CN1781941A - Protein Akaan 1 extracted from antrodia camphorata and its use in regulating immune function - Google Patents

Abstract

The present invention relates to protein ACA1 extracted from Antrodia camphorata and its immunoregulation use, and aims at clarifying the active components in Antrodia camphorata. The protein ACA1 has the amino acid sequence of: VNVTYDPFFD-NPNNSLSYVA-CSDGTNGLLT- KGYTTLGSLP-DFPYIGGAYA-IAGWNSPSCG-TCWELTYNNV-SINILGIDTA-AGFNIATAM- NVLTNNAAVD-LGEVDAAAIQ-VDSSVCGL. ACA1 and its chemical composition have immunoregulation activity, and can activate RAW264.7 macrophage and mouse's spleen cell, promote the TNF-alpha and NO secretion of RAW264.7 macrophage, and cause mouse's spleen cell proliferation and IFN-gamma section.

Description

By the albumen ACA1 of camphor tree sesame extraction and the purposes of adjusting immunologic function thereof

Technical field:

The present invention relates to protein, particularly the new albumen ACA1 that extracts by camphor tree sesame (Antrodia camphorata).Purifying is present in the albumen ACA1 (ACA1) in the camphor tree sesame (mycelium), and utilize the molecular biotechnology choosing to grow the nucleotide sequence that obtains ACA1 (ACA1), Bing finds the human and mouse red blood corpuscle of not aggegation of ACA1 (ACA1), but direct activation RAW264.7 scavenger cell, make it produce tumor necrosis factor TNF-alpha and nitrogen protoxide, and can cause the hyperplasia Bing secretion Interferon, rabbit gamma of mouse boosting cell, the tool immunoregulatory activity.

Background technology:

Camphor tree sesame (Antrodia camphorata) is the peculiar bacterial classification in Taiwan with special region meaning, exist for a long time in Taiwan, but research reported literature to nineteen ninety is just studied the 12nd volume 395-396 page or leaf in Yunnan plant and delivers with reviving by a surname.The camphor tree sesame has another name called Antrodia camphorata, Cinnamomum kanahirai hay mushroom, camphor tree mushroom or Cinnamomum kanahirai hay bacterium, belong to Mycophyta (Mycota), Basidiomycotina (Basidiomycotina), Hymenomycetes (Hymenomycetes), aptychus Zoopagales (Phyllophorales), polyporaceae (Polyporaceae), Antrodia genus (Antrodia) in classification, its kenel as shown in Figure 1.Camphor tree sesame sporophore belongs to perennial, has strong camphor tree fragrance towards nose, with general glossy ganoderma class very big difference is arranged, and its external form is tabular or mitriform.Platy morphology person, face is tangerine (Huang) look, and whole has the bacterium hole entirely, and the plate bottom has the suberin of ivory buff, and suberin is attached to growing on the Cinnamomum kanahirai hay tree hollow heartwood inwall by this.Mitriform form person, thalamium (clock face) also is tangerine (Huang) look, be full of the bacterium hole (4～5 bacterium holes/mm), in have the spore flavor extremely bitter, be orange when fresh, can become tangerine brown or brown afterwards, the clock body then is the cot of dark green brown.With its sporidium of microscopic examination, its form is level and smooth colourless transparent little curved cylindricality (3.5～5.0 * 1.5～2 μ m).

The research report of relevant camphor tree sesame physiological function is less before 2002, clinical and the pharmacology evidence that also lacks scientific research and obtain, therefore the physiological function of camphor tree sesame all is the curative effect of teach orally in the folk custom therapy known to the major part, demands utilizing the scientific experimentation further investigation urgently.On the physiology of fungi, the camphor tree sesame is a large amount of biocidal property safrole materials and mushroom class that can normal growth shows that the camphor tree sesame has the physiological metabolism mechanism that is different from other kind mushroom class in the unique energy metabolism Cinnamomum kanahirai hay tree in the mushroom class.Point out in the resulting triterpene composition of camphor tree sesame sporophore in 1994 researchs of journey one China, the framework that all has 24 (28)-en on the side chain, the triterpene pathways metabolism that shows the camphor tree sesame, be very different with the glossy ganoderma of other kind, this side chain framework should can be used as the feature of camphor tree sesame, and the extraction quantity of camphor tree sesame methanol extraction thing far surpasses the extraction quantity of general glossy ganoderma 3% up to 30%, and the bitter taste of camphor tree sesame is than glossy ganoderma hardship, and this may be many oxidized forms triterpene and the extremely rich cause of steroid content of camphor tree sesame.Thorough the equaling of Wang uncle points out that the camphor tree sesame has very high evaluation in the folk custom therapy in the 1-36 page or leaf in 1998 foodstuffs industry the 30th volume, food poisoning, diarrhoea, stomachache, vomiting, pesticide intoxication all there is detoxification, the camphor tree sesame is very effective to the treatment of liver tumor and uterus tumor, also can be used to stable mood, the camphor tree sesame also is that the Taiwan aboriginal is used for the magic weapon of liver-protecting sobering up simultaneously.

Educational circles has begun function and the activeconstituents of active research camphor tree sesame in recent years; Cai Yanhui points out the experiment with big white mouse liver function aspect in 2002 food science and technology institute of National Chung Hsing University Master's thesis; the isolated triterpenoid β of camphor tree sesame sporophore has GPT value in the blood of acute liver damage mouse is brought out in reduction with tetracol phenixin effect; people 2002 and 2003 such as Song T.Y. also point out to utilize the ability of ferment filtrate protection tetrachloro-methane induction rat acute liver injury also quite high in Journal Agriculture Food Chemistry the 50th volume 322-3327 page or leaf and the 51st volume 1571-1577; heavy expounding one's ideas in writing waits people 2002 in Chinese Medicine institute nutrient research institute Master's thesis to point out in 2002 that in protective foods research and development plan gains in depth of comprehension presentations and Chen Xinyi an amount of Antrodia camphorata mycelium fermented filtrate has the influence in front to the liver physiology function; can reduce hepatic fibrosis and denaturation degrees; increase GSH content and increase antioxidative enzyme activity in liver and the red blood corpuscle; reduce the liver level of lipid peroxidation; and help the decline of vivo oxidation pressure; after pointing out in study of pharmacy institute of poplar book prestige Univ Nat Taiwan in 1991 Master's thesis that camphor tree sesame extraction composition is with ethyl acetate and water dispenser extraction; the sharp amine activity of the cholinolytic of ethyl acetate layer and anti-brain is the strongest, truly has curative effect.The elementary people of Chen Jing points out preliminary safety testing calendar year 2001 in second annual meeting for the first time of Chinese protective foods association, find that Antrodia Camphorata mycelium do not have toxicity to various kinds of cell and mouse, and the possible immunomodulatory of camphor tree sesame, antitumor or other physiologically active more need have system and extensive studies deeply to inquire into.Chen Qingnong etc. understood the 29 general meeting in Republic of China's Food science technology in 1999 point out that the camphor tree sesame has the special fragrance smell, Bing has antibiotic and oxidation resistant function, can apply in the aromatotherapy (aromatherapy), this fragrance matter composition is terpene alkylol cpd and ethyl hexadecanoate etc. through qualification result.Grape king biotechnology center is also studied at anti-hepatitis B virus activity and the immunologic function assessment of camphor tree sesame, the result shows that the thick extract of camphor tree sesame has strong anti-hepatitis B virus activity, and under the processing that half con A (concanavalin A) (Con A) is arranged, Antrodia Camphorata mycelium can promote the lymph corpuscle hyperplasia and stimulate spleen cell to produce cytohormone IL-2.

Improve the function aspects of immunizing power in the mushroom class, people such as Lee S.S. nineteen ninety-five points out that in Journal of Chinese Medicine the 6th volume 1-12 page or leaf a lot of research finds that all the extract of multiple mushroom class all can improve activity of immune cells, Bing promotes the generation of cytohormone and Interferon, rabbit, people such as Chen W.C. 1999 point out that in the American journal of chinesemedicine mushroom class extract can recover behind radiation irradiation, the mouse immune ability of immunologic hypofunction, in addition, fourth is cherished in foodstuffs industry in modest 2000 the 32nd volume 28-42 page or leaf and is pointed out that the continent scholar is also once respectively at glossy ganoderma, rainbow conk, white fungus, Cordyceps sinensis, Hericium erinaceus (Bull. Ex Fr.) Pers., umbellate pore furgus, needle mushroom, mushroom, the immune physiologically active of edible medicinal mushroom classes such as dance mushroom is studied, find the difference of these mushroom classes according to kind, has the lymphocytes of promotion propagation respectively, activating B cell Bing increases anti-body contg in the serum, improve scavenger cell, the phagocytic activity of natural killer cell, promote mouse anti sheep red blood cell (SRBC), plaque-forming bacteria (PFC) reaction, the opposing endoxan, purinethol, the restraining effect of immunosuppressor such as Fluracil, and promotion ConA inductive mouse spleen lymphocyte proliferation response, the lymphocytic transformation that allogenic antigen stimulates.People such as Lieu C.W. Anticancer Research the 12nd volume 1211-1215 page or leaf in 1992, people such as Sakagami MRS. 1993 are in Anticancer Research the 13rd volume 671-675 page or leaf, people such as Wang H. roll up 810-816 page or leaf and the 289th in Biochemical and biophysical research communications the 275th in 2001 and 2002 and roll up the 750-755 page or leaf because the extract of mushroom class can activate panimmunity cell in the body, improve the phagocytic activity of scavenger cell and natural killer cell, immune stimulatory emiocytosis suppresses the multiple Interferon, rabbit and the cytohormone of tumour cell, organism can be killed cancer cells or suppress tumor growth by immune activation, so the anti-tumor capacity of mushroom class extract has directly related property with the function of its promotion immunizing power.

The camphor tree sesame is the distinctive fungi in Taiwan, and the various physiologically active of tool, but its activeconstituents it be unclear that in the past.The present invention finds protein ACA1 (ACA1) and its immunomodulatory function in Antrodia Camphorata mycelium.

Summary of the invention:

Order of the present invention is to overcome the activeconstituents that prior art can not be understood the camphor tree sesame, provides a kind of by camphor tree sesame extracting protein matter ACA1, and discloses the purposes of the adjusting immunologic function of ACA1 (ACA1).

The present invention adopts following technical scheme: by the albumen ACA1 (ACA1) of camphor tree sesame extraction, have following aminoacid sequence, or be higher than 90% aminoacid sequence: VNVTYDPFFD-NPNNSLSYVA-CSDGTNGLLT-KGYTTLGSLP-DFPYIGGAYA-I AGWNSPSCG-TCWELTYNNV-SINILGIDTA-AGFNIALTAM-NVLTNNAAVD-LG EVDAAAIQ-VDSSVCGL with the following amino acid sequences similarity.This camphor tree sesame albumen ACA1 (ACA1) and be the chemical composition of main component with camphor tree sesame albumen ACA1 (ACA1) is used to regulate the purposes of immunologic function.

ACA1 (ACA1) is the glucoprotein of the about 29kDa of molecular weight, and iso-electric point is about pH 5.3, and its protein part contains 118 amino acid.ACA1 (ACA1) has methionine(Met), halfcystine and histidine's three seed amino acids, and not aggegation is human and the mouse red blood corpuscle, and the characteristic that flies beneficial good fortune (FIP-fve) and glossy ganoderma LingZhi-8 with needle mushroom is different.ACA1 (ACA1) tool immunoregulatory activity can activate RAW 264.7 scavenger cells and mouse boosting cell, impels RAW 264.7 scavenger cell TNF secretion-alpha and nitrogen protoxides, and the hyperplasia justacrine IFN-gamma that causes mouse boosting cell.

Description of drawings:

Fig. 1, wild camphor tree sesame sporophore.

Fig. 2, camphor tree sesame protein ACA1 (ACA1) are via DE-52 tubing string chromatography purification figure.

Fig. 3, camphor tree sesame protein ACA1 (ACA1) carry out protein electrophorese figure after via DE-52 tubing string chromatography purification.

Fig. 4, camphor tree sesame protein ACA1 (ACA1) are via FPLC MonoQ tubing string chromatography purification figure.

Fig. 5, analyze ACA1 (ACA1) molecular weight via SDS/PAGE.

The glucoprotein dyeing of Fig. 6, ACA1 (ACA1).

The iso-electric point analysis of Fig. 7, ACA1 (ACA1).

Fig. 8, utilize the molecule tamisage to analyze the molecular weight of ACA1 (ACA1).

Fig. 9, ACA1 (ACA1) hemagglutination activity.

Figure 10, the PR4-650 fragment electrophoresis result of growing gained via 3 ' RACE technology choosing

Nucleotide sequence and the aminoacid sequence of Figure 11, camphor tree sesame gene fragment PR4-650

Figure 12, the PR14-700 fragment electrophoresis result of growing gained via 5 ' RACE technology choosing

Nucleotide sequence and the aminoacid sequence of Figure 13, camphor tree sesame gene fragment PR14-700

The nucleotide sequence and the aminoacid sequence of Figure 14, ACA1 (ACA1) gene

Figure 15, ACA1 (ACA1) can activate RAW 264.7 scavenger cells and produce nitrogen protoxide

Figure 16, ACA1 (ACA1) can activate RAW 264.7 scavenger cells and produce tumor necrosis factor TNF-alpha

Figure 17, ACA1 (ACA1) can improve the efficient of mouse boosting cell picked-up Brd-U, promote the hyperplasia effect

Figure 18, ACA1 (ACA1) can improve the metabolic efficiency of mouse boosting cell to MTT, promote the hyperplasia effect

Figure 19, ACA1 (ACA1) can stimulate mouse boosting cell secretion Interferon, rabbit IFN-gamma

Embodiment:

One, the purifying of camphor tree sesame albumen ACA1 (ACA1)

(1) get camphor tree sesame fermented liquid 10L, utilize the filtration of bleeding of diameter 110mm filter paper, the about 1kg of mycelium weight in wet base, after passing through separating step again, thick extraction liquid is with saturated solid ammonium sulfate precipitating proteins, and the sedimentary protein dialysis of institute separates camphor tree sesame albumen with it by the DE-52 anion-exchange column fully.And survey its absorbancy at the 280nm place, and can get several absorption peaks such as Fig. 2, after the analysis of SDS-PAGE protein electrophorese, obtain a kind of albumen such as Fig. 3, with its called after ACA1 (ACA1).

(2) according to the characteristic of the negatively charged ion of ACA1 (ACA1) absorption, select the Mono-Q tubing string to carry out the purifying preparation with protein flash chromatography system (FPLC), the chromatography collection of illustrative plates of gained is single crest such as Fig. 4, is further purified to obtain camphor tree sesame albumen ACA1 (ACA1).Every liter camphor tree sesame fermented liquid can obtain the about 2.5mg of ACA1 (ACA1) approximately.

(3) analyze via SDS/PAGE, learn that by Fig. 5 the molecular weight of camphor tree sesame albumen ACA1 (ACA1) is about 29kDa.The electrophoresis film that SDS/PAGE is analyzed gained carries out glucoprotein dyeing, as seen from Figure 6 ACA1 (ACA1) can with the Schiff reagent react, and manifest the electrophoresis band of purple, so ACA1 (ACA1) is a glucoprotein.

(4) the camphor tree sesame albumen ACA1 (ACA1) behind the purifying via etc. electric burnt current collection swimming (ion focusingelectrophoresis IEF) measures the iso-electric point of camphor tree sesame albumen ACA1 (ACA1), shows as Fig. 7.Compare with standard substance (Pharmacia pI calibration kit, IEF 3-9) and positive regulation group (OVA:pI 5.2), after analyzing via cellular elements photograph analytical system again, learn that ACA1 (ACA1) albumen iso-electric point is all near 5.3.

(5) utilize molecule sieving (size exclusion) principle, divide standard albumen and the delay of ACA1 (ACA1) in exchange column with colloid sieving (gel filtration) technical area, use the judgement molecular weight, found that the molecular weight of ACA1 (ACA1) is about 28.8kDa (Fig. 8).

(6) ACA1 (ACA1) albumen is carried out the erythrocyte agglutination activity test, the aggegation results of case of the mixed observation of this kind albumen and Balb/C mouse blood blood as shown in Figure 9, by the ACA1 (ACA1) that can find among Fig. 9 to be purified in protein original content and weaker concn 0.5,0.25,0.125,0.063,0.0031 in the time of (mg/mL), with gold needle mushroom immunomodulatory protein FIP-fve (the active immune modulator of obvious erythrocyte agglutination is arranged) comparison, found that this kind albumen does not all have agglutination activity.

Two, the choosing of the molecule of ACA1 (ACA1) is grown and aminoacid sequence

(1) with after ACA1 (ACA1) the albumen process SDS-PAGE electrophoretic separation, changes and steep to pvdf membrane, carry out the N terminal amino acid sequence of ACA1 (ACA1) and analyze.The N terminal amino acid sequence that found that ACA1 (ACA1) is VNVTYDPFFDNPPNNLLYYAASSDDTN in regular turn.

(2) grow aspect the gene of ACA1 (ACA1) in choosing, cultivate the mycelium of camphor tree sesame earlier, Bing extracts its total RNA, utilizes reverse transcription reaction to make the complementary DNA (cDNA) of camphor tree sesame mRNA again, the masterplate of growing as choosing (template).Utilize 3 '-RACE technology then, angle the gene of getting ACA1 (ACA1), and the introduction of 3 '-RACE reaction pushes away possible nucleic acid codon (codon) design and gets by the N terminal amino acid sequence of ACA1 (ACA1) is counter in the PCR mode.

(3) by the N terminal amino acid sequence of ACA1 (ACA1), design its possible corresponding introduction (mapping primer), utilize 3 '-RACE technology to select and grow.Hold the designed introduction ACCTACGACCCCTTCTTCGACAA (5 ' to 3 ') that goes out of nine amino acid of the 3rd amino acid to the by ACA1 (ACA1) N, after 3 '-RACE reaction, electrophoretic analysis obtains a nucleic acid fragment (as Figure 10) with about 650 base pairs.

(4) nucleic acid fragment with about 650 base pairs of having of 3 '-RACE gained carries out the TA cloning, and choosing is grown after the pGEMT carrier, analyzes this 650 segmental nucleotide sequences of base pair, obtains the sequence (as Figure 11) of PR4-650.Sequence with PR4-650 translates to amino acid whose sequence again, the aminoacid sequence of Bing and ACA1 (ACA1) relatively, find 24 by in the obtained aminoacid sequence of Edman reaction, there are 19 aminoacid sequences of translating with PR4-650 identical, the identical configuration of both aminoacid sequences reaches (as Figure 11) more than 79.2%, represents that both high degree are similar.

(5) utilize the PR4-650 sequence further to design PR14 introduction GTCCCAATTCGATACTCCTAAAC, with 5 '-RACE technology, the nucleotide sequence before the 3rd amino acid of ACA1 (ACA1) is grown in choosing, and the result obtains having the fragment of about 700 base pairs as shown in figure 12.

(6) nucleic acid fragment with about 700 base pairs of having of 5 '-RACE gained carries out the TA cloning, and choosing is grown after the pGEMT carrier, analyzes this 700 segmental nucleotide sequences of base pair, obtains the sequence (Figure 13) of PR14-700.Sequence with PR14-700 translates to amino acid whose sequence again, the aminoacid sequence of Bing and ACA1 (ACAl) relatively, first and the 3rd amino acid that gained is grown in choosing is V, and is identical with the result of sequence gained, found that second amino acid should be N (Figure 13) and grow gained by choosing.

(7) nucleotide sequence of contrast serial connection PR4-650 and PR14-700, Bing are aided with nested PCR to be confirmed, obtains the nucleotide sequence and the aminoacid sequence of ACA1 (ACA1), as Figure 14.The part of its performance is begun by the 119th nucleic acid or the 40th amino acid of Figure 14, till the 472nd nucleic acid or the 157th amino acid.

Aminoacid sequence by ACA1 (ACA1) contrasts as can be known, and the albumen ACA1 (ACA1) that the camphor tree sesame extracts has aminoacid sequence as shown in figure 14, or is higher than 90% aminoacid sequence with Figure 14 aminoacid sequence similarity.

Three, ACA1 (ACA1) activation RAW 264.7 scavenger cells

(1) with behind ACA1 (ACA1) and the RAW 264.7 scavenger cell co-cultivation 24h, with the nitrite concentration in the Griess reaction method mensuration nutrient solution, with assessment ACA1 (ACA1) activation RAW 264.7 scavenger cells, produce nitric oxide production effect, the result is as shown in figure 15.With RAW 264.7 scavenger cells after ACA1 (ACA1) activation, ACA1 (ACA1) has the ability that stimulates scavenger cell to produce nitrite when concentration 20 μ g/mL, the nitrite generation can reach 13.2 μ M, and the nitrite generation is respectively 16.2 μ M and 17.8 μ M (Figure 15) when concentration 160 μ g/mL.This result shows ACA1 (ACA) but direct activation RAW 264.7 scavenger cells, impels it to produce nitrogen protoxide.

(2) with after ACA1 (ACA1) and the RAW 264.7 scavenger cell co-cultivation 24h, with the TNF-alpha concentration in the ELISA method mensuration nutrient solution, with assessment ACA1 (ACA1) activation RAW 264.7 scavenger cells, produce the effect of tumor necrosis factor TNF-alpha, the result as shown in figure 16.With RAW 264.7 scavenger cells with ACA1 (ACA1) through 24 hours the activation after, ACA1 (ACA1) has the ability that stimulates scavenger cell to produce TNF-alpha when concentration 20 μ g/mL, the TNF-alpha generation is 20000pg/mL, and along with the raising of ACA1 (ACA1) concentration, TNF-alpha output also more and more higher (Figure 16).This result shows ACA1 (ACA1) but direct activation RAW 264.7 scavenger cells, impels its secreting tumor necrosis factor TNF-alpha.

Four, ACA1 (ACA1) can activate mouse boosting cell

(1), utilize the BrdU method to measure the proliferation response of mouse boosting cell with after ACA1 (ACA1) and the mouse boosting cell co-cultivation 72h.The BrdU method is to utilize BrdU to replace uridine, when hyperplasia is divided, allow cellular uptake BrdU in the division, use the BrdU molecule that the specific antibody identification of BrdU tool is absorbed (uptake) by cell again, therefore BrdU can be detected out by antibody, infers the proliferation of cells effect in view of the above.The result as shown in figure 17, the concentration of handling along with ACA1 (ACA1) is high more, the hyperplasia effect of mouse boosting cell is high more, at ACA1 (ACA1) but concentration is irritation cell hyperplasia more than the 20 μ g/mL, improve the BrdU intake (Figure 17) of mouse boosting cell.Therefore, ACA1 (ACA1) can activate mouse boosting cell, stimulates the mouse spleen cell to carry out hyperplasia.

(2), utilize mtt assay to measure the cell metabolic activity of mouse boosting cell, with the proliferative effect of estimation mouse boosting cell with behind ACA1 (ACA1) and the mouse boosting cell co-cultivation 72h.Mtt assay is to utilize the ferment effect MTT tetrazolium salts to be transferred to the formazan product of blueness, orange, this reaction is only carried out in viable cell, result from the born of the same parents formazan again with the DMSO stripping to nutrient solution, and formazan formation amount (photon absorbing intensity) is directly proportional with the viable cell number.Because the ability of cell reduction MTT is represented cell pellets body of gland activity, therefore can be as the index of cell survival rate or hyperplasia efficient.The analytical results of mtt assay as shown in figure 18, ACA1 (ACA1) but more than concentration 10 μ g/mL irritation cell hyperplasia (Figure 18).Therefore, ACA1 (ACA1) can activate mouse boosting cell, stimulates the mouse spleen cell to carry out hyperplasia.

(3) with behind ACA1 (ACA1) and the mouse boosting cell co-cultivation 72h, utilize the Interferon, rabbit IFN-gamma concentration in the ELISA method mensuration nutrient solution, found that ACA1 (ACA1) is when concentration 80ug/mL, the IFN-gamma secretory volume is 21,653pg/mL (as Figure 19), therefore ACA1 (ACA1) can activate mouse boosting cell, impels mouse boosting cell secretion IFN-gamma.

Embodiment one: the purifying of ACA1 (ACA1)

1. the cultivation of Antrodia Camphorata mycelium

Camphor tree sesame (Antrodia camphorata) bacterial classification is BCRC 35396 (available from a foodstuffs industry institute).

The dull and stereotyped cultivation: substratum is that malt extract substratum (MEA, malt extract agar) component prescription is that (Difco, USA) product contains: malt extract 20g/L, glucose 20g/L, peptone 1g/L and agar 20g/L in U.S. Supreme Being husband mouth company.Substratum is cooled to 65 ℃ behind autoclaving, it is standby to pour culture dish immediately into.Antrodia Camphorata mycelium is inoculated on the plate culture medium, 25 ℃ of cultivations, red color visible mycelial growth after two weeks.

The liquid cultivation: liquid substratum is that malt extract substratum (MEA, malt extract agar) component prescription is that (Difco, USA) product contains: malt extract 20g/L, glucose 20g/L, peptone 1g/L in U.S. Supreme Being husband mouth company.There is the plate culture medium of antrodia camphorata mycelium to cut about 8 0.25 square centimeter bacterium piece from length, is inoculated in the 200ml triangular pyramidal culturing bottle that the liquid substratum of 100mL is housed.In 25 ℃, after three weeks, carry out follow-up test with the 100rpm shaking culture.

2. from Antrodia Camphorata mycelium purifying ACA1 (ACA1)

The purifying flow process of ACA1 (ACA1) comprises steps such as ammonium sulfate precipitation, separation, ion exchange chromatography, and all steps are all carried out under 4 ℃.

(1) camphor tree sesame fermented liquid (about 1L) is centrifugal with the RC5C whizzer that Suo Er (Sorvall-Kendro) company produces, with 8,000xg, 30 minutes centrifugation fermented liquids and mycelium.Filter to clean the mycelium of centrifuged deposit with deionized water, give a baby a bath on the third day after its birth time, the Antrodia Camphorata mycelium that will remove nutrient solution is with 8 again, and 000xg removed redundant moisture in centrifugal 30 minutes.The mycelium of obtaining is soaked in the extraction liquid (0.1% (v/v) beta-mercaptoethanol is dissolved in 5% (v/v) glacial acetic acid solution), utilize the BEAD-BEATER biomixer, (temperature maintenance is under 4 ℃ with the granulated glass sphere of 1.0mm its grinding to be broken into pulpous state, each broken 3 minutes, 5 minutes at interval, about five times).With the slurries after the fragmentation with 12, centrifugal 30 minutes of 000xg.

(2) get the supernatant liquor of the broken slurries of camphor tree sesame after centrifugal, slowly add solid ammonium sulfate to 95% saturation ratio precipitation, Bing is stirred to spend the night.Again with 18, centrifugal 1 hour of 000xg, taking precipitate place and add 5L 10mM Tris-HCl damping fluid in the dialysis tubing, in pH 8.2 dialysis 120 hours, during every day change once above-mentioned damping fluid.Dialysing, protein soln is with 18 completely, and centrifugal 10 minutes of 000xg collects supernatant liquor, is camphor tree sesame ammonium sulphate precipitation crude protein liquid.

(3) (Britain Whatman company produces camphor tree sesame ammonium sulphate precipitation crude protein liquid to be injected the DEAE-52 Mierocrystalline cellulose of crossing with 10mM Tris-HCl pH 8.2 damping fluid balances in advance, DE-52) anion-exchange column, with the damping fluid swash of wave, dash the protein that proposes to be combined on the exchange column with the identical buffered soln that contains 0-0.5M NaCl more earlier.Solution that above-mentioned exchange column flows out is all collected with minute collection, Bing surveys its absorbancy at 280nm wavelength place, can get several protein absorption peak, the collection liquid of the different collecting regions that obtained carries out electrophoretic analysis with the policapram glue SDS-PAGE of 12% lauroleic acid sodium.

(4) with the albumen of separating step gained, (the fast protein liquid chromatography of Akta protein flash chromatography system by An Maxun (Amersham Biosciences) company product, FPLC) carry out purifying, according to the characteristic of separating the albumen negatively charged ion absorption that obtains, the Mono-Q tubing string of selecting An Maxun (Amersham Biosciences) company to produce carries out the purifying preparation.Same earlier with 10mM Tris-HCl pH 8.2 damping fluid balance Mono-Q tubing strings, after treating that sample injects, dash the protein that proposes to be combined on the tubing string with the identical buffered soln that contains 0-0.5M NaCl again, Bing collects with minute collection, Bing surveys its absorbancy at 280nm wavelength place, can get several protein absorption peak, the collection liquid that is obtained carries out electrophoretic analysis with the policapram glue SDS-PAGE of 12% lauroleic acid sodium.

Embodiment two: colloid electrophoresis analysis (SDS-polyacrylamide slab gel electrophoresis)

1. the preparation of the policapram glue SDS-PAGE of lauroleic acid sodium

(1) device of plate glue: the MiniProtein3 device that utilizes Bio-Rad company to produce carries out electrophoresis.Plate gel electrophoresis device is two flat glasss, fixes with retaining clip with the left and right sides of glass respectively, makes space wherein can hold gel, with the upright placement of its device.

(2) the policapram glue separation gel of configuration 12% lauroleic acid sodium: get polyacrylamide (30% acrylamide and 0.8%N, N '-methylene-bisacrylamide) 3mL, add 1.5M Tris-HCl, pH 8.8 damping fluid 1.9mL, 10%SDS 0.1mL, mixed evenly after, help to take out the bubble that degass with decompression, add ammonium persulphate (APS) the solution 50 μ L of fresh configuration again, TEMED5.5 μ L adds distilled water 2.5mL at last again.With the gelating soln of above-mentioned configuration, inject oneself ready glass device, treat that it forms the gel liquid level after, continue to do concentrated glue.

(3) the policapram glue polyacrylamide of configuration 3% lauroleic acid sodium concentrates glue: get polyacrylamide (30% acrylamide and 0.8%N, N '-methylene-bisacrylamide) 0.5mL, add 1.5M Tris-HCl, pH 6.8 damping fluid 0.76mL, 10%SDS 30 μ L, mixed evenly after, help to take out the bubble that degass with decompression, add ammonium persulphate (APS) the solution 30 μ L of fresh configuration again, TEMED 3.4 μ L add distilled water 1.76mL at last again.With the gelating soln of above-mentioned configuration, inject above the separation gel that gel has been finished, Bing is put a pectination masterplate (comb), just can form the U type groove that holds protein sample after waiting to condense.

2.Tank the preparation of damping fluid:

Get 3gTris-base, add the 14.4g glycine, add 10mL 10%SDS solution again, adding distil water is made into 0.1%SDS to 1000mL again, 25mM trivalent glycine buffer solution, and pH 8.3.

3. the processing of protein example:

Getting concentration is the camphor tree sesame protein soln 100 μ L of 1mg/mL, the 10%SDS solution that adds 10 μ L, the beta-mercaptoethanol that adds 5 μ L, add 2 μ L 1.5M Tris-HCl again, pH 8.8 damping fluids, glycerine and 2 μ L, 0.05% tetrabromophenol sulfonphthalein (bromophenol blue), 100 ℃, 10 minutes.Adopt relatively molecular weight of LMW marker standard protein, contain: phosphorylase b (97kDa), bovine serum albumin(BSA) (67ka), ovalbumin (43kDa), carbonic anhydrase (30kDa), Trypsin inhibitor SBTI (20.1kDa), and whey-protein (14.4kDa).

4. electrophoretic working method:

Ready-made plate glue is fixed on the electrophoresis apparatus, concave glass will be arranged towards electrophoresis chamber, take off the pectination masterplate, then on plate glue, form U type groove, fill with electrophoresis chamber up and down with the tray damping fluid, the protein example solution of getting about 30 μ L adds in the colloidal U type groove, connect electrode, electric current with 50V passes through earlier, when the tetrabromophenol sulfonphthalein indicator moves to separation gel and concentrated glue intersection, uses the electric current of 100V instead, when treating that indicator moves at the bottom of the plate about 1 centimeter, stop energising, separation gel is taken out, place dish to dye and fade.

Dyeing with fade:

(1) preparation of staining fluid: get the Coomassie brilliant blue of 1.25g, be dissolved in 227mL methyl alcohol and the 46mL acetic acid, add distilled water again to 500mL, mixed evenly after, filter standby.

(2) the fade preparation of liquid: get 75mL acetic acid, 50mL methyl alcohol, adding distil water to cumulative volume is a mixing for standby use behind the 1000mL.

(3) the plate glue behind the electrophoresis: be dipped in staining fluid 30 minutes, and poured out staining fluid, change the solution that fades, change the liquid that fades for several times after, place, albumen place presents blueness on the just visible gel

Embodiment three: glucoprotein staining analysis (periodic acid-Schiff stain)

Protein is after the policapram glue SDS-PAGE of lauroleic acid sodium analyzes, colloid is dipped in the stationary liquid (TCA solution) fixes 30 minutes, the water flushing for several times, be dipped in periodic acid-acetate solution [1% periodic acid (w/v), 3% acetic acid (w/w)] in 60 minutes, again with distillation washing 3 times, each 10 minutes, be dipped in then in the Schiff reagent, lucifuge is at 4 ℃ of reactions 50 minutes, as seen colour generation, wash for several times with discoloring agent (10% acetic acid) then, to sloughing background color, with the distillation washed several times with water, be dipped in 50% methanol solution preservation or dry again.

Embodiment four: the iso-electric point electrophoretic analysis

The LKB PhastSystem that utilizes An Maxun (Amersham Biosciences) company to produce carries out quick electrophoresis to be identified, film is that homogeneous 7.5% draws deionized water 60 μ L earlier in the middle of electrophoresis plate, take out plastic sheet with tweezers, film is put down with miter angle in order to avoid produce bubble, make film good red line frame.The sample of drawing 5 μ L places on the parafilm, utilizes the pectination template to draw sample, is put on the frame, begins to carry out electrophoresis.

Deposition condition is as follows: the lower limit of sampling is 1.20Vh, and the upper limit of sampling is 1.30Vh (SAMPLE APPL.DOWN AT 1.20Vh, SAMPLE APPL.UP AT 1.30Vh); Step 1:250V, 10.0mA, 3.0W, 15 ℃, 1Vh; Step 2:250V, 1.0mA, 3.0W, 15 ℃, 1Vh; Step 3:250V, 10.0mA, 3.0W, 15 ℃, 60Vh.

After electrophoresis finishes, carry out the silver seasoning then of dying, decolour and preserve.With etc. electric common factor standard protein Pharmacia pIcalibration kit (pI 3-10) standard substance and positive regulation group (OVA:pI 5.2) compare analysis.

Embodiment five: the colloid sieving is analyzed

Utilize molecule sieving (size exclusion) principle, divide standard albumen and the delay of ACA1 (ACA1) in tubing string, use the judgement molecular weight with colloid sieving (gel filtration) technical area.

Material: colloid filters tubing string Amersham Superdex 7510/300; Elutriant: the 50mM phosphate buffer, 0.15M NaCl, pH 7.0; Sample: filter with 0.2 μ m filter in advance; Standard protein: the Amersham molecule that is used for the filtering normal size of protein colloid (includes ribonuclease A, 13.7kDa; Chymotrypsinogen A, 25kDa, ovalbumin, 45kDa; White protein, 66kDa)

Chromatography: carry out colloid sieving chromatography with Amersham Akta FPLC system, flow velocity 0.7mL/min, the residence time that can record each standard protein and sample, with efflux volume, draw up the Ve value of each crest, use the calculating molecular weight.Calculate: calculate the Kav value of all protein standard substances and sample earlier with formula Kav=(Ve-Vo)/(Vt-Vo), in the following formula, Ve is this proteic efflux volume, and Vo is the volume that is not detained fully, and Vt is a tubing string inner pore cumulative volume.Drawing standard curve then is the longitudinal axis with the Kav of protein standard substance, and the log of protein standard substance (MW) is a transverse axis, and Bing asks for this slope of a curve and intercept.By the Kav value of sample,, can estimate its molecular weight at last with the typical curve contrast.

Be about 29kDa with the foregoing description amount of implementing to get a point, iso-electric point is about 5.3 camphor tree sesame immune modulator ACA1 (ACA1), and via the electrophoresis film being carried out glucoprotein dyeing, can learn that ACA1 (ACA1) is a glucoprotein.

Embodiment six: the erythrocyte agglutination activation analysis

The about 200 μ L of blood that get healthy Balb/C mouse add PBS, and low-speed centrifugal (above step is done three times) is diluted to 1.5% (v/v) blood with PBS at last.With the micromanipulation dish in 96 holes, the sample protein matter of getting 0.1mL, do concentration with PBS and be: 0.5,0.25,0.125,0.063,0.0031 (mg/mL) serial dilution, add 1.5% (v/v) blood, 50 μ L, left standstill after mixing 2 hours.Agglutination activity detects by an unaided eye.Agglutination activity is to illustrate with agglutination titer titer: definition is a proteinic minimum concentration when observing erythrocyte agglutination.Carry out the analysis of ACA1 (ACA1) with this step and find that it does not have blood agglutinative activity.

Embodiment seven: amino acid sequence analysis

At first with the FIP-aca sample purity of SDS-PAGE colloid electrophoresis analysis from FPLC Mono Q tubing string purifying, steep to pvdf membrane and the blue dyeing of coomassie through commentaries on classics, committee is utilized the Edman reaction principle by Chung Hsing University's Biochemical Research, analyze with ABI aminoacid sequence automatic sequencing instrument, can be according to the HPLC collection of illustrative plates of each amino-acid residue, calculate the N terminal amino acid sequence of sample, by analysis after as can be known the N terminal sequence of ACA1 (ACA1) be VNVTYDPFFDNPPNNLLYYAASSDDTN.

Embodiment eight: stimulate scavenger cell to produce the nitrogen protoxide test

Calendar year 2001 roll up the described method of 1767-1722 page or leaf according to people such as Sheu F. in J.Agric.Food Chem. the 49th, scavenger cell RAW 264.7 is subjected to e. coli lipopolysaccharide (lipopolysaccharide, LPS) after the stimulation, can show the nitrogen protoxide NOSs in a large number, with arginine catalysis is nitrogen protoxide, the nitrogen protoxide that is produced with citrulline is with after reactive oxygen species combines, can form aggressive extremely strong nitroxyl free radical, it is the important weapon that the scavenger cell macaque kills pathogenic bacteria, usually measure nitrite concentration in the cell culture fluid, to represent NO concentration, the generation of wherein analyzing NO is that the assessment scavenger cell is subjected to one of important indicator of activation degree.

(1) with RAW 264.7 scavenger cells (105 cell/caves) with 96 hole culture plates, in 37 ℃, cultivated in 5% CO2gas incubator about 24 hours, add ACA1 (ACA1), concentration is 0,5,10,20,40,80,160 (μ g/mL).In 37 ℃, cultivated 20 hours in 5% CO2gas incubator equally.

(2) get cell culture fluid 100 μ L, add Griess reagent and (contain 0.05%N-(1-naphthyl) ethyl-alkene dihydrazinite acidulants, 0.5% sulfanilic amide, 2.5% phosphoric acid) 100 μ L, nitrite anions and Griess reagent react form red-purple azoic dyestuff product in acidic solution, have obtained the maximum absorption at the 540nm place.The Bio-Rad Model 3550-UV ELISA Reader that produces with one hundred ALLRED (Bio-Rad) company measures the absorption value at 540nm place, and by nitrite typical curve calculation sample nitrite anions concentration.

After implementing, find, with RAW 264.7 scavenger cells after ACA1 (ACA1) activation, the ability that stimulates scavenger cell to produce NO is arranged when concentration 20 μ g/mL, the nitrite generation can reach 13.2 μ M, and the nitrite generation is respectively 16.2 μ M and 17.8 μ M (Figure 15) when concentration 160mg/mL.This result shows ACA1 (ACA1) but direct activation RAW 264.7 scavenger cells, impels it to produce nitrogen protoxide.

Embodiment nine: the mensuration of cytohormone TNF-alpa

The TNF-alphaOptEIA Set that the quantitative utilization of mouse boosting cell TNF-alpha must Supreme Being company (BD Pharmingen) be produced carries out.RAW 264.7 scavenger cells (10^5 cell/cave) with 96 hole culture plates, in 37 ℃, were cultivated about 24 hours in 5% CO2gas incubator, added ACA1 (ACA1), concentration is 0,5,10,20,40,80,160 (μ g/mL).In 37 ℃, cultivated 20 hours in 5% CO2gas incubator equally.

Reagent: (a) capture antibody (capture antibody): Anti-mouse TNF-alpha antibody.(b) survey antibody (Detection Antibody): Biotinylated anti-mouse TNF-alpha antibody.(c) Enzyme reagent: Avidin-horseradish peroxidase conjugate.(d) blocking-up liquid (blocking buffer): PBSwith 10%FBS.(e) mensuration thinner: PBS with 10%FBS.(f) washings (wash buffer): PBS with0.05%Tween 20.

Coating capture antibody is injected on the 96 hole analysis discs (96-well ELISA plate), and an evening is left standstill in 4 ℃ after adding the capture antibody (capture antibody) of 100 μ L in each hole.Clean plate 3 times with washings every other day.Confining liquid is added to reduce nonspecific interference, after one hour, clean plate 3 times with washings (wash buffer) in 37 ℃ of effects.Add cell culture fluid 100 μ L, after one hour, clean plate 3 times with washings (wash buffer) in 37 ℃ of effects.Add and survey antibody (Detection Antibody) and Enzyme reagent (avidin-HRP) 100 μ L, in 37 ℃ of effects one hour, utilize ABTS solution colour generation, the Bio-Rad Model 3550-UV ELISA Reader that produces with one hundred ALLRED (Bio-Rad) company surveys its light absorption value at the 405nm place.Each experiment triplicate Bing compares with typical curve, calculates its generation to record sample concentration.

After implementing, find with RAW 264.7 scavenger cells with ACA1 (ACA1) after through activation in 24 hours, the ability that stimulates scavenger cell to produce TNF-alpha is arranged during ACA1 (ACA1) concentration 20 μ g/mL, the TNF-alpha generation is 20000pg/mL, and along with ACA1 (ACA1) concentration is high more, TNF-alpha output also high more (Figure 16).This result shows ACA1 (ACA1) but direct activation RAW 264.7 scavenger cells, impels its secreting tumor necrosis factor TNF-alpha.

Embodiment ten: the analysis of broxuridine BrdU picked-up

The separation of mouse boosting cell: the Balb/C mouse is imposed the cervical vertebra dislocation method with the ether fan after dusk, take out complete spleen cell from mouse, utilize slide glass frosted part 10mL DMEM substratum to be housed to grind spleen, to place, at room temperature in 1, centrifugal 10 minutes of 600rpm.Remove supernatant liquor, add 9mL PBS after breaking up cell with the molten cytosol of 1mL RBC, centrifugal 1,600rpm, 5 minutes.Remove supernatant liquor, add 10mL DMEM substratum and break up cell Bing the evenly use immediately of cell thorough mixing.

Utilize Roche BrdU hyperplasia cover group to analyze, according to people such as Vista D.T. 1991 in people's nineteen nineties such as Cancerresearch the 51st volume 2515-2520 page or leaf and Hall P.A. institute in J.Pathol. the 162nd volume 285-294 page or leaf mention, hyperplasia in the BrdU method need utilize dna replication dna, because of DNA is synthetic is the important factor of hyperplasia, the synthetic method that generally is commonly used to measure cell mitogen and hyperplasia that become of DNA, utilizing BrdU (5-bromo-2 '-deoxyuridine) to replace thymidine combines with DNA, in conjunction with after the BrdU molecule that absorbed by cell with specific antibody identification again to the BrdU tool, therefore BrdU can be detected out by antibody when immunoassay, infers the proliferation of cells activity in view of the above.

Reagent: (a) BrdU solution: the BrdU that gets 20 μ L is added in the developing medium of 2mL, and it is mixed with the BrdU that concentration is 100 μ M.(b) Anti-BrdU-POD: the stock liquid of getting 100 μ L joins in the antibody diluent of 10mL standby.The Anti-BrdU-POD powder is joined in the deionized water of 1.1mL, mixed 10 minutes, be mixed with stock liquid.(c) washings: with the washings of 10 times of concentration, get 10mL, join in the deionized water of 90mL standby.(d) stop buffer 1M H ₂SO ₄: original liquid concentration is the vitriol oil (H of 18.78M ₂SO ₄), dilute 18.78 times, make it become the H of 1M ₂SO ₄

Lymph corpuscle with separator well, be incubated in the DMEM substratum, cell number is adjusted to 5 * 106 cell/mL, get enchylema and be inoculated in (5 * 10^5 cell/cave) in the 96 hole culture plates, adding concentration respectively is 0,10,20,40,80, the ACA1 (ACA1) of 160,320 (μ g/mL), with Con A (1 μ g/mL) as control group.In 37 ℃, cultivated 48 hours in 5% CO2gas incubator.

Every cave adds the BrdU reagent of 10 μ L, cultivates under the same conditions 4 hours, removes developing medium, cleans cell with washings, dries up culture plate.In each hole, add fixed deformation liquid 200 μ L, under room temperature, placed 30 minutes, after cleaning every cave, add Anti-BrdU-POD 100 μ L again, placed 90 minutes under the room temperature, add photoghraphic coupler 100 μ L at last, placed 10-30 minute under the room temperature, measure the absorption value at 450nm place with the Bio-Rad Model 3550-UV ELISAReader of one hundred ALLRED (Bio-Rad) company product.

As can be known along with the concentration that ACA1 (ACA1) is handled is high more, the hyperplasia effect of mouse boosting cell is high more through overtesting, and therefore ACA1 (ACA1) can activate mouse boosting cell as can be known, stimulates the mouse spleen cell to carry out hyperplasia.

Embodiment 11: cell metabolic activity analysis (mtt assay)

Roll up described in the 69-84 page or leaf nineteen ninety-five according to people such as Marshall N.J. in Growth regul. the 5th, mtt assay is the method that hyperplasia is analyzed, be commonly referred to as micoculture tetrazolium assay s (MTAs) with the XTT method, but applied analysis cell survival, growth and differentiation characteristic.Mtt assay is a kind of color method that is fast, is applied to field of immunology at first, mainly utilizes the ferment effect to transfer MTT tetrazolium salts [3-(4,5-dimethyl three nitrogen-2-yl)-2,5-hexichol tetrazolium bromide] to blue product MTT formazan.MTT changes and only carries out in survivaling cell, and is deposited in the cell, after the adding DMSO dissolving, can survey the extinction amount also quantitatively by the about 540nm of wavelength place, and formazan formation amount is directly proportional with the viable cell number.Because the ability of cell reduction MTT is represented cell pellets body of gland activity, therefore can be as the index of cell survival rate.Owing to have the problem of fast, economical and "dead" element pollution, so often be used as the mensuration of cell survival rate and macrophage phagocytic ability, and be the results relevance that cell survival rate that color method is measured and radioactivity nucleic acid Bing go into method through MTT relatively and can reach 0.8.People such as main reference SheuF. roll up the described method of 1767-1772 page or leaf in J.Agric.Food Chem. the 49th calendar year 2001.

(1) with the lymph corpuscle of separator well, be incubated in the DMEM substratum, be inoculated in (5 * 105 cell/caves) in the 96 hole culture plates, adding concentration respectively is 0,10,20,40,80, the ACA1 (ACA1) of 160,320 (μ g/mL), with ConA (1 μ g/mL) as contrast.In 37 ℃, co-cultivation is 48 hours in 5% CO2gas incubator.

(2) every cave adds the MTT solution of 20 μ L, with cultivating 5 hours under the situation, centrifugal, remove nutrient solution, add DMSO and placed 5 minutes, measure the light absorption value at 540nm place with the Bio-Rad Model 3550-UV ELISA Reader of one hundred ALLRED (Bio-Rad) company product.

(3) hyperplasia effect is to represent with respect to the extinction effect of control group (Con A processing).

Behind ACA1 (ACA1) and mouse boosting cell co-cultivation 72h, utilize mtt assay to measure the cell metabolic activity of mouse boosting cell, with the proliferative effect of estimation mouse boosting cell.The analytical results of mtt assay as shown in figure 18, ACA1 (ACA1) but more than concentration 10 μ g/mL irritation cell hyperplasia (Figure 18).Therefore, ACA1 (ACA1) can activate mouse boosting cell, stimulates the mouse spleen cell to carry out hyperplasia.

Embodiment 12: the mensuration of cytohormone IFN-gamma

The IFN-gamma OptEIASet that the quantitative utilization of T lymph corpuscle IFN-gamma must Supreme Being company (BD Pharmingen) be produced carries out.

Reagent: (a) capture antibody (capture antibody): Anti-mouse IFN-gamma antibody.(b) survey antibody (Detection Antibody): Biotinylated anti-mouse IFN-gamma antibodies.(c) Enzyme reagent: Avidin-horseradish peroxidase conjugate.(d) blocking-up liquid: PBS with 10%FBS.(e) measure with thinner (Assay diluent): PBS with 10%FBS.(f) washings: PBS with 0.05%Tween 20.

The separation of mouse boosting cell:

(1) the Balb/C mouse is imposed the vertebra dislocation method with the ether fan after dusk, take out complete spleen cell, utilize slide glass frosted part 10mL DMEM substratum to be housed to grind spleen, to place from mouse, at room temperature in 1, centrifugal 10 minutes of 600rpm.Remove supernatant liquor, add 9mL PBS, rotating speed 1,600rpm, centrifugal 5 minutes after breaking up cell with the molten cytosol of 1mL RBC.Remove supernatant liquor, add 10mL DMEM substratum and break up cell Bing the evenly use immediately of cell thorough mixing.

(2) get the mouse splenocyte, cell number is adjusted into 5 * 106 cell/mL, add ACA1 (ACA1) and cultivated the collecting cell nutrient solution 48 hours.

(3) coating capture antibody is injected on the 96 hole analysis discs (96-well ELISA plate), an evening is left standstill in 4 ℃ after adding the capture antibody (capture antibody) of 100 μ L in each cave.Clean plate 3 times with washings every other day.Add confining liquid (blocking buffer) to reduce nonspecific interference, after one hour, clean plate 3 times with washings in 37 ℃ of effects.Add cell culture fluid 100 μ L, after one hour, clean plate 3 times with washings in 37 ℃ of effects.Add and survey antibody (Detection Antibody) and Enzyme reagent (avidin-HRP) 100 μ L, in 37 ℃ of effects one hour, to utilize ABTS solution colour generation, be determined at the light absorption value at 405nm place with the Bio-Rad Model 3550-UV ELISA Reader of one hundred ALLRED (Bio-Rad) company first product.Test at every turn all that triplicate Bing compares with typical curve, calculate its generation to record sample concentration.

Behind ACA1 (ACA1) and mouse boosting cell co-cultivation 72h, utilize the Interferon, rabbit IFN-gamma concentration in the ELISA mensuration nutrient solution, found that ACA1 (ACA1) is when concentration 80 μ g/mL, the IFN-gamma secretory volume is 21,653pg/mL, therefore ACA1 (ACA1) can activate mouse boosting cell as can be known, impels mouse boosting cell secretion IFN-gamma.

Can get a camphor tree sesame albumen ACA1 (ACA1) after the foregoing description enforcement, its aminoacid sequence is:

VNVTYDPFFD-NPNNSLSYVA-CSDGTNGLLT-KGYTTLGSLP-DFPYIGGAYA-IAGWNSPSCG-TCWELTYNNV-SINILGIDTA-AGFNIALTAM-NVLTNNAAVD-LGEVDAAAIQ-VDSSVCGL，

Or for to be higher than 90% aminoacid sequence with above-listed aminoacid sequence similarity, ACA1 (ACA1) has the effect of regulating immunologic function, the additive that can be used as food, beverage perhaps adds excipient and other chemical substance and constitutes chemical composition, uses as medical material.

The foregoing description has further disclosed the present invention, but is not to be used to limit the present invention, and any people who is familiar with this technology without departing from the spirit and scope of the present invention, can make any change and modification.Therefore protection scope of the present invention is as the criterion with claims restricted portion.

＜110〉the letter uncle holds

＜120〉by the albumen ACA1 of camphor tree sesame extraction and the purposes of adjusting immunologic function thereof

<160>3

<210>1

<211>206

<212>DNA

＜213〉camphor tree sesame (Antrodia camphorata)

<220>

<221>misc_feature

<222>(116，144，169)

<220>

<221>CDS

<222>(1)...(206)

<400>1

acc?tac?gac?ccc?ttc?ttc?gac?aac?cca?aac?aac?tct?ctc?agc?tac 45

Thr?Tyr?Asp?Pro?Phe?Phe?Asp?Asn?Pro?Asn?Asn?Ser?Leu?ser?Tyr

1 5 10 15

gtc?gct?tgc?tcg?gat?ggt?acc?aat?ggt?ctt?ctc?acc?aaa?ggg?tat 90

Val?Ala?Cys?Ser?Asp?Gly?Thr?Asn?Gly?Leu?Leu?Thr?Lys?Gly?Tyr

20 25 30

acc?acc?ttg?ggc?tcc?ctc?cct?gat?ttc?cct?tac?att?gga?ggc?gca 135

Thr?Thr?Leu?Gly?Ser?Leu?Pro?Asp?Phe?Pro?Tyr?Ile?Gly?Gly?Ala

35 40 45

tat?gcc?atc?gca?gga?tgg?aat?tcc?ccg?agc?tgt?ggc?aca?tgt?tgg 180

Tyr?Ala?Ile?Ala?Gly?Trp?asn?Ser?Pro?Ser?Cys?Gly?Thr?Cys?Trp

50 55 60

gag?cya?aca?yac?aac?aac?gyc?agc?ayc?aac?aya?yyg?ggg?atc?gac 225

Glu?Leu?Thr?Tyr?Asn?Asn?Val?Ser?Ile?Asn?Ile?Leu?Gly?Ile?Asp

65 70 75

aca?gct?gcg?ggc?ttc?aac?att?gca?ctt?acg?gct?atg?aac?gta?ctc 270

Thr?Ala?Ala?Gly?Phe?Asn?Ile?Ala?Leu?Thr?Ala?Met?Asn?Val?Leu

80 85 90

acc?aat?aac?gcg?gcc?gta?gat?ctg?ggg?gag?gtt?gat?gca?acg?gca 315

Thr?Asn?Asn?Ala?Ala?Val?Asp?Leu?Gly?Glu?Val?Asp?Ala?Thr?Ala

95 100 105

ata?cag?gtc?gac?tcg?tcc?gtg?tgc?ggg?ctg?taa?aga?tat?gta?aaa 360

Ile?Gln?Val?Asp?Ser?Ser?Val?Cys?Gly?Leu?Xaa?Arg?Tyr?Val?Lys

110 115 120

cag?ctg?gaa?att?tgt?gga?cga?tgt?cat?atg?tca?tca?ttt?tgg?act 405

Gln?Leu?Glu?Ile?Cys?Gly?Arg?Cys?His?Met?Ser?Ser?Phe?Trp?Thr

125 130 135

cgt?ggc?ata?gtc?gaa?act?gat?gcc?tag?tgt?gtc?att?aaa?gtc?tct 450

Arg?Gly?Ile?Val?Glu?Thr?Asp?Ala?Xaa?Cys?Val?Ile?Lys?Val?Ser

140 145 150

tgt?tac?cac?caa?aca?atg?ctcggac?gtg?aga?tcg?tgg?gga?gaa?tgt 495

Cys?Tyr?His?Gln?Thr?Met?Leu?Asp?Val?Arg?Ser?Trp?Gly?Glu?Cys

155 160 165

ttg?att?gtt?tag?gag?tat?cga?att?ggg?aca?aat?tta?aac?ata?aaa 540

Leu?Ile?Val?Xaa?Glu?Tyr?Arg?Ile?Gly?Thr?Asn?Leu?Asn?Ile?Lys

170 175 180

aaa?aaa?aaa?aaa?aaa?gaa?aaa?aaa?aac?aaa?aaa?aaa?aaa?aaa?aaa 585

Lys?Lys?Lys?Lys?Lys?Glu?Lys?Lys?Asn?Lys?Lys?Lys?Lys?Lys?Lys

185 190 195

aaa?aaa?aag?tac?tct?gcg?ttg?ata?cct?ctg?ctt 618

Lys?Lys?Lys?Tyr?Ser?Ala?Leu?Ile?Pro?Leu?Leu

200 205

<210>2

<211>118

<212>DNA

＜213〉camphor tree sesame (Amrodia camphorata)

<220>

<221>CDS

<222>(1)...(118)

<400>2

gta?aac?gtg?acc?tat?gac?cct?ttt?ttc?gac?aac?cca?aac?aac?tct 45

Val?Asn?Val?Thr?Tyr?Asp?Pro?Phe?Phe?Asp?Asn?Pro?Asn?Asn?Ser

1 5 10 15

ctc?agc?tac?gtc?gct?tgc?tcg?gat?ggt?acc?aat?ggt?ctt?ctc?acc 90

Leu?Ser?Tyr?Val?Ala?Cys?Ser?Asp?Gly?Thr?Asn?Gly?Leu?Leu?Thr

20 25 30

aaa?ggg?tat?acc?accattg?ggc?tcc?ctc?cct?gat?ttc?cct?tac?att 135

Lys?Gly?Tyr?Thr?Thr?Leu?Gly?Ser?Leu?Pro?Asp?Phe?Pro?Tyr?Ile

35 40 45

gga?ggc?gca?tat?gcc?atc?gca?gga?tgg?aat?tcc?ccg?agc?tgt?ggc 180

Gly?Gly?Ala?Tyr?Ala?Ile?Ala?Gly?Trp?Asn?Ser?Pro?Ser?Cys?Gly

50 55 60

aca?tgt?tgg?gag?cta?aca?tac?aac?aac?gtc?agc?atc?aac?ata?ttg 225

Thr?Cys?Trp?Glu?Leu?Thr?Tyr?Asn?Asn?Val?Ser?Ile?Asn?Ile?Leu

65 70 75

ggg?atc?gac?aca?gct?gcg?ggc?ttc?aac?att?gca?ctt?acg?gct?atg 270

Gly?Ile?Asp?Thr?Ala?Ala?Gly?Phe?Asn?Ile?Ala?Leu?Thr?Ala?Met

80 85 90

aac?gta?ctc?acc?aat?aac?gcg?gcc?gtc?gat?ctg?ggg?gag?gtt?gat 315

Asn?Val?Leu?Thr?Asn?Asn?Ala?Ala?Val?Asp?Leu?Gly?Glu?Val?Asp

95 100 105

gca?gcg?gca?ata?cag?gtc?gac?gct?tcc?gtg?tgc?ggg?ctg 354

Ala?Ala?Ala?Ile?Gln?Val?Asp?Ser?Ser?Val?Cys?Gly?Leu

110 115 118

<210>1

<211>118

<212>DNA

＜213〉camphor tree sesame (Antrodia camphorata)

<220>

<221>CDS

<222>(1)...(118)

<400>1

gtt?aac?gtg?acc?tat?gac?cct?ttt?ttt?gac?aac?cca?aac?aac?tct 45

Val?Asn?Val?Thr?Tyr?Asp?Pro?Phe?Phe?Asp?Asn?Pro?Asn?Asn?Ser

1 5 10 15

ctc?agc?tac?gtc?gct?tgc?tcg?gat?ggt?acc?aat?ggt?ctt?ctc?acc 90

Leu?Ser?Tyr?Val?Ala?Cys?Ser?Asp?Gly?Thr?Asn?Gly?Leu?Leu?Thr

20 25 30

aaa?ggg?tat?acc?acc?ttg?ggc?tcc?ctc?cct?gat?ttc?cct?tac?att 135

Lys?Gly?Tyr?Thr?Thr?Leu?Gly?Ser?Leu?Pro?Asp?Phe?Pro?Tyr?Ile

35 40 45

gga?ggc?gca?tat?gcc?atc?gca?gga?tgg?aat?tcc?ccg?agc?tgt?ggc 180

Gly?Gly?Ala?Tyr?Ala?Ile?Ala?Gly?Trp?Asn?Ser?Pro?Ser?Cys?Gly

50 55 60

aca?tgt?tgg?gag?cta?aca?tac?aac?aac?gtc?agc?arc?aac?ata?ttg 225

Thr?Cys?Trp?Glu?Leu?Thr?Tyr?Asn?Asn?Val?Ser?Ile?Asn?Ile?Leu

65 70 75

ggg?atc?gac?aca?gct?gcg?ggc?ttc?aac?att?gca?ctt?acg?gct?atg 270

Gly?Ile?Asp?Thr?Ala?Ala?Gly?Phe?Asn?Ile?Ala?Leu?Thr?Ala?Met

80 85 90

aac?gta?ctc?acc?aat?aac?gcg?gcc?gta?gat?ctg?ggg?gag?gtt?gat 315

Asn?Val?Leu?Thr?Asn?Asn?Ala?Ala?Val?Asp?Leu?Gly?Glu?Val?Asp

95 100 105

gca?gcg?gca?ata?cag?gtc?gac?tcg?tcc?gtg?tgc?ggg?ctg 354

Ala?Ala?Ala?Ile?Gln?Val?Asp?Ser?Ser?Val?Cys?Gly?Leu

110 115 118

Claims (3)

1. albumen ACA1 (ACA1) by camphor tree sesame extraction, it is characterized in that having following aminoacid sequence, or be higher than 90% aminoacid sequence: VNVTYDPFFD-NPNNSLSYVA-CSDGTNGLLT-KGYTTLGSLP-DFPYIGGAYA-I AGWNSPSCG-TCWELTYNNV-SINILGIDTA-AGFNIALTAM-NVLTNNAAVD-LG EVDAAAIQ-VDSSVCGL with the following amino acid sequences similarity

2. camphor tree sesame albumen ACA1 as claimed in claim 1 (ACA1), it is further characterized in that this camphor tree sesame albumen ACA1 (ACA1) is used to regulate the purposes of immunologic function.

3. one kind is the chemical composition of main component with camphor tree sesame albumen ACA1 as claimed in claim 1 (ACA1), it is characterized in that this chemical composition is used to regulate the purposes of immunologic function.

Images