CN1771334A - Method for determining susceptibility of tumor to treatment with anti-neoplastic agent - Google Patents

Abstract

The level of one or more glucose transporters in a sample containing cancer cells is measured and compared to a reference value to determine whether the cancer is susceptible to treatment with an anti-cancer agent comprising glucose or glucose analog that is transported into the cancer by a glucose transporter.

Description

Be used for determining the method for tumour to the susceptibility of the treatment of anti-tumor agents

The cross reference of related application

[0001] the application requires the rights and interests of the U.S. Provisional Application 60/453,083 of submission on March 7th, 2003, and its full content is incorporated at this, as a reference.

Technical field

[0002] the present invention relates to determine the method for tumour, in biology and medical science, have purposes the susceptibility of anti-tumor agents treatment.

Background technology

[0003] term " cancer (cancer) " typically refers to a class by paracytic uncontrolled growth with send out a kind of in 100 kinds the disease of surpassing who causes, it can be that solid tumor (solid tumors), lymphoma and non-solid carcinoma (non-solid cancers) are as leukemic form.Treatment cancer patients's doctor has various pharmacotherapys and non-drug therapy selective.Yet, when concrete patient is determined suitable therapy, be problematic, reason is, though some treatment can be matched with some cancer types, but the patient but is inconsistent to the reaction of a particular treatment.

[0004] many anticancer agents likely comprise glucose or glucose sample part (glucose-likemoiety), and can be the membranins of helper cell ingestion of glucose therefore---the substrate of glucose transporter.Example comprises anticarcinogen streptozotocin (STZ), glucofosfamide and 2gluSNAP, among other the medicine that contains glucose or contain glucalogue is being developed.The glucose sample of these medicines partly mediates the transhipment in cancer cells, therefore utilized such fact here: with respect to normal cell, many cancer cells demonstrate the glucose metabolism of increase, this is considered to partly increase owing to glucose transporter quantity (referring to Medina et al., 2002, Biol Res.35:9-26).Yet for example U-9889, glucofosfamide and 2gluSNAP's not every patient (perhaps cancer) react to pharmacological agent.Which patient's most probable of aid forecasting is benefited from the method for the particular treatment of the medicament that adopts specific anticancer agent and particular type, can make the doctor more effectively treat cancer and provides significant benefits to the patient.The present invention just provides such method.

Summary of the invention

Whether [0005] the present invention includes many aspects, but usually, method and reagent are provided, they are used to screen the cancer patients, responsive to determine that cancer that they are suffered from contains the treatment of anticancer agent of glucose or glucalogue to employing.

[0006] in one aspect, the invention provides method, be used for the level of one or more glucose transporter of cancer cells is associated with the susceptibility of described cell to anticancer agent, wherein said anticancer agent is transported by described translocator, for example contains the anti-tumor agents of glucose or glucalogue.In one embodiment, medicament contains glucose moiety (moiety); In other embodiment, medicament contains 2-deoxyglucose part or fructose part.

[0007] in one embodiment, the invention provides method, be used for determining whether cancer is responsive to the anti-tumor agents treatment, implements through the following steps: (a) obtain the cancer sample; (b) measure the level of at least a glucose transporter in this sample; (c) this level and predetermined value are compared; (d) be responsive if the level of measuring, is then determined this cancer than predetermined value height to this anti-tumor agents treatment.At a related aspect, the invention provides method, be used for determining whether human cancer is responsive to anticancer pharmaceutical treatment, and wherein said anticancer agent contains glucose or glucalogue, and by the glucose transporter transhipment, described method comprises: the sample that obtains described cancer; Measure the amount of glucose transporter in the described sample; Described amount in the described sample is compared with predetermined value; If described amount, determines then that described cancer is to described anticancer agent sensitivity and can use this pharmaceutical treatment than predetermined value height, perhaps, if described amount is lower than described predetermined value, determine that then described cancer is insensitive or have the susceptibility of reduction to described anticancer agent.

[0008] in one embodiment, determined in the cancer sample more than a kind of level of glucose transporter.In one embodiment, the level of I class and/or II class and/or III class GLUT glucose transporter is determined.The whole bag of tricks can be used to the level of the glucose transporter in the working sample.A kind of method is an immune analysis.Another kind of suitable method relates to RNA amplification or cDNA amplification.In one embodiment, handle described human cancer sample, it for example can be, fresh, refrigerated, immobilized or immobilization and with paraffin-embedded tumour cell sample, go out total protein from described sample separation, with one or more the antibody contact separation thing that is specific in the described glucose transporter,, determine the level of glucose transporter in the described isolate by detecting the mixture that forms between antibody and the described glucose transporter.In other embodiment, by detecting glucose transporter with the reagent that is different from antibody, for example, by measuring the glucose uptake in the flesh tissue sample, perhaps by measuring the messenger RNA(mRNA) of one or more glucose transporter gene, perhaps, by measuring the activity of glucose transporter or its corresponding gene, determine the level or the content of glucose transporter in the sample.

[0009] in a kind of embodiment of present method, the GLUT2 level in the cancer sample is determined.In the another embodiment of present method, anticancer agent is the streptozotocin treatment.In another embodiment, cancer is carcinoma of the pancreas or islet-cell carcinoma.In a kind of embodiment preferred, the GLUT2 level is determined, and anticancer agent is streptozotocin, glucofosfamide or gluSNAP compound, and cancer is carcinoma of the pancreas or islet-cell carcinoma.

[00010] in yet another aspect, the invention provides useful reagent box in practice of the present invention.In one embodiment, test kit comprises the diagnosis screening agent and the working instructions thereof of present method.In another embodiment, test kit further comprises the antineoplaston medicament that contains glucose or glucalogue.

[00011] following detailed, embodiment and claim have been described these aspects of the present invention and others and embodiment in further detail.

Detailed Description Of The Invention

1. foreword

[00012] the invention provides method, reagent and equipment, whether they are responsive to anticancer pharmaceutical treatment in the evaluation cancer, and perhaps cancer is useful to the sensitivity aspect of anticancer agent.In one aspect, anticancer agent is the medicine that is transported by glucose transporter, for example comprises the medicine of glucose or glucalogue part, and it is the substrate of glucose transporter.Use as this paper, if determined that a kind of cancer is to pharmacological agent " sensitivity ", this just means, be confirmed as to this medicament not the tumour of " sensitivity " compare, to the tumour of this medicament " sensitivity " by this medicine effectively in treatment the possibility of opposing higher.Therefore, the judgement whether cancer is responsive to the treatment of an a kind of medicine or a class medicine provides the method for the chemotherapy scheme that is identified for treating the patient.

[00013] in certain methods of the present invention, obtains the cancer sample and detect from the patient, to determine the level of one or more glucose transporter; The cancer of expressing high-caliber glucose transporter is defined as, and to the chemotherapy sensitivity of anticancer agent, wherein said anticancer agent contains glucose or glucose moiety and is transported by glucose transporter.On the contrary, the cancer of expressing low-level glucose transporter is defined as, to such chemoresistance (perhaps more insensitive).Make the doctor can more effectively treat cancer according to screening (pre-therapy screening) before the treatment of the inventive method, because it has offered a kind of method of doctor, in order to determine whether the anticancer agent treatment can be effective, if not effectively, then use this cancer of the more effective compounds for treating of possibility, if effectively, then use this medicament and treat.

[00014] relevant but different slightly meaning is used in the medical literature term " glucose transporter " with two kinds.In first kind of meaning, glucose transporter is that the transhipment compound is (no matter be glucose, glucalogue, other carbohydrate for example fructose or inositol, perhaps non-carbohydrate is xitix for example) pass the protein of cytolemma, and (for example based on structural similarity, homology with other glucose transporter), they are classified as glucose transporter " family " member.Yet the main substrate of believing " glucose transporter " is the material that is different from glucose.For example, glucose transporter GLUT5 mainly is the translocator of fructose, it is reported, it is with low-affinity transhipment glucose itself.Similarly, the main substrate of glucose transporter HMIT is myo-inositol (myo-inositol, a kind of sugar alcohol).Use as this paper, unless otherwise, term " glucose transporter " comprises the translocator of fructose and inositol.In one aspect, the present invention has expected, measure the level of any glucose transporter, to estimate the susceptibility of tumour to anticancer agent, wherein said anticancer agent enters tumour cell by glucose transporter (include but not limited to, be selected from the glucose transporter of GLUT1-12, HMIT and SGLT1-6 translocator) transhipment.In a kind of embodiment preferred, the present invention has expected, measure the level of glucose transporter, this translocator is to be higher than for example avidity transhipment glucose of xitix of fructose, inositol, H+-flesh inositol or non-carbohydrate, to estimate the susceptibility of tumour to anticancer agent, wherein said anticancer agent comprises glucose or glucalogue part, enters tumour cell by the glucose transporter transhipment.

[00015] in a kind of embodiment preferred of the present invention, measures the level of one or more glucose transporter in the cancer sample, and compare with reference point (a plurality of value).With respect to described reference point, translocator level high in the cancer cell is pointed out, and tumour is to the treatment sensitivity of the member in the kind anti-cancer drugs agent that contains glucose or glucalogue part.

[00016] therefore, in one embodiment, the present invention has comprised the method that is used for determining that whether responsive cancer to the anti-tumor agents treatment, wherein said medicament comprises by glucose transporter transhipment and enters the glucose or the glucalogue of cancer cell, and described method comprises the following steps: that (a) obtains the sample of described cancer; (b) amount or the activity of glucose transporter in the described sample of mensuration; (c) described amount or the activity measured in the step (b) are compared with predetermined amount or activity; If (d) described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described cancer is responsive to described treatment, if described measured quantity, determines then that described cancer is insensitive or more insensitive to described treatment less than described predetermined amount or activity.

[00017] in one embodiment, the present invention has comprised the method that is used for determining that whether responsive the patient to the anti-tumor agents treatment, wherein said medicament comprises by glucose transporter transhipment and enters the glucose or the glucalogue of cancer cell, and described method comprises the following steps: that (a) diagnosis patient suffers from cancer; (b) obtain the sample of described cancer from described patient; (c) amount or the activity of glucose transporter in the described sample of mensuration; (d) described amount or the activity measured in the step (c) are compared with predetermined amount or activity; If (e) described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described patient is responsive to described treatment, if described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described patient is insensitive to described treatment.

[00018] in one embodiment, the present invention has comprised the method with anti-tumor agents treatment cancer patients, wherein said anti-tumor agents comprises by glucose transporter transhipment and enters the glucose or the glucalogue of cancer cell, and described method comprises the following steps: that (a) obtains the sample of described cancer from described patient; (b) amount or the activity of glucose transporter in the described sample of mensuration; (c) described amount or the activity measured in the step (b) are compared with predetermined amount or activity; If (d) described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described cancer is responsive to described treatment, if described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described cancer is insensitive to described treatment; If active in described predetermined amount or activity with described measured quantity or mensuration, then (e) treats the cancer patients with this anti-tumor agents.

[00019] in one embodiment, the present invention has comprised the method with anti-tumor agents treatment patient, wherein said anti-tumor agents comprises by glucose transporter transhipment and enters the glucose or the glucalogue of cancer cell, and described method comprises the following steps: that (a) diagnosis patient suffers from cancer; (b) obtain the sample of described cancer from described patient; (c) amount or the activity of glucose transporter in the described sample of mensuration; (d) described amount or the activity measured in the step (c) are compared with predetermined amount or activity; (e) if described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described cancer is responsive to described treatment, if described measured quantity or mensuration are active in described predetermined amount or activity, determine that then described cancer is insensitive to described treatment; If active in described predetermined amount or activity with described measured quantity or mensuration, then (f) treats the cancer patients with this anti-tumor agents.

2. " anticancer agent (ANTI-CANCER AGENTS) " and " anti-tumor agents (ANTI-NEOPLASTICAGENTS) "

[00020] anticancer agent is the compound that prevents or stop patient's growth of cancer cells and/or send out.Give anticancer agent can cause the delay of disease process or slow down, the improvement of morbid state or alleviate, take a turn for the better (no matter partially or fully), and/or prolong survival (comparing) with the expectation survival under the situation of not receiving treatment.Using at present or anticancer agent under development includes but not limited to alkylating agent, anthracene nucleus medicament, microbiotic, metabolic poison, the radioactive nuleus thuja acid, metallic poison, enzyme inhibitors, arimedex, biphosphonate, cyclooxygenase inhibitors, estrogenic agents, antifol, the inorganic arsenic hydrochlorate, the microtubule inhibitor, revise agent (modifiers), nitrosourea, nucleoside analog, potash feldspar inhibitor (orthoclaseinhibitors), contain platinic compound, retinoids (retinoid), topoisomerase 1 inhibitor, topoisomerase 2 inhibitor and tyrosine kinase inhibitor.

[00021] main interest of the present invention is, is entered the anticancer agent of cancer cells by the glucose transporter transhipment.Thus, term " anti-tumor agents " is used to refer to such anticancer agent, thereby with they with can't help the anticancer agent (for example, cis-platinum, Bevacizumab, Pemetrexed and similar medicament) that glucose transporter transhipment enters cancer cells and make a distinction.Anti-tumor agents comprises the molecule that contains glucose moiety or glucalogue part, described glucose moiety or glucalogue partly help to enter cell by the glucose transporter transhipment, perhaps otherwise, allow to enter cell by the glucose transporter transhipment.In one embodiment, glucalogue itself is an anti-tumor agents.The example of such medicament is 2-deoxyglucose (2-DG).Other example comprises 2-fluoro-2-deoxyglucose (2-FDG) and radiolabeled 2-FDG compound such as 2-18FDG.In another embodiment, glucose moiety or glucose sample partly are connected to (conjugated to) another part, this another part for example is a cytotoxic compound, itself can be as above-named those anticancer agents at (that is, when partly not being connected with glucose moiety or glucose sample).For example, glucose or glucalogue part can only play target molecule, bring cytotoxicity medicament attached thereto into cell.Described among the PCT publication WO03/082301 and contained the glucose that is connected in toxicity part or the anti-tumor agents of glucalogue.In one embodiment, when being given with disconnected form, glucose sample part and other parts all are avirulent.In a kind of selectable embodiment, when being given independently, glucose sample part and other parts all are virose.

[00022] for the anti-tumor agents that contains the part that is connected in glucose or glucalogue, can use any link, as long as its with glucose or glucalogue partly and non-glucose moiety compatible; For example, at WO03/082301 or at United States Patent (USP) 5,622, any link of describing in 936.Anti-tumor agents can be attached to glucose or glucalogue at any functional site, for example, and on glucose or glucalogue 1,2,3 or 4.

[00023] as anti-tumor agents or its a part of glucalogue of applicable screening method of the present invention, be well known in the art, include but not limited to glucose-derivative such as D-(+)-2-deoxyglucose, D-(+)-2-amino-2-deoxyglucose or N-acetyl D-(+)-2-amino-2-deoxyglucose; D-seminose and mannose derivative; D-glucose and D-glucose-derivative include but not limited to D-3-amino-3-deoxidation-glucose and D-2-amino-2-deoxidation-glucose; And D-semi-lactosi and galactose derivate include but not limited to D-2-deoxidation-D-semi-lactosi, D-4-amino-4-deoxidation-semi-lactosi and D-2-amino-2-deoxidation-semi-lactosi.Therefore, the difference of glucose or glucose moiety and D-glucose or derivative such as 2-DG and 2-glycosamine can be that it is its epimer.In addition, glucose or glucalogue part can be any one a fluorinated derivatives in the aforesaid compound.And the oxygen in the aforesaid compound in the ring of any one can replace with the isostere that is selected from S, sulfone and analogue (isostere).For example, glucalogue can be 5-sulfo--D-glucose or its derivative.Term " glucalogue " also comprises glucose-derivative; include but not limited to; have (C1-C12) acyl group or (C1-C12) derivative of alkyl group, wherein said carboxyl groups or alkyl group by-O-or-the NH-group is connected in 3 or 4 of glucose molecule.In addition, glucose-derivative can have dissolving or partition effect thing or the composition (solubility or partitioning effector or component) that is connected in 1-, 3-or 4-position.

[00024] in some embodiments, glucalogue be fructose, psicose, sorbose, tagatose, allose, altrose, gulose, idose, talose, inositol (for example, myo-inositol (myo-inositol), scillo-inositol, muco-inositol and chiro-inositol) or can be used as other sugar alcohol (sugar alcohol) of the substrate of glucose transporter, perhaps can be used as its derivative of the substrate of glucose transporter, as cited those in the table 1.

[00025] a large amount of anti-tumor agents that comprise glucose or glucalogue are known, and in other experiment or the exploitation, for use in clinical application in the future.The unrestricted purpose for explanation, the example of such anti-tumor agents comprises streptozotocin (streptozotocin), glucofosfamide, glycosyl-S-nitrosothiol (glyco-S-nitrosothiol) (comprising 2gluSNAP), simple substance emission radioactive tracer (singleproton-emitting radio tracers) (comprising 2-O-(3 '-iodobenzene methyl)-D-glucose and N-(4 '-iodobenzene methyl)-D-glycosamine), 2-deoxy-D-glucose of describing among the WO03/082301 (2-DG) and 2-DG binding substances (conjugates), the binding substances of describing among the WO02/058741, the binding substances of describing among the WO99/20316, United States Patent (USP) 6,489, the binding substances of describing in 302, United States Patent (USP) 5,622, binding substances and their derivative and the analogue described in 396.

[00026] streptozotocin [2-deoxidation-2-(3-methyl-3-nitroso-group-urea groups)-D-glucose; N-methyl nitroso-group carbamyl-D-glycosamine; STZ; Zanosar ^TM] be a kind of antimitotic alkylating agent, wherein have Cytotoxic N-nitrosourea group and be attached to 2 of glucosamine.FDA is verified, streptozotocin treatment islet-cell carcinoma and carcinoid tumor.Compare with the similar thing of other nitrosourea, streptozotocin optionally target in the beta cell of pancreas, this is owing to having glucose moiety in this compound, the process that as if its cell that has mediated quilt expression GLUT2 taken in (referring to, Schnedl et al., Nov.1994, Diabetes 43:1326-33; Elsner etal., Dec.2000, Diabetologia 43:1528-33; Hosokawa et al., Dec.2001, Biochem.Biophys.Res.Commun.289:1114-17; Wang et al., Jan.1998, Diabetes 47:50-56; AndWang et al., 1995, Exp.Clin.Endocrinol.Diabetes 103 Suppl.2:83-97).Referring to, for example, United States Patent (USP) 3,694,428 and 3,940,383.

[00027] anti-tumor agents glucofosfamide (β-D-glucosyl-ifosfamide mustard; Glc-IPM) contain the cytotoxic agent ifosfamide, it is by the ester bond at the Sauerstoffatom place of 1 of glucose be connected with glucose (referring to United States Patent (USP) 5,622,936 and United States Patent (USP) 6,489,302).After tested glucofosfamide to the Pancreas cancer patients of accepting first-line treatment with accept the chemotherapeutic nonsmall-cell lung cancer patient in two wires, and glioblastoma multiforme, mammary cancer and colorectal carcinoma patient's treatment.Referring to, Niculescu-Duvaz, 2002, Curer.Opin.Investit.Drug 3:1527-32.Briasoulis et al., 2000, J.Clin.Oncol.18:3535-44 has reported that the cellular uptake of glucofosfamide is mediated by Na+-dependent form glucose transporter.

[00028] glycosyl-S-nitrosothiol compound can be described to and the sugared cytotoxic agent that is connected, existing reporting, it preferably target in the tumour cell of overexpression GLUT1 (referring to, Ramirez et al., 1996, Bioorg.Med.Chem.Lett.6:2575-80 and Cantuaria et al., 2000, Cancer 88:381-88).The structure that representational glycosyl-S-nitrosothiol, 2gluSNAP have is wherein to supply with nitric oxide production cytotoxicity part (S-nitroso-group-N-N-acetylpenicillamine) and be connected in 2-deoxy-glucose amine by amido linkage at 2.Be reported that these targeting compounds in the tumour cell of overexpression GLUT1 (referring to Ramirez et al., supra, andCantuaria et al., supra).

[00029] other anti-tumor agents that can be employed for its screening method of the present invention, it is the compound that contains glucose moiety, wherein said glucose moiety is connected in the single photon emission part by heterocyclic group, hydrocarbyl group or aromatic group, as describing among the PCT publication WO99/20316.These compounds comprise, for example, and 2-O-(3 '-iodobenzene methyl)-D-glucose and N-(4 '-iodobenzene methyl)-D-glycosamine.Other example that can be connected in the anti-tumor agents of above-described glucose or glucalogue comprises, for example, Yttrium-90, iodine-125, iodine-131, phosphorus-32, hydroxyurea, triapine, 5-HP, camptothecine and its analogue, carboplatin and analogue thereof, DOTA and other radiomethal ion chelating agent, methotrexate and analogue thereof, mitoxantrone and relevant anthraquinone ring, little kinase inhibitor, Dacarbazine (dacarbazine) or Procarbazine (Procarbazine), and mitomycin.

[00030] is different from the compound of glucose and glucalogue by one or more glucose transporter transhipments.For example, report also that xitix is entered cell by glucose transporter by transhipment with the form of L-dehydroascorbic acid.Referring to, Vera et al., 1004, Blood 84:1628-34 and Agus et al., 1997, J:Clin.Invest.100:2842-48.Proton/flesh inositol albumen (HMIT) that cotransports is a member of glucose facilitation diffusion translocator classification (facilitative glucose transporter class), and it has optionally for myo-, scillo-, muco-and chiro-inositol.Transhipment is high-affinity (Km=100uM), and can increase when hanging down pH, reaches maximum rate when pH=5.0.

[00031] anti-tumor agents described herein can be used as basic, single pharmaceutical treatment and is used for cancer therapy, also can carry out combination therapy with the combination of radiotherapy, operation or other anticancer agent and these therapies.

3. glucose transporter

[00032] as top pointed, in one aspect of the invention, the level of one or more glucose transporter in the cancer sample is determined.Therefore, understand the character and the type of glucose transporter, can offer the relevant guidance of the present invention of practitioner.

[00033] glucose transporter comprises glucose facilitation diffusion translocator family member (GLUT/SLC2A), sodium dependent glucose albumen (SGLT/SLC5A), the H+/myo-inositol albumen (HMIT1) that cotransports that cotransports, and aforesaid people or Mammals homologue (homologs) and directly to homologue (orthologs).The unrestricted purpose for explanation, representational glucose transporter comprises those that enumerate in the table 1.

Table 1

Glucose transporter	Nucleotide sequence numbering (Accession No.) *	The protein sequence numbering *	Classification	The tissue of the selection of expressing translocator is in the news	The main reference document
						GLUT1	NM_006516	P11166	I	Institute is (abundant in red corpuscle and brain) in a organized way	1，2
GLUT2	NM_000340	P11168	I	Liver, pancreas, islet cells, retina, intestines, kidney	2，3
						GLUT3	NM_006931	P11169	I	Brain	2，4
GLUT4	NM_001042	P14672	I	Heart, muscle, fat, brain	5，6
						GLUT5	BC001692	P22732	II	Intestines, testis, kidney, red corpuscle	7，8
GLUT6	NM_017585	Q9UGQ3	III	Brain, spleen, white corpuscle	9，10
						GLUT7			II	Unknown	11
GLUT8	NM_014580	Q9NY64	III	Testis, brain, blastocyst	10，12，13， 14，29
						GLUT9	BC018897	Q9NRM0	II	Liver, kidney	15
GLUT10	NM_030777	Q95528	III	Liver, pancreas	16，17
						GLUT11	NM_030807	Q9BYW1	II	Heart, muscle	18，19，20
GLUT12	NM_145176	NP_660159	III	Heart, prostate gland, muscle, small intestine, fat	21
						HMIT	NM_052885	NP_443117	III	Brain	22
GLUT14	NM_153449 AF481879	AAL89709 AAL89710	I	Testis	28
						SGLT1	NM_000343	P13866		Small intestine, kidney, heart, liver, lung	23
SGLT2	NM_003041.1	P31639		Extensively there be (mainly being kidney)	24，25
						SGLT3	AJ133127 **	Q9NY91		Small intestine, skeletal muscle (based on pig SGLT 3)	26
SGLT5	NM_152351				27

^*To quoting of concrete sequence is for illustrative purposes, rather than will limit the present invention by any way.For example, for the translocator of enumerating in the 1st hurdle, can have other or selectable sequence includes but not limited to, polymorphic sequence and other varient.

^*The EMBL sequence numbering

1.Mueckler et al.1985, Science 229:941-5; 2.Gould et al.1991, Biochem.30:5139-45; 3.Fukumoto et al.1988, PNAS 85:5434-8; 4.Kayano et al.1988, J.of Biol.Chem.263:15245-8; 5.Fukumoto et al.1989, J.of Biol.Chem.264:7776-9; 6.Jameset al.1989, Nature 338:83-7; 7.Kayano et al.1990, J.of Biol.Chem.265:13276-82; 8.Davidson et al.1992, Am.J.of Physiol.262:C795-C800; 9.Doege et al.2000a, Biochem.J.350:771-6; 10.Lisinski et al., 2001, Biochem.J.358:517-22; 11.Joost ﹠amp; Thorens, 2001, Mol.Membrane Biol.18:247-56; 12.Carayannopoulos et al.2000, PNAS 97:7313-8; 13.Doege et al.2000b, J.of Biol.Chem.275:16275-80; 14.Ibberson et al.2000, J.of Biol.Chem.275:4607-12; 15.Phay et al.2000, Surgery 128:946-51; 16.Dawson et al.2001, Mol.Genetics and Metabol.74:186-99; 17.McVie-Wylie et al.2001, Genomics 72:113-7; 18.Doege et al.2001, Biochem.1 J 359:443-9; 19.Wu et al.2002, Mol.Genetics and Metabol.76:37-45; 20.Sasaki et al.2001, Biochem.and Biophys.Res.Comm.289:1218-24; 21.Rogers et al.2002, Am.J.ofPhysiol.282:E733-8; 22.Udry et al.2001, EMBO are J.20:4467-7; 23.Hediger et al.1989, PNAS, 86 (5): 5748-52; 24.Wells et al., 1992, Am.J.Physiol.263 (3): F459-65; 25.Kanai et al., 1994, J Clin Invest.93 (1): 397-404; 26.Diez-Sampedro, 2003, PNAS, 100 (20): 11753-8; 27.Wood ﹠amp; Trayhurn, 2003, British J.Nutr.89:3-9; 28.Wu et al., 2002, Genomics 80:553-7; 29. U.S. Patent application 20030228592.

3.1GLUTs

[00034] in some embodiments, glucose transporter right and wrong Na ⁺Dependent form facilitation diffusion HUCEP-8 or glucose facilitation diffusion translocator." glucose facilitation diffusion translocator (facilitative glucosetransporter) " or " non-Na ⁺Dependent form facilitation diffusion HUCEP-8 (facilitative Na ⁺Independentsugar transporter) " or " GLUT " be meant glucose transporter, it utilizes the diffusion gradient of striding cytoplasmic membrane of substrate such as glucose to transport substrate.Glucose facilitation diffusion translocator includes but not limited to GLUT1, GLUT2, GLUT3, GLUT4, GLUT6, GLUT7, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, H+-link coupled flesh inositol translocator HMIT1.GLUT14 and GLUT3 have 94.5% identity, and are also included within the GLUT family.

[00035] glucose facilitation diffusion translocator has 12 transbilayer helixs usually.This proteic membrane spaning domain can contain the path of being filled by water, and substrate can move through this path, and in some cases, this proteic endochylema outer structure territory can be contained and have the big ring that N connects the oligosaccharides part.This ring can form between any two successive transbilayer helixs, for example, between first and second transbilayer helix, perhaps forms between the 9th and the tenth transbilayer helix.

[00036] in some embodiments, glucose transporter comprises one or more " glucose transporter sign (glucose transporter signature) ".Use as this paper, " glucose transporter sign " is meant the conserved residues on two kinds or the more kinds of translocator, and it has participated in the function of this albumen as translocator.In some embodiments, the glucose transporter sign is the existence of 7 glycine residues in transbilayer helix 1,2,4,5,7,8 and 10.In some embodiments, the glucose transporter sign is one or more the charged residue on this proteic tenuigenin one side, and they are guarded in known GLUTs.Referring to Joost et al., 2001, Mol.Membrane Biol.18:247-256.In some embodiments, the glucose transporter sign is one or more in following: the tryptophane in the tryptophane in the spiral 6, the spiral 11, the tyrosine in the spiral 4, the tyrosine in the spiral 7.In some embodiments, the glucose transporter sign is spiral 6 a PXXPR motif afterwards.In other embodiment, glucose transporter does not comprise such PXXPR motif.

[00037] in some embodiments, the glucose transporter sign is the tryptophan residue (when sequence is when comparing with GLUT1, then corresponding to the tryptophane among the GLUT1 388) of the and then conservative GXXPXP motifs of spiral 10.In some embodiments, the glucose transporter sign is the tryptophan residue (when sequence is when comparing with GLUT1, then corresponding to the tryptophane among the GLUT1 412) in the spiral 10.Show, these tryptophan residues for the part cytochalasin B and not the combination of SCH (forskolin) be important, and given the glucose transporter pair cell Relaxin B or the susceptibility of SCH not.Garcia et al., 1992, J.Biol.Chem.267:7770-76; Schurmann et al., 1993, Biochem.J.290:497-501. therefore, embodiments more of the present invention comprise pair cell Relaxin B or the not analysis of the responsive glucose transporter of SCH treatment.In some embodiments, glucose transporter pair cell Relaxin B the or not binding affinity of SCH is low.In some embodiments, glucose transporter pair cell Relaxin B or not the binding affinity height of SCH.

[00038] glucose transporter of analyzing in practice of the present invention has different avidity to glucose or glucalogue.Therefore, in some embodiments, glucose transporter has shown the high-affinity to glucose.Such as in the literary composition application, for GLUTs, " high-affinity " mean, uses Burant et al., 1992, the Africa xenopus ovocyte analysis of describing among the J.Biol.Chem.267:14523-26, KM is less than 5mM; For SGLTs, " high-affinity " means that the K0.5 value is less than 1mM, preferably less than 0.5mM, this is to use Panayotova-Heiermann et al., 1996, two microelectrode pincers analyses (two-microelectrode clamp assay) of describing among the J.Biol.Chem.271:10029-34 are measured.In other embodiment, glucose transporter has shown the low-affinity to glucose.In some embodiments, glucose transporter is different to the binding affinity of glucose/glucalogue in different tissues, under different physiological conditions, when morbid state such as cancer, is different for example perhaps.

[00039] according to sequence similarity and characteristic element, can be three littler subgroups with known GLUT protein ingredient, i.e. I class (GLUT1-4), II class (GLUT5, GLUT7, GLUT9 and GLUT11) and III class (GLUT6,8,10,12 and HMIT1).Referring to Joost et al., 2001, Mol.Membr.Biol.18:247-56.Unusual and/or the overexpression of observing GLUT in some tumor tissues is (referring to summary Smith, 1999, Br.J.Biomed.Sci.564:285-92; Bell et al., 1990, Diabetes Care 13:198-206).

3.1.1 I class GLUTs

[00040] I class glucose transporter can contain for example glutamine at spiral 5 places (when sequence and GLUT1 comparison, corresponding to the Q161 among the GLUT1) of sequence motifs (glucose transporter sign).In some embodiments, glucose transporter contains the STSIF motif in extracellular ring 7 (that is the ring between transbilayer helix 7 and transbilayer helix 8).In some embodiments, glucose transporter contains the QLS motif at spiral 7 places.It is reported that I class glucose transporter is expressed in various noumenal tumours, for example mammary cancer, renal cell carcinoma, cerebral tumor, stomach and intestine malignant tumor and cervical cancer.

[00041] in some embodiments of the present invention, the level of I class glucose transporter is determined.

[00042] in some embodiments of the present invention, the GLUT1 level is determined.Report, GLUT1 by overexpression, comprises tumour, leiomyosarcoma, lung, ovary, pancreas, penis, Tiroidina, the uterus of bladder, mammary gland, uterine neck, knot rectum, stomach, esophagus, head and neck, the tumour and the teen-age vascular tumor of vascular in various malignant tissues.Medina et al., 2002, Biol.Res.35:9-26. shows that also the expression of GLUT1 is relevant with tumor hypoxia.Airley et al.，2001，Clin.Cancer Res.7：928-34；Chen et al.2001，J.Biol.Chem.12：9519-25。

[00043] in some embodiments of the present invention, the GLUT2 level is determined.Be reported that GLUT2 in cancer of the stomach by overexpression.

[00044] in some embodiments of the present invention, the GLUT3 level is determined.Be reported that GLUT3 in the cancer of the brain, lung cancer, mammary cancer, cancer of the stomach, head and neck cancer, meningioma and ovarian cancer by overexpression.GLUT3 has high-affinity to glucose, and for example is considered in the tissue that the glucose as nutriment is had tight demand responsible to the transhipment of glucose in the brain.

[00045] in some embodiments of the present invention, the GLUT4 level is determined.Be reported that GLUT4 in mammary cancer, cancer of the stomach, lung cancer and carcinoma of the pancreas by overexpression.

[00046] in some embodiments of the present invention, the GLUT14 level is determined.Be reported that it is 497 amino acid whose protein that GLUT14 has the short form of two kinds of splicing form: GLUT14, has 94.5% consistence with GLUT3.Long form is 520 amino acid whose protein, only is different from short form at N-terminal.It is reported that two kinds of isomer are all expressed specifically in testis.

3.1.2II class GLUTs

[00047] in some embodiments, glucose transporter is II class GLUT.In some embodiments, glucose transporter lacks in abutting connection with the tryptophan residue of spiral 10 conservative GXXPXP motifs (when sequence is compared with GLUT1, corresponding to the tryptophane among the GLUT1 388), this residue has been given the susceptibility of glucose transporter pair cell Relaxin B.The inhibition of II class glucose transporter pair cell Relaxin B insensitive (referring to Joost et al., 2001, Mol.Mern.Biol.18:247-56).

[00048] in some embodiments of the present invention, the level of II class glucose transporter is determined.

[00049] in one embodiment of the invention, the GLUT5 level is determined.Be reported that GLUT5 in lung cancer and mammary cancer by overexpression.

[00050] in one embodiment of the invention, the GLUT7 level is determined.

[00051] in one embodiment of the invention, the GLUT9 level is determined.Identified a kind of other splicing form of GLUT9 recently, it is only different with GLUT9 at N-terminal.Auguatin et al.，2004，January22，J.Biol.Chem。

[00052] in some embodiments of the present invention, the level of GLUT11 is determined.For GLUT11, two kinds of splicing variants have been described, the form (493 amino acid) of a kind of form of length (503 amino acid) and a kind of weak point.Doege et al.，2001，Biol.J.359：443-49；Sasaki et al.，2001，Biochem.Biophys.Res.Comm.289：1218-24。Be reported that the glucose transport of the GLUT11 mediation low-affinity of short-form, show that the GLUT11 of short-form mainly expresses in heart and skeletal muscle.The GLUT11 that is reported that microscler formula expresses in liver, lung, tracheae and brain, shows, the GLUT11 of microscler formula increases the fructose transhipment.Therefore, in some embodiments of the present invention, glucose transporter is the form of the length of GLUT11.In other embodiment, glucose transporter is the form of the weak point of GLUT11.In other embodiment, glucose transporter is derivative, varient or the close homologue (close homologue) of GLUT11.

3.1.3III class GLUTs

[00053] in some embodiments, glucose transporter is III class GLUT.The motif of finding in some III class GLUT comprises, glycosylation site and target motif (targeting motifs) on ring 9 (that is the rings between transbilayer helix 9 and the transbilayer helix 10).

[00054] in some embodiments of the present invention, the level of III class glucose transporter is determined.

[00055] in one embodiment of the invention, the level of GLUT6 is determined.It is reported that GLUT6 mainly expresses in brain, spleen and peripheral leukocytes.

[00056] in one embodiment of the invention, the level of GLUT8 is determined.GLUT8 expresses in breast cancer cell.

[00057] in one embodiment of the invention, the level of GLUT10 is determined.

[00058] in one embodiment of the invention, the level of GLUT12 is determined.Find that GLUT12 expresses in breast tumor.Referring to Rogers et al., 2003, Cancer Letters, 93:225-33; Rogers et al., 2002, Am.J.Physiol.Endocrinol.Metab.282 (3): E733-8.

[00059] in one embodiment of the invention, the level of HMIT1 is determined.

3.2SGLTs

[00060] in some embodiments, glucose transporter is Na ⁺The dependent form glucose albumen (Na that cotransports ⁺-dependent glucose co-transporter)." Na ⁺The dependent form glucose albumen that cotransports " or " Na ⁺/ glucose the albumen that cotransports " be meant glucose transporter, mode active transport glucose or glucalogue that it relies on energy.Some Na ⁺The dependent form glucose transporter is utilized Na ⁺Drive the picked-up of glucose or glucalogue along moving of electrochemical gradient.Na ⁺The dependent form glucose transporter includes but not limited to, SGLT1, SGLT2, SGLT3, SGLT4, SGLT5 and SGLT6.Referring to table 1; Also referring to Coady et al., 2002, " Identification of a novel Na+/myo-inositol cotransporter. " J BiolChem.277:35219-24.In some embodiments, glucose transporter is the Na of high-affinity, lower volume (capacity) ⁺The dependent form glucose transporter.In some embodiments, glucose transporter is the Na of low-affinity, heavy body ⁺The dependent form glucose transporter.

[00061] in some embodiments, Na ⁺The dependent form glucose transporter comprises 14 transbilayer helixs.In some embodiments, glucose transporter further comprises the N-link glycosylation site between spiral 6 and spiral 7, and has shown that this site is conservative between several known SGLT.Referring to, Wright, Am.J.Physiol.Renal Physiol.2001,280 (1): F10-8.

[00062] in some embodiments of the present invention, the SGLT1 level is determined.SGLT1 has high glucose avidity, the Na of report ⁺/ glucose binding ratio is 2: 1.It is reported that SGLT1 expresses in several intestinal tumor clones and former lung cancer.Bissonette et al.，1996，Am.J.Physiol.，270：G833-G843；Delezay et al.，1995，J Cell Playsiol.163：120-128；Ishikawa et al.，2001，Jpn.J CancerRes.92：874-79。

[00063] in some embodiments of the present invention, the level of SGLT2 is determined.Be reported that SGLT2 is the translocator of low-affinity, heavy body, the Na of report ⁺/ glucose binding ratio is 1: 1.

[00064] in some embodiments of the present invention, the level of SGLT3 is determined.Be reported that SGLT3 (title originally is SAAT1) mediation chemotherapeutics β-D-glucoside isophosphoramide mustard (glucosyllisophosphoramide mustard) (D-19575) transports and enter tumour cell.Vehyl et al.，1998，Proc.Natl.Acad.Sci.USA，95：2914-19。Recently, existing people proposes, and SGLT3 is not Na ⁺/ glucose the albumen that cotransports, but (the Diez-Sampedro et al. of the glucose sensor in the cytoplasmic membrane of cholinergic neuron, skeletal muscle and other tissue, 2003, " A glucose sensor hiding in a family oftransporters " Proc.Natl.Acad.Sci.USA 100:11753-8).Therefore, in some embodiments of the present invention, the determined glucose transporter of level is not SGLT3, does not perhaps comprise SGLT3.

[00065] in one embodiment of the invention, the level of SGLT4 is determined.

[00066] in one embodiment of the invention, the level of SGLT5 is determined.

[00067] in one embodiment of the invention, the level of SGLT6 is determined.

Be apparent that [00068] level of other glucose transporter except that the translocator of describing in the table 1 can be determined in practice of the present invention.For example, the derivative of any one in the glucose transporter of enumerating in the table 1, isoform, varient, mutant and homologue are included in the homologue in other Mammals, can be determined, and perhaps their level or activity are determined.Further, method of the present invention is applicable to the found glucose transporter of possibility in the future, for example having the constitutional features of known translocator or the translocator of sequence signature (comprises, for example, with table 1 in the amino acid sequence similarity of the glucose transporter enumerated be at least 28%, at least 30%, at least 50%, at least 60%, at least 80%, at least 90% glucose transporter).

4. determine the susceptibility of cancer to the anti-tumor agents treatment

[00069] on the one hand, method of the present invention relates to, the level of glucose transporter in mensuration patient's the cancer sample.This level is compared with reference point (reference value), whether responsive to the anti-tumor agents treatment to determine this cancer owing to express high-caliber one or more translocators.As following more detailed explanation, at different aspect of the present invention, the level of single translocator is determined in the cancer sample, the level of multiple different translocator is measured (promptly independently in the cancer sample, level for each translocator, different values is determined), and/or (for example measure in the cancer sample two kinds or more kinds of different translocator with the measuring method of associating, by using the analysis of identification, perhaps by using the analysis of a plurality of probes) more than a kind of probe of translocator.

[00070] as applied here, word " level (level) " is meant that any of number that can reflect glucose transporter in the cancer sample measures, in different embodiments, it can be quantitative, semiquantitative or relative (for example, only be confirmed as " more than " or " being less than " another level of measuring similarly).This number can infer from various differences are measured.For example, this number can be from the content of glucose transporter, the abundance of messenger RNA(mRNA), and perhaps the glucose transporter activity from sample is inferred out.The many analytical procedures that can use in the present invention are described below, and for the implementer, after the disclosure instructs, other analytical procedure will be obvious.

[00071] in some embodiments, the measured value with glucose transporter in the sample is standardized as each cell, every gram tissue, every mm ³Amount (perhaps number) in tissue or the similar standard.As known in the art, also can be by with reference to second kind of proteic abundance in sample, with the translocator level standardization in the cancer sample, the water-glass of translocator is shown translocator and second kind of proteic quantity ratio.The advantage of this method is, by select a kind of under different condition the albumen with relative constant horizontal expression, can make material in generally inhibition, apoptosis or the analytic process of protein synthesis lose the influence that is caused and minimize.Suitable " second kind of albumen " includes but not limited to that structural protein are as Actin muscle, tubulin and glyceraldehyde-3-phosphate dehydrogenase.When the translocator rna level is determined, can use comparative standardization (for example, by translocator rna level and ribosome-RNA(rRNA) or the proteic mRNA of coding structure are compared).In one aspect, the G-6-Pase activity in the tumour is also determined, and the glucose transporter water-glass is shown translocator (albumen, RNA or activity) and G-6-Pase (G6Pase) albumen, RNA or active ratio.High ratio prompting is to the susceptibility increase of anti-tumor agents treatment.Glucose and some glucalogues by phosphorylation, cause accumulation after entering cell, and under the situation of some analogue, because the accumulation of phosphorylation form in the cell has caused the toxicity that increases.To the expression analysis of G-6-Pase and activation analysis be known (referring to, for example, Schmoll et al., 2001, Cancer Letters, 167:85-90; Taketa et al., 1998, Cancer Res.48:467-74).In some embodiments, the glucose transporter level is determined to the ratio of G-6-Pase level.Ratio is high more, and patient's cancer is responsive more to the treatment of the anti-tumor agents that contains glucose or glucalogue.

[00072] in another embodiment, the translocator level in the cancer sample is represented as, the ratio of the translocator level in the nonneoplastic tissue of translocator level in the cancer sample and same patient's coupling." nonneoplastic tissue of coupling (matching non-tumor tissue) " is meant the sample of non-cancer tissue, preferably, the non-tumor sample of coupling or non-pernicious sample source in, with tumor sample come the identical organ of source organ.Most preferably, the non-tumor sample of coupling derives from, the organ-tissue layer identical with the source of tumor sample.And, preferably, tumor sample is being carried out the bioptic while, obtain the nonneoplastic tissue sample of coupling.For example, when obtaining tissue from pancreatic neoplasm when being used for purposes of the present invention, the implementer also can obtain nonmalignant pancreatic tissue from the position away from tumour.Then, measure the glucose transporter level in each sample, if the level in the mensuration horizontal exceeding normal specimens in the tumor sample determines that then treatment is responsive to this tumour to the glucose transporter anticancer agent.

[00073] in a kind of relevant embodiment, the translocator water-glass in the cancer sample is shown, the translocator level of the cancer in the cancer sample (vicious transformation) cell with from the non-cancer cells of same sample the transhipment protein level ratio.This ratio can be measured easily, because (for example work as from object acquisition cancer sample, by examination of living tissue) time, this sample also comprises non-cancer cells usually, non-cancer cells can perhaps be identified by the disappearance that detects the cancer specific molecular marked compound by observing or the application organizes method.

[00074] although the translocator level the most normally is determined in the single cancer sample (with optional single non-cancer sample) from object; But in some embodiments, several parts of biological samples of this cancerous tissue and/or healthy tissues can obtain from single object, so that obtain the mean value at this object.

4.1. reference point

[00075] expression level and the reference point with glucose transporter in the cancer sample compares, to determine the relative sensitivity to the anti-tumor agents treatment.For specific translocator, will be understood that for different cancers, being used for determining can be different to the reference point of the susceptibility of treatment.The reference point of can variety of methods determining concrete translocator.

[00076] In one embodiment of the present invention, a kind of reference point of cancer types is to be determined by the translocator level of estimating in the cancer sample (a plurality of level), described cancer sample is called as " survey group (survey population) " herein from many different patients.Normally, patient among the survey group and cancer sample come source object, all suffer from the cancer of same type.For example, in one embodiment, analyze from 10,50,100,200,500 or 1000 or the GLUT2 level of more a plurality of patients' carcinoma of the pancreas sample." type (type) " classification of cancer is in the skill that the practitioner grasps and in the judgement scope.Normally, cancer " type " is based on the tissue (for example, carcinoma of the pancreas, mammary cancer) of origin, but also can be based on the existence and the similar factor of stage, transfer, degree of oxygen deficiency, prognostic marker.Another parameter that is used for cancer is classified by type is, certain anticancer agent or certain kind anti-cancer drugs agent (comprising some anti-tumor agents or certain species specific anti-tumor agents) be the shown effect that goes out in the patient who suffers from this cancer " type ".Such as in the literary composition application, " effect (effect) " comprises the survival time length that reaction (or lacking reaction) to anticancer agent (various medicaments) treatment, the patient who is treated increase, and similar effect.Except being matched with cancer types, also can for example sex, age and race and other standard be matched with survey group and object according to patient characteristic.

[00077] survey group's translocator level (that is, being called as " investigation value (survey values) " herein) will form a kind of distribution, and it can be unimodal, bimodal or multimodal.In one embodiment of the present invention, use this and distribute to determine suitable reference point, as previously discussed, the cancer that the expression level of translocator is higher than reference point is accredited as, and is responsive to the anti-tumor agents treatment.Reference point can be single cutoff (cut-off value), median or average that for example investigation value distributes, and wherein, the patient's sample survey that the translocator value is higher than average or median is, and is responsive to the anti-tumor agents treatment.In a kind of relevant embodiment, reference point is the percentile that the investigation value distributes, as 60 ^ThPercentile, 75 ^ThPercentile, 90 ^ThPercentile and similar numerical value.Perhaps, reference point is a scope, for example, the distribution of investigation value is divided into equal (perhaps not waiting) part, as quadrant, each quadrant and the sensitivity levels for the treatment of is associated (for example, minimum quadrant is associated to minimum susceptibility, and the highest quadrant is associated to the highest susceptibility).The distribution of investigation value in some cases, is bimodal (having a low scope and a high scope).Under such situation, the cancer sample survey that will have glucose transporter level in higher range or that be higher than higher range is to originate from the responsive cancer of anti-tumor agents treatment.The distribution of investigation value in some cases, is multimodal (has a low scope and more than one higher range).In this case, with the cancer sample of glucose transporter level greater than low scope, preferably, the cancer sample survey in will be in the higher range higher again scope is to originate from the responsive cancer of anti-tumor agents treatment.

[00078] in some cases, reference point can be zero or approaching zero, for example work as a kind of cancer types (for the purpose of discussing, the cancer that is called " tissue x " herein) comprises some tumours of not expressing specified a kind of glucose transporter or multiple translocator, when comprising other tumour of expressing this translocator or multiple translocator again.In this case, any of translocator (multiple translocator) can detected expression be enough to prompting, and the patient is the candidate of anti-tumor agents treatment.

[00079] will be understood that, as long as the unit of investigation value (and reference point) be used for being illustrated in the cancer sample transport the unit of protein level identical or similar (perhaps, investigation value and cancer sample levels can be compared), the concrete grammar of describing the translocator level so just is not strict the qualification, and it will depend on the character of cancer, the analytical procedure of application and implementer's preferential selection.

[00080] in another embodiment, the survey group by the object of not suffering from cancer (for example is, healthy individuality) forms, and for a kind of cancer types, reference point is transported protein level (a plurality of level) in normal (non-pernicious) sample and is determined by estimating, described sample is from the coupling tissue that is not diagnosed as the object (for example, health objects) of suffering from cancer, and the described object of suffering from cancer that is not diagnosed as constitutes " survey group ".Since normal specimens from tumor sample come the identical organ of source organ, preferably, from identical organized layer, so normal specimens can be matched with cancer types.Reference point is the value greater than the median or the mean number of normal value, preferably, is 75% the big value of value than normal specimens, usually is 90% the big value of value than normal specimens, sometimes than 95% big or even than 99% big.

[00081] therefore, can use ordinary method and determine reference point, for example, collect cancer sample (perhaps normal specimens) and measure the translocator level.After guidance of the present disclosure, be used to estimate tumour the concrete threshold level of treatment susceptibility determined that the selection of OK range, patient's type, cancer types and similar factor is in the skill of medical personnel.To be understood that, make so really regularly, the statistical method that the practitioner can application standard.Referring to, for example, the Principles of Biostatistics (BrookCole of Marcello Pagano etc.; 2000); The Fundamentals of Biostatistics of Bernard Rosner (Duxbury Press, 5th Ed, 1999); Biostatistics:a Foundation for Analysis in the HealthScience (the John Wiley ﹠amp of Wayne W.Daniels; Sons, 3rd Ed.; 1983); And the ClinicalEpidemiology and Biostatistics of Knapp and Miller (PA 1992 for William and Wilkins, Harual Publishing Co.Malvern).

[00082], can determine the translocator level of single translocator as following more detailed discussion.Optionally, can determine the level (for example, simultaneously and/or amount to, and not distinguishing the level of each translocator) of several different translocators.In a kind of different embodiment, transport compound (for example specified anti-tumor agents or compound at cell, described compound should be transported by the identical translocator of the translocator that transports described appointment anti-tumor agents) ability, all translocators in the sample are analyzed.

4.2. analyze

[00083] method of measuring glucose transporter level in the biological sample is well known in the art, and only is practitioner for purposes of illustration and for convenience, has further described such analysis herein.Suitable method comprises, for example, and to the analysis of protein of translocator, to the analysis of translocator RNA, and to the active analysis of translocator.

[00084] analytical procedure has been described below and in an embodiment.As there be not other indicating, what analytical procedure was used is traditional Protocols in Molecular Biology (comprising recombinant technology), microbiological technique, cytobiology technology, Measurement for Biochemistry, nucleic acid chemistry technology and immunological technique, and all technology are all within the skill of those of ordinary skill.Such technology is fully explained in the literature, for example, MOLECULAR CLONING:A LABORATORY MANUAL, second edition (Sambrook et al., 1989) and MOLECULARCLONING:A LABORATORY MANUAL, the third edition (Sambrook and Russel, 2001) (two parts of documents quoting previously are collectively referred to as " Sambrook " at this); CURRENT PROTOCOLS INMOLECULAR BIOLOGY (F.M.Ausubel et al., eds., 1987, comprise supplementary issue and the revised edition of 2003 whole years); PCR:THE POLYMERASE CHAIN REACTION (Mullis et al., eds., 1994); Harlow and Lane, 1988, ANTIBODIES, A LABORATORY MANUAL, Cold SpringHarbor Publications, New York and Harlow and Lane, 1999, USING ANTIBODIES:ALABORATORY MANUAL Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (being collectively referred to as " Harlow and Lane " herein), METHODS IN CELL BIOLOGY VOLUME37:ANTIBODIES IN CELL BIOLOGY, Asai, ed.Academic Press, Inc.New York (1993); BASIC AND CLINICAL IMMUNOLOGY 7th Edition, Stites ﹠amp; Terr, eds. (1991); Hames et al., ed., NUCLEIC ACID HYBRIDIZATION, A PRACTICALAPPROACH IRL Press, (1985); With Beaucage et al., eds., CURRENT PROTOCOLS INNUCLEIC ACID CHEMISTRY, 2000, John Wiley ﹠amp; Sons, Inc., New York).

[00085] considers herein disclosure, at given patient, it is in practitioner's technical scope that specific analytical method is selected, it depends on many factors, comprise cancer type and stage, whether carried out the utilizability of surgical blanking, cancer sample, and the type of sample, the type of sample can be, for example, tissue sample or tissue extract or cell or cell lysate or cell extract or from the supernatant liquor of above-mentioned sample type, whether the convenience and the reagent that also depend on the implementer can obtain and spend.

4.2.1 biological sample

[00086] by from the object acquisition biological sample and detect the albumen, mRNA, translocator activity of glucose transporter and the existence or the content of other mark that translocator is expressed, can determine the glucose transporter level in the cancer sample or in the non-cancer tissue.For convenience's sake, term " cancer sample (cancersample) " is used to represent the determined material of glucose transporter wherein (or cell or cell-derived).Normally, the cancer sample source is in the people.Use the currently known methods in this area, can be determined at the translocator level in the supernatant liquor of the supernatant liquor of cell lysate before tissue sample, tissue extract, cell, cell lysate, cell extract, body fluid, the tumour or knurl lysate.

[00087] can obtain the cancer sample from any cancer, and method of the present invention is applicable to any cancer, and described cancer includes but not limited to leukemia, mammary cancer, skin carcinoma, osteocarcinoma, prostate cancer, liver cancer, lung cancer, the cancer of the brain, laryngocarcinoma, carcinoma of gallbladder, the rectum cancer, parathyroid carcinoma, thyroid carcinoma, adrenal carcinoma, nervous tissue cancer, incidence cancer, colorectal carcinoma, cancer of the stomach, bronchogenic carcinoma and kidney; Rodent cancer, ulcer type squamous cell carcinoma and nipple type squamous cell carcinoma, the transitivity skin carcinoma, osteosarcoma, Ewing sarcoma (Ewing ' s sarcoma), reticulum cell sarcoma, myelomatosis, giant cell tumor, small cell lung tumor, islet-cell carcinoma, primary brain tumors, acute and chronic lymphocytic knurl and granulocyte knurl, the hair cell knurl, adenoma, hyperplasia, medullary carcinoma, pheochromocytoma, mucosal neuroma, enteric ganglia glucagonoma (intestinal ganglloneuromas), hyperplasia corneal nerve knurl, class horse Fa Shi syndrome tumour (marfanoid habitus tumor), the nephroblastoma, spermocytoma, ovarian tumor, smooth muscle tumor (leiomyomater tumor), cervical dysplasia and carcinoma in situ, neuroblastoma, retinoblastoma, soft tissue sarcoma, carcinoid malignant, local skin is sick to be decreased, mycosis fungoides, rhabdosarcoma, Kaposi sarcoma, osteogenic sarcoma and other sarcoma, malignant hypercalcemia, renal cell carcinoma, polycythemia vera, gland cancer, glioblastoma multiforme, leukemia, lymphoma, malignant melanoma and epidermal carcinoma.

[00088] method of obtaining tissue sample is well known in the art, and will be according to tumor type and location and doctor's preference and different.In one embodiment, sample is to obtain from the tissue of excision.Tissue sample and cell sample also can obtain without invasive surgical, for example, by inserting the wall of the chest or stomach wall with fine needle or insert from breast piece, Tiroidina piece or other site, and extract cellular material (fine needle aspiration biopsy) out.

[00089] in another embodiment, biological sample is the body fluid that possible contain cancer cells, it can be, for example, blood, mammary gland transudate (for example, nipple aspirated liquid), ight soil suspension, phlegm, mucus, urine, lymph liquid, cytosol, ascites, pleura transudate, amniotic fluid or bladder scavenging solution.

[00090] biological sample of Huo Deing can be used with fresh, refrigerated or immobilized (for example, paraffin embedding) form, and this depends on the character of sample, the analysis of use and implementer's facility.Analyze and analysis of protein although fresh material, frozen material and immobilization material all are suitable for various RNA, normally, flesh tissue will be preferred for active determination in vitro.

[00091] tissue sample that also can be applying immobilized.Be fixed by usually organizing of obtaining of biopsy, normally by application examples as, formalin, formaldehyde or glutaraldehyde are perhaps by the alcohol submergence.Usually with immobilized biological sample dehydration and embedding in paraffin or other solid support, as known in the art.Referring to reference Plenat et al., 2001, Ann.Pathol.21:29-47.Embedding, immobilized tissue, and the tissue of immobilization and embedding can be used among the present invention.The solid support that is used for the embedded immobilization tissue can be removed with organic solvent, so that the tissue that is saved rehydration subsequently.

[00092] in some cases, the analysis to the translocator level comprises the step that cell or tissue is cultivated.Cultural method is being known in the art.For example, can use the enzyme (as collagenase and Unidasa) will be from the cell breakdown of biopsy samples, and/or (for example use the physics disruption method, it is repeated by No. 25 pins (25-gauge needel)) dismiss cell, cell is through centrifugal collection, resuspension in required damping fluid or nutrient solution, they can be used to cultivate, analysis at once or further handle.

4.2.2 based on proteic detection

[00093] in one aspect of the invention, determine the level of glucose transporter by measuring translocator albumen itself.Most convenient ground, this be use immunoassay carry out (such as but not limited to, western blotting (Western) analysis, flow cytometry, EIA, ELISA, RIA, competitive immunization analysis, double-antibody sandwich analysis, immunochemistry, immunocytochemistry and immunohistochemical method, co-agulation analy and immunoprecipitation).

[00094] antibody that is used for the immunoassay purposes can obtain at an easy rate.Use conventional method, can prepare and be specific to the proteinic antibody of glucose transporter (equivalent that comprises monoclonal antibody and polyclonal antibody, Fab and F (ab ') 2 fragments, recombinant production).Referring to, for example, Harlow and Lane, supra; Kohlerand Milstein, 1975, Nature 256:495.

[00095] translocator that can application of purified or its part (no matter being from that organize purifying or recombinant expressed) produce antibody.Optionally, can use synthetic peptide or peptide sequence and produce or select interested antibody.Referring to, Huse et al., 1989, Science 246:1275-81; With Ward et al., 1989, Nature 341:544-46.For some analyses, can preferably use and zone, the extracellular of translocator (multiple translocator) bonded antibody, can obtain this specific specificity by epi-position outside the application cell in the production of antibody or chosen process.Similarly, can select to be identified in that () antibody for example, conserved sequence is analyzed multiple translocator simultaneously so that allow more than the epi-position of finding in one the translocator.Table 1 provides translocator and the dna sequence dna of gene and the numbering (accessionnumbers) of protein sequence that is allowed a choice, and it can be used to express or synthetic antigen.

[00096] monoclonal antibody of glucose transporter and polyclonal antibody description to some extent in scientific literature (referring to, Bukhard et al., 2004, Oral Oncology, 40:28-35[resists-SGLT1], Hasper et al., 1988, J.Biol.Chem.263:398-403[has described 13 rabbit anti-serums that amino acid whose peptide is cultivated using corresponding to the C-terminal of GLUT1]; Rogers er al., 2003, Am.J.Physiol.Endocrinol.Metab..282:E733-738[has described the anti-GLUT12 antibody of rabbit polyclonal, R1396, it is specific to 16 C-terminal amino acid of people GLUT12 uniqueness], and can [for example obtain from various wide range of commercial channels, ResearchDiagnostics Inc., Alpha Diagnostics, Inc., East Acres Biologicals, DAKO, Hamburg, Germany, Chemicon International, Inc., Temecula, CA, (referring to table 2).

Table 2

The feature of the exemplary antibody that can obtain through commercial approach

Rabbit resists-SGLT-1 (antigen: synthesize peptide, it is corresponding to the amino acid 402-420 of the extracellular loop of inferring of rabbit intestinal SGLT-1)
	Rabbit resists-GLUT-1[MYH antibody, because it detects the zone, extracellular, therefore it is to have advantage] (antigen: 15 amino acid whose synthetic peptides, it is corresponding to the outside ring (Threonine-tryptophane-l-asparagine-Histidine-arginine-tyrosine-glycine-glutaminic acid-Serine-Isoleucine-proline(Pro)-serine-threonine-Threonine-leucine) of people GLUT-1)
Rabbit is anti--and GLUT-2 (antigen: synthetic peptide (40-55 amino acid), it is corresponding to the spiral 1 of GLUT2 and the endochylema outer shroud between the spiral 2)
	Rabbit resists-GLUT-3 (antigen: 12 amino acid whose synthetic peptides, its C-terminal corresponding to people GLUT-3 (SIEPAKETTTNV))
Rabbit resists-GLUT-4 (antigen: synthetic peptide, its C-end corresponding to mouse Glut-4 (amino acid 498-510))
	Rabbit is anti--GLUT-5 (antigen: 12 amino acid whose synthetic peptides are specific to the C-terminal (ELKELPPVTSEQ) of people GLUT-5 sequence)
Rabbit is anti--and GLUT-8 (antigen: 11 amino acid whose sequences, near the C-end of mouse Glut-8)

[00097] exists the multiple level that can be used for detecting glucose transporter based on proteic method.For example, from sample translocator (for example can be purified, by chromatography or electrophoretic method) or by enrichment (for example, separate by cell grade), and analyze determined by Western, perhaps can use competitive immunization analysis or noncompetitive immunoassay (as ELISA or other sandwich assay), its with or without the purifying or the enrichment of translocator.Further guidance about the methodology and the step of various antibody analysis methods is provided in following document, for example, has authorized the United States Patent (USP) 4,376,110 of Greene; ANTIBODIES:A LABORATORY MANUAL, COLD SPRING HARBORLABORATORY, " the Immunometric Assays Using MonoclonalAntibodies " among the CHAP.14 (1988); The HANDBOOK OFEXPERIMENTAL IMMUNOLOGY (D.M.Weir that Blackwell Scientific Publications published in 1986, ed.), in the 1st volume the 26th chapter, " the Radioimmunoassay and Related Methods " that Bolton and Hunter showed; The HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (D.M.Weir that Blackwell ScientificPublications published in 1986, ed.), in the 1st volume the 27th chapter, Nakamura etc. " Enzyme Immunoassays:Heterogeneous and Homogenous Systems " that the people showed; And Coligan, supra.

[00098] for example, Western blot (immunoblotting) is analyzed the translocator can be used to detect and quantitatively to exist in the sample.Western blot is useful for tissue sample that detects homogeneity and the glucose transporter in the humoral sample.Western blotting technique is used for determining the protein level of sample in the art routinely.Referring to, Sambrook, supra.Normally, use stain remover such as Triton-100, sample is homogenized and lysing cell.Then,, be transferred on the suitable solid support (as nitrocellulose filter, nylon membrane or deutero-nylon membrane) by the gel electrophoresis separate substance, and with the proteic antibody incubation of binding transport specifically.These antibody can perhaps selectively, can be used the traget antibody that is incorporated into anti-translocator antibody specifically and be detected (for example, the sheep anti-mouse antibody of mark) subsequently by direct mark.

[00099] in another approach, use immunohistology method or immunocytology method, analyze the level of glucose transporter.The tissue sample preparation method be well known in the art (referring to, for example, Harlow supra), and describes in an embodiment to some extent.Typically, the tissue that obtains from examination of living tissue is immobilized, embedding in paraffin or other solid support, perhaps not embedding and placing it on the solid support.Also can use freezing microtome section.Referring to Plenat et al., 2001, Ann.Pathol.21 (1): 29-47.Before immunostaining, therebetween or afterwards, can further handle tissue slice; For example, the epi-position restorative procedure, for example can be in citrate buffer the heat tissue sample.Referring to, for example, Leong et al., 1996, Appl.Immunohistochem.4:201.After optional sealing step, under appropriate condition, tissue slice is exposed to one anti-(those antibody as described above, preferably those and extracellular epi-position bonded antibody), long enough, so that the glucose transporter combination in the anti-and tissue sample.Can be identified for obtaining such result's conditions suitable by the experimental technique of routine.Antibody and sample bonded degree can be analyzed directly or indirectly.For example, in one embodiment, one is anti-or two anti-by fluorescent mark, uses immunofluorescence microscopy and detect in conjunction with situation.

[000100] in another approach, allow anti-glucose transporter antibody directly with cell (for example, expressing the cell of translocator) combination, and direct (for example, one of application fluorescence labels or enzyme labelling resists) or indirect (for example, using two of mark resists) mensuration antibody.The example of this binding analysis be flow cytometry such as fluorescent activation cell analysis (referring to, for example, Salih et al., 2000, J.Immunology 165:2903-10).Before FASC analyzes, can neoplasmic tissue sample be separated and leave.Particularly, shred with tumor resection and in damping fluid.Come isolated cell by adding enzyme (for example collagenase and Unidasa), obtain the tumour cell suspension.Then, in cleaning buffer solution, clean cell, and make it for several times by No. 25 pins.After centrifugal, cell is resuspended in the buffered soln.In one embodiment, flow cytometry is the result be shown as, and cell number is to staining power (for example, the translocator number), and with respect to distribution situation in the sample of the distribution situation among the survey group.

[000101] can use any appropriate method that adapts with analytical procedure, the expression of glucose transporter is carried out quantitatively.For example, for western blot analysis, can scan the density of band and in addition quantitative.For the immunohistochemical analysis of tumor biopsy, can the examination of living tissue section be marked according to the painted intensity of glucose transporter, for example, be meant dye-free in 0 minute, be meant slight dyeing in 1 minute, be meant moderate dyeing in 2 minutes, be meant that severe dyeed in 3 minutes.In some embodiments, dyeing of differentiation film and tenuigenin dyeing are possible.In those embodiments, can mark to film dyeing.For quantitative methods, also referring to, for example, Raleigh et al., 2001, " Semiquantitative immunohistochemical analysis forhypoxia in human tumors " Int.J.Radiat.Oncol.Biol.Phys., 2001 Feb 1,49 (2): 569-74 and Hatanaka et al., 2001, " Quantitative immunohistochemical evaluation of HER2/neuexpression with HercepTest ^TMIn breast carcinoma by image analysis " Pathol.Int.51:33-6.

[000102] as discussed above, in some embodiments, also measuring with reference to proteic level, is geostationary with reference to albumen for cancerous state.Suitable comprises Actin muscle, tubulin and glyceraldehyde-3-phosphate dehydrogenase with reference to albumen.Application is during with reference to albumen, and the glucose transporter level can be with respect to reference albumen by " stdn ", and this is by realizing divided by reference albumen with glucose transporter.As described herein, the ratio that obtains is compared with predetermined ratio.

4.2.3 detection based on RNA

[000103] in another embodiment, the level of glucose transporter is determined by measuring translocator mRNA level.Analysis to one or more glucose transporter messenger rna levels in the sample comprises: Northern analyzes; polymerase chain reaction (PCR) comprises quantitative PCR, ligase chain reaction (LCR) (LCR); RNase protects analysis; in situ hybridization; serial analysis of gene expression (SAGE); difference shows that (DD) analyzes; RNA random primer (RAP)-PCR; the restriction endonuclease analysis of differential expression sequence (READS); amplification restriction fragment length polypeptide (AFLP); total gene expression analysis (TOGA); the application [StaRT-(PCR)] of internal standard competitive template primer (CTs) in quantitative multiplex RT-PCR method; High Density cDNA filter hybridization (HDFCA) is analyzed; inhibition subtractive hybridization (SSH); differential screening (DS); High Density cDNA array or oligonucleotide arrays.For summary, referring to Ahmed, 2002, " Moleculartechniques for studying gene expression in carcinogenesis " J.Environ.Sci.Health PartC Environ.Carcinog.Ecotoxicol.Rev.20:77-116.Also referring to Lipshutz et al.Nat.Genet.1999,21:20-4; United States Patent (USP) 5,445,934; 5,578,832; 5,556,752 and 5,510,270; Schena et al., 1995, Science 270:467-70 (High Density cDNA array); Lynn et al., 1983, Proc.Natl.Acad.Sci.80:2656; Zinn et al., 1983, Cell 34:865; With Sambrook and Ausubel, supra (rnase protection analysis).

[000104] be used for from the tissue isolation of RNA method be known (referring to, for example, Ausubel, supra; Rapley et al., " RNA Isolation and Characterization Protocols " 1998.Humana Press, Inc.Totowa, New Jersey; Farrell et al., " RNA Methodologies " 1993.Academic Press, Inc.San Diego, California).Also can from immobilized and/or paraffin-embedded tissue slice, isolate the RNA that is used to increase.Referring to Stanta et al., " RNA Extracted from Paraffin-Embedded HumanTissues is Amenable to Analysis by PCR Amplification " Bio Techniques 11 (3): 304-308.1991; Finke et al., " An Improved Strategy and a Useful Housekeeping Gene for RNAAnalysis from Formalin-Fixed, " Bio Techniques 14 (3): 448-453.1993 for Paraffin-Embedded Tissues by PCR; De Andres et al., " Improved Method for mRNA Extraction fromParaffin-Embedded Tissues.BioTechniques 18 (1): 42-43.1995 "; Rupp et al., " Purification and Analysis of RNA from Paraffin-Embedded Tissues " .BioTechniques6 (1): 56-60.1988; Sorg et al., " Detection of Borna Disease Virus RNA inFormalin-Fixed, Paraffin-embedded Brain Tissues by Nested PCR " .Journal of ClinicalMicrobiology 33 (4): 821-823.1995; Werner et al., " Effect of formalin tissue fixationand processing on immunohistochemisty " American Journal of Surgical Pathology 24 (7): 1016-1019.2000.Also referring to United States Patent (USP) 6,602,670 and the publication in its specification sheets and " references cited ", quoted.

[000105] for purposes of illustration, in one embodiment, use quantitative PCR, measure the level of glucose transporter.Quantitative PCR is meant the quantitatively method of cDNA, and cDNA is the reverse transcription from the mRNA in the cell that comes from tissue sample.Can carry out reverse transcription to the mRNA in the cell that comes from tissue sample by the currently known methods in this area, this for example comprises, Sambrook, supra and Ausubel, the method among the supra.Quantitative PCR can carry out like this, for example comes cloning RNA according to the PCR method of standard, and wherein applied primer is modified so that can catch the product that obtains on solid surface.For example, can be respectively with 5 ' primer or 3 ' primer at 5 ' terminal or 3 ' terminal biotinylation, so that can on the micro-reaction plate of avidin bag quilt, catch the product that obtains.Then, to carrying out attached to the product on the solid surface quantitatively, for example, by be attached with can quantitative mark oligonucleotide probe hybridization implement." can quantitative mark " can be, for example, and radioactive atom or radioactivity group.Then, by the level of the radioactivity in the working sample, estimate translocator mRNA expression levels.Optionally, " but quantitative mark " is group or part (moiety) digoxin for example.In this embodiment, by adding 1) with alkaline phosphatase link coupled anti digoxin antibody and 2) chromogenic substrate of alkaline phosphatase, carry out the absorbancy analysis afterwards, come the quantitative PCR product.Can be randomly, can be according to the cDNA typical curve with result standardization.

[000106] also can use and be called as the whole bag of tricks of " amplification in real time " method or " real-time quantitative PCR ", determine the amount of the glucose transporter mRNA that exists in the sample.Such method relates to, the amount of the amplified production that forms at the period detecting of amplification procedure.Produce the analysis of fluorescence nuclease and be and to be used to detect and the quantitative methodological object lesson of real-time quantitative of glucose transporter transcripton.In a word, this type of analytical procedure is used the product fluorescence oligonucleotide probe of double-tagging, continues to measure PCR product semi-invariant, and such method is called " TaqMan " method in the literature usually simply.Short typically (approximately 20-25 base) polynucleotide of probe that are used for such analysis are with two kinds of different fluorochrome labels.Although dyestuff also can be attached to other position on the probe, 5 ' end of probe typically is attached reporting dyes (reporter dye), and 3 ' end adheres to quencher dyes (quenching dye).In order to measure the glucose transporter transcripton, with probe design be, have with the glucose transporter transcripton on the most of at least sequence of probe binding site complementary.Also be added into reaction mixture with the regional bonded PCR upstream primer and the downstream primer of glucose transporter encoding sequence both sides, to be used to the glucose transporter polynucleotide that increase.When probe is intact, energy takes place between two kinds of fluorophores to be shifted, quencher dyes makes the emission cancellation from reporting dyes.During the primer extension of PCR, probe is by for example 5 ' the nuclease cutting of Taq polysaccharase of nucleic acid polymerase, thereby from polynucleotide-quencher dyes mixture, discharge reporting dyes, this causes the emissive porwer of reporting dyes to increase, and the emissive porwer of reporting dyes can be measured by suitable detection system.

[000107] in one embodiment, application in situ hybridization comes the glucose transporter sequence in the test sample.The in situ hybridization analytical procedure is known, and at Angerer et al., METHODS ENZYMOL.152:649-660 is described in (1987) prevailingly.For example, can be by Ruglowski et al., 2003, in situ hybridization is carried out in the description among the Am.J.Clin.Pathol.120:691-698.Can use paraffin-embedded tissue sample.In brief, with slide glass Proteinase K and the pre-treatment of ethanoyl reagent, and with glucose transporter RNA's ³³The justice of P-mark and antisense cRNA ribose probe incubation.After the incubation, slide glass is cleaned in washings,, clean once more, and dewater with RNase A digestion.After the dehydration, with silver-colored emulsion bag by slide glass and expose certain hour (for example, 8-10 days).Can use method as known in the art, for example, use darkfield microscope, measure the intensity of silver-colored dyestuff.Image that also can check dightization.In-situ hybridization method is also at Harris, and 1996, Anal.Biochem.243:249-256; Singer et al., 1986, Biotechniques 4:230-250; Haase etal., 1984, METHODS IN VIROLOGY, vol.VII, pp.189-226; Be described among the NUCLEIC ACIDHYBRIDIZATION:A PRACTICAL APPROACH (Hames et al., eds., 1987).

[000108] the compatible any method of the method that can use and analyze is carried out quantitatively the expression of glucose transporter.

[000109] based on the nucleotide sequence of glucose transporter, uses conventional method, can easily obtain or prepare for detecting useful probe and the primer of glucose transporter RNA.According to understanding, can easily design the useful primer of detection based on amplification to target sequence (sequence that desire is detected).Analyze for some, specially suitable primer has the T near 60 ℃ _MAs if [this more similarly is a probe length to length between 100bp to 600bp, rather than primer length], and it is that special (this can analyze by the BLAST of GenBank and primer of expection be determined for the zone of desire amplification, application software such as Oligo 6.0 (Molecular Biology Insights, Inc. for example; Http:// www.oligo.net).Preferred primer is crossed over exon montage joint, like this, can be easily the amplification of the genomic dna of the amplification of required RNA/cDNA and pollution be separated.The primer that is known that selection should satisfy, and primer self does not form dimer, does not also form dimer with other primer (if present) of the primer centering that is used to increase.Probe and primer are described in the literature to some extent, referring to, for example, Helmke et al., 2004, Oral Oncology, 40:28-35 (SGLT1, SGLT2); U.S. Patent application 20030228592 (GLUT8); Rogers, 2003, CancerLetters 193:225-33 (GLUT12, GLUT4); Brukhard et al., 2004, Oral Oncology 40:28-35 (SGLT1 and SGLT2) and Auguatin et al., Jan 22,2004, J Biol.C ' hem. (GLUT9).Many other primer and probes have been described in scientific literature.Other primer and probe are presented in the table 3, and this is the purpose unrestricted for explanation.The probe that can prepare other with ordinary method for example, can go out them with the primer amplification of enumerating in the table 3.

Table 3

Gene	The primer title	Primer sequence	Primer length (bp)	Tm (℃)	CG ％	Product length (bp)
							GLUT1	F_1_(1231- ＞1252)	TGACCATCGCGCTAGCACTGC	21	61.7	61.9	759

GLUT1	R_2_(1969 ＜＝1990)	TCCACCCTCAGGCATGGAACC	21	61.2	61.9
GLUT1	F_4_(1341- ＞1362)	TGGTTCATCGTGGCTGAACTC	21	57	52.4	1017
							GLUT1	R_1_(2337 ＜＝2358)	TGAGTTTGCAGGCTCCCACAG	21	59.5	57.1
							GLUT1	F_2_(1192- ＞1213)	TCATAGGCCTCGCTGGCATGG	21	61.3	61.9	1171
GLUT1	R_3_(2342 ＜＝2363)	AGCAGTGAGTTTGCAGGCTCC	21	59.8	57.1
GLUT2	F_3_(980- ＞1001)	TGTCTGGTGTGCGAGCCATCC	21	61.5	61.9	2295
							GLUT2	R_3_(3254 ＜＝3275)	GATCAGTGCTCCAGTTGGTGG	21	57.9	57.1
							GLUT2	F_2_(1232- ＞1253)	TGATGCTGCATGTGGCTCAGC	21	60.3	57.1	2044
GLUT2	R_1_(3255 ＜＝3276)	TGATCAGTGCTCCAGTTGGTG	21	56.9	52.4
GLUT2	F_3_(980- ＞1001)	TGTCTGGTGTGCGAGCCATCC	21	61.5	61.9	868
							GLUT2	R_2_(1827 ＜＝1848)	ACAGCAGCTTTTGGCCTGTGG	21	60.6	57.1
							GLUT3	F_1_(1451- ＞1472)	AGTGGCCGGCTGCTCCAACTG	21	64.2	66.7	2254
GLUT3	R_3_(3684 ＜＝3705)	AGACGGAGTCTCGCCCTGTGG	21	62.5	66.7
GLUT3	F_4_(1589- ＞1610)	AGTCCCTGAGACCCGTGGCAG	21	62.7	66.7	700
							GLUT3	R_1_(2268 ＜＝2289)	ACAAACCTGCACATTCGGCAC	21	58.6	52.4
							GLUT4	F_2_(762- ＞783)	TGGGCCTCACAGTGCTACCTG	21	60.9	61.9	379
GLUT4	R_2_(1420 ＜＝1441)	AAGTTGCTCGTCCAGTTGGAG	21	57	52.4
GLUT4	F_3_(720- ＞741)	TGGAGTCCCTCCTGGGCACTG	21	62.7	66.7	664
							GLUT4	R_3_(1363 ＜＝1384)	TGGCTGAAGAGCTCGGCCACG	21	63.6	66.7

							GLUT4	F_3_(720- ＞741)	TGGAGTCCCTCCTGGGCACTG	21	62.7	66.7	721
GLUT4	R_2_(1420 ＜＝1441)	AAGTTGCTCGTCCAGTTGGAG	21	57	52.4
GLUT5	F_1_(102- ＞123)	TGCCCTGGCAACCCTGATAGC	21	61.7	61.9	1071
							GLUT5	R_2_(1152 ＜＝1173)	TATGGCATCCAGGACACTGTG	21	56.5	52.4
							GLUT5	F_2_(619- ＞640)	GATGGCTGGCCGATCCTGCTG	21	62.7	66.7	1229
GLUT5	R_1_(1827 ＜＝1848)	AGCCACGTTACCAGGAGCCAC	21	61.3	61.9
GLUT5	F_3_(148- ＞169)	GGGTACAACGTGGCTGCTGTC	21	60.5	61.9	1025
							GLUT5	R_2_(1152 ＜＝1173)	TATGGCATCCAGGACACTGTG	21	56.5	52.4
							GLUT6	F_1_(482- ＞503)	ACAGCTGCCTGCATCCCGGTG	21	64.2	66.7	991
GLUT6	R_7_(1452 ＜＝1473)	TGAACACCAGGCTCACCAAGC	21	59.7	57.1
GLUT6	F_2_(762- ＞783)	TCGATGTCCACTGGGAGTTCG	21	58.3	57.1	980
							GLUT6	R_1_(1721 ＜＝1742)	AGCAGTGCTACCTGTCCCGAG	21	60.5	61.9
							GLUT6	F_3_(266- ＞287)	ACCAAATCCCAGGCATCCTGG	21	59.5	57.1	1485
GLUT6	R_4_(1730 ＜＝1751)	TGGCTGGACAGCAGTGCTACC	21	61.3	61.9
GLUT8	F_1_(956- ＞977)	TCCAGGTGCTGTTCACAGCTG	21	59.4	57.1	775
							GLUT8	R_4_(1710 ＜＝1731)	ACCGCAGGTCTGCAAAGCTCG	21	62	61.9
							GLUT8	F_2_(944- ＞965)	TCGTGGGTGTCATCCAGGTGC	21	61.3	61.9	588
GLUT8	R_5_(1511 ＜＝1532)	AGCTTGGAGTCACAGGCTTGC	21	59.8	57.1
GLUT8	F_1_(956-	TCCAGGTGCTGTTCACAGCTG	21	59.4	57.1	416

	＞977)
							GLUT8	R_3_(1351 ＜＝1372)	TCCATAGGGCCTGAGGACCTC	21	59.7	61.9
							GLUT9	F_2_(3-＞ 24)	TGGCTCTAGGGCTGGCACCAG	21	63.2	66.7	668
GLUT9	R_2_(650 ＜＝671)	AGCCACGGATCTCCTTGGGTG	21	61	61.9
GLUT9	F_1_(422- ＞443)	TCGCCATCGGTGGACTTGTGG	21	61.4	61.9	612
							GLUT9	R_1_(1013 ＜＝1034)	TCACGGTGACCACCTGCCAGC	21	63.8	66.7
							GLUT10	F_1_(1068- ＞1089)	ACTCAGGCCCAAGCTGTCTGG	21	61.3	61.9	1256
GLUT10	R_1_(2303 ＜＝2324)	TGGTTGCATGCGCCTGTAGTC	21	59.9	57.1
GLUT10	F_4_(1642- ＞1663)	ACGGTTCACCCTGAGCTTTGG	21	59.5	57.1	1591
							GLUT10	R_2_(3212 ＜＝3233)	TGGCAAAGCCAGCTCCAGCAC	21	62.7	61.9
							GLUT11	F_1_(701- ＞722)	TCTTTACGGCTCTGGGGATCG	21	58.2	57.1	561
GLUT11	R_4_(1241 ＜＝1262)	AGCAGGTCATCAGGCTGTACC	21	58.6	57.1
GLUT11	F_2_(211- ＞232)	TCCTTACGGCCTCGGACGCAG	21	62.8	66.7	951
							GLUT11	R_3_(1141 ＜＝1162)	AGTCCCGATGATCGCGTACTG	21	58.2	57.1
							GLUT11	F_3_(749- ＞770)	AGCTCCTAGGTGGCCCTCAGG	21	62.4	66.7	657
GLUT11	R_6_(1385 ＜＝1406)	ACAGCTCTGTGGCCAGGATCC	21	61.1	61.9
GLUT11	F_5_(450- ＞471)	TGGAGCACTGCTTGCAGGTCC	21	61.9	61.9	615
							GLUT11	R_7_(1044 ＜＝1065)	TCCATGGCACTGCCCAGAACC	21	61.9	61.9
							GLUT12	F_1_(541- ＞562)	ACGCATTGCCATAGGGGTCTC	21	59.2	57.1	1061
GLUT12	R_2_(1581	TCTCGCTGAGCACCAGCCAGG	21	63.3	66.7

	＜＝1602)
GLUT12	F_4_(1091- ＞1112)	TCCACTGGGGTTGGAGTCGTC	21	60.5	61.9	1384
							GLUT12	R_1_(2454 ＜＝2475)	TGGGCAGTTGTCCACACTGTG	21	59.7	57.1
							GLUT12	F_4_(1091- ＞1112)	TCCACTGGGGTTGGAGTCGTC	21	60.5	61.9	511
GLUT12	R_2_(1581 ＜＝1602)	TCTCGCTGAGCACCAGCCAGG	21	63.3	66.7
SGLT1	F_1_(1083- ＞1104)	AGGTTGGCTGTACCAACATCG	21	57.1	52.4	477
							SGLT1	R_1_(1539 ＜＝1560)	AGTTGCTGGGCTCCATGCAGC	21	62.5	61.9
							SGLT1	F_4_(209- ＞230)	TGGTGGCCGATTGGAGCCTCC	21	63.7	66.7	1143
SGLT1	R_2_(1331 ＜＝1352)	TGCTGACTGCACAATGGGCAC	21	60.5	57.1
SGLT1	F_3_(1122- ＞1143)	TGGAGCTCATGCCCAATGGAC	21	59.6	57.1	964
							SGLT1	R_3_(2065 ＜＝2086)	TCCCTTCAACACCACAGGACG	21	58.9	57.1
							SGLT2	F_2_(175- ＞196)	TGGGCGGCTACTTCCTGGCAG	21	63.5	66.7	909
SGLT2	R_4_(1063 ＜＝1084)	ACACGCGCCTGCACACCTCAG	21	64.2	66.7
SGLT2	F_3_(394- ＞415)	TGCCACAGTACCTGCGCAAGC	21	62.3	61.9	758
							SGLT2	R_1_(1131 ＜＝1152)	ACCGTTGGGCATGAGCTTCAC	21	60	57.1
							SGLT2	F_4_(894- ＞915)	TGCAGCGACCAGGTCATCGTG	21	61.5	61.9	449
SGLT2	R_7_(1322 ＜＝1343)	AGCCAGGCCACCGACACTACC	21	63.2	66.7
SGLT5	F_6_(643- ＞664)	TCGCAGCTTTTGACCAGATCG	21	57.4	52.4	934
							SGLT5	R_7_(1556 ＜＝1577)	TGCTCGTTGGCACGTCGCCAG	21	64.2	66.7

SGLT5	F_1_(843- ＞864)	TGCACCGACCAGGTCATCGTG	21	61.3	61.9	597
							SGLT5	R_1_(1419 ＜＝1440)	ACTCACGCCGATGAGTGCCAC	21	61.5	61.9
							SGLT5	F_2_(739- ＞760)	TGCCACGTACAGACGCCATGC	21	62	61.9	745
SGLT5	R_5_(1463 ＜＝1484)	AGTTGCCCGCTGTTGGAGTCC	21	61.8	61.9

4.2.4. functional analysis

[000110] in one embodiment, by measuring the glucose transporter activity, for example, in external or body,, determine the level of glucose transporter to the picked-up of glucose or glucalogue.For example, can be with the glucose uptake analysis in external test glucose transporter activity.The glucose uptake analysis in this area be known (referring to, for example, Gnudi et al., 1997, Mol.Endocrinol.11:67-76; Also referring to PCT publication WO03/082301).---in order to illustrate rather than to limit---the glucose uptake analysis is the picked-up of sugar of measuring mark in a kind of situation.As mentioned above, cell obtains by neoplasmic tissue sample is dissociated.Can be randomly, cell is cultivated, and can be randomly, and cell is gone down to posterity to be cultured to be converged, separated subsequently and resuspension.Then, under cytochalasin B (being used for GLUTs) or phlorrhizen (phlorizin) (being used for SGLTs) existence or non-existent condition, radio-labeled (for example, ¹⁴The C-mark or ³The H-mark) glucose or glucalogue (as the 2-deoxyglucose) and cell incubation.Behind the incubation, washed cell is also analyzed its radioactivity.Cytochalasin B suppresses I class and III class glucose transporter, and therefore, the activity of estimating this type of translocator is useful.Phlorrhizen suppresses SGLTs, therefore, is useful to the activity of estimating this type of translocator.

[000111] in some embodiments, measure the level of SGLTs, glucalogue a-methyl D-glucoside (a-MDG) is used.A-MDG can betransported apparent avidity (K in the mode that sodium relies on _0.5) be 0.4 (SGLT1) and 2mM (SGLT2 and SGLT3).In some embodiments, only by a kind of special glucose transporter transportation of or minority, therefore, the picked-up of glucose tracer agent is directly related with the expression level of glucose transporter for glucalogue.For example, report that cervical cancer cell is relevant to the exclusive film overexpression of striding of the increase of glucose uptake and GLUT1.Therefore, in glucose uptake is analyzed, the prompting of the glucose uptake of increase, the expression of GLUT1 increases.

[000112] in some embodiments, glucalogue is by transporting more than a kind of glucose transporter.Therefore, total glucose uptake amount will be relevant with the aggregate level of the glucose transporter of this cell expressing.

[000113] the another kind analysis that is used to estimate the expression level of glucose transporter is, the cytochalasin B binding analysis (referring to, Ogura et al., 1999, J.Endocrinology, 160:443-452; Ozaki et al., 1996, Mech Ageing Dev.88:149-158; And Gorga ﹠amp; Lienhard, 1981, Biochem.20:5108-13).In brief, prepare the film extract from tissue sample or cell sample, and and radio-labeled (as, ³The H-mark) cytochalasin B mixes.When reaction finishes, membrane-bound cytochalasin B is separated (for example, by filtration or centrifugal) with the free cytochalasin B.Calculate the radioactivity of membrane portions.The level of cytochalasin B bonded level and GLUTs is relevant.

[000114] in another embodiment,, determines the level of glucose transporter by measuring glucose uptake in vivo.In this method, between glucose transporter expression and glucose uptake, form related.For example, Kato et al., 2003, Anti-Cancer Res.23:3263-72 has reported in the esophagus squamous cell carcinoma, the accumulation of 18-F-fluorodeoxyglucose is related with the GLUT1 expression.The glucose uptake analysis is well known in the art.Referring to, for example, Reske et al., 1997, J.Nucl.Med., 38:1344-48.Normally, use nonmetabolizable glucalogue,, estimate glucose uptake as 2-fluorodeoxyglucose (2-FDG), 2-deoxyglucose (2-DG) and 3-O-methyl glucoside.The glucose transporter activity can be determined, for example, uses fluorescently-labeled glucalogue, implements by positron emission X line body section radiography.

5. the selection of anti-tumor agents

[000115] some anti-tumor agents is preferably transported by some glucose transporter.For example, the medicine streptozotocin betransported by the GLUT2 translocator and enters pancreatic cancer cell.The method according to this invention, the detection of high-level GLUT2 translocator in the cancerous tissue provides the foundation to streptozotocin treatment sensitivity for predicting this tumour.Normally, the level of specific translocator is high more, and this tumour is to responsive more by the treatment of the anti-tumor agents of this specific translocator transportation.

[000116] therefore, in some embodiments, before the selection anti-tumor agents is treated, determine the amount of glucose transporter.In case find, the glucose transporter level determines then that greater than predetermined amount this cancer is responsive to the treatment of specific anti-tumor agents.The selection of anti-tumor agents can include but not limited to based on many factors, the substrate specificity of statistical analysis or glucose transporter.

[000117] in some embodiments, to be known be to transport certain anti-tumor agents specifically to glucose transporter.The bigger amount of glucose transporter and the association between the susceptibility of this anti-tumor agents formed immediately then.For example, be reported that glucofosfamide, be also referred to as glufosfamide, transport by SGLT1.So, the method according to this invention, the amount of SGLT1 is more than predetermined amount, then prompting, this cancer is responsive to the treatment of glucofosfamide.In another embodiment, known glucose transporter is transported the anti-tumor agents of a certain type.For example, 2 not adorned glucalogues of known GLUT2 transportation.

[000118] in some embodiments, anti-tumor agents is selected in advance, and determines that this medicament is the level of the glucose transporter of its substrate, thereby whether the cancer that the observation patient suffers from is the type responsive to this treatment.If in the cancer sample from the patient, the level of glucose transporter is higher than reference point, then with this anti-tumor agents treatment patient.

[000119] uses methods known in the art (as following description), a kind of medicament can be accredited as a kind of substrate of concrete translocator.Optionally, can be tested and appraised a group patient, prove that medicament is effectively to this colony, and determined which type of translocator is expressed, thereby set up the translocator level and the association between the susceptibility of this medicament.Then, with concrete patient's level or expression with prove this treatment comparing to its effective colony with reference to situation.

[000120] can use various substrate analyses.For example, Sugar intake and the competitive analysis of utilizing primary cell culture or xenopus leavis oocytes to carry out have been used for habitually determining whether glucose transporter transports specific substrate.Referring to, for example, Garcia et al., 2003, J Neurochemistry, 86:709; Burant et al., J.Biol.Chem., 1992,267:14523-6; With Veyhl et al., 1998, Proc.Natl.Acad.Sci.USA95:2914-29.Can prepare just cRNA, describe, and be injected into the ovarian follicle xenopus leavis oocytes as people such as Veyhl from glucose transporter.Cytochalasin B (being used for GLUTs) or phlorrhizen (being used for SGLTs) exist or non-existent condition under, the incubation ovum, contain wherein that desire detects various radiolabeled ( ¹⁴C, ³H etc.) glucose or glucalogue.After the incubation, analyze the radioactivity in the ovum.For SGLTs, can analyze the picked-up of glucose or glucalogue by using two microelectrode voltage clamp technology.

[000121] other analysis and utilization primary cell for example human cancer cell carry out, known its expressed specific glucose transporter.Allow cell grow and to go down to posterity to be cultured to and converge, separate then and resuspension.Then, cytochalasin B (being used for GLUTs) or phlorrhizen (being used for SGLTs) exist or non-existent condition under, with cell and the detection of various desire radiolabeled (for example, ¹⁴C-or ³The H-mark) glucose or glucalogue incubation.After the incubation, washed cell is also analyzed its radioactivity.

[000122] in related fields of the present invention, use the external activity analysis, determine the susceptibility of concrete tumour (perhaps tumor type) to concrete anti-tumor agents.According to this method, will be from the cell of described tumour and the described anti-tumor agents incubation of multiple concentration, the concentration of described anti-tumor agents has comprised the bulk concentration of estimating when this medicament is given human patients.One or more timed intervals (for example, 10 minutes, 30 minutes, 1 hour and 3 hours) afterwards, measure the influence of medicament cell growth and survival ability, and will influence with the contrast that does not add medicament and/or added different anti-tumor agents or the comparing of different anticancer agent.Cell growth with respect to contrast (for example reduces, estimated by measuring cell number or alternative index such as dna content) or the survival ability reduction is (for example, estimated by the apoptosis in the monitoring culture) prompting, this tumour is to this medicament sensitivity.In one embodiment,, screen a series of several (for example, at least 2, at least 3, at least 4, at least 5 or at least 10) different medicaments, can be used for giving most promising candidate's medicament of patient with evaluation according to this method.

6. be used to the measure translocator equipment and the method for level of---comprising multiple translocator---

[000123] this paper has described many methods that are used for the level of definite glucose transporter, and after having considered present disclosure, for those skilled in the relevant art, other method will be conspicuous.In some embodiments of the present invention, only adopt a kind of in the analytical procedure, determine the level of glucose transporter.In other embodiment, unite and adopt two kinds or more kinds of method, determine the level of glucose transporter.For example, the sample that is shown as high glucose transporter expression level in immunohistochemical analysis can be further processed, so that by western blotting (Western blot) analysis protein level is carried out quantitatively, if this information is useful for the implementer.Similarly, can do further to detect, measure the protein level or the mRNA level of glucose transporter the sample that demonstrates high glucose uptake.

[000124] in some embodiments, only measure a kind of expression level of glucose transporter.In other embodiment, measure the expression level of two kinds or more kinds of glucose transporter.To the mensuration of two kinds or more kinds of glucose transporter, can carry out in succession or carry out simultaneously.

[000125] in some embodiments, mensuration is more than a kind of expression of glucose transporter.When this is expressed in same sample in multiple glucose transporter, be significant especially.The implementer can (1) pass through to analyze several translocators, determines that the expression level of which translocator in this tissue is higher than reference point; (2) which translocator to transport the knowledge of which medicine based on, select anti-tumor agents.

[000126] for example, show that multiple glucose transporter comprises that GLUT1, GLUT4, GLUT5, GLUT8, GLUT12 and HMIT all express in adipocyte.Can be by means of the method that allow to detect or measure multiple glucose transporter, and though be in succession or simultaneously, multiple glucose transporter is detected.

[000127] measure method more than a kind of proteic expression level simultaneously, be well known in the art, provided herein further describing only is for illustration purpose.For example, microarray analysis both can be used in to be measured in the protein level, can be used in again and measure in the rna level, comprises the level that is used to measure more than a kind of translocator or RNA.

[000128] method that is used for measuring cell or organizes the level of the multiple RNA that expresses is as known in the art, comprises high-density polynucleotide array or oligonucleotide arrays (Lipshutz et al., Nat.Genet., 1999,21:20-4; United States Patent (USP) 5,445,934; 5,578,832; 5,556,752; With 5,510,270), the High Density cDNA array (referring to, for example, Schena et al., 1995, Science 270:467-7), Dot blot and slot blot (dot and slot blots), dip in rod (dip sticks), pin (pins), chip or pearl (beads).All these technology and equipments are well known in the art, and are the bases of many diagnostic kits that can obtain through commercial channel.By the guidance of present disclosure, these technology can easily be used, to measure the level of glucose transporter.

[000129] in some embodiments, use the expression that protein array is determined glucose transporter (multiple translocator)." protein array " contains different capture agents, and capture agent is fixed on the different positions of solid support, allows to interact independently between each capture agent and other target protein of its branch.Capture agent can be any molecule that optionally is incorporated into target protein, as antibody, recombinant protein and little chemical substance.Protein array can be used for determining the amount of sample specific protein.Referring to, Von Eggeling et al., 2000, BioTechniques 29:1066-70; Haab, Proteomics, 3:2116-22; Wiesner, 2003, J.Lab.Medicine 27:85-91; Kodadek, 2002, Trends Biochem.Sci.27:295-300.

[000130] in some embodiments of the present invention, the only a kind of or a small amount of several level in the mensuration glucose transporter.In some cases, for example, the overexpression of known patient's cancer and specific glucose transporter is associated on certain frequency.For example, be reported that the GLUT1 overexpression is relevant with bladder cancer, mammary cancer, cervical cancer, the rectum cancer, esophagus cancer, cancer of the stomach, head and neck cancer, leiomyosarcoma, ovarian cancer and thyroid carcinoma.Therefore, In one embodiment of the present invention, mensuration is from the GLUT1 level in the cancer sample of object, and described object suffers from bladder cancer, mammary cancer, cervical cancer, the rectum cancer, esophagus cancer, cancer of the stomach, head and neck cancer, leiomyosarcoma, ovarian cancer or thyroid carcinoma.

[000131] is reported that the GLUT2 overexpression is associated with carcinoma of the pancreas or cancer of the stomach.Therefore, in some embodiments of the present invention, measure from the GLUT2 level in the cancer sample of object, described object suffers from carcinoma of the pancreas or cancer of the stomach.In one embodiment, cancer is a carcinoma of the pancreas, and the level of the GLUT2 in the cancer sample is determined, and anticancer agent is selected from streptozotocin, glucofosfamide and gluSNAP compound.

[000132] is reported that the GLUT3 overexpression is associated with the cancer of the brain or lung cancer.Therefore, in one embodiment of the invention, determined from the level of the GLUT3 in the cancer sample of the object of suffering from the cancer of the brain or lung cancer.

[000133] in some embodiments, the association between cancer and the glucose transporter overexpression is unknown.In these embodiments, in determining the patient before the level of selected glucose transporter,, set up the association between glucose transporter and the dissimilar cancer at first by for example making to express the method for collection of illustrative plates.Perhaps, can measure the aggregate level of the translocator in the cancer sample simply, if this aggregate level surpasses reference point, then selected required dosage when using this medicine is used this medicine.

7. test kit and equipment

[000134] on the one hand, the invention provides the test kit and the equipment that are used to screen patient tumors, to determine susceptibility to concrete anti-tumor agents.

[000135] test kit of the present invention comprises the reagent of the expression that is used to estimate one or more glucose transporter genes, as is used to detect or the probe and/or the primer of the glucose transporter gene product that increases.In one embodiment, probe is nucleic acid probe or primer, and it is incorporated into one or more polynucleotide of being transcribed by glucose transporter gene specifically.In one embodiment, test kit contains the antibody that is specific to different human glucose transport proteins one or more (at least 2 kinds, be preferably 3 kinds, usually be 4 kinds, be 5 kinds or more kinds of sometimes) in white.Test kit of the present invention can randomly comprise implementing other useful composition of method of the present invention, as is used for isolated cell or from the equipment of cell protein isolate or nucleic acid.In addition, test kit can contain working curve, be used for predetermined value compare with reference to sample (or albumen or nucleic acid), and/or the reference point form of form (for example, with) as described herein.

[000136] the present invention also provides and has been used for determining human tissue or the level of humoral sample glucose transporter or the test kit of amount.In one embodiment, test kit comprises diagnosis screening reagent and working instructions in the method for the invention thereof.

[000137] the present invention also provides screening method useful device of the present invention.On the one hand, provide the equipment that comprises immobilized probe (multiple probe), described probe is specific to one or more glucose transporter gene products (polynucleotide or albumen).Probe can be in conjunction with the cell of polynucleotide (for example, based on hybridization), polypeptide or express polypeptide.

[000138] in some embodiments, the equipment that will comprise single immobilization probe is used for screening.In one embodiment, use array format, wherein multiple (at least 2 kinds, at least 4 kinds or more usually) different probe is immobilized.Term " array " is employed with its common implication, and means, is fixed in the multiple probe on the matrix each, all has clear and definite location (address) on substrate.According to the character and the purposes of equipment, the number of probe can be different on the array.For example, although usually there are at least 2 kinds or, be used to detect dipping in bar type array (dipstick formatarray) and can having few probe to a kind of glucose transporter more than 2 kinds of different probes.

[000139] various combinations and hybridization form are known, comprise Nucleotide array, cDNA array, dip in rod (dipsticks), pin type (pins), chip (chips) or pearl (beads), Southern trace, Northern trace, Dot blot and slot blot.Therefore, the invention provides the equipment that comprises the glucose transporter gene product probe that is fixed on the solid substrate.Can use various solid supports, it can be made by glass (for example, glass slide), plastics (for example, polypropylene, nylon), polyacrylamide, nitrocellulose or other material.With nucleic acid be, by on sheet glass, printing, as at Schena et al., 1995, Science 270:467-470 attached to lip-deep a kind of method; Shalon et al., 1996, among the Genome Res.6:639-645 describe prevailingly.The another kind of method that is used to make microarray is by making high density oligonucleotide array.Referring to, Fodor et al., 1991, Science 251:767-73; Lockhart et al., 1996, Nature Biotech 14:1675; With U.S. Patent number 5,578,832; 5,556,752 and 5,510,270.

[000140] although it is known containing the array (for example, comprising the array at the segmental probe of genomic essence) of the probe that is useful on glucose transporter, equipment of the present invention focuses on the mensuration glucose transporter.Therefore, in embodiments, the immobilization probe on equipment or array about at least 10%, about at least sometimes 25%, about at least 50% or about at least 75%, specifically in conjunction with (for example, hybridizing to) glucose transporter gene product.In one embodiment, matrix comprises and is less than about 100 kinds of different probes, is less than about 50 kinds of different probes, is less than about 10 kinds of different probes, is less than about 5 kinds of different probes or is less than about 3 kinds of different probes.Such as herein application, if two kinds of probes are not to be incorporated into identical polypeptide or polynucleotide (that is, for example at heterogeneic cDNA probe) specifically, then a kind of probe " is different from " another kind of probe.

[000141] in one embodiment, probe is selected from monoclonal antibody or other special conjugated protein (for example, antibody derivatives or fragment), and it is specifically with glucose transporter or express this proteic cell combination.The probe that is used for polypeptide also can be fixed with array way, for example, adopts the ELISA form of porous plate.

8. embodiment

[000142] chapters and sections of front have described the present invention in detail.The following examples have been set forth each side of the present invention.Whether under each situation, the glucose transporter level that will determine in the cancer sample is compared with reference point, responsive to the treatment of the anti-tumor agents that contains glucose moiety to determine tumour.

Embodiment 1

Western to GLUT2 level in the pancreatic neoplasm analyzes

[000143] present embodiment has been described the glucose transporter analysis based on antibody, and it is used for determining the GLUT2 level from the sample of Pancreas cancer patients.

[000144] human pancreatic island cell cancer or carcinoid tumor cancerous tissue are to obtain from the patient who has experienced the operation that is used for the treatment of carcinoma of the pancreas.In Operation theatre, the tissue that cuts is placed in the container, clearly mark and deliver to pathology department.Carrying out pathology evaluation with the pathological characteristics of estimating tumour and after guaranteeing that this sample contains tumour cell, the part of tumour is placed in the container that performs mark, and on dry ice, deliver to the laboratory, it is kept at-70 ℃ in the laboratory until application.In some cases, use pin suction examination of living tissue and estimate tumour existence and feature.Below be applicable to any kind of sample in steps.

[000145] with freezing samples weighing, and pulverizes, will organize powder to be placed in the pipe of cleaning in organizing in the pulverizer at thermovac on the dry ice.Make and organize powder (50mM Tris-HCl-ethylenediamine tetraacetic acid (EDTA) (EDTA) sodium, 1%Triton X-100,10% glycerine, 10mM Sodium orthomolybdate, 10mM thioglycerin, 10ug/ml Trypsin inhibitor,Trasylol, 10ug/ml leupeptin, 0.5mM phenylmethylsulfonyl fluoride and 10ug/ml pepstatin) in damping fluid to become homogenate, wherein use the polytrone that has suitable probe according to the size of tissue sample.Homogenization carries out at 0-4 ℃, and the burst length is 30 seconds, between each subpulse homogenate is arranged 1 minute cooling time.10,000g is centrifugal 10 minutes of tissue homogenate thing, so that endochylema/film soluble constituent and nuclear components and cell debris are separated.Abandon the precipitation that obtains, pipette supernatant and freezing preservation until detection, supernatant mainly contains plasmosin and embrane-associated protein, comprises GLUT2.

[000146] by mixing 3M Tris-HCl, the 31.56ml ddH of 20ml acrylamide-methylene diacrylamide (30%-0.8%wt/vol), 7.5mlpH8.8 ₂O and 0.6ml 10%SDS make separation gel (10%); With the mixture degasification that obtains 30 minutes.Add TEMED (35 μ l), with mixture degasification 30 minutes once more.Add Ammonium Persulfate 98.5 (APS) (10%, 0.33ml), mixture is poured into the gel device immediately with the syringe of 60cc.1-butanols (1ml) to be preventing drying on the top of separation gel covers, and makes gel polymerisation 1 hour.Perfusion concentrate glue (referring to following) at once before, clean by water, remove the butanols layer.

[000147] concentrates 2M Tris-HCl, the 24ml ddH of glue by 3.75ml acrylamide-methylene diacrylamide (30%-8%wt/vol), 1.875mlpH6.8 ₂O and 0.3ml 10%SDS form; Prepare this gel mixture and degasification 30 minutes.Add TEMED (25: 1) to mixture, and with mixture degasification 30 minutes once more.Adding Ammonium Persulfate 98.5 (APS) (10%, 0.3ml), will concentrate glue and pour into the gel device and correctly put into comb.Make and concentrate glue polymerization 1 hour.Remove comb, in the gel frame, add electrode buffer (25mM Tris, 192mM glycine, 4mM sodium lauryl sulphate, pH8.3).With 5 * sample buffer (2g SDS, 1.0mlTritonX100,3.126ml 2M Tris-HCl, 10.8ml ddH ₂O; Final volume is transferred to 20ml and pH transfers to 6.8,100mg bromjophenol blue, 1.0ml mercaptoethanol and 4ml glycerine) mix the isolating protein sample of desire, obtain 1 * final concentration and lay in gel pore.Molecular weight (MW) mark (BioRad) can be involved in gel (the MW marker of 10 μ l joins 1 * sample buffer of 0.150ml).With the sample lay to gel, under 17mA and 500V condition, room temperature electrophoresis 12-17 hour.

[000148] gel is shifted out from device, and is placed on BioRad and changes in the film instrument, change be full of in the film instrument transfering buffering liquid (20% methyl alcohol, 192mM glycine and 20mM Tris, pH8.3).At 0.36A and 100V, the albumen in the gel is transferred to nitrocellulose filter, 0-4 ℃ was shifted 3 hours, and was accompanied by stirring.Be placed on nitrocellulose filter between the two layers of filter paper and in room temperature preservation, perhaps be used for western blotting (Westernblot) analysis immediately.

[000149] by at room temperature, on vibrator, (10mM Tris, 150mM sodium-chlor are regulated pH to 8.0 at the TBST/5% skimmed milk; Add 0.5% Tween 20 again) in incubation 1 hour, the nonspecific proteins binding site on the sealing nitrocellulose filter.Subsequently, clean film, and resist with one of required extent of dilution (1: 1000 or 1: 2000, in TBST/5% milk) the anti-GLUT2 of adding with TBST.Vibrated gently under the room temperature 1 hour, and carried out antibody-antigenic interaction.Then, clean film 3 times, each 5 minutes, remove unconjugated one and resist with TBST.

[000150] adding two anti-(goat anti-rabbit iggs of immune purifying, it is coupled to peroxidase) on nitrocellulose filter (1: 50,000, in TBST/ milk).At room temperature vibrated gently 40 minutes, and carried out this incubation.Then, clean film 4 times with TBST, each 5 minutes.Then, the stable peroxide solutions of portion to the system of a luminol,3-aminophthalic acid cyclic hydrazide/toughener solution in incubation film 3-5 minute (Pierce), advise as manufacturers.Be wrapped in film in the saran wrap and be placed in the box.In the darkroom, x-ray film is placed on 1-30 kind second on the film.With film development, can see band, and carry out quantitatively.The proteic level standard of GLUT2 in the sample is turned to, the units in the unit weight tumour, and and reference point relatively, whether responsive to determine tumour to the treatment of the anti-tumor agents that contains glucose moiety.

Embodiment 2

Immunohistochemical analysis to GLUT2 protein level in the carcinoma of the pancreas

[000151] in the illustrative methods that is described below, uses following damping fluid and solution: phosphate buffered saline buffer (PBS): 5mM Na ₂HPO ₄, 0.9mM KH ₂PO ₄, 72mM NaCl, 1.6mM KCl, pH7.4; PBS/TritonX100:PBS contains Triton X100, and Dilution ratio is 1: 500; And citrate buffer: 18ml 0.1M citric acid and 82ml 0.1M Trisodium Citrate.

[000152] as described in Example 1, obtain the carcinoma of the pancreas tissue sample.Be cut into the section of 5 μ m, and be placed on the slide glass of silane package quilt.Make the slide glass dried overnight.65 ℃ of heating slide glasss 45 minutes to 1 hour, dewaxing and rehydration then, method are for going into dimethylbenzene 3 times, each 5 minutes, go into 100% alcohol 2 times, each 3 minutes and go into 95% alcohol 2 times, each 2 minutes.The incubation slide glass is 20 minutes in 45ml methyl alcohol and 5ml 30% hydrogen peroxide, seals endogenic peroxidase.With PBS/Triton X-100 rinse slide glass 2 times, each 2 minutes.

[000153] by adding citrate buffer in the Glass Containers that is soaked with slide glass, and microwave superpower heating 15 minutes, the heating of 50% power is 5 minutes then, and 50% power reheat 5 minutes, carries out antigen retrieval.Then, slide glass was cooled to room temperature about 30 minutes, rinse is 2 times in PBS/Triton X-100, each 2 minutes.Add GLUT2 one anti-(with the PBS dilution, each slide glass adds 200 μ l) with suitable Dilution ratio to each slide glass, and in wet box (humidity chamber) 37 ℃ of incubations 1 hour.Wash slide glass 2 times with PBS 5% TritonX-100, each 2 minutes.Anti-impose on the slide glass room temperature 30 minutes with biotinylated two.In PBS 5%Triton X-100, clean slide glass.

[000154] then, the room-temperature applications streptavidin is 30 minutes in wet box, cleans slide glass then in PBS 5%Triton X-100.Add chromophoric group (2.5ml PBS, 1/4 3,3 ' diaminobenzene diamine, four hydrochloric acid (DAB) and 2 0.8% hydrogen peroxide), room temperature incubation slide glass is 10 minutes in wet box.Use ddH ₂O rinse slide glass 5 minutes is used in Gill ' the s phenodin and was redyed 1 minute, cleans until limpid with flowing water.Acid alcohol clarification tenuigenin (dipping 3 times) with 0.25%.Then, under the light and slow current of successive, clean slide glass and in 1% ammoniacal liquor oil blackeite (differentiated) 10 seconds, in flowing water, clean subsequently.Then, with the slide glass dehydration, method is that incubation is 2 times in 95% alcohol, dips 8-10 time at every turn; , dip 8-10 time in 100% alcohol for 2 times at every turn; With in the dimethylbenzene 3 times, dip 10-15 time at every turn; Use Permount and apply cover glass, be used for observation by light microscope.With Kodak Ectochrome speed 100 films is that slide glass is taken a picture, and determines painted level.

Embodiment 3

The immunohistochemical analysis of GLUT1

[000155] present embodiment has been described the immunohistochemistry glucose transporter analysis based on antibody, is useful in this GLUT1 level in determining tumor sample.

[000156] ordinary method in the application of treatment cancer patients process, by surgical discectomy or tumor biopsy, the chorista sample.After separating at once, tissue sample is placed in the container of clear and definite mark and delivers to pathology department.Carrying out after pathological evaluation contains tumour cell with evaluation oncological pathology feature and confirmatory sample, the part of tumour cell is being placed in the good container of mark, be placed on the dry ice, delivering to the laboratory.

[000157] immediately sample is immersed in 10% formalin solution, and is processed as the paraffin-embedded tissue piece according to standard method.Use cryostat and cut at least three serial section from paraffin-embedded fixing organization blocks, every 4 micron thickness, and the paster of will cut into slices wrap at Vectabond on the slide glass of quilt (Vector Laboratories, Burlingame, CA).Allow the slide glass dried overnight, 56 ℃ of heating are 30 minutes again, and then with slide glass dewaxing and rehydration, method is, goes into dimethylbenzene 3 times, and each 5 minutes, go into 100% alcohol 2 times, each 3 minutes, go into 95% alcohol 2 times, each 2 minutes.

[000158] with slide glass incubation 20 minutes in the methyl alcohol that contains 0.3% hydrogen peroxide, the sealing endogenous peroxydase.With PBS (5mM Na ₂HPO ₄, 0.9mM KH ₂PO ₄, 72mM NaCl, 1.6mM KCl, pH7.4) clean slide glass 2 times, each 2 minutes.

[000159] by microwave heating slide glass in the citrate buffer of 10mM pH6.0, repair antigen, heated three circulations 5 minutes.Then, slide glass is cooled to room temperature (22 ℃) about 30 minutes, in PBS, cleans 2 times each 2 minutes then.Be the combination of sealing nonspecific proteins, in 2% the normal sheep serum that slide glass is immersed in, 2% normal sheep serum is dissolved in the PBS solution that contains 1%BSA, room temperature 30 minutes.

[000160] (dilutes with 1: 300 Dilution ratio with the PBS that contains 0.1%BSA, each slide glass adds 200 μ l) add anti-people GLUT1 one anti-(Chemicon International, Inc., Temecula to each slide glass, CA), room temperature incubation 2 hours in wet box.The rabbit polyclonal antibody that this anti-GLUT1 antibody is affinity purification, it uses 15 amino acid whose synthetic peptides corresponding to the outside surface ring of people GLUT-1 sequence to generate.

[000161], can separate nonneoplastic tissue from the healthy part the catch an illness organ or the healthy organ of same patient for negative control.In addition, negative control can comprise, does not use an anti-dyeing, resists dyeing with the alternative anti-glucose transporter antibody of the rabbit igg (20ug/ml) of non-immunity with one of target antigen albumen preadsorption.The positive control of this analysis is observed dyeing in vascular tissue that exists in the tissue slice and the red corpuscle.

[000162] with after a temperature resistance educates, cleans slide glass 2 times with PBS, each 2 minutes.Streptavidin-vitamin H the detection method of peroxidase labelling that can application standard detects one anti-.Use biotinylated two to slide glass and resist room temperature 30 minutes.In PBS, clean slide glass.Then, room-temperature applications streptavidin 30 minutes in wet box.Add chromophoric group (2.5ml PBS, 1/4 3,3 ' diaminobenzene diamine, four hydrochloric acid (DAB) and 2 0.8% hydrogen peroxide), and in the box that wets room temperature incubation slide glass 10 minutes.

[000163] then, at ddH ₂Cleaned slide glass 5 minutes among the O, counterstaining is 1 minute in Gill ' s phenodin, and cleans until limpid in flowing water.Acid alcohol clarification tenuigenin (dipping 3 times) with 0.25%.Then, under the light and slow current of successive the flushing slide glass and in 1% ammoniacal liquor oil blackeite 10 seconds, in flowing water, clean subsequently.

[000164] with the slide glass dehydration, method is that incubation is 2 times in 95% alcohol, dips 8-10 time at every turn; , dip 8-10 time in 100% alcohol for 2 times at every turn; With incubation in the dimethylbenzene 3 times, dip 10-15 time at every turn; Use Permount and apply cover glass, so that carry out observation by light microscope.With Kodak Ectochromespeed 100 films is that slide glass is taken a picture.

[000165] notes semi-quantitative assessment and painted density with the painted cell proportion of film.Can use the KS-300 of computer-aided image analysis system (Zeiss) that is connected in BX60 microscope (Olympus) and KY-F55B (JVC) color video camera, calculate the proportional area that immunoreactive protein occupies.According to painted density and positive rate, coloration result was marked by 0 minute to 4 minutes.Repeat this experiment, calculating mean value.

[000166] depend on the source of tissue sample and reagent, this analytical procedure will need optimum parameter is judged.Can controlled parameter include but not limited to the adhesivity of tissue slice on slide glass, an anti-extent of dilution, the time of educating with a temperature resistance and temperature and educate the strict degree that the back is cleaned with a temperature resistance.

Embodiment 4

The analysis of GLUT8 mRNA level

[000167] present embodiment has been described useful glucose transporter analysis in the GLUT8 mRNA level of determining tumor sample.

[000168] ordinary method in the application of treatment cancer patients process, by surgical discectomy or tumor biopsy, the chorista sample.After separating at once, tissue sample is placed in the container of clear and definite mark and delivers to pathology department.Carrying out after pathological evaluation contains tumour cell with evaluation oncological pathology feature and confirmatory sample, the part of tumour cell is being placed in the good container of mark, on dry ice, delivering to the laboratory.

[000169] homogenate tissue sample in the 4M guanidine thiocyanate.Use Dynabeads mRNA purification kit (Dynal Biotech),, separate Poly (A) RNAs according to manufacturer's recommendation.

[000170] by carrying out denaturing gel electrophoresis containing on 1% sepharose of 1% formaldehyde, separates Poly (A) RNAs of 1-5 μ g.By capillary action, isolating RNA is transferred on the nylon membrane (Hybond N+, Amersham Pharmacia Biotech, Braunschweig, Germany).

[000171] adopt random oligonucleotide guiding method (random oligonucleotide priming), with the Klenow fragment of dna polymerase i and [α- ³²P] dCTP, carry out radio-labeling to GLUT8 cDNA.The ExpressHyb hybridization solution (Clontech Laboratories, Palo Alto, CA) in, in 42 ℃ hybridization nylon membranes.

[000172] subsequently,, clean films 2 times in 55 ℃, film is dried and goes up to expose and spend the night at phosphorus imaging plate (phosphoimager plate) (Fugi Photo Film) with 0.12M NaCl, 0.012M Trisodium Citrate, 0.1%SDS.Repeat this experiment, calculating mean value.

Embodiment 5

The immunohistochemical analysis of GLUT12 protein level

[000173] present embodiment has been described the glucose transporter immunohistochemical analysis based on antibody, is useful in this GLUT12 protein level in determining tumor sample.

[000174] before the step of carrying out antibodies, as described in Example 2, obtains and handles neoplasmic tissue sample.Then, in wet box, with 1: 150 or 1: 300 the 5%FBS/PBS diluent incubation slide glass (each slide glass 200 μ l) of anti-GLUT12 one anti-(R1396), 4 ℃ are spent the night.The anti-GLUT12 antibody of this rabbit polyclonal, R1396, be (the Rogers et al. that cultivates at 16 C-end amino acids of people GLUT12 uniqueness, 2002, " Identification of a novel glucose transporter-like protein-GLUT-12 " Am.J.Physiol.Endocrinol.Metab.282:E733-E738).

[000175] with after a temperature resistance educates, clean slide glass with the PBS that contains 0.1%Tween-20, (USA) incubation is 1 hour for Dako, Carpinteria with the anti-rabbit igg of biotinylation pig then.Streptavidin-vitamin H the detection method of peroxidase labelling that can application standard detects one anti-.With the biotinylated two anti-slide glasss, room temperature 30 minutes of being applied to.In PBS, clean slide glass.Then in wet box,, clean slide glass with PBS again in room-temperature applications streptavidin 30 minutes.(room temperature incubation slide glass is 10 minutes in wet box for 2.5ml PBS, 1/4 3,3 ' diaminobenzene diamine, four hydrochloric acid (DAB) (Sigma, St.Louis is USA) with 2 0.8% hydrogen peroxide) to add chromophoric group.

[000176] then, at ddH ₂Cleaned slide glass 5 minutes among the O, counterstaining is 1 minute in Gill ' s phenodin, and washes until limpid in flowing water.Acid alcohol clarification tenuigenin (dipping 3 times) with 0.25%.Then, under the light and slow current of successive the flushing slide glass and in 1% ammoniacal liquor oil blackeite 10 seconds, in flowing water, clean subsequently.

[000177] with the slide glass dehydration, method is that incubation is 2 times in 95% alcohol, dips 8-10 time at every turn; , dip 8-10 time in 100% alcohol for 2 times at every turn; With in the dimethylbenzene 3 times, dip 10-15 time at every turn; Use Permount and apply cover glass, be used for observation by light microscope.With Kodak Ectochrome speed 100 films is that slide glass is taken a picture.

[000178] notes semi-quantitative assessment and painted density to ratio with the painted cell of film.Be used to estimate those standards that painted standard is based on people's descriptions such as Southby.Application is connected in the KS-300 of computer-aided image analysis system (Zeiss) of BX60 microscope (Olympus) and KY-F55B (JVC) color video camera, can calculate the proportional area that immunoreactive protein occupies.According to painted density and positive rate, coloration result is assigned to mark by 0 to 4.

Embodiment 6

FDG-PET scanning

[000179] as Manda et al.Anti-cancer Res. (2003) 23 (4): described in the 3263-72, the positron emission tomography (PET) of using 18-F-fluorodeoxyglucose (FDG) is used to determine suffer from the patient's of chest esophagus SCC glucose transporter level.This research is to carry out in the patient who has experienced FDG-PET imaging before the surgical operation.FDG-PET research is to use the SET 2400 W PET scanner (SchimazuCorporation with 59.5cm transverse axis visual field (transaxial fieldof view) and the axial visual field of 20cm (axial field of view), Kyoto, Japan) carry out, it produces 63 image surfaces, the 3.125mm of being separated by between face.The result of transverse axis FDG PET image and crown FDG PET image and CT or MRI is linked together, and the doctor explains intuitively by nuclear medicine.Use interesting areas, estimate the FDG picked-up in the sections, evaluation region is 4 * 4 squares of pixels, and it comprises the zone that radioactivity is the highest but does not comprise whole tumour.

Embodiment 7

Immunohistochemical analysis

[000180] Xia Mian analysis can be used to analyze the expression of glucose transporter.Cut the section of primary tumor, thickness is 3-4mm, in dimethylbenzene, dewax, and in the alcohol of gradient that successively decreases (100-70%) rehydration.With containing 3% hydrogen peroxide in methanol sealing endogenous peroxidase activity.After distilled water and phosphate buffered saline buffer flushing for several times,, dye with minimum background with diluent incubation section in 1: 10 of notmal horse sera.At room temperature subsequently, resist (Chemicon GLUT1 antibody) incubation 1 hour with one.The peroxidase stain program is to utilize ABC Elite Kits (Vector Laboratories, Burlingame Calif.) carries out.As chromophore, can see the immunostaining reaction with 3-amino-9-ethyl carbazole.Cut into slices and/or cell centrifugation smear prepared product with Toluidine blue staining, and fix with Permount.Positive and negative control immunostaining thing have also been prepared.

[000181] cuts into slices by the pathological technique personnel evaluation.Use semi-quantitative standards, note this immunoreactive two features: the relative number of positive cell (0%,＜10%, 10-50% and＞50%) and the intensity (0-3) of reacting.Note the mode (film dyeing, endochylema dyeing) of immunostaining respectively.If oncocyte demonstrates the cytolemma reactive behavior, then think this tumour overexpression glucose transporter.

[000182] appliance computer image analysis, with the SAMBA 4000 cell imaging analytical systems of having integrated Windows software (Cell Image Analysis System) (Image Products International, Inc., Chantilly, Va.), carry out the quantitative assay of glucose transporter immunostaining.Strong painted tumor tissue section is used as positive control.With isoform-coupling but incoherent antibody surrogate above-mentioned is anti-, set up the negative control threshold, will be from the equalization as a result in ten zones.

Embodiment 8

The glucose transporter of pair cell Relaxin B sensitivity based on active glucose transporter analysis

[000183] present embodiment has been described based on active glucose transporter analysis, the level of this glucose transporter of cytochalasin B sensitivity in determining tumor sample and active aspect, be useful.

[000184] ordinary method in the application of treatment cancer patients process, by surgical discectomy or tumor biopsy, the chorista sample.After separating at once, tissue sample is placed in the container of clear and definite mark and delivers to pathology department.Carrying out after pathological evaluation contains tumour cell with evaluation oncological pathology feature and confirmatory sample, the part of tumour cell is being placed in the good container of mark, be placed on and deliver to the laboratory on ice.

[000185] by adding enzyme to following final concentration: 0.02%DNA enzyme, 0.3% collagenase and 0.4% Unidasa obtain tumor cell suspension, 37 ℃ of incubations 2 hours.Clean cell 3 times with PBS, make cell pass No. 25 pins 3 times.After centrifugal, with incubation buffer (15mM HEPES, 135mM NaCl, 5mM KCl, 1.8mM CaCl ₂, 0.8mM MgCl ₂) the resuspension cell, and in this medium incubated at room cell 30 minutes.Then, at the 2-[1 of 2-deoxyglucose that contains 0.5mmol and 6 μ L, 2- ³H] DDG (25-50Ci/mmol; NEN Life Science Products, Boston in 0.5ml incubation buffer MA), absorbs analysis 1 minute in normal temperature.Clean cell with ice-cold PBS 10mL, stop glucose uptake.

[000186] cleans 2 times through centrifugal collecting cell and with cold PBS.Then, (0.2%SDS) lysing cell is analyzed the radioactivity that is integrated into by liquid scintillation counting(LSC) for 10mMTris-HCl, pH8.0 with the 0.5mL lysis buffer.

[000187] repeated experiments and calculating mean value.After the non-specific uptake of deducting in parallel sample, calculate the picked-up of 2-deoxyglucose, described parallel sample is to hatch under the condition that 10 μ mol/L cytochalasin Bs exist, and cytochalasin B is effective inhibition of glucose transporter.At the cell number of determining in the parallel sample with result standardization.

[000188], also from the healthy organ of same patient, separates non-tumor sample for negative control.Optional positive control can be, observed glucose transport in the tissue of the high-caliber GLUT4 of known expression, the high-caliber GLUT4 of described expression organizes for example people's muscle tissue and fatty tissue, perhaps uses the COS cell culture of total length GLUT4 cDNA transfection.

Embodiment 9

The glucose transporter analysis of carrying out at the GLUT3 level based on flow cytometry

[000189] present embodiment has been described based on antibody, based on the glucose transporter analysis of flow cytometer, and this is useful in the proteic level of GLUT3 of determining tumor sample.

[000190] ordinary method in the application of treatment cancer patients process, by surgical discectomy or tumor biopsy, the chorista sample.After separating at once, tissue sample is placed in the container of clear and definite mark and delivers to pathology department.After pathological evaluation contains tumour cell with evaluation oncological pathology feature and confirmatory sample, the part of tumour cell is placed in the good container of mark, be placed on the dry ice, deliver to the laboratory.

[000191] using collagenase digesting Ficoll gradient purification process, is single cell suspension with sample dispersion.By in room temperature (RT) with 500 * g precipitation 30 seconds, Dulbecco ' s phosphate buffered saline buffer (PBS) (pH7.6) in twice in cleaning cell.Then, at phosphate buffered saline buffer (PBS) fixed cell 15 minute of room temperature with the pH7.2 that contains 4% Paraformaldehyde 96.Cell is cleaned in PBS 3 times, with the PBS resuspension that contains 3% bovine serum albumin (BSA), and with every pipe about 10 ⁵The density of individual cell is divided in the 1.5ml Eppendorf tube.

[000192] with 1: 60 Dilution ratio, will resisting people GLUT3 one, anti-(Temecula CA) adds every pipe, is incubated overnight at 4 ℃ for Chemicon International, Inc..After educating with a temperature resistance,, clean cell twice by in PBS centrifugal 30 seconds with 500 * g.Re-suspended cell precipitation in the goat anti-rabbit igg (Fisher Scientific) of R-phycoerythrin mark, 4 ℃ of incubations 1 hour, and vibration once in a while.By in PBS, cleaning in centrifugal 30 seconds after twice in the cell, cell is resuspended among the PBS of 500 μ l with 500 * g.

[000193] adopts Flow Cytometry, on FACScan (Becton Dickinson) flow cytometer, carry out the IgG bonded and measure.Cell mass pack into to get rid of dead cell.The source of depending on tissue sample and reagent, this analytical procedure will need optimum parameter is judged.The parameter that can change comprises, an anti-Dilution ratio, with an anti-time of hatching and temperature, with anti-hatching after the strict degree of cleaning.Determine the ratio of positive painted cell in each sample, and can compare with the negative control sample.In one embodiment, the result of flow cytometry is shown as, and cell number is to staining power (for example, the number of translocator), and the sample distribution of comparing with the survey group.

[000194] although, describe the present invention in detail, person of skill in the art will appreciate that its modification and improvement are included within the scope and spirit of the present invention, as illustrated in the claims by with reference to specific embodiment.All publications that this paper quotes and patent documentation (patent, disclosed patent application and undocumented patent application) are all pointed out to incorporate this paper into as a reference particularly and respectively as publication or document that each part is such incorporated herein by reference as a reference.Quoting of publication and patent documentation not to admit that any such document all is relevant prior art, neither constitute any approval about its content or time.Now, the present invention has been described by the mode of written description and embodiment, person of skill in the art will appreciate that the present invention can be implemented with various embodiments, and the explanation of front and embodiment are for illustrative purposes rather than to the restriction of claim.

Claims (23)

1. be used for determining the method that whether responsive cancer to the treatment of anti-tumor agents, it comprises the following steps:

(a) obtain the sample of cancer;

(b) level of at least a glucose transporter in the described sample of mensuration;

(c) described level and predetermined value are compared; With

(d) if the level that determines, determines then that this cancer is responsive to the treatment of this anti-tumor agents than predetermined value height.

2. the described method of claim 1, wherein said anti-tumor agents comprises glucose moiety.

3. the described method of claim 2, wherein said anti-tumor agents comprises the glucalogue part.

4. the described method of claim 3, wherein said glucalogue partly is the fructose part.

5. the described method of claim 1, wherein said glucose transporter is I class GLUT.

6. the described method of claim 1, wherein said glucose transporter is II class GLUT.

7. the described method of claim 1, wherein said glucose transporter is III class GLUT.

8. any described method in the aforementioned claim, wherein at least two kinds of different glucose transporter are determined.

9. the described method of claim 8, the level of wherein at least a I class GLUT, at least a II class GLUT and at least a III class GLUT is determined.

10. the described method of claim 1, wherein said anti-tumor agents is a streptozotocin.

11. the described method of claim 10, wherein said glucose transporter is GLUT2.

12. the described method of claim 1, wherein said anti-tumor agents is glucofosfamide.

13. the described method of claim 12, wherein said glucose transporter is Na ⁺The dependent form glucose transporter.

14. the described method of claim 1, wherein said anti-tumor agents is glycosyl-S-nitrosothiol.

15. the described method of claim 14, wherein said glucose transporter is GLUT1.

16. the described method of claim 1, the level of the glucose transporter in the wherein said sample is determined by immune analysis.

17. the described method of claim 1, the level of the glucose transporter in the wherein said sample are determined by the amplification of RNA or cDNA.

18. method according to claim 1, wherein said cancer is selected from: leukemia, mammary cancer, skin carcinoma, osteocarcinoma, prostate cancer, liver cancer, lung cancer, the cancer of the brain, laryngocarcinoma, carcinoma of gallbladder, carcinoma of the pancreas, the pancreas islet cancer, the rectum cancer, parathyroid carcinoma, thyroid carcinoma, adrenal carcinoma, the nervous tissue cancer, head and neck cancer, colorectal carcinoma, cancer of the stomach, bronchogenic carcinoma, kidney, rodent cancer, ulcer type squamous cell carcinoma and nipple type squamous cell carcinoma, the transitivity skin carcinoma, osteosarcoma, Ewing sarcoma, reticulum cell sarcoma, myelomatosis, giant cell tumor, small cell lung tumor, islet-cell carcinoma, primary brain tumors, acute and chronic lymphocytic knurl and granulocyte knurl, the hair cell knurl, adenoma, hyperplasia, medullary carcinoma, pheochromocytoma, mucosal neuroma, the enteric ganglia glucagonoma, hyperplasia corneal nerve knurl, class horse Fa Shi syndrome tumour, the nephroblastoma, spermocytoma, ovarian tumor, smooth muscle tumor, cervical dysplasia and carcinoma in situ, neuroblastoma, retinoblastoma, soft tissue sarcoma, carcinoid malignant, local skin is sick to be decreased, mycosis fungoides, rhabdosarcoma, Kaposi sarcoma, osteogenic sarcoma and other sarcoma, malignant hypercalcemia, renal cell carcinoma, polycythemia vera, gland cancer, glioblastoma multiforme, leukemia, lymphoma, malignant melanoma and epidermal carcinoma.

19. the described method of claim 18, wherein said cancer is a carcinoma of the pancreas.

20. the described method of claim 19, wherein said cancer is an islet-cell carcinoma.

21. the described method of claim 1, wherein said glucose transporter is GLUT2, and described cancer is carcinoma of the pancreas or islet-cell carcinoma, and described anti-tumor agents is streptozotocin, glucofosfamide or gluSNAP compound.

22. be used for determining the method to patient's chemotherapy scheme, described method comprises the following steps: that (a) diagnosis patient is for suffering from cancer; (b) obtain the cancer sample from described patient; (c) level of glucose transporter in the described sample of mensuration; (d) amount that will measure in step (c) is compared with predetermined value; If (e) amount of measuring is greater than described predetermined amount, determine that then this patient is a candidate of using the anti-tumor agents that transported by described glucose transporter to treat in step (c).

23. be used for determining the test kit that whether responsive cancer to the treatment of anti-tumor agents, described test kit comprises (a) reagent, it is used for determining a kind of or more than a kind of level of glucose transporter with (b) comprise the specification sheets of reference point at the cancer sample.