO:101, SEQ ID NO:102 and SEQ ID NO:103, SEQ ID NO:104 and SEQ ID NO:105; At least one pair of of following primer centering of no is used to increase: SEQ ID NO:52 and SEQ ID NO:53, SEQID NO:54 and SEQ ID NO:55, SEQ ID NO:56 and SEQ ID NO:57; At least one pair of of following primer centering of camv35s is used to increase: SEQ ID NO:58 and SEQ ID NO:59, SEQ ID NO:60 and SEQ IDNO:61, SEQ ID NO:62 and SEQ ID NO:63; Be used to increase the following primer of mdb484-mdb501 to SEQ IDNO:64 and SEQ ID NO:65; At least one pair of of following primer centering of barstar is used to increase: SEQ ID NO:140 and SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143, SEQ ID NO:144 and SEQ IDNO:145; At least one pair of of following primer centering of barnase is used to increase: SEQ ID NO:134 and SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137, SEQ ID NO:138 and SEQ ID NO:139; At least one pair of of following primer centering of cpti is used to increase: SEQ ID NO:126 and SEQ ID NO:127, SEQ ID NO:128 and SEQ ID NO:129, SEQ ID NO:130 and SEQ ID NO:131, SEQ ID NO:132 and SEQ IDNO:133; At least one pair of of following primer centering of mcp4epsps is used to increase: SEQ ID NO:112 and SEQ ID NO:113, SEQ ID NO:114 and SEQ ID NO:115, SEQ ID NO:116 and SEQ ID NO:117, SEQ IDNO:118 and SEQ ID NO:119; At least one pair of of following primer centering of cryIA (b) is used to increase: SEQ ID NO:120 and SEQ ID NO:121, SEQ ID NO:122 and SEQ ID NO:123, SEQ ID NO:124 and SEQ IDNO:125; At least one pair of of following primer centering of cp4epsps is used to increase: SEQ ID NO:106 and SEQ ID NO:107, SEQ ID NO:108 and SEQ ID NO:109, SEQ ID NO:110 and SEQ ID NO:111; The following primer of rbcl of being used to increase is right: SEQ ID NO:66 and SEQ ID NO:67; At least one pair of of following primer centering of lectin is used to increase: SEQ ID NO:68 and SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, SEQ ID NO:72 and SEQ ID NO:73; At least one pair of of following primer centering of zein is used to increase: SEQ ID NO:74 and SEQ ID NO:75, SEQ ID NO:76 and SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79; At least one pair of of following primer centering of napin is used to increase: SEQ ID NO:146 and SEQ ID NO:147, SEQ ID NO:148 and SEQ ID NO:149, SEQ ID NO:150 and SEQ ID NO:151.

7. the preparation method of transgene agricultural product DNA detection chip as claimed in claim 5, this method also comprises according to positive control spvc and designs and synthesizes the polymerase chain reaction primer, and utilizing this polymerase chain reaction primer amplification spvc detection probes, described primer is that following primer is right: SEQ ID NO:152 and SEQ ID NO:153.

8. the preparation method of transgene agricultural product DNA detection chip as claimed in claim 5, wherein step (2) comprises utilize the polymerase chain reaction target detect probe that increases from the DNA of transgene agricultural product, and the condition of polymerase chain reaction is: 94～95 ℃ of pre-sex change 3～5min; 94 ℃ of sex change 40s; 58～60 ℃ of annealing 40s; 72 ℃ are extended 60s; Carry out 40 circulations; 72 ℃ are extended 5～10min.

9. the application of each described transgene agricultural product DNA detection chip of claim 1～4 in detecting transgene agricultural product.

10. application as claimed in claim 9, comprising following steps:

(1) DNA of extraction agricultural-food to be measured;

(2) with following primer the DNA of agricultural-food to be measured is carried out pcr amplification and mark, described primer comprises: at least one pair of of the following primer centering of the hpt that is used to increase: SEQ ID NO:90 and SEQ ID NO:91, SEQ ID NO:92 and SEQ ID NO:93, SEQ ID NO:94 and SEQ ID NO:95, SEQ ID NO:96 and SEQ ID NO:97; At least one pair of of following primer centering of nptII is used to increase: SEQ ID NO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, SEQ ID NO:86 and SEQ ID NO:87, SEQ ID NO:88 and SEQ ID NO:89; At least one pair of of following primer centering of pnos is used to increase: SEQ IDNO:98 and SEQ ID NO:99, SEQ ID NO:100 and SEQ ID NO:101, SEQ ID NO:102 and SEQ IDNO:103, SEQ ID NO:104 and SEQ ID NO:105; At least one pair of of following primer centering of no is used to increase: SEQ ID NO:52 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, SEQ ID NO:56 and SEQ ID NO:57; At least one pair of of following primer centering of camv35s is used to increase: SEQ ID NO:58 and SEQ IDNO:59, SEQ ID NO:60 and SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63; Be used to increase the following primer of mdb484-mdb501 to SEQ ID NO:64 and SEQ ID NO:65; At least one pair of of following primer centering of barstar is used to increase: SEQ ID NO:140 and SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143, SEQ ID NO:144 and SEQ ID NO:145; At least one pair of of following primer centering of barnase is used to increase: SEQ ID NO:134 and SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137, SEQ ID NO:138 and SEQ ID NO:139; At least one pair of of following primer centering of cpti is used to increase: SEQ ID NO:126 and SEQ IDNO:127, SEQ ID NO:128 and SEQ ID NO:129, SEQ ID NO:130 and SEQ ID NO:131, SEQ IDNO:132 and SEQ ID NO.133; At least one pair of of following primer centering of mcp4epsps is used to increase: SEQ ID NO:112 and SEQ ID NO:113, SEQ ID NO:114 and SEQ ID NO:115, SEQ ID NO:116 and SEQ ID NO:117, SEQ ID NO:118 and SEQ ID NO:119; At least one pair of of following primer centering of cryIA (b) is used to increase: SEQ ID NO:120 and SEQ ID NO:121, SEQ ID NO:122 and SEQ ID NO:123, SEQ ID NO:124 and SEQ ID NO:125; At least one pair of of following primer centering of cp4epsps is used to increase: SEQ ID NO:106 and SEQ ID NO:107, SEQ ID NO:108 and SEQ ID NO:109, SEQ ID NO:110 and SEQ ID NO:111; The following primer of rbcl of being used to increase is right: SEQ ID NO:66 and SEQ ID NO:67; At least one pair of of following primer centering of lectin is used to increase: SEQ ID NO:68 and SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, SEQ ID NO:72 and SEQ ID NO:73; At least one pair of of following primer centering of zein is used to increase: SEQ IDNO:74 and SEQ ID NO:75, SEQ ID NO:76 and SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79; At least one pair of of following primer centering of napin is used to increase: SEQ ID NO:146 and SEQ ID NO:147, SEQID NO:148 and SEQ ID NO:149, SEQ ID NO:150 and SEQ ID NO:151;

(3) will be through each the transgene agricultural product DNA detection chip hybridization of the amplified production of mark and claim 1～4; With

(4) determine whether described agricultural-food to be measured are transgene agricultural product.

11. application as claimed in claim 10 wherein is divided at least two groups with described primer, and then carries out pcr amplification and mark respectively with each group.

12. a transgene agricultural product DNA detection kit, this test kit contain just like each described transgene agricultural product DNA detection chip of claim 1～4; With the primer that is used for pcr amplification, this primer comprises: at least one pair of of the following primer centering of the hpt that is used to increase: SEQ ID NO:90 and SEQ ID NO:91, SEQ ID NO:92 and SEQ ID NO:93, SEQ ID NO:94 and SEQ ID NO:95, SEQ ID NO:96 and SEQ ID NO:97; At least one pair of of following primer centering of nptII is used to increase: SEQ ID NO:80 and SEQ ID NO:81, SEQ ID NO:82 and SEQ IDNO:83, SEQ ID NO:84 and SEQ ID NO:85, SEQ ID NO:86 and SEQ ID NO:87, SEQ ID NO:88 and SEQ ID NO:89; At least one pair of of following primer centering of pnos is used to increase: SEQ ID NO:98 and SEQ IDNO:99, SEQ ID NO:100 and SEQ ID NO:101, SEQ ID NO:102 and SEQ ID NO:103, SEQ IDNO:104 and SEQ ID NO:105; At least one pair of of following primer centering of no is used to increase: SEQ ID NO:52 and SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, SEQ ID NO:56 and SEQ ID NO:57; At least one pair of of following primer centering of camv35s is used to increase: SEQ ID NO:58 and SEQ ID NO:59, SEQ IDNO:60 and SEQ ID NO:61, SEQ ID NO:62 and SEQ ID NO:63; Be used to increase the following primer of mdb484-mdb501 to SEQ ID NO:64 and SEQ ID NO:65; At least one pair of of following primer centering of barstar is used to increase: SEQ ID NO:140 and SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143, SEQ IDNO:144 and SEQ ID NO:145; At least one pair of of following primer centering of barnase is used to increase: SEQ ID NO:134 and SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137, SEQ ID NO:138 and SEQ ID NO:139; At least one pair of of following primer centering of cpti is used to increase: SEQ ID NO:126 and SEQ ID NO:127, SEQID NO:128 and SEQ ID NO:129, SEQ ID NO:130 and SEQ ID NO:131, SEQ ID NO:132 and SEQ ID NO:133; At least one pair of of following primer centering of mcp4epsps is used to increase: SEQ ID NO:112 and SEQID NO:113, SEQ ID NO:114 and SEQ ID NO:115, SEQ ID NO:116 and SEQ ID NO:117, SEQ ID NO:118 and SEQ ID NO:119; At least one pair of of following primer centering of cryIA (b) is used to increase: SEQID NO:120 and SEQ ID NO:121, SEQ ID NO:122 and SEQ ID NO:123, SEQ ID NO:124 and SEQ ID NO:125; At least one pair of of following primer centering of cp4epsps is used to increase: SEQ ID NO:106 and SEQID NO:107, SEQ ID NO:108 and SEQ ID NO:109, SEQ ID NO:110 and SEQ ID NO:111; The following primer of rbcl of being used to increase is right: SEQ ID NO:66 and SEQ ID NO:67; At least one pair of of following primer centering of lectin is used to increase: SEQ ID NO:68 and SEQ ID NO:69, SEQ ID NO:70 and SEQ ID NO:71, SEQ ID NO:72 and SEQ ID NO:73; At least one pair of of following primer centering of zein is used to increase: SEQ IDNO:74 and SEQ ID NO:75, SEQ ID NO:76 and SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79; At least one pair of of following primer centering of napin is used to increase: SEQ ID NO:146 and SEQ ID NO:147, SEQID NO:148 and SEQ ID NO:149, SEQ ID NO:150 and SEQ ID NO:151.

13. a method that detects transgene agricultural product, this method comprises:

(1) DNA of extraction agricultural-food to be measured, described agricultural-food comprise agricultural-food starting material and/or processing of farm products product;

(2) utilize the DNA of the described product to be measured of following target detect probe in detecting, described target detect probe comprises: at least one in SEQ ID NOs:1～4 of detection hpt, in SEQ ID NOs:5～9 of detection nptII at least one, in NOs:10～13 of detection pnos at least one, in SEQ ID NOs:14～16 of detection no at least one, in SEQ ID NOs:17～19 of detection camv35s at least one, detect the SEQ IDNO:20 of mdb484-mdb501, in SEQ ID NOs:21～23 of detection barstar at least one, in SEQ ID NOs:24～26 of detection barnase at least one, in SEQ ID NOs:27～30 of detection cpti at least one, in SEQ ID NOs:31～34 of detection mcp4epsps at least one, in SEQ ID NOs:35～37 of detection cryIA (b) at least one, in SEQ ID NOs:38～40 of detection cp4epsps at least one, detect the SEQ ID NO:41 of rbcl, in SEQ ID NOs:42～44 of detection lectin at least one, in SEQ ID NOs:45～47 of detection zein at least one, at least one in SEQ ID NOs:48～50 of detection napin; With

(3) judge with the situation that combines of described transgene agricultural product DNA whether these agricultural-food to be measured are transgene agricultural product according to described probe.

Images