CN1743454A - Glucose isomerase mutant and its use - Google Patents

Abstract

This invention discloses a series of thermoanaerobacterium saccharolyticum grape sugar isomerases with heat-resistant and high catalytic active performance, suitable for testing content of fruit sugar by the gene mutation technology. These mutants mutate at bit 186 and at least three mutates at bit 139, 182 187 and 299, which can generate grape sugar with fruit sugar as the base further to test the fruit sugar content in the human body, organs, other living bodies or goods taking sequence as the reference in the sequence list.

Description

Glucose isomerase mutant and application thereof

Technical field:

The present invention relates to molecular biology and biological technical field, specifically, relate to high vigor or high vigor and heat-stable glucose isomerase mutant, application and employed test kit aspect mensuration fructose.

Background technology:

Fructose in the seminal fluid is secreted by seminal vesicle, is the important nutritive ingredient for the sperm Metabolic activity.Therefore, the fructose content height directly influences the vigor of sperm.Seminal fluid fructose is measured and is mainly used in the diagnosis and differential diagnosis of seminal vesicle, vas deferens, prostatosis and the diagnosis of Infertility clinically.Discovered in recent years, the function of seminal vesicle secretion fructose is subjected to androgenic regulation and control, so but the variation of male sex hormone level in the fructose content antimer of seminal fluid, seminal fluid fructose is measured and be can be used for the evaluation of male gonad secreting function and sexual function and the diagnosis of relative disease.

Have many-sided important value clinically although seminal fluid fructose is determined at, because the restriction of detection method, clinical labororatory does not extensively carry out the analysis of seminal fluid fructose.The method of measuring seminal fluid fructose at present mainly contains chromatography, chemical method and Fructose dehydrogenase method.Chromatography is subjected to the restriction of instrument, because of clinical labororatory seldom has high performance liquid chromatograph, also lacks relevant technologies.Chemical method utilizes compound reactions such as fructose and Resorcinol, indoles or carbazole to generate colour-change, try to achieve content by colorimetric, but these chemical colour reaction reactions all must be carried out in strongly-acid medium and high temperature (80-100oC), need to add the sulfuric acid or the hydrochloric acid of high density in the operation, dangerous, also be not suitable for the automatic biochemistry analyzer operation; And the colour developing unstable products, repeatability is very poor, and error can be up to 100%.The dehydrogenation enzyme process is the novel method of nineties development, the reaction conditions gentleness, and the result is accurate, but the unstable chemcial property of Fructose dehydrogenase and developer thereof, and the both need use preceding fresh preparation, and enzyme reagent costs an arm and a leg, so its commercial applications also is restricted.Therefore we can say up to the present also do not have a kind of real ideal clinically and practical seminal fluid fructose measuring method.

Glucose isomerase (Glucose isomerase, E.C.5.3.1.5 are called for short GI) catalysis glucose produces fructose, can fructose be that substrate generates glucose also.The glucogenic vigor of existing glucose isomerase enzyme catalysis fructose is low, and the sensitivity of measuring seminal fluid fructose is corresponding also low, does not apply the usefulness of Clinical Laboratory seminal fluid fructose.Therefore, need at first provide a series of high temperature resistant, glucose isomerases that can expeditiously fructose be converted into glucose at present, utilize glucose isomerase to detect fructose content efficiently, delicately then.

Summary of the invention:

The present invention utilizes genetic engineering and protein engineering that the glucose isomerase that derives from Thermoanaerobacteriumsaccharolyticum is improved, and has cultivated a series of high temperature resistant, glucose isomerases that high-level efficiency is converted into fructose glucose.These glucose isomerases effectively change into glucose with the fructose in the seminal fluid, the quantity of the glucose that generates with determination of glucose oxidase then, and then can determine the content of fructose in the seminal fluid.Method of the present invention is the new detection method of world initiative, has overcome the drawback of existing mensuration seminal fluid fructose method, have easy and simple to handle, the result is accurate, reaction conditions is gentle, with low cost, stable reagent and be convenient to characteristics such as commercial operation.Glucose isomerase mutant of the present invention can also be used in the human body or a certain organ or other organism or commodity DETERMINATION OF FRUCTOSE IN in the body.

The object of the present invention is to provide that to have efficient catalytic fructose be that the active or tool efficient catalytic fructose of glucose is the activity heat-stable glucose isomerase mutant also of glucose.The present invention also correspondingly provides the DNA of the described glucose isomerase mutant of encoding and the application that these mutant are used to measure fructose content.

Particularly, the present invention includes following aspect:

On the one hand, the invention provides a kind of glucose isomerase mutant, it is characterized in that with the sequence in the sequence table 2 (SEQ ID NO.:2) be reference sequences, have the 186th sudden change and be selected from the 139th, the 182nd, at least three sudden changes of the 187th and the 299th, described the 139th tryptophane sports Methionin (Lys), or Serine (Ser), or halfcystine (Cys), or Isoleucine (Ile), or Threonine (Thr), or l-asparagine (Asn), or phenylalanine (Phe), described the 182nd arginine sports proline(Pro) (Pro), or Serine (Ser), or L-Ala (Ala), or Isoleucine (Ile), or Threonine (Thr), or Xie Ansuan (Val), described the 186th Xie Ansuan sports Threonine (Thr), or L-Ala (Ala), or aspartic acid (Asp), described the 187th phenylalanine sports glycine (Gly), or Serine (Ser), or L-Ala (Ala), or proline(Pro) (Pro), and described the 299th Threonine sports Isoleucine (Ile), or tyrosine (Tyr), or halfcystine (Cys), or methionine(Met) (Met), or L-glutamic acid (Glu), or glutamine (Gln).Preferably, glucose isomerase mutant of the present invention has the listed aminoacid sequence of sequence 4 (SEQ ID NO.:4), wherein on behalf of phenylalanine (Phe), the 182nd X, the 139th X represent L-Ala (Ala), the 186th X to represent Threonine (Thr), the 187th X represents phenylalanine, and the 299th X represents glutamine (Gln) simultaneously.

On the other hand, the invention provides the DNA of the nucleotide sequence that contains the glucose isomerase mutant of the present invention of encoding.

On the one hand, provide glucose isomerase mutant of the present invention is applied to measure fructose content again.Use the glucose isomerase mutant of high catalytic activity of the present invention can measure the fructose content of a certain organ in human body fluid or the body.When measuring human seminal fluid's fructose content, glucose isomerase mutant of the present invention is particularly useful.

Another aspect the invention provides the method for fructose content in a kind of people's of mensuration seminal fluid, comprises the steps:

1) obtains people's seminal fluid sample;

2) glucose isomerase mutant of the present invention is joined in the seminal fluid sample, obtain reaction mixture;

3) reaction mixture was reacted 20-40 minute at 65-80 ℃, preferably reacted 30 minutes down at 75 ℃; With

4) record fructose content in the reaction mixture after reaction finishes.

Carry out step 2) before, also preferably include the proteic step of removing in the seminal fluid sample.This step implement many modes, for example, can by with the contact of seminal fluid sample and ion exchange resin or by in the seminal fluid sample, add protein denaturant make separate again behind the protein denaturation in the seminal fluid sample or by with the seminal fluid sample 90-100 ℃ of heating centrifugal again realization after 20-40 minute.Have many ion exchange resin to use in the prior art, for example, Chelex 100.For protein denaturant, also have no particular limits.But, consider the protein denaturant that preferably uses those to be easy to from reaction system, remove for angle to the influence degree of subsequent step.

Also on the one hand, the invention provides a kind of test kit that is used for measuring people's seminal fluid fructose content, it is characterized in that comprising glucose isomerase mutant of the present invention.Preferred test kit also comprises proteic reagent and the glucose oxidase that is used for removing seminal fluid sample to be measured.In test kit of the present invention, the wherein said proteic reagent that is used for removing seminal fluid sample to be measured can be ion exchange resin, also can be general protein denaturant.From being easy to handle and to the angle of the influence degree of subsequent step, it is comparatively preferred making spent ion exchange resin.In order to improve the accuracy of mensuration, test kit of the present invention also can comprise the fructose concentration standardized solution.Certainly, the function of standardized solution also can realize with computer.

The explanation of accompanying drawing table:

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 glucose isomerase mutant MGI-4B polyacrylamide gel electrophoresis figure.Wherein four swimming lanes from left to right are followed successively by molecular weight of albumen standard, bovine serum albumin, thick leach protein, partially purified glucose isomerase mutant MGI-4B.(example 9 is seen in the preparation of thick leach protein, partially purified glucose isomerase mutant MGI-4B)

Thermally-stabilised at 80 ℃ of Fig. 2 parent glucose isomerase and glucose isomerase mutant.Wherein the MGI-4B representative has the glucose isomerase mutant in four mutational sites, specifically sees also example 13.

What Fig. 3 showed is fructose content bioassay standard curve.

Embodiment:

The present invention carries out rite-directed mutagenesis to Thermoanaerobacterium saccharolyticum glucose isomerase gene, subsequently at MacConkey (DIFCO, USA) screening glucose isomerase clone on the substratum, a series of to have efficient catalytic fructose be that glucose activity or tool efficient catalytic fructose are the active and heat-stable glucose isomerase mutant of glucose thereby obtain.Specific activity as one of them mutant MGI-4B is high by 755% than the parent.Parental gene means the glucose isomerase from Thermoanaerobacterium sachcharolyticum ATCC 49915 among the present invention, its nucleotide sequence is shown in sequence 1 (SEQ ID NO.:1), and aminoacid sequence is shown in the sequence 2 (SEQ ID NO.:2).The gene order of the T.saccharolyticum glucose isomerase of the nucleotide sequence of parental gene and announcement among the present invention (Lee et al., Journal of GeneralMicrobiology, 139:1227-1234,1993; GenBank L09699) compares in the 241-242 position difference is arranged, see for details hereinafter about the definition of " parent " and the description of example 1.

Prepare in the method for glucose isomerase in the present invention, the carrier that is suitable for includes but not limited to prokaryotic expression carrier pGEMT-Easy, pRSET and pET21; Include but not limited to carrier for expression of eukaryon pYD1 and pYES2/GS; Include but not limited to cloning vector pUC18/19 and pBluescript-SK.

Prepare in the method for glucose isomerase in the present invention, the glucose isomerase that is suitable for can be expressed in prokaryotic cell prokaryocyte or eukaryotic cell born of the same parents, also can adopt any other proper method known in the art to be implemented in prokaryotic cell prokaryocyte or the eukaryotic cell born of the same parents express outward.

Prepare in the method for glucose isomerase mutant in the present invention, the microbial host cell of described carrier is prokaryotic cell prokaryocyte or eukaryotic cell.Described prokaryotic micro-organisms includes but not limited to intestinal bacteria, Bacillus coagulans, Bacillus subtillis, Bacillus megatherium (as Bacillus megatherium BP931), T.saccharolyticum and streptomycete (as Streptomyces diastaticus M1033).Described eukaryotic microorganisms includes but not limited to yeast saccharomyces cerevisiae and finishes red saccharomyces pastorianus (as finishing red saccharomyces pastorianus GS115/9891).

The present invention has obtained a kind of glucose isomerase mutant, it is characterized in that with aminoacid sequence shown in the sequence in the sequence table 2 (SEQID NO.:2) be reference sequences, at least have an amino acid whose difference, and with fructose be substrate its have than the parent exceed at least 50-150%, preferably exceed at least 150-250%, more preferably exceed 250% glucose isomerase enzymatic activity at least.Preferably, with the sequence in the sequence table 2 is reference sequences, have the 186th Xie Ansuan to the sudden change of other 19 natural amino acids and at least three tryptophanes that are selected from the 139th to other 19 natural amino acids, the 182nd arginine is to other 19 natural amino acids, the 187th the sudden change of phenylalanine to other 19 natural amino acids and the 299th 's Threonine to other 19 natural amino acids, and with fructose be substrate its have and exceed at least 50% glucose isomerase enzymatic activity than the parent.More preferably described the 139th tryptophane sports Methionin (Lys) or Serine (Ser) or halfcystine (Cys) or Isoleucine (Ile) or Threonine (Thr) or l-asparagine (Asn) or phenylalanine (Phe); Described the 182nd arginine sports proline(Pro) (Pro) or Serine (Ser) or L-Ala (Ala) or Isoleucine (Ile) or Threonine (Thr) or Xie Ansuan (Val); Described the 186th Xie Ansuan sports Threonine (Thr) or L-Ala (Ala) or aspartic acid (Asp); Described the 187th phenylalanine sports glycine (Gly) or Serine (Ser) or L-Ala (Ala) or proline(Pro) (Pro); And/or described the 299th Threonine sports Isoleucine (Ile) or tyrosine (Tyr) or halfcystine (Cys) or methionine(Met) (Met) or L-glutamic acid (Glu) or glutamine (Gln).Most preferably, glucose isomerase mutant of the present invention is included in the 139th, 182,186 and 299 sudden change.

It is that glucose is active and have a thermotolerance that these mutant have efficient catalytic fructose.For example, in a series of mutant that the present invention obtains, the specific activity of a mutant MGI-4B with four point mutation is high by 755% than the parent, and still keeps 50% or above vigor after 16 hours 80 ℃ of reactions.

High catalytic activity that the present invention obtains or high catalytic activity and heat-stable glucose isomerase mutant can be used for measuring in the human body or fructose content in a certain organ or other organism or the commodity in the body.Described glucose isomerase mutant can use with not purified thick enzyme form, also can be the form through partially purified or complete purifying.If desired, also can utilize curing technology known in the art glucose isomerase mutant of the present invention to be made the curing enzyme of solid enzyme or solid phase cells form.

Used term " parent " means the glucose isomerase from Thermoanaerobacteriumsaccharolyticum ATCC 49915 in the application's text, and its nucleotide sequence is shown in sequence 1, and aminoacid sequence is shown in sequence 2.The gene order of the T.saccharolyticum glucose isomerase of the nucleotide sequence of parental gene and announcement among the present invention (Lee et al., Journal of GeneralMicrobiology, 139:1227-1234,1993; GenBank L09699) compares the difference that two Nucleotide are arranged, promptly compare with the nucleotide sequence of gene pool (GenBank L09699), parental gene 241-242 position is GC among the present invention, corresponding the 81st amino acids sequence is L-Ala (Ala), GenBankL09699 corresponding position, 241-242 position nucleotides sequence are classified CG as, and corresponding the 81st amino acids sequence is arginine (Arg).

Used term " reference sequences " in the application's text when it is nucleotide sequence, means the sequence 1 in the sequence table, when it is aminoacid sequence, is meant the sequence 2 in the sequence table.When the glucose isomerase enzyme sequence with reference sequences and sudden change sorts comparison, can carry out by hand, also can carry out (have at present many, CLUSTALW for example, AMAS, DIALIGN program etc.) with computer for the computer softwares that utilize.

Used term " glucose isomerase mutant " is meant that a kind of like this is reference sequences with aminoacid sequence shown in the sequence in the sequence table 2 in the application's text, at least have an amino acid whose difference, and with fructose be substrate its have the enzyme that exceeds at least 50% glucose isomerase enzymatic activity than the parent.Therefore, in present patent application, described glucose isomerase mutant comprises conservative replacement form, the increase in other sites except that the 139th, 182,186,187 and 299 in the aminoacid sequence shown in the sequence 2 or lacks one or several amino acid whose form.

Embodiment:

Following embodiment only is used to the present invention is described and should regard as and is used to limit scope of the present invention.Unreceipted actual conditions person in the embodiment, the condition of conditioned disjunction manufacturers suggestion is carried out routinely.

Example 1: the amplification of parental gene and the structure of pGEMT-TS thereof

According to gene pool (GenBank L09699) gene order design primer T1 and T2 (seeing Table 1).Utilize primer to T1 and T2 from T.saccharolyticum ATCC 49915 (available from ATCC, USA) in amplification glucose isomerase parental gene.

Amplification condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1% Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1,400nM primer T2,1.5U Pfu archaeal dna polymerase (Promega, USA), with a little T.saccharolyticum thalline of transfering loop picking, transfer reaction volume to 50 μ l with sterilized water again.

The pcr amplification reaction program is: 95 ℃ 3 minutes, 40 circle circulations: 95 ℃ 50 seconds, 50 ℃ 30 seconds and 72 ℃ 1 minute, last 72 ℃ 10 minutes.The product (being about 1.5kb) that increases is connected to carrier pGEMT-Easy, and (Promega USA), gets plasmid pGEMT-TS.(MarligenBioscience USA) extracts plasmid pGEMT-TS, determines that through dna sequencing the nucleotides sequence of parent's glucose isomerase classifies sequence table sequence 1 as, and amino acid sequence corresponding is a sequence table sequence 2 to utilize rapid plasmid to prepare test kit.Compare with the nucleotide sequence of gene pool (GenBankL09699), parental gene 241-242 position is GC among the present invention, and corresponding the 81st amino acids sequence is L-Ala (Ala).241-242 position, GenBankL09699 corresponding position nucleotides sequence is classified CG as, and corresponding the 81st amino acids sequence is arginine (Arg).

Example 2: the rite-directed mutagenesis in glucose isomerase site 139

Site-directed mutagenesis technique is with reference to the description of Ho et al. (Gene 77:51-59,1989) and White et al. (PCRProtocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

With plasmid pGEMT-TS (seeing example 1) is template, and the design primer sports Phe (F) to 139FF and 139FR (seeing Table 1) with the Trp (W) in the 139th site in parent's aminoacid sequence, obtains mutant MGI-W139F.Primer is seen example 1 to T1 and T2.

Utilize primer to T1 and 139FR, amplification T1FR fragment, primer is to 139FF and T2, and the FFT2 fragment increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1% Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM primer 139FR or 400nM primer 139FF and 400nM primer T2,1.5U the Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.(QIAGEN German) reclaims, and obtains T1FR fragment and FFT2 fragment through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction GelKit.Full-length gene then increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄, 0.1% Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM T2,1.5U Pfu archaeal dna polymerase (Promega, USA), 20ng T1FR fragment and 20ng FFT2 fragment are transferred reaction volume to 50 μ l with sterilized water.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim the test kit recovery through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel KitDNA, obtain total length mutator gene MGI-W139F.MGI-W139F is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-W139F.Change plasmid pGEMT-MGI-W139F over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-W139F DNA, determine that through dna sequencing the point mutation of introducing is errorless.

Make up mutant MGI-W139K, MGI-W139S, MGI-W139C, MGI-W139I, MGI-W139T and MGI-W139N according to similar step, the primer sees Table 1.

Example 3: the rite-directed mutagenesis in glucose isomerase site 182

The description of site-directed mutagenesis technique main reference Ho et al. (Gene 77:51-59,1989) and White et al. (PCRProtocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

With plasmid pGEMT-TS (seeing example 1) is template, and the design primer sports Ala (A) to 182AF and 182AR (seeing Table 1) with the Arg (R) in the 182nd site in parent's aminoacid sequence, obtains mutant MGI-R182A.Primer T1 and T2 see example 1.

Utilize primer to T1 and 182AR, amplification T1AR fragment, primer is to 182AF and T2, and the AFT2 fragment increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCI, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM primer 182AR or 400nM primer 182AF and 400nM primer T2,1.5U the Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain T1AR fragment and AFT2 fragment.Full-length gene then increases.Amplification reaction condition is: 20mMTris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nMT2,1.5U the Pfu archaeal dna polymerase, 20ng T1AR fragment and 20ng AFT2 fragment are transferred reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquickExtraction Gel Kit, obtain total length mutator gene MGI-R182A.MGI-R182A is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-R182A.Change plasmid pGEMT-MGI-R182A over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-R182ADNA, determine that through dna sequencing the point mutation of introducing is errorless.

Make up mutant MGI-R182P, MGI-R182S, MGI-R182I, MGI-R182T and MGI-R182V according to similar step, the primer sees Table 1.

Example 4: the rite-directed mutagenesis in glucose isomerase site 186

Site-directed mutagenesis technique is with reference to the description of Ho et al. (Gene 77:51-59,1989) and White et al. (PCRProtocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

With plasmid pGEMT-TS (seeing example 1) is template, and the design primer sports Thr (T) to 186TF and 186TR (seeing Table 1) with the Val (V) in the 186th site in parent's aminoacid sequence, obtains mutant MGI-V186T.Primer T1 and T2 see example 1.

Utilize primer to T1 and 186TR, amplification T1TR fragment, primer is to 186TF and T2, and the TFT2 fragment increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM primer 186TR or 400nM primer T2 and 400nM primer 186TF, 1.5U the Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain T1TR fragment and TFT2 fragment.Full-length gene then increases.Amplification reaction condition is: 20mMTris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nMT2,1.5U the Pfu archaeal dna polymerase, 20ng T1TR fragment and 20ng TFT2 fragment are transferred reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquickExtraction Gel Kit, obtain total length mutator gene MGI-V186T.MGI-V186T is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-V186T.Change plasmid pGEMT-MGI-V186T over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-V186TDNA, determine that through dna sequencing the point mutation of introducing is errorless.Make up mutant MGI-V186A and MGI-V186D according to similar step, the primer sees Table 1.

Example 5: the rite-directed mutagenesis in glucose isomerase site 187

Site-directed mutagenesis technique is with reference to the description of Ho et al. (Gene 77:51-59,1989) and White et al. (PCRProtocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

With plasmid pGEMT-TS (seeing example 1) is template, and the design primer sports Ser (S) to 187SF and 187SR (seeing Table 1) with the Phe (F) in the 187th site in parent's aminoacid sequence, obtains mutant MGI-F187S.Primer T1 and T2 see example 1.

Utilize primer to T1 and 187SR, amplification T1SR fragment, primer is to 187SF and T2, and the SFT2 fragment increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer Tl and 400nM primer 187SR or 400nM primer T2 and 400nM primer 187SF, 1.5U the Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain T1SR fragment and SFT2 fragment.Full-length gene then increases.Amplification reaction condition is: 20mMTris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer Tl and 400nMT2,1.5U the Pfu archaeal dna polymerase, 20ng T1SR fragment and 20ng SFT2 fragment are transferred reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquickExtraction Gel Kit, obtain total length mutator gene MGI-F187S.MGI-F187S is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-F 187S.Change plasmid pGEMT-MGI-F 187S over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-F187SDNA, determine that through dna sequencing the point mutation of introducing is errorless.Make up mutant MGI-F187G, MGI-F187P and MGI-F187A according to similar step, the primer sees Table 1.

Example 6: the rite-directed mutagenesis in glucose isomerase site 299

Site-directed mutagenesis technique is with reference to the description of Ho et al. (Gene 77:51-59,1989) and White et al. (PCRProtocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

With plasmid pGEMT-TS (seeing example 1) is template, and the design primer sports Gln (Q) to 299QF and 299QR (seeing Table 1) with the Thr (T) in the 299th site in parent's aminoacid sequence, obtains mutant MGI-T299Q.Primer T1 and T2 see example 1.

Utilize primer to T1 and 299QR, amplification T1QR fragment, primer is to 299QF and T2, and the QFT2 fragment increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM primer 2 99QR or 400nM primer 2 99QF and 400nM primer T2,1.5U the Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain TlQR fragment and QFT2 fragment.Full-length gene then increases.Amplification reaction condition is: 20mMTris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM T2,1.5U the Pfu archaeal dna polymerase, 20ng T1QR fragment and 20ng QFT2 fragment are transferred reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquickExtraction Gel Kit, obtain total length mutator gene MGI-T299Q.MGI-T299Q is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-T299Q.Change plasmid pGEMT-MGI-T299Q over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-T299QDNA, determine that through dna sequencing the point mutation of introducing is errorless.Make up mutant MGI-T299I, MGI-T299Y, MGI-T299C, MGI-T299M and MGI-T299E according to similar step, the primer sees Table 1.

Example 7: the structure of glucose isomerase four sudden change combination MGI-4B

Site-directed mutagenesis technique is with reference to the description of Ho et al. (Gene 77:51-59,1989) and White et al. (PCR Protocol:current methods and applications.Totowa, N.J.:Humana Press, 1993).

Press example 2 amplifications and reclaim the T1FR fragment, press example 6 amplifications and reclaim the QFT2 fragment.With primer to 139FF (as example 2) and 182AR (as example 3) amplification with reclaim the FFAR fragment.FFAR fragment amplification reaction conditions is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM139FF and 400nM 182AR, 1.5U Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain the FFAR fragment.With primer to 182AF (as example 3) and 186TR (as example 4) amplification AFTR fragment.AFTR fragment amplification reaction conditions is: 20mMTris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM 182AF and 400nM186TR, 1.5U Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain the AFTR fragment.With primer to 186TF (as example 4) and 299QR (as example 6) amplification TFQR fragment.TFQR fragment amplification reaction conditions is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM, 2mM MgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ MdGTP, 400nM 186TF and 400nM 299QR, 1.5U Pfu archaeal dna polymerase, 20ng pGEMT-TS transfers reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquick Extraction Gel Kit, obtain the TFQR fragment.Full-length gene then increases.Amplification reaction condition is: 20mM Tris-HCl (pH8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄, 0.1%Triton X-100,50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 400nM primer T1 and 400nM T2,1.5U Pfu archaeal dna polymerase, 20ng T1FR fragment, 20ng FFAR fragment, 20ng AFTR fragment, 20ng TFQR fragment and 20ng QFT2 fragment are transferred reaction volume to 50 μ l with sterilized water again.The pcr amplification reaction program is: 95 ℃ 3 minutes, 35 circle circulations: 95 ℃ 50 seconds, 52 ℃ 30 seconds and 72 ℃ 3 minutes, last 72 ℃ 5 minutes.Reclaim through the separation of 1% agarose gel electrophoresis and with QIAquickExtraction Gel Kit, obtain total length mutator gene MGI-4B.MGI-4B is connected with carrier pGEMT-Easy, gets plasmid pGEMT-MGI-4B.Change plasmid pGEMT-MGI-4B over to competence bacterial cell HB101, on 1%MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), filter out the clone of tool glucose isomerase activity.From the clone, extract plasmid pGEMT-MGI-4B DNA, determine that through dna sequencing the point mutation of introducing is errorless.The MGI-4 sequence contains four sudden changes of W139F, R182A, V186T and T299Q.The MGI-4B sequence is seen sequence table sequence 5 (SEQ ID NO.:5).

Parent's glucose isomerase (parent) and example 1-7 glucose isomerase mutant used primer such as the following table 1 of increasing is listed:

Table 1

	Primer is right
		The parent	T1：5’AGATTACCTAGGTACATATGAATAAATATTTTGAGAACGT 3’ T2：5’ATTTCCGATGGCGCGCCTTATTCTGCAAACAAATACTGA 3’
Mutant	Primer is right
		MGI-W139K	139KF：5’AAGTTTTGAAAGGTACCGCAAATCTTTTCT 3’ 139KR：5’TGCGGTACCTTTCAAAACTTTTGTCTTGCT 3’
MGI-W139S	139SF：5’AAGTTTTGTCAGGTACCGCAAATCTTTTCT 3’ 139SR：5’TGCGGTACCTGACAAAACTTTTGTCTTGCT 3’
		MGI-W139C	139CF：5’AAGTTTTGTGCGGTACCGCAAATCTTTTCT 3’ 139CR：5’TGCGGTACCGCACAAAACTTTTGTCTTGCT 3’
MGI-W139I	139IF：5’AAGTTTTGATTGGTACCGCAAATCTTTTCT 3’ 139IR：5’TGCGGTACCAATCAAAACTTTTGTCTTGCT 3’
		MGI-W139T	139TF：5’AAGTTTTGACAGGTACCGCAAATCTTTTCT 3’ 139TR：5’TGCGGTACCTGTCAAAACTTTTGTCTTGCT 3
MGI-W139N	139NF：5’AAGTTTTGAACGGTACCGCAAATCTTTTCT 3’ 139NR：5’TGCGGTACCGTTCAAAACTTTTGTCTTGCT 3’
		MGI-W139F	139FF：5’AAAAGTTTTGTTTGGTACCGCAAATCTTTTCTC 3’ 139FR：5’TTGCGGTACCAAACAAAACTTTTGTCTTGCTGG 3’
MGI-R182R	182RF：5’AGCTTGGCGGCGAAAACTACGTATTTTGGG 3’ 182RR：5’GTAGTTTTCGCCGCCAAGCTCCTTAGTAAT 3’
		MGI-R182S	182SF：5’AGCTTGGCTCAGAAAACTACGTATTTTGGG 3’ 182SR：5’GTAGTTTTCTGAGCCAAGCTCCTTAGTAAT 3’
MGI-R182A	182AF：5’GGAGCTTGGCGCGGAAAACTACGTATTTTGGGG 3’ 182AR：5’CGTAGTTTTCCGCGCCAAGCTCCTTAGTAATCT 3’
		MGI-R182I	182IF：5’AGCTTGGCATTGAAAACTACGTATTTTGGG 3’ 182IR：5’GTAGTTTTCAATGCCAAGCTCCTTAGTAAT 3’
MGI-R182T	182TF：5’AGCTTGGCACAGAAAACTACGTATTTTGGG 3’ 182TR：5’GTAGTTTTCTGTGCCAAGCTCCTTAGTAAT 3’
		MGI-R182V	182VF：5’AGCTTGGCGTGGAAAACTACGTATTTTGGG 3’ 182VR：5’GTAGTTTTCCACGCCAAGCTCCTTAGTAAT 3’
MGI-V186T	186TF：5’AAAACTACACCTTTTGGGGTGGAAGAGAAGG 3’ 186TR：5’CCCCAAAAGGTGTAGTTTTCGCGGCCAAGC 3’

MGI-V186A	186TF：5’AAAACTACGCATTTTGGGGTGGAAGAGAAGG 3’ 186TR：5’CCCCAAAATGCGTAGTTTTCGCGGCCAAGC 3’
		MGI-V186D	186TF：5’AAAACTACGATTTTTGGGGTGGAAGAGAAGG 3’ 186TR：5’CCCCAAAAATCGTAGTTTTCGCGGCCAAGC 3’
MGI-V187G	187GF：5’ACTACGTAGGCTGGGGTGGAAGAGAAGGGT 3’ 187GR：5’CCACCCCAGCCTACGTAGTTTTCGCGGCCA3’
		MGI-V187P	187PF：5’ACTACGTACCGTGGGGTGGAAGAGAAGGGT 3’ 187PR：5’CCACCCCACGGTACGTAGTTTTCGCGGCCA 3’
MGI-V187A	187AF：5’ACTACGTAGCATGGGGTGGAAGAGAAGGGT 3’ 187AR：5’CCACCCCATGCTACGTAGTTTTCGCGGCCA 3’
		MGI-V187S	187SF：5’ACTACGTAAGCTGGGGTGGAAGAGAAGGGT 3’ 187SR：5’CCACCCCAGCTTACGTAGTTTTCGCGGCCA 3’
MGI-T299I	299IF：5’GACGCAAATATTGGCGACATGCTTTTAGGAT 3’ 299IR：5’CATGTCGCCAATATTTGCGTCGATTGATCCT 3’
		MGI-T299Y	299YF：5’GACGCAAATTATGGCGACATGCTTTTAGGAT 3’ 299YR：5’CATGTCGCCATAATTTGCGTCGATTGATCCT 3’
MGI-T299C	299CF：5’GACGCAAATTGCGGCGACATGCTTTTAGGAT 3’ 299CR：5’CATGTCGCCGCAATTTGCGTCGATTGATCCT 3’
		MGI-T299M	299MF：5’GACGCAAATATGGGCGACATGCTTTTAGGAT 3’ 299MR：5’CATGTCGCCCATATTTGCGTCGATTGATCCT 3’
MGI-T299Q	299QF：5’TGACGCAAATCAAGGCGACATGCTTTTGGGATG 3’ 299QR：5’GCATGTCGCCTTGATTTGCGTCAATTGATCCTA 3’
		MGI-T299E	299EF：5’GACGCAAATGAAGGCGACATGCTTTTAGGAT 3’ 299ER：5’CATGTCGCCTTCATTTGCGTCGATTGATCCT 3’

Example 8: the extraction and purification of parent's glucose isomerase

The extraction and purification main reference Lee et al. of glucose isomerase, Journal of GeneralMicrobiology, 139:1227-1234 (1993).

The plasmid pGEMT-TS transformed competence colibacillus bacterial cell HB101 that will contain parent's glucose isomerase gene, go up at MacConkey flat board (containing 1%D-wood sugar and 50mg/L penbritin), 37 ℃ cultivated 36 hours.Inoculate in the single 5ml of the being cloned in LB liquid nutrient medium (containing the 50mg/L penbritin) and cultivated 16 hours.Centrifugal collection thalline, and be suspended in the 1ml 20mM sodium phosphate buffer (pH6.5), add CoCl ₂And MgCl ₂Be respectively 250 μ M and 5mM to final concentration.Use the ultrasonic treatment bacterial cell then.Centrifugal (10 ℃, 17,800g, 15 minutes) and collect supernatant liquor, be thick leach protein.Thick leach protein is through 80 ℃ of thermal treatments after 10 minutes, centrifugal (10 ℃, 17,800g, 15 minutes) goes precipitation.Supernatant liquor is partially purified glucose isomerase, can be used for the mensuration of enzymic activity and measures the seminal fluid fructose content.

Example 9: the extraction and purification of glucose isomerase mutant MGI-4B

The extraction and purification of glucose isomerase mutant MGI-4B and example 8 are same, and only used plasmid is pGEMT-MGI-4B.Partially purified glucose isomerase is seen Fig. 1.

Example 10: the mensuration of parent's glucose isomerase activity

Joining fructose, 20mM buffer solution of sodium phosphate (pH6.5), the final concentration that substrate solution SA contains 1.0M is the CoCl of 250 μ M ₂With final concentration be the MgCl of 5mM ₂Transfer pH to 6.5.Get substrate solution SA90 μ l, add the glucose isomerase of 10 μ l then, react on 80 ℃ and carried out 10 minutes by example 8 preparations.Reactant is put on ice with termination reaction.Reaction product D-glucose is by D-determination of glucose oxidase (referring to Trinder, Ann.Clin.Biochem, 24:27,1969, and the Reagent kit of glucose working instructions of Shanghai Ke Hua-Dong water chestnut diagnostic article company limited).Use Coomassie ^(PIERCE USA) and in conjunction with sds polyacrylamide gel electrophoresis measures zymoprotein concentration to Plus Protein Assay Reagent Kit.One unit specific enzyme activity is defined as under these conditions per minute, and to transform micromole's fructose be the required enzyme amount of glucose.

Example 11: glucose isomerase mutant MGI-4B is to the fructose determination of activity

Glucose isomerase mutant MGI-4B determination of activity and example 10 are together.The result shows that glucose isomerase mutant MGI-4B exceeds 755% than parent glucose isomerase to the fructose specific activity.

Example 12: parent's glucose isomerase thermal stability determination

To place 7 1.5ml centrifuge tubes by partially purified parent's glucose isomerase that example 8 obtains.Every centrifuge tube adds 200 μ l enzyme liquid respectively, and adds 200 μ l mineral oil.Centrifuge tube is placed 80 ℃ of water-baths, take out a pipe enzyme liquid after 0 hour, 2 hours, 4 hours, 8 hours, 16 hours, 32 hours, 72 hours respectively, centrifugal (10 ℃, 17,800g, 20 minutes) after, get supernatant liquor, press example 10 described mensuration glucose isomerase residual protein and residual ratio activity.Fig. 2 shows parent's glucose isomerase thermally-stabilised at 80 ℃.

Example 13: glucose isomerase mutant thermal stability determination

The thermal stability determination of glucose isomerase mutant MGI-4B and example 12 are together.Fig. 2 shows glucose isomerase mutant MGI-4B thermally-stabilised at 80 ℃.As shown in the figure, parent's glucose isomerase is 3.5 hours 80 ℃ transformation period; MGI-4B is 16 hours.

Example 14: the biochemical constant measuring of parent's glucose isomerase

Preparation substrate solution SB phosphoric acid sodium-MgCl ₂-CoCl ₂Buffered soln [20mM sodium phosphate (pH 6.5), 250 μ M CoCl ₂, 5mM MgCl ₂] and 2M D-fructose, transfer pH to 6.5.With same sodium phosphate-MgCl ₂-CoCl ₂Buffered soln is diluted to substrate solution SB and contains D-fructose 1.8M, 1.6M, 1.4M, 1.2M, 1.0M, 0.8M, 0.6M, 0.4M, 0.2M, 0.1M, 0.05M and 0.025M.The substrate solution SB that gets partially purified parent's glucose isomerase of 10 μ l (seeing embodiment 8) and 90 μ l different concns reacted 10 minutes at 65 ℃ or 80 ℃.Then, by Mi-Man (Michaelis-Menten) equation and adopt Lineweaver-Burk double-reciprocal plot method, measure Michaelis-Menton constant K _m, the maximum speed of reaction V under the saturation of substrates concentration _MaxWith turnover number K _CatIts result such as following table 2 are listed.

Example 15: the mensuration of the biochemical constant of glucose isomerase mutant MGI-4B

Biochemical constant measuring of glucose isomerase mutant MGI-4B and example 14 are together.Table 2 shows glucose isomerase mutant MGI-4B and the biochemical constant of parent's glucose isomerase relatively.

The biochemical constant of table 2 parent glucose isomerase (parent) and glucose isomerase mutant MGI-4B

Substrate	65℃
									K m (mM)		K cat (min -1)		K cat/K m (mM -1min -1)
	The parent	MGI-4B	The parent	MGI-4B	The parent		MGI-4B
									D-fructose	103.3	65.6	224.9	1060	2.18			16.16
Substrate	80℃
									K m (mM)		K cat (min -1)		K cat/K m (mM -1min -1)
	The parent	MGI-4B	The parent	MGI-4B	The parent	MGI-4B
									D-fructose	241.1	120.30	983.9	2911	4.08			24.20

Example 16: the preparation of fructose content typical curve

Take by weighing the fructose 90.08mg that is dried to constant weight, add water to the 25ml dissolving, get the fructose standardized solution of 20mM, prepare the isocyatic standardized solution of 16mM, 8mM, 4mM, 2mM, 1mM, 0.5mM and 0mM with deionized water.The standardized solution 450 μ l that get each concentration respectively add 1U MGI-4B, put 75 ℃ of reactions 30 minutes, are cooled to room temperature rapidly after reaction is finished.Reaction product D-glucose by the D-determination of glucose oxidase as described in the example 10.Extract reaction solution 20 μ l, (Reagent kit of glucose by Shanghai Ke Hua-Dong water chestnut diagnostic article company limited provides to add 600 μ l glucose oxidase reagent A liquid, contain 〉=1.0U/ml peroxidase and 0.1M phosphoric acid buffer, pH6.8) and 300 μ l glucose oxidase reagent B liquid (Reagent kit of glucose by Shanghai Ke Hua-Dong water chestnut diagnostic article company limited provides, contain 〉=the 15U/ml glucose oxidase, 0.5mM 4-aminoantipyrene and 0.1mM phosphoric acid buffer, pH6.8), mixed rearmounted 37 ℃ of water-baths 7 minutes.The OD of assaying reaction thing after reaction is finished ₅₆₀Absorbance value.With fructose concentration to OD ₅₆₀Value is made typical curve.The following Fig. 3 of result is listed.Wherein Y-axis is represented the standard fructose concentration, and X-axis is represented the OD under a certain standard fructose concentration ₅₆₀Value.For example, when the standard fructose concentration is 4mM, its OD ₅₆₀Be 0.24; When the standard fructose concentration is 8mM, its OD ₅₆₀Be 0.49.

Example 17:MGI-4B is used for measuring the content (1) of seminal fluid fructose

Standard fructose curve is as described in the example 16.The control tube water replaces MGI-4B, and standard pipe replaces sample solution with the fructose standardized solution of 10mM.During mensuration, elder generation in 95 ℃ of heating 30 minutes, after centrifugal (15000g, 15 minutes), gets semen sample supernatant liquor and measures, the according to the form below operation.Each pipe is cooled to room temperature rapidly in 75 ℃ of reactions 30 minutes then.Reaction product D-glucose assays according to the facts example 10 carries out, and tries to achieve and respectively manages OD ₅₆₀

	Sample hose	Standard pipe	Control tube
				Refining	450μl
	0	450μl
			10mM fructose reference liquid	0	450μl	0
Deionized water	0	0					50μl
			20U/ml MGI-4B	50μl	50μ1			0

The fructose concentration of seminal fluid calculates by following formula:

The fructose concentration of seminal fluid=(OD that sample hose is surveyed ₅₆₀OD that-control tube is surveyed ₅₆₀) ÷ OD that standard pipe is surveyed ₅₆₀The concentration of * standard pipe fructose.The semen sample that adopts in this example is one 30 years old male sex's a seminal fluid, the OD of the sample hose that records, control tube and standard pipe ₅₆₀Be respectively 0.854,0.012 and 0.654, then this seminal fluid fructose content is: (0.854-0.012) ÷ 0.654 * 10=12.87mM.The normal range of fructose content is 9.11-17.67mmol/L in the seminal fluid.Seminal fluid fructose reduce see seminal vesiculitis, capsule adenositis underdevelopment, and sexual hypofunction etc. due to infertility (" Clinical Laboratory today " Cong Yulong, Shujuan WANG chief editor, China Science Tech Publishing House, version in 1997).

Example 18:MGI-4B is used for measuring the content (2) of seminal fluid fructose

Standard fructose curve is as described in the example 16.The control tube water replaces MGI-4B, and standard pipe replaces sample solution with the fructose standardized solution of 10mM.During mensuration, get about 0.7 milliliter of semen sample to be measured and place the small test tube that about 0.5 gramion exchange resin Chelex 100 (BioRad) is housed, mix, centrifugal (15000g after 10 minutes, 15 minutes), get supernatant liquor and measure, press example 17 listed tableaux method operations.Each pipe is cooled to room temperature rapidly in 75 ℃ of reactions 30 minutes then.Reaction product D-glucose assays according to the facts example 10 carries out, and tries to achieve and respectively manages OD ₅₆₀The method of calculation of the fructose concentration of seminal fluid are with example 17.The semen sample that adopts in this example is one 28 years old male sex's a seminal fluid, the OD of the sample hose that records, control tube and standard pipe ₅₆₀Be respectively 0.921,0.013 and 0.660, then this seminal fluid fructose content is: (0.921-0.013) ÷ 0.660 * 10=13.76mM.

Example 19:MGI-4B is used for measuring the content (3) of seminal fluid fructose

Get three and respectively fill the MGI-4B (about 10 units) of equivalent and the small test tube of about 0.5 gram of ion exchange resin Chelex 100 (BioRad), be denoted as respectively and measure pipe, standard pipe and blank pipe, each pipe adds each 0.5 milliliter in the fructose standardized solution of semen sample to be measured, 10mM and water respectively, mix, each pipe is cooled to room temperature rapidly in 75 ℃ of reactions 30 minutes then, centrifugal (15000g, 15 minutes), get according to the facts example 10 assaying reaction product D-glucose of supernatant liquor, try to achieve and respectively manage OD ₅₆₀The method of calculation of the fructose concentration of seminal fluid are with example 17.The semen sample that adopts in this example is one 38 years old male sex's a seminal fluid, the OD of the sample hose that records, control tube and standard pipe ₅₆₀Be respectively 1.02,0.015 and 0.658, then this seminal fluid fructose content is: (1.02-0.015) ÷ 0.658 * 10=15.27mM.

The present invention is not subjected to the restriction of above-mentioned concrete text description, and the present invention can make various changes in the generalized scope of claims institute.These change all within the scope of the present invention.

Sequence table

＜110〉Bairui Global Co., Ltd. (Bioright Worldwide Company, Ltd.)

＜120〉glucose isomerase mutant and application thereof

<130>FI-040039-59

<160>5

<170>PatentIn version 3.2

<210>1

<211>1320

<212>DNA

<213>Thermoanaerobacterium saccharolyticum

<400>1

atgaataaat attttgagaa cgtatctaaa ataaaatatg aaggaccaaa atcaaataat 60

ccttattcct ttaaatttta caatccagag gaagtaatcg atggcaagac gatggaggag 120

catctccgct tttctatagc ttattggcac acttttactg ctgatggaac agatcaattt 180

ggcaaggcta ctatgcaaag accatggaac cactacacag atcctatgga tatagcgaaa 240

gcaagggtag aagcagcatt tgagtttttt gataagataa atgcaccttt cttctgcttc 300

catgataggg atattgcccc tgaaggagat actcttagag agacaaacaa aaacttagat 360

acaatagttg ctatgataaa ggattactta aagaccagca agacaaaagt tttgtggggt 420

accgcaaatc ttttctccaa tccgagattt gtacatggtg catcaacatc ctgcaatgct 480

gacgtttttg catattctgc agcgcaagtc aaaaaagccc ttgagattac taaggagctt 540

ggccgcgaaa actacgtatt ttggggtgga agagaagggt acgagacgct tctcaataca 600

gatatggagt tagagcttga taactttgca agatttttgc acatggctgt tgactatgca 660

aaggaaatcg gctttgaagg tcagttcttg attgagccga agccaaagga gcctacaaaa 720

catcaatacg actttgacgt ggcaaatgta ttggcattct tgagaaaata cgaccttgac 780

aaatatttca aagtaaatat cgaagcaaac catgcgacat tggcattcca cgacttccaa 840

catgagctaa gatacgccag aataaacggt gtattaggat caattgacgc aaatacaggc 900

gacatgcttt tgggatggga tacggaccag ttccctacag atatacgcat gacaacgctt 960

gctatgtatg aagtcataaa gatgggtgga tttgacaaag gtggccttaa ctttgatgca 1020

aaagtaagac gtgcttcatt tgagccagaa gatcttttct taggtcacat agcaggaatg 1080

gatgcttttg caaaaggctt taaagttgct tacaagcttg tgaaagatgg cgtatttgac 1140

aagttcatcg aagaaagata cgcaagctac aaagaaggca ttggcgctga tattgtaagc 1200

ggtaaagctg acttcaagag ccttgaaaag tatgcattag agcacagcca gattgtaaac 1260

aaatcaggca gacaagagct attagaatca atcctaaatc agtatttgtt tgcagaataa 1320

<210>2

<211>439

<212>PRT

<213>Thermoanaerobacterium saccharolyticum

<400>2

Met Asn Lys Tyr Phe Glu Asn Val Ser Lys Ile Lys Tyr Glu Gly Pro

1 5 10 15

Lys Ser Asn Asn Pro Tyr Ser Phe Lys Phe Tyr Asn Pro Glu Glu Val

20 25 30

Ile Asp Gly Lys Thr Met Glu Glu His Leu Arg Phe Ser Ile Ala Tyr

35 40 45

Trp His Thr Phe Thr Ala Asp Gly Thr Asp Gln Phe Gly Lys Ala Thr

50 55 60

Met Gln Arg Pro Trp Asn His Tyr Thr Asp Pro Met Asp Ile Ala Lys

65 70 75 80

Ala Arg Val Glu Ala Ala Phe Glu Phe Phe Asp Lys ILe Asn Ala Pro

85 90 95

Phe Phe Cys Phe His Asp Arg Asp Ile Ala Pro Glu Gly Asp Thr Leu

100 105 110

Arg Glu Thr Asn Lys Asn Leu Asp Thr Ile Val Ala Met Ile Lys Asp

115 120 125

Tyr Leu Lys Thr Ser Lys Thr Lys Val Leu Trp Gly Thr Ala Asn Leu

130 135 140

Phe Ser Asn Pro Arg Phe Val His Gly Ala Ser Thr Ser Cys Asn Ala

145 150 155 160

Asp Val Phe Ala Tyr Ser Ala Ala Gln Val Lys Lys Ala Leu Glu Ile

165 170 175

Thr Lys Glu Leu Gly Arg Glu Asn Tyr Val Phe Trp Gly Gly Arg Glu

180 185 190

Gly Tyr Glu Thr Leu Leu Asn Thr Asp Met Glu Leu Glu Leu Asp Asn

195 200 205

Phe Ala Arg Phe Leu His Met Ala Val Asp Tyr Ala Lys Glu Ile Gly

210 215 220

Phe Glu Gly Gln Phe Leu Ile Glu Pro Lys Pro Lys Glu Pro Thr Lys

225 230 235 240

His Gln Tyr Asp Phe Asp Val Ala Asn Val Leu Ala Phe Leu Arg Lys

245 250 255

Tyr Asp Leu Asp Lys Tyr Phe Lys Val Asn Ile Glu Ala Asn His Ala

260 265 270

Thr Leu Ala Phe His Asp Phe Gln His Glu Leu Arg Tyr Ala Arg Ile

275 280 285

Asn Gly Val Leu Gly Ser Ile Asp Ala Asn Thr Gly Asp Met Leu Leu

290 295 300

Gly Trp Asp Thr Asp Gln Phe Pro Thr Asp ILe Arg Met Thr Thr Leu

305 310 315 320

Ala Met Tyr Glu Val Ile Lys Met Gly Gly Phe Asp Lys Gly Gly Leu

325 330 335

Asn Phe Asp Ala Lys Val Arg Arg Ala Ser Phe Glu Pro Glu Asp Leu

340 345 350

Phe Leu Gly His Ile Ala Gly Met Asp Ala Phe Ala Lys Gly Phe Lys

355 360 365

Val Ala Tyr Lys Leu Val Lys Asp Gly Val Phe Asp Lys Phe Ile Glu

370 375 380

Glu Arg Tyr Ala Ser Tyr Lys Glu Gly Ile Gly Ala Asp Ile Val Ser

385 390 395 400

Gly Lys Ala Asp Phe Lys Ser Leu Glu Lys Tyr Ala Leu Glu His Ser

405 410 415

Gln Ile Val Asn Lys Ser Gly Arg Gln Glu Leu Leu Glu Ser Ile Leu

420 425 430

Asn Gln Tyr Leu Phe Ala Glu

435

<210>3

<211>1320

<212>DNA

<213>Thermoanaerobacterium saccharolyticum

<220>

<221>misc feature

<222>(415)..(417)

＜223〉" n " represents a, t, g or c; And any codon of " nnn " representative except that tryptophane

<220>

<221>misc feature

<222>(544)..(546)

＜223〉" n " represents a, t, g or c; And any codon of " nnn " representative except that arginine

<220>

<221>misc_feature

<222>(556)..(558)

＜223〉" n " represents a, t, g or c; And any codon of " nnn " representative except that Xie Ansuan

<220>

<221>misc_feature

<222>(559)..(561)

＜223〉" n " represents a, t, g or c; And any codon of " nnn " representative except that phenylalanine

<220>

<221>misc feature

<222>(895)..(897)

＜223〉" n " represents a, t, g or c; And any codon of " nnn " representative except that Threonine

<400>3

atgaataaat attttgagaa cgtatctaaa ataaaatatg aaggaccaaa atcaaataat 60

ccttattcct ttaaatttta caatccagag gaagtaatcg atggcaagac gatggaggag 120

catctccgct tttctatagc ttattggcac acttttactg ctgatggaac agatcaattt 180

ggcaaggcta ctatgcaaag accatggaac cactacacag atcctatgga tatagcgaaa 240

gcaagggtag aagcagcatt tgagtttttt gataagataa atgcaccttt cttctgcttc 300

catgataggg atattgcccc tgaaggagat actcttagag agacaaacaa aaacttagat 360

acaatagttg ctatgataaa ggattactta aagaccagca agacaaaagt tttgnnnggt 420

accgcaaatc ttttctccaa tccgagattt gtacatggtg catcaacatc ctgcaatgct 480

gacgtttttg catattctgc agcgcaagtc aaaaaagccc ttgagattac taaggagctt 540

ggcnnngaaa actacnnnnn ntggggtgga agagaagggt acgagacgct tctcaataca 600

gatatggagt tagagcttga taactttgca agatttttgc acatggctgt tgactatgca 660

aaggaaatcg gctttgaagg tcagttcttg attgagccga agccaaagga gcctacaaaa 720

catcaatacg actttgacgt ggcaaatgta ttggcattct tgagaaaata cgaccttgac 780

aaatatttca aagtaaatat cgaagcaaac catgcgacat tggcattcca cgacttccaa 840

catgagctaa gatacgccag aataaacggt gtattaggat caattgacgc aaatnnnggc 900

gacatgcttt tgggatggga tacggaccag ttccctacag atatacgcat gacaacgctt 960

gctatgtatg aagtcataaa gatgggtgga tttgacaaag gtggccttaa ctttgatgca 1020

aaagtaagac gtgcttcatt tgagccagaa gatcttttct taggtcacat agcaggaatg 1080

gatgcttttg caaaaggctt taaagttgct tacaagcttg tgaaagatgg cgtatttgac 1140

aagttcatcg aagaaagata cgcaagctac aaagaaggca ttggcgctga tattgtaagc 1200

ggtaaagctg acttcaagag ccttgaaaag tatgcattag agcacagcca gattgtaaac 1260

aaatcaggca gacaagagct attagaatca atcctaaatc agtatttgtt tgcagaataa 1320

<210>4

<211>439

<212>PRT

<213>Thermoanaerobacterium saccharolyticum

<220>

<221>MISC_FEATURE

<222>(139)..(139)

＜223〉any amino acid of " Xaa " representative except that tryptophane

<220>

<221>MISC_FEATURE

<222>(182)..(182)

＜223〉any amino acid of " Xaa " representative except that arginine

<220>

<221>MISC_FEATURE

<222>(186)..(186)

＜223〉any amino of " Xaa " representative except that Xie Ansuan

<220>

<221>MISC_FEATURE

<222>(187)..(187)

＜223〉any amino acid of " Xaa " representative except that phenylalanine

<220>

<221>MISC_FEATURE

<222>(299)..(299)

＜223〉any amino acid of " Xaa " representative except that Threonine

<400>4

Met Asn Lys Tyr Phe Glu Asn Val Ser Lys Ile Lys Tyr Glu Gly Pro

1 5 10 15

Lys Ser Asn Asn Pro Tyr Ser Phe Lys Phe Tyr Asn Pro Glu Glu Val

20 25 30

Ile Asp Gly Lys Thr Met Glu Glu His Leu Arg Phe Ser Ile Ala Tyr

35 40 45

Trp His Thr Phe Thr Ala Asp Gly Thr Asp Gln Phe Gly Lys Ala Thr

50 55 60

Met Gln Arg Pro Trp Asn His Tyr Thr Asp Pro Met Asp Ile Ala Lys

65 70 75 80

Ala Arg Val Glu Ala Ala Phe Glu Phe Phe Asp Lys Ile Asn Ala Pro

85 90 95

Phe Phe Cys Phe His Asp Arg Asp Ile Ala Pro Glu Gly Asp Thr Leu

100 105 110

Arg Glu Thr Asn Lys Asn Leu Asp Thr Ile Val Ala Met Ile Lys Asp

115 120 125

Tyr Leu Lys Thr Ser Lys Thr Lys Val Leu Xaa Gly Thr Ala Asn Leu

130 135 140

Phe Ser Asn Pro Arg Phe Val His Gly Ala Ser Thr Ser Cys Asn Ala

145 150 155 160

Asp Val Phe Ala Tyr Ser Ala Ala Gln Val Lys Lys Ala Leu Glu Ile

165 170 175

Thr Lys Glu Leu Gly Xaa Glu Asn Tyr Xaa Xaa Trp Gly Gly Arg Glu

180 185 190

Gly Tyr Glu Thr Leu Leu Asn Thr Asp Met Glu Leu Glu Leu Asp Asn

195 200 205

Phe Ala Arg Phe Leu His Met Ala Val Asp Tyr Ala Lys Glu Ile Gly

210 215 220

Phe Glu Gly Gln Phe Leu Ile Glu Pro Lys Pro Lys Glu Pro Thr Lys

225 230 235 240

His Gln Tyr Asp Phe Asp Val Ala Asn Val Leu Ala Phe Leu Arg Lys

245 250 255

Tyr Asp Leu Asp Lys Tyr Phe Lys Val Asn Ile Glu Ala Asn His Ala

260 265 270

Thr Leu Ala Phe His Asp Phe Gln His Glu Leu Arg Tyr Ala Arg Ile

275 280 285

Asn Gly Val Leu Gly Ser Ile Asp Ala Asn Xaa Gly Asp Met Leu Leu

290 295 300

Gly Trp Asp Thr Asp Gln Phe Pro Thr Asp Ile Arg Met Thr Thr Leu

305 310 315 320

Ala Met Tyr Glu Val Ile Lys Met Gly Gly Phe Asp Lys Gly Gly Leu

325 330 335

Asn Phe Asp Ala Lys Val Arg Arg Ala Ser Phe Glu Pro Glu Asp Leu

340 345 350

Phe Leu Gly His Ile Ala Gly Met Asp Ala Phe Ala Lys Gly Phe Lys

355 360 365

Val Ala Tyr Lys Leu Val Lys Asp Gly Val Phe Asp Lys Phe Ile Glu

370 375 380

Glu Arg Tyr Ala Ser Tyr Lys Glu Gly Ile Gly Ala Asp lle Val Ser

385 390 395 400

Gly Lys Ala Asp Phe Lys Ser Leu Glu Lys Tyr Ala Leu Glu His Ser

405 410 415

Gln Ile Val Asn Lys Ser Gly Arg Gln Glu Leu Leu Glu Ser Ile Leu

420 425 430

Asn Gln Tyr Leu Phe Ala Glu

435

<210>5

<211>439

<212>PRT

<213>Thermoanaerobacterium saccharolyticum

<400>5

Met Asn Lys Tyr Phe Glu Asn Val Ser Lys Ile Lys Tyr Glu Gly Pro

1 5 10 15

Lys Ser Asn Asn Pro Tyr Ser Phe Lys Phe Tyr Asn Pro Glu Glu Val

20 25 30

Ile Asp Gly Lys Thr Met Glu Glu His Leu Arg Phe Ser Ile Ala Tyr

35 40 45

Trp His Thr Phe Thr Ala Asp Gly Thr Asp Gln Phe Gly Lys Ala Thr

50 55 60

Met Gln Arg Pro Trp Asn His Tyr Thr Asp Pro Met Asp Ile Ala Lys

65 70 75 80

Ala Arg Val Glu Ala Ala Phe Glu Phe Phe Asp Lys Ile Asn Ala Pro

85 90 95

Phe Phe Cys Phe His Asp Arg Asp Ile Ala Pro Glu Gly Asp Thr Leu

100 105 110

Arg Glu Thr Asn Lys Asn Leu Asp Thr Ile Val Ala Met Ile Lys Asp

115 120 125

Tyr Leu Lys Thr Ser Lys Thr Lys Val Leu Phe Gly Thr Ala Asn Leu

130 135 140

Phe Ser Asn Pro Arg Phe Val His Gly Ala Ser Thr Ser Cys Asn Ala

145 150 155 160

Asp Val Phe Ala Tyr Ser Ala Ala Gln Val Lys Lys Ala Leu Glu Ile

165 170 175

Thr Lys Glu Leu Gly Ala Glu Asn Tyr Thr Phe Trp Gly Gly Arg Glu

180 185 190

Gly Tyr Glu Thr Leu Leu Asn Thr Asp Met Glu Leu Glu Leu Asp Asn

195 200 205

Phe Ala Arg Phe Leu His Met Ala Val Asp Tyr Ala Lys Glu Ile Gly

210 215 220

Phe Glu Gly Gln Phe Leu Ile Glu Pro Lys Pro Lys Glu Pro Thr Lys

225 230 235 240

His Gln Tyr Asp Phe Asp Val Ala Asn Val Leu Ala Phe Leu Arg Lys

245 250 255

Tyr Asp Leu Asp Lys Tyr Phe Lys Val Asn Ile Glu Ala Asn His Ala

260 265 270

Thr Leu Ala Phe His Asp Phe Gln His Glu Leu Arg Tyr Ala Arg Ile

275 280 285

Asn Gly Val Leu Gly Ser Ile Asp Ala Asn Gln Gly Asp Met Leu Leu

290 295 300

Gly Trp Asp Thr Asp Gln Phe Pro Thr Asp Ile Arg Met Thr Thr Leu

305 310 315 320

Ala Met Tyr Glu Val Ile Lys Met Gly Gly Phe Asp Lys Gly Gly Leu

325 330 335

Asn Phe Asp Ala Lys Val Arg Arg Ala Ser Phe Glu Pro Glu Asp Leu

340 345 350

Phe Leu Gly His Ile Ala Gly Met Asp Ala Phe Ala Lys Gly Phe Lys

355 360 365

Val Ala Tyr Lys Leu Val Lys Asp Gly Val Phe Asp Lys Phe Ile Glu

370 375 380

Glu Arg Tyr Ala Ser Tyr Lys Glu Gly Ile Gly Ala Asp Ile Val Ser

385 390 395 400

Gly Lys Ala Asp Phe Lys Ser Leu Glu Lys Tyr Ala Leu Glu His Ser

405 410 415

Gln Ile Val Asn Lys Ser Gly Arg Gln Glu Leu Leu Glu Ser Ile Leu

420 425 430

Asn Gln Tyr Leu Phe Ala Glu

435

Claims (15)

1. glucose isomerase mutant, it is characterized in that with the SEQ ID NO.:2 in the sequence table be reference sequences, have the 186th sudden change and be selected from the 139th, the 182nd, at least three sudden changes of the 187th and the 299th, described the 139th tryptophane sports Methionin (Lys), or Serine (Ser), or halfcystine (Cys), or Isoleucine (Ile), or Threonine (Thr), or l-asparagine (Asn), or phenylalanine (Phe), described the 182nd arginine sports proline(Pro) (Pro), or Serine (Ser), or L-Ala (Ala), or Isoleucine (Ile), or Threonine (Thr), or Xie Ansuan (Val), described the 186th Xie Ansuan sports Threonine (Thr), or L-Ala (Ala), or aspartic acid (Asp), described the 187th phenylalanine sports glycine (Gly), or Serine (Ser), or L-Ala (Ala), or proline(Pro) (Pro), and described the 299th Threonine sports Isoleucine (Ile), or tyrosine (Tyr), or halfcystine (Cys), or methionine(Met) (Met), or L-glutamic acid (Glu), or glutamine (Gln).

2. the described glucose isomerase mutant of claim 1, it is characterized in that having the listed aminoacid sequence of SEQ ID NO.:4, wherein on behalf of phenylalanine (Phe), the 182nd X, the 139th X represent L-Ala (Ala), the 186th X to represent Threonine (Thr), the 187th X represents phenylalanine, and the 299th X represents glutamine (Gln) simultaneously.

3. DNA, it contains the nucleotide sequence of coding claim 1 or 2 described glucose isomerase mutants.

4. plasmid, it contains the described DNA of claim 3.

5. the described plasmid of claim 4, it contains the DNA of aminoacid sequence shown in the coding SEQ ID NO.:5.

6. the application of claim 1 or 2 described glucose isomerase mutants, wherein said glucose isomerase mutant is used to measure fructose content.

7. the described application of claim 6, wherein said glucose isomerase mutant is used to measure human seminal fluid's fructose content.

8. a method of measuring fructose content in people's seminal fluid comprises the steps:

1) obtains people's seminal fluid sample;

2) claim 1 or 2 described glucose isomerase mutants are joined in the seminal fluid sample, obtain reaction mixture;

3) reaction mixture was reacted 20-40 minute at 65-80 ℃; With

4) record the fructose content that reacts in the end afterreaction mixture.

9. the described method of claim 8 wherein carry out step 2) before, also comprise the proteic step of removing in the seminal fluid sample.

10. the described method of claim 9 wherein saidly removes that proteic step realizes by the seminal fluid sample is contacted with ion exchange resin in the seminal fluid.

11. the described method of claim 9, wherein said remove in the seminal fluid sample proteic step by with the seminal fluid sample 90-100 ℃ of heating centrifugal again realization after 20-40 minute.

12. each described method of claim 8-11, wherein reaction mixture reacted 30 minutes down at 75 ℃ in step 4).

13. a test kit that is used for measuring people's seminal fluid fructose content is characterized in that containing claim 1 or 2 described glucose isomerase mutants.

14. the described test kit of claim 13 also comprises

-ion exchange resin; With

-glucose oxidase.

15. claim 13 or 14 described test kits also comprise the fructose concentration standardized solution.

Images