CN1729293A

CN1729293A - Novel method for the production of polyunsaturated fatty acids

Info

Publication number: CN1729293A
Application number: CNA200380106787XA
Authority: CN
Inventors: J·A·内皮尔; O·萨亚诺娃; C·M·拉扎勒斯; B·齐; E·海因茨; T·灿克; U·策林格
Original assignee: University of Bristol
Current assignee: University of Bristol
Priority date: 2002-12-19
Filing date: 2003-12-11
Publication date: 2006-02-01
Anticipated expiration: 2023-12-11
Also published as: GB0229578D0; CN100412197C

Abstract

The present invention relates to an improved process for the specific production of poly-unsaturated omega-3 and omega-6 fatty acids and a process for the production of triglycerides having an increased content of unsaturated fatty acids, in particular omega-3 and omega-6 fatty acids having at least two double bonds and a 20 or 22 carbon atom chain length. The invention relates to the produc-tion of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, hav-ing an increased content of fatty acids, oils or lipids containing C20- or C22- fatty acids with a delta-5, 7, 8, 10 double bond, respectively due to the expression of a delta-8-desaturase and a delta-9- elon-gase from organisms such as plants preferably Algae like Isochrysis galbana or Euglena gracilis. In addition the invention relates to a process for the production of poly unsaturated fatty acids such as Eicosapentaenoic, Arachidonic, Docosapentaenoic or Docosahexaenoic acid through the co- expression of a delta -8-desaturase, a delta-9-elongase and a delta-5 desaturase in organisms such as microorganisms or plants.The invention additionally relates to the use of specific nucleic acid sequences encoding for the aforementioned proteins with delta-8-desaturase-, delta-9-elongase- or delta-5-desaturase-activity, nucleic acid constructs, vectors and organisms containing said nucleic acid sequences. The invention further relates to unsaturated fatty acids and triglycerides having an increased content of at least 1 % by weight of unsaturated fatty acids and use thereof.

Description

Produce the method for polyunsaturated fatty acid

Invention field

The present invention relates to improving one's methods of special production how unsaturated ω-3 and ω-6 lipid acid; With the method for the triglyceride level of producing the unsaturated fatty acid content increase, wherein said unsaturated fatty acids especially has the ω-3 and ω-6 lipid acid of at least two two keys and 20 or 22 carbon atom chain length.The present invention relates to the generation of genetically modified organism, preferred transgenic plant or transgenic microorganism wherein comprise the C that has Δ-5,7,8,10 pair key respectively ₂₀-or C ₂₂-lipid acid increases at the content of interior lipid acid, oil or lipid, this increase is attributable to the expression that prolongs enzyme (elongase) from such as biological Δ 8-desaturase such as plant and Δ 9-, described plant optimization algae such as IsochrysisgalbauaParke or tiny Euglena.In addition, the invention still further relates to the coexpression that prolongs enzyme and Δ-5-desaturase by such as Δ in the biologies such as microorganism or plant-8-desaturase, Δ-9-, produce method such as polyunsaturated fatty acids such as timnodonic acid, arachidonic acid, clupanodonic acid or docosahexenoic acids.

The present invention also relates to the purposes that coding has Δ-8-desaturase, Δ-9-prolongation enzyme or the active aforementioned proteinic specific nucleic acid squences of Δ-5-desaturase, the nucleic acid construct that contains described nucleotide sequence, carrier and organism in addition.The present invention also relates to triglyceride level of the unsaturated fatty acids and the unsaturated fatty acids of the increase content with at least 1% weight and uses thereof in addition.

Background technology

Lipid acid and triglyceride level have purposes widely in the industry at foodstuffs industry, animal nutrition, makeup and medicine.Depend on that whether they be saturated or unsaturated fatty acids of free or the triglyceride level with saturated or unsaturated fatty acids that content increases, they are applicable to multiple use; Therefore, for example, with polyunsaturated fatty acid (=PUFA) add in the steamer to improve its nutritive value.Various lipid acid and triglyceride level are mainly available from such as microorganism such as genus mortierella or such as oil-produced vegetables such as soybean, oilseed rape, Sunflower Receptacles, and wherein they obtain with the form of triacylglycerol ester usually.Perhaps, they can be easily available from such as animals such as fishes.Prepare free fatty acids easily by hydrolysis.The oil that whether preferably has unsaturated fatty acids or have a saturated fatty acid depends on application target; Therefore, for example, in the human nutriology, preferably has the lipid of unsaturated fatty acids, especially polyunsaturated fatty acid, because they are for the cholesterol levels in the blood and come that therefrom the possibility that suffers from a heart complaint is had positive influence.They can be used in various nutritive food or the medicine.In addition, PUFA is generally used in food, feed and the cosmetic industry.Many unsaturated ω-3-and/or ω-6-lipid acid is an important component among animal-feed and the human food prods.Because human food prods's common composition should add how unsaturated omega-3-fatty acid (it is the basal component of fish oil) in the food to improve Nutritive value of food; Therefore, for example, as mentioned above will be such as docosahexenoic acid (=DHA, C _22:6 ^{Δ 4,7,10,13,16,19}) or timnodonic acid (=EPA, C _20:5 ^{Δ 5,8,11,14,17}) wait polyunsaturated fatty acid to add in the steamer to improve its nutritive value.And DHA has active influence to the growth of baby's brain.The how unsaturated omega-fatty acid of preferred interpolation is because add how unsaturated ω-6 lipid acid such as arachidonic acid (=ARA, C in bread and cheese _20:4 ^{Δ 5,8,11,14}) to having undesirable result such as rheumatisms such as rheumatoid arthritiss.Many unsaturated ω-3 and ω-6 lipid acid are the precursors that is called as the paracrine hormone family of eicosanoid such as prostaglandin(PG) etc., and they are the metabolic products of Dihomo-gamma-linoleic acid, ARA or EPA.In other critical function of the adjusting of initial, the circulation of blood of the adjusting of lipolysis, Inflammatory response and blood pressure and health, all relate to eicosanoid.Eicosanoid comprises prostaglandin(PG), leukotrienes, thromboxane and prostacyclin.As if omega-fatty acid mainly come prevention of arterial sclerosis (artherosclerosis) and cardiovascular disorder by the level of regulating different eicosanoids.Other eicosanoid is thromboxane and leukotrienes, and they are the metabolic products of ARA or EPA.

Substantially; such as microorganism such as genus mortierella or such as oil-produced vegetable such as soybean, oilseed rape or Sunflower Receptacle or such as algae such as Crytocodinium or brown algae genus is the common source that contains the oils of PUFA, and wherein they obtain with the form of its triacylglycerol ester usually.Perhaps, they can be easily available from animal such as fish.Can prepare free lipid acid easily by using such as highly basic hydrolysis such as potassium hydroxide or sodium hydroxide.Such as DHA, EPA, ARA, Dihomo-gamma-linoleic acid (C _20:3 ^{Δ 8,11,14}) or clupanodonic acid (=DPA, C _22:5 ^{Δ 7,10,13,16,19}) wait that more the high-grade polyunsaturated fatty acid can not be by producing such as oil-produced vegetables such as soybean, oilseed rape, safflower or Sunflower Receptacles.The natural origin of said lipid acid is for example fish or algae such as black carp, salmon, sardines, snapper, common eel, carp, trout, halibut, mackerel, zander or tuna.

Because their available characteristic, done many trials in the past and prepared and participate in lipid acid or triglyceride level synthetic gene so that in various organisms, produce oil with the unsaturated fatty acids that changes content.Therefore, in WO 91/13972 and its U.S.'s patent families, a kind of Δ-9-desaturase has been described.In WO 93/11245, announce Δ-15-desaturase, in WO 94/11516, announced Δ-12-desaturase.WO 00/34439 has announced Δ-5-and Δ-8-desaturase.Other desaturase is consulted, for example, EP-A-0550162, WO94/18337, WO97/30582, WO97/21340, WO95/18222, EP-A-0794250, Stukey etc., J.Biol.Chem., 265,1990:20144-20149, Wada etc., Nature347,1990:200-203 or Huang etc., Lipids34,1999:649-659.But, up to now, only on biochemistry, various desaturases have been carried out inadequate sign, because the enzyme of membrane bound protein form is separated and characterizes have very big difficulty (McKeon etc., Enzymology method (Methods in Enzymol) 71,1981:12141-12147, Wang etc., Plant Physiol.Biochem., 26,1988:777-792).Usually, film is by being introduced in the suitable organism in conjunction with the sign of desaturase, studies in the mode of analyzing parent material and product then that its enzymic activity finishes.Δ-6-desaturase is consulted WO 93/06712, US5614393, US5614393, WO 96/21022, WO 0021557 and WO 99/27111, and their application are aborning consulted in genetically modified organism, as, WO 9846763, WO 9846764 and WO 9846765.Simultaneously, the expression of various fatty acid biological synthetic genes, described in WO 9964616 or WO 9846776, and the formation of polyunsaturated fatty acid also has description and patent application.Expression efficiency and they influences as for desaturase to polyunsaturated fatty acid formation, what can mention is, by the expression of described desaturase and prolongation enzyme up to now, only obtained the polyunsaturated fatty acid/lipid of low levels, such as timnodonic acid or arachidonic acid.Therefore, need other more effective approach that output is increased.

Therefore, be a long felt need for new and more suitable gene, these genes encodings participate in the biosynthetic enzyme of unsaturated fatty acids and make and can produce some lipid acid and not have unwanted by-products to form to be specific to plant-scale mode.When selecting gene to be used for biosynthesizing, more than two characteristics be even more important.On the other hand, but still need improved method and be used to obtain the polyunsaturated fatty acid of high intrinsic energy.

Therefore, an object of the present invention is to provide and be used at the desaturase of organism (preferably in microorganism and plant) synthesize polyunsaturated fatty acid and prolong the gene of enzyme, and in commercial run, they are used to produce polyunsaturated fatty acid.In the raising organism that said method should be high as far as possible, the PUFA content in the seed of preferred oil-produced vegetable.

Summary of the invention

We have found can reach this purpose by the method that is used for producing at genetically modified organism following general formula compound,

Wherein, in this genetically modified organism, by weight, the content of described compound account for described organism total lipid content at least 1%,

Said method comprising the steps of:

A) nucleotide sequence that at least a coded delta-9-is prolonged enzyme is introduced in the transgenic organism,

B) introduce second nucleotide sequence of at least a coded delta-8-desaturase,

C) if necessary, introduce at least a coded delta-5-desaturase the 3rd nucleotide sequence and

D) cultivate and gather in the crops said organism,

Variable and substituting group among its Chinese style I have following implication:

R ¹=hydroxyl-, coenzyme A-(thioesters), phosphatidylcholine-, phosphatidylethanolamine-, phosphatidyl glycerol-, diphosphatidylglycerol-, phosphatidylserine-, phosphatidylinositols-, sphingolipid-, sphingoglycolipid-or the group of general formula I I:

Substituting group among its Chinese style II has following implication:

R ²=hydrogen-, phosphatidylcholine-, phosphatidylethanolamine-, phosphatidyl glycerol-, diphosphatidylglycerol-, phosphatidylserine-, phosphatidylinositols-, sphingolipid-, sphingoglycolipid-, sphingoglycolipid-saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl-,

R ³=hydrogen-, saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl-, or

R ²And R ³Be the group of formula Ia independently of each other:

N=3,4 or 6, m=3,4 or 5 and p=0 or 3, preferred n=3, m=4 or 5 and p=0 or 3.

R ¹In formula I, represent hydroxyl-, acetyl-CoA-, phosphatidylcholine-, phosphatidylethanolamine-, phosphatidyl glycerol-, diphosphatidylglycerol-, phosphatidylserine-, phosphatidylinositols-, sphingolipid-, sphingoglycolipid-or the group of general formula I I

Above-mentioned R ¹Group is usually with the form of its ester or thioesters and the compound coupling of general formula I.

R ²In the structure of general formula I I, represent hydrogen, phosphatidylcholine-, phosphatidylethanolamine-, phosphatidyl glycerol-, diphosphatidylglycerol-, phosphatidylserine-, phosphatidylinositols-, sphingolipid-, sphingoglycolipid-, sphingoglycolipid-saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl-group.

The alkyl that can be mentioned is to be substituted or unsubstituted, saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl chain, such as the ethyl carbonyl-, the n-propyl carbonyl-, the normal-butyl carbonyl-, the n-pentyl carbonyl-, the n-hexyl carbonyl-, the n-heptyl carbonyl-, the n-octyl carbonyl-, the n-nonyl carbonyl-, positive decyl carbonyl-, n-undecane base carbonyl-, the dodecyl carbonyl-, n-tridecane base carbonyl-, n-tetradecane base carbonyl-, Pentadecane base carbonyl-, the n-hexadecyl carbonyl-, n-heptadecane base carbonyl-, Octadecane base carbonyl-, NSC 77136 base carbonyl-, NSC 62789 base carbonyl-, n-docosane base carbonyl-or n-tetracosane base carbonyl-, they comprise one or more pairs of keys.Preferred saturated or undersaturated C ₁₀-C ₂₂-alkyl-carbonyl group, such as positive decyl carbonyl-, n-undecane base carbonyl-, the dodecyl carbonyl-, n-tridecane base carbonyl-, n-tetradecane base carbonyl-, Pentadecane base carbonyl-, the n-hexadecyl carbonyl-, n-heptadecane base carbonyl-, Octadecane base carbonyl-, NSC 77136 base carbonyl-, NSC 62789 base carbonyl-, n-docosane base carbonyl-or n-tetracosane base carbonyl-, they comprise one or more pairs of keys.Especially preferred is saturated or undersaturated C ₁₀-C ₂₂-alkyl-carbonyl group is such as C ₁₀-alkyl-carbonyl-, C ₁₁-alkyl-carbonyl-, C ₁₂-alkyl-carbonyl-, C ₁₃-alkyl-carbonyl-, C ₁₄-alkyl-carbonyl-, C ₁₆-alkyl-carbonyl-, C ₁₈-alkyl-carbonyl-, C ₂₀-alkyl-carbonyl-, C ₂₂-alkyl-carbonyl-or C ₂₄-alkyl-carbonyl group, they comprise one or more pairs of keys.Especially preferred saturated or undersaturated C ₁₆-C ₂₂-alkyl-carbonyl group is such as C ₁₆-alkyl-carbonyl-, C ₁₈-alkyl-carbonyl-, C ₂₀-alkyl-carbonyl-or C ₂₂-alkyl-carbonyl group, they comprise one or more pairs of keys.Described group comprises especially two, three, four or five two keys.Especially preferred is the group with 20 or 22 carbon atoms that are no more than five two keys, preferred three, four or five two keys.The corresponding lipid acid that all groups are all controlled oneself and mentioned.

R ³In general formula I I structure, represent hydrogen, saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl.

Be substituted or unsubstituted, saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl-group be for example the ethyl carbonyl-, the n-propyl carbonyl-, the normal-butyl carbonyl-, the n-pentyl carbonyl-, the n-hexyl carbonyl-, the n-heptyl carbonyl-, the n-octyl carbonyl-, the n-nonyl carbonyl-, positive decyl carbonyl-, n-undecane base carbonyl-, the dodecyl carbonyl-, n-tridecane base carbonyl-, n-tetradecane base carbonyl-, Pentadecane base carbonyl-, the n-hexadecyl carbonyl-, n-heptadecane base carbonyl-, Octadecane base carbonyl-, NSC 77136 base carbonyl-, NSC 62789 base carbonyl-, n-docosane base carbonyl-, or n-tetracosane base carbonyl-, they comprise one or more pairs of keys.Preferred saturated or undersaturated C ₁₀-C ₂₄-alkyl-carbonyl group, such as positive decyl carbonyl-, n-undecane base carbonyl-, the dodecyl carbonyl-, n-tridecane base carbonyl-, n-tetradecane base carbonyl-, Pentadecane base carbonyl-, the n-hexadecyl carbonyl-, n-heptadecane base carbonyl-, Octadecane base carbonyl-, NSC 77136 base carbonyl-, NSC 62789 base carbonyl-, n-docosane base carbonyl-or n-tetracosane base carbonyl-, they comprise one or more pairs of keys.Especially saturated or undersaturated C ₁₀-C ₂₄-alkyl-carbonyl group is such as C ₁₀-alkyl-carbonyl-, C ₁₁-alkyl-carbonyl-, C ₁₂-alkyl-carbonyl-, C ₁₃-alkyl-carbonyl-, C ₁₄-alkyl-carbonyl-, C ₁₆-alkyl-carbonyl-, C ₁₈-alkyl-carbonyl-, C ₂₀-alkyl-carbonyl-, C ₂₂-alkyl-carbonyl-or C ₂₄-alkyl-carbonyl group, they comprise one or more pairs of keys.Especially preferred is saturated or undersaturated C ₁₆-C ₂₂-alkyl-carbonyl group is such as C ₁₆-alkyl-carbonyl-, C ₁₈-alkyl-carbonyl-, C ₂₀-alkyl-carbonyl-or C ₂₂-alkyl-carbonyl group, they have a plurality of pairs of keys.The C that especially preferably comprises one, two, three or four two keys ₁₈-alkyl-carbonyl group and the C that contains three, four or five two keys ₂₀-alkyl-carbonyl group.All groups are all from corresponding lipid acid.

R ²And R ³The group of in general formula I I structure, representing general formula I a independently of each other:

And the specification of variables among formula I and the Ia is: n=3,4 or 6, m=3,4 or 5 and p=0 or 3.Especially n=3, m=4 or 5 and p=0 or 3.

Above-mentioned radicals R ¹, R ²And R ³Available hydroxyl-or epoxide group replace and maybe can also comprise triple bond.

According to the present invention, used nucleotide sequence is that coding has C ₂₀-Δ 5-or Δ-8 desaturase or C ₁₈-Δ 9-prolongs the separated nucleic acid sequence of the polypeptide of enzymic activity.

Contain formula II group as R according to synthetic of the present invention ¹The formula I material of group preferably comprises different R ²Or R ³The mixture of group.These groups are from different fatty acid molecules---have 4-6 C atom short chain fatty acid, have the medium chain fatty acid of 8-12 C atom and have the longer chain fatty acid of 14-24 C atom, and longer chain fatty acid is preferred.Said longer chain fatty acid is preferably from the favourable C that contains 2-5 two keys ₁₈-or C ₂₀-polyunsaturated fatty acid.In addition, the main chain of formula I is also from aforementioned fatty acids, and it advantageously is different from R ²And R ³This means that the compound that is produced by the inventive method is the triglyceride level with different replacements or unsubstituted, saturated or undersaturated fatty acid ester or thioesters in one aspect of the invention.

According to another aspect of the present invention, especially preferably has the esters of polyunsaturated fatty acids (formula I) of the two keys of 18,20 or 22 fatty acid carbons atom chain lengths and at least two, preferred 3,4 or 5 two keys.

Especially, for eicosadienoic acid, eicosatrienoic acid, eicosatetraenoic acid (arachidonic acid) and timnodonic acid (C20:2n-6, Δ 11,14 in the inventive method; C20:3n-6, Δ 8,11,14; C20:4n-6, Δ 5,8,11,14; C20:3n-3, Δ 11,14,17; C20:4n-3, Δ 8,11,14,17; C20:5n-3, Δ 5,8,11,14,17) synthetic, preferably have the fatty acid molecule of 3,4 or 5 two keys, and arachidonic acid and timnodonic acid are most preferred.We find, can reach this purpose by the combination expression very easily according to three kinds of separated nucleic acid sequences that the present invention's coding has following active polypeptide: have C20-Δ-8-desaturase activity, C18-Δ-9-prolongation enzymic activity and active polypeptide of C20-Δ-5 desaturase.This purpose especially reaches by the coexpression according to separated nucleic acid sequence of the present invention.The C18 lipid acid that has two keys in Δ-9-position prolongs enzyme by the Δ-9-that is used for the inventive method easily and extends.By Δ used in present method-8-desaturase, two keys of Δ-8 position are introduced in the C20 lipid acid.In addition, available Δ-5-desaturase is introduced two keys in the fatty acid molecule in Δ-5 position.

Synthetic C in the inventive method ₁₈-, C ₂₀-and/or C ₂₂The fatty acid ester of-polyunsaturated fatty acid (advantageously with the form of ester or thioesters in triglyceride level); can produce organism from microorganism or plant etc. with following form separates; described form is an oil; the form of lipid or lipid mixt; for example as sphingolipid; phosphoglyceride; lipid; glycolipid is such as sphingoglycolipid; phosphatide is such as phosphatidylethanolamine; phosphatidylcholine; phosphatidylserine; phosphatidyl glycerol; phosphatidylinositols or diphosphatidylglycerol; or as the monoacylglycerol ester; DG ester or triacylglycerol ester or conduct are such as other fatty acid esters such as acetyl-CoA thioesters; they comprise saturated or unsaturated fatty acids; preferably in fatty acid molecule, have at least two, the polyunsaturated fatty acid of preferred at least three two keys.Except with the above-mentioned ester-formin bonded lipid acid, be incorporated into lipid acid or the also available the inventive method generation of free lipid acid in other compound.

Usually; the genetically modified organism that is used for the inventive method for example transgenic microorganism or plant comprises fatty acid ester or lipid acid; it distributes and to be approximately triacylglycerol ester 80-90%, DG ester 2-5%, monoacylglycerol ester 5-10%, free fatty acids 1-5% and phosphatidase 12-8% by weight, and wherein all to add total amount together be 100% weight to aforesaid compound.

In the inventive method [odd number should comprise plural number, and vice versa], with reference to the total lipid content of used organism in present method, produce and be at least 1% by weight, preferably be at least 2,3,4 or 5%, more preferably be at least 6,7,8 or 9%, most preferably 10,20 or 30% formula I compound.The preferred raw material that is used for the inventive method is linolic acid (C18:2) and/or linolenic acid (C18:3), and they can be transformed into preferred end product ARA or EPA.Because the inventive method uses organism to implement, so the product of this method itself is not a kind of pure substance.It is the mixture of cotype I material not, and wherein one or more compounds are primary products, and in other only be included in as by product.When linoleic acid plus linolenic acid was obtainable in present method used organism, end product was the mixture of ARA and EPA.Advantageously, by product should be no more than by weight organism total lipid content 20%, preferred by product is no more than 15% weight, more preferably no more than 10% weight, is most preferably not exceeding 5% weight.The preferred use contained as raw-material linolic acid or linolenic organism in present method, thereby only produces ARA or EPA as present method end product.When EPA and ARA produce together, the ratio that their produce should be at least 1: 2 (EPA: ARA), preferably be at least 1: 3, more preferably be at least 1: 4, most preferably be at least 1: 5.When the mixture such as ARA and different lipid acid such as EPA is the product of the inventive method, said lipid acid can carry out further purifying with method known to those skilled in the art, such as the combination of distillation, extracting, low temperature crystallization, chromatography or described method.

The inventive method may further comprise the steps easily:

A) in plant, express at least a coding and have the nucleotide sequence that Δ-9 prolongs the enzyme of enzymic activity,

B) nucleotide sequence of at least a coding of expression C20-specificity Δ-8 desaturase,

C) randomly express the 3rd nucleotide sequence of coding C20-specificity Δ-5 desaturase,

D) cultivate transgenic plant and gather in the crops seed subsequently.

In principle, all host living beings all can be used in the inventive method, and transgenic organism for example is as plant, as mosses; Green, red, brown or blue-green algae; Monocotyledons or dicotyledons.Advantageously in the inventive method as herein described, utilize such as produce oil genetically modified organisms (for the present invention, odd number should comprise plural number, and vice versa) such as fungi, bacterium, algae, mosses or plants.Favourable organism in addition is animal or preferably plant or its part.Fungi, yeast or plant optimization use, especially preferred fungi or plant, preferred plant especially, as contain the oilseeds plant of high-load lipid compounds, such as oilseed rape, opium poppy, leaf mustard, hemp, castor-oil plant, flax, olive, mary bush, punica, fibert, apricot, Queensland nut, avocado, pumpkin, English walnut, bay, pistachio, Flower of Beltleaf Primrose, canola, peanut, linseed oil, soybean, safflower, Sunflower Receptacle, the Borrago officinalis, or such as corn, wheat, rye, oat, triticale, rice, barley, cotton, cassava, pepper, plants such as Flower of Aztec Marigold, such as potato, tobacco, plant of Solanaceae such as eggplant and tomato, the Vicia kind, pea, alfalfa, shrub plant (coffee, cocoa, tea), sallow, tree (oil palm, coconut) and perennial grass and fodder crop.The especially preferred plant of the present invention is the oilseeds plants, Semen Brassicae campestris, opium poppy, leaf mustard, hemp, castor-oil plant, flax, olive, mary bush, punica, fibert, apricot, Queensland nut, avocado, pumpkin, bay, Pistacia vera, Flower of Beltleaf Primrose, canola, peanut, Semen Lini, soybean, safflower, Sunflower Receptacle, Borrago officinalis or tree (oil palm, coconut).C most preferably _18:2-and/or C _18:3The plant that-lipid acid is abundant is such as hemp, flax, Semen Lini, opium poppy, pumpkin, English walnut, tobacco, cotton, safflower or Sunflower Receptacle.

Depend on nucleic acid used in the inventive method and/or organism, can synthesize different compound of Formula I.In addition, depend on plant used in present method or fungi, can produce free or combining form formula I compound different mixtures or such as single compounds such as arachidonic acid or timnodonic acids.Used organism contains preferably C in the inventive method _18:2-or C _18:3When-lipid acid synthesizes precursor as lipid acid, can synthesize different polyunsaturated fatty acids, for example, from C _18:2-lipid acid gamma-linoleic acid begins, and can produce dihomo-gamma-linoleic acid or arachidonic acid, perhaps from C _18:3-lipid acid therapic acid (stearidonic acid) beginning can produce eicosatetraenoic acid or timnodonic acid.By influencing the different genes or the activity of its gene product, can produce different simplification compound or compound.When utilizing the organism that lives in the methods of the invention, raw material means thick lipid and/or the thick oil of separation from this organism, and it preferably comprises at least some initial compounds in product, such as C _18:2-or C _18:3-lipid acid or their combination, and the activity that depends on nucleotide sequence and gene product thereof, the lipid acid intermediate of biosynthesizing chain.Said initial compounds or the intermediate concentration in product is lower than separation from 20% or 15% of the total fatty acids weight of used organism, preferably is lower than 10,9,8,7 or 6%, more preferably less than 5,4,3,2 or 1%.

Transgenic plant are interpreted as referring to single vegetable cell and their cultures on solid medium or liquid nutrient medium, part and the whole strain plant of plant, such as plant cell cultures, from the protoplastis of plant, callus culture thing or plant tissue are such as leaf, stem, seed, flower, root etc.Said transgenic plant for example can be incubated on solid or the liquid nutrient medium, or carry out soil and cultivate or water planting.

After cultivating, the preferred transgenic plant sale of transgenic organism used in the inventive method can be need not to separate the compound of general formula I.Preferably, the compound of general formula I separates from said organism with the form of its free fatty acids, lipid or oil.Can finish purifying with ordinary method,, perhaps replace extractive other method, such as the combination of distillation, low temperature crystallization, chromatography or said method such as extruding and the extracting of plant.Method is before extruding and extraction steps plant to be ground, heats and/or evaporation easily.Utilize the hexane equal solvent as extractive solvent.By isolating oil being carried out further purifying with for example phosphoric acid acidifying.Free fatty acids produces from said oil or lipid by hydrolytic action.With the dyestuff in gac or the diatomite removal liquid.In another preferred embodiment of the inventive method, effective for treatment of premature ejaculation produces from oil and lipid by the transesterification of conventional chemical or zymetology.Preferable methods is to produce alkyl ester down at the alcoholate existence condition such as corresponding lower alcohols such as methylate or ethylate (C1 to C10 alcohol is such as methyl alcohol, ethanol, propyl alcohol, butanols, hexanol etc.).Therefore, as is known to persons skilled in the art, under the condition that the alkali (such as NaOH or KOH) of catalytic amount exists, alcohol is added in oil or the lipid.

In the preferred form of the inventive method, after cultivating organism, can obtain lipid in common mode.For this purpose, can gather in the crops organism earlier then with its fragmentation, perhaps they can directly use.Utilize suitable solvent extraction lipid easily, such as non-polar solvent, hexane for example, perhaps polar solvent, for example ethanol, Virahol, or mixture, such as hexane/isopropyl alcohol, phenol/chloroform/primary isoamyl alcohol, temperature between 0 ℃-80 ℃, preferably between 20 ℃-50 ℃.Usually, with excessive solvent extraction biomass, 1: 4 excessive solvent for example: biomass ratio.Solvent is removed by methods such as for example distillations subsequently.Also available postcritical CO ₂Extract.After the extraction, remaining biomass can be removed by modes such as for example filtrations.The standard method of extracting lipid acid from plant and microorganism consult Bligh etc. (Can.J.Biochem.Physiol.37,1959:911-917) or people (Plant Physiol.69, document 1982:1103-1108) such as Vick.

Thus obtained thick oil can be then goes muddy and subsequent filtration or centrifugal and be further purified by for example adding non-polar solvents such as acetone isopolarity solvent or chloroform.It also is possible carrying out further purifying by pillar or other technology.

In order from triglyceride level, to obtain free lipid acid, can use the usual manner hydrolyzing triglyceride, for example with NaOH or KOH.

Oil, lipid and/or free lipid acid or their fraction have been produced in the methods of the invention.Said product can be used for producing feed and food, makeup or medicine.

In principle, coding has all nucleic acid that Δ-8 desaturase, Δ-9-prolongs enzyme and/or Δ-active polypeptide of 5-desaturase and all can be used in the inventive method.The preferred nucleic acid sequence is separable from for example microorganism or plant, such as fungi, resemble that genus mortierella, algae resemble Euglena, Crypthecodinium cohnii belongs to or Isochrysis galbana belongs to, diatom resembles that brown algae belongs to or mosses resemble sword-like leave Rhodobryum or angle tooth Rhodobryum, and also can be used as the source of nucleotide sequence such as non-human animals such as Caenorhabditis.Advantageously have the nucleotide sequence that Δ-8 desaturase, Δ-9-prolong enzyme and/or Δ-active polypeptide of 5-desaturase and derive from microorganism or plant, especially advantageously from Phaeodactylum tricornutum, angle tooth moss, exhibition leaf sword-like leave moss, tiny Euglena or IsochrysisgalbauaParke according to the present invention coding.Tiny Euglena or IsochrysisgalbauaParke are used in particular for the conversion of ω-3-or ω-6 lipid acid.Therefore, Δ-9 coexpression that prolongs special Δ-8 desaturase of enzyme and C20 has caused the formation of eicosatrienoic acid (C20:6n-3, Δ 8,11,14) and eicosatetraenoic acid (C20:3n-4, Δ 8,11,14,17).The trigenic coexpression of coding C20-Δ 5 specificity desaturases has caused the generation of arachidonic acid (C20:6n-4, Δ 5,8,11,14) or timnodonic acid (C20:3n-5, Δ 5,8,11,14,17).

The derivative of sequence of the present invention means, for example, showed identical said specific enzymes active, by the function homologue (homologues) of SEQ ID NO:2 or SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ IDNO:10 encoded polypeptides or enzyme.This specific enzymes activity advantageously makes the unsaturated fatty acids that has two keys more than three in the fatty acid molecule to synthesize.Unsaturated fatty acids means the two unsaturated or polyunsaturated fatty acid that wherein has two keys hereinafter.Two keys can be conjugation or unconjugated.Said sequence encoding shows that Δ-9 prolongs enzyme, Δ-8-desaturase or Δ-active enzyme of 5-desaturase.

According to enzyme of the present invention; be that Δ-9 prolongs enzyme, Δ-8-desaturase or Δ-5-desaturase, easily or prolong the fatty acid chain (referring to SEQ ID NO:2) of 18 carbon atoms of tool or two keys are introduced in fatty acid group of glycerine lipids, free fatty acids or acyl-CoA lipid acid at C8-C9 position (referring to SEQ ID NO:4) or C5-C6 position (referring to SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10).

Can be used for easily by other genome sequence of homology screening and separating according to nucleotide sequence of the present invention (for application aims, odd number comprises plural number, and vice versa) or its fragment.

Said derivative separable from, for example, other biology, such as eukaryotes such as plants, especially mosses, algae, dinoflagellate or fungi, preferred algae and mosses.

Allele variant especially comprises can be by disappearance in sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQID NO:5, SEQ ID NO:7 or the SEQ ID NO:9, insertion or alternative Nucleotide functional variant that obtain, that kept the enzymatic activity of deutero-synthetic protein.

These dna sequence dnas can originate in the fragment of dna sequence dna described in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or the SEQ ID NO:9 or said sequence, separate from other eukaryote all those biologies as mentioned with for example normal hybridizing method or round pcr.Under standard conditions with these dna sequence dnas and said sequence hybridization.In order to hybridize, preferably utilize the about 15-70bp of mean length, preferably about 17-60bp, more preferably from about 19-50bp, most preferably from about the short oligonucleotide of the conserved regions of 20-40bp can be determined conserved regions by comparing with other desaturase or prolongation enzyme in the manner known to persons skilled in the art.Advantageous applications Histidine box sequence.But, nucleic acid of the present invention also can be used for hybridization than long segment or complete sequence.Depend on applied nucleic acid: oligonucleotide, than long segment or complete sequence, or depend on the type (DNA or RNA) of nucleic acid, the standard conditions that are used to hybridize change to some extent.Therefore, for example, the melting temperature(Tm) of DNA:DNA hybrid molecule is hanged down about 10 ℃ than the melting temperature(Tm) of the DNA:RNA hybrid molecule of same length.

Standard conditions are meant, for example, depend on described nucleic acid, temperature is 42 ℃ to 58 ℃, concentration between 0.1 and 5x SSC (1x SSC=0.15M NaCl, the 15mM Trisodium Citrate is pH7.2) in the aqueous buffer solution between, or additionally also have 50% methane amide, for example in 42 ℃ of following 5x SSC and 50% methane amide.The hybridization conditions of DNA:DNA hybrid molecule is preferably 0.1x SSC, and temperature is between about 20 ℃ and 45 ℃, preferably between about 30 ℃ and 45 ℃.For the DNA:RNA hybrid molecule, preferred 0.1x SSC of hybridization conditions and temperature are at about 30 ℃ to 55 ℃, preferably at about 45 ℃ to 55 ℃.These temperature that are used to hybridize are that to be about 100 Nucleotide and G+C content with length under the no methane amide condition be that 50% nucleic acid is the melting temperature(Tm) value that example is calculated.The experiment condition of DNA hybridization is consulted relevant genetics books, such as Sambrook etc., " molecular cloning ", cold spring harbor laboratory, 1989, and available formula calculating well known by persons skilled in the art, for example calculate by the characteristic of length nucleic acid, hybrid molecule or the function of G+C content.Those skilled in the art can obtain the more information of relevant hybridization by following books: Ausubel etc. (editor), 1985, molecular biology universal method (Current Protocols in Molecular Biology), John Wiley﹠amp; Sons, New York; Hames and Higgins (editor), 1985, nucleic acid hybridization: practical approach (Nucleic AcidsHybridization:A Pratical Approach), the IRL Press of Oxford University Press, Oxford; Brown (editor), 1991, base molecule biology: application manual (Essential MolecularBiology:A Practical Approach), the IRL Press of Oxford University Press, Oxford.

In addition, derivative refers to the homologue (homologues) of sequence SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9, for example RNA of the single stranded DNA of the sequence of eucaryon homologue, brachymemma, coding and noncoding DNA sequence or coding and noncoding DNA sequence.

In addition, the homologue of sequence SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ IDNO:7 and SEQ ID NO:9 also refers to such as derivatives such as promoter variants.These variants can be by not modifying exchange, insertion and/or the disappearance of the functional of promotor or the dysgenic one or more Nucleotide of effectiveness generation.In addition, promotor also can improve its effectiveness or even alternative fully by more effectively start of external source biology by changing self sequence.

Derivative refers to preferably that also its nucleotides sequence is listed in before the initiator codon variant that has changed in-1 to-2000 the zone, and in this way, genetic expression and/or protein expression are changed, and preferred expression increases.In addition, derivative also refers at 3 ' the terminal variant of having modified.

The nucleotide sequence that prolongs enzyme according to coded delta of the present invention-8-desaturase, Δ-5-desaturase and/or Δ-9 can produce or from natural origin or comprise synthetic and the mixture of natural DNA component and by forming from different biological a plurality of allos Δs-8-desaturases, Δ-5-desaturase and/or Δ-9 prolongation enzyme gene fragment by synthetic.Generally speaking, the synthetic nucleotide sequence uses the preferred codon of corresponding host living beings such as plant for example to produce.This causes the optimum expression of heterologous gene usually.For plant preferred these codons can be from be expressed in most of plant species and codon with high protein frequency determine.About the example of Corynebacterium glutamicum (Corynebacteriumglutamicum) referring to (1992) Nucleic AcidsRes.20:2111-2118 such as document Wada.Such experiment available standards method is carried out and is known to those skilled in the art.

The function equivalence sequence of coded delta-8-desaturase, Δ-5-desaturase and/or Δ-9 prolongation enzyme gene is the derivative according to sequence of the present invention, although its nucleotide sequence is different but still have a function of expectation, promptly described proteinic enzymatic activity and specific selectivity.Therefore, function equivalent comprises the natural variant and the synthetic variant of sequence described herein, as, by the artificial sequence oligodeoxynucleotide that vegetable codon uses that is adapted to of chemosynthesis acquisition.

In addition, the dna sequence dna of synthetic suits, as long as, as mentioned above, they can mediate desired characteristics and get final product, for example, can by in farm crop preferably, cross express Δ-8 and/or Δ-5 delta 8 desaturase genes improve organism such as plant in lipid acid, oil or the Δ-8 of lipid and/or the content of the two keys of Δ 5-.Such artificial DNA sequence can be for example by anti-translation of the protein that minute the submodule mode of building makes up shown Δ-8 and/or Δ-5 desaturase and/or Δ-9-and prolong enzymic activity, perhaps can identify by in-vitro screening.May be used for the external evolution of DNA and consult Patten with the technology of modifying or improve dna sequence dna, P.A. wait Current Opinion in Biotechnology 8,724-733 (1997) or Moore, J.C. etc., Journal of Molecular Biology 272,336-347 (1997).Especially the dna encoding sequence that suitable is uses the anti-translation by peptide sequence to obtain according to the special codon of host plant.The those skilled in the art that are familiar with the plant genetics method can be by determining easily that to the Computer Analysis of other known of plant to be transformed special codon uses.

The nucleotide sequence of equal value that other that can be mentioned is suitable is the sequence of encoding fusion protein matter, and a component of fusion rotein is Δ-8-and/or Δ-5-desaturase polypeptide and/or Δ-9 prolongation enzyme polypeptide or its function equivalence part.The second section of fusion rotein can be, for example, has another polypeptide or the antigenic peptide sequence of enzymic activity, and mode can confirm the expression (as myc label or his label) that Δ-8-and/or Δ-5-desaturase or Δ-9-prolong enzyme thus.But, preferably, this be instruct Δ-8-and/or Δ-5-desaturase albumen and or Δ-9-prolong the modulability protein sequence that zymoprotein is oriented to the action site of expectation, as endoplasmic reticulum (=ER) signal sequence, perhaps this is to influence the adjusting sequence that nucleotide sequence of the present invention is expressed, such as promotor or terminator.In another embodiment preferred, the second section of fusion rotein is the exogenous protein (Targetingof foreign proteins to the chloroplast) that Napier J.A.[is oriented to chloroplast(id), Methods Mol.Biol., 49,1995:369-376] described plastid target sequence.The carrier of preferred use that contains described plastid target sequence is as [Guerineau F. as described in the ColinLazarus, Woolston S., Brooks L., Mullineaux P. are oriented to exogenous protein the expression cassette (An expression cassette for targetingforeign proteins into chloroplast) of chloroplast(id); Nucleic.Acids Res., Dec 9,16 (23), 1988:11380].

Favourable, Δ in according to method of the present invention-8-desaturase and Δ-9-prolong enzyme and/or Δ-5-delta 8 desaturase genes can with biosynthetic other assortment of genes that is used for lipid acid.The example of described gene be acyltransferase, other desaturase prolong enzyme such as Δ-4-, Δ-5-or Δ-6-desaturase or ω-3-and/or ω-6-specificity desaturase such as Δ-12 (at C ₁₈Lipid acid), Δ-15 is (at C ₁₈Lipid acid) or Δ-19 (at C ₂₂Lipid acid) and/or such as Δ-5-or Δ-6-prolong enzyme.In order to carry out in the body and especially external synthesizing, advantageously be used in combination with the NADH cytochrome B5-reductase that for example can absorb or discharge reducing equivalent.

Refer to contain SEQ ID NO:2 according to aminoacid sequence of the present invention, SEQ ID NO:4, SEQID NO:6, the protein of aminoacid sequence shown in SEQ ID NO:8 and the SEQ ID NO:10 or contain can substituting by one or more amino acid groups, inversion, insert or disappearance and (such sequence is SEQ ID NO:2 available from the sequence of above-mentioned sequence, SEQ ID NO:4, SEQ IDNO:6, the derivative of SEQ ID NO:8 and SEQ ID NO:10) protein, SEQ ID NO:2 in the protein wherein, SEQ ID NO:4, SEQ ID NO:6, proteinic enzymic activity described in SEQ ID NO:8 and the SEQ ID NO:10 still is retained or does not reduce basically, and promptly it has still kept identical enzyme spcificity.So-called " not reducing basically " or " identical enzymic activity " are meant the enzyme that all are such, this enzyme still presents at least available from 10% of the enzyme work of the biological initial enzyme in wild-type source, preferred 20%, preferred especially 30%, wherein said source biology is the biology such as following genus: sword-like leave Rhodobryum (Physcomitrella), angle tooth Rhodobryum (Ceratodon), the Borrago officinalis belongs to (Borago), genus thraustochytrium (Thraustochytrium), Schizochytrium, phytophthora (Phytophtora), genus mortierella (Mortierella), Caenorhabditis, Aleuritia, Muscariodides, Isochrysis galbana belongs to (Isochrysis), brown algae belongs to (Phaeodactylum), Crypthecodinium cohnii belongs to (Crypthecodinium) or Euglena (Euglenia).Preferred source biology is the biology such as following species: tiny Euglena (Euglenia gracilis), IsochrysisgalbauaParke (Isochrysis galbana), Phaeodactylum tricornutum (Phaeodactylum tricornutum), Caenorhabditis elegans (Caenorhabditis elegans), thraustochytriale (Thraustochytrium), phytophthora infestans (Phytophtora infestans), angle tooth moss (Ceratodon purpureus), IsochrysisgalbauaParke, Aleuritia farinosa, Muscariodides vialii, Mortierella alpina (Mortierella alpina), Borrago officinalis (Borago officinalis) or exhibition leaf sword-like leave moss (Physco-mitrella patens).In order to estimate " basically reduce " or to have the enzymic activity of " same enzyme activity ", measure the enzymic activity of derived sequence and compare with the wild-type enzyme activity.For this reason, for example, some amino acid can be had the amino acid replacement of similar physicochemical property (space filling, alkalescence, hydrophobicity etc.) by other.For example, arginine residues and lysine residue exchange, Xie Ansuan residue and the exchange of Isoleucine residue or asparagicacid residue and glutaminic acid residue exchange.But, one or more amino acid also can be by exchange sequence, interpolation or removal, and perhaps several these methods can make up mutually.

Derivative also refers to also contain especially the Δ-8-desaturase of the initial separation of natural or artificial mutation, the function equivalent that Δ-9-prolongs enzyme and/or Δ-5-desaturase encoding sequence, this function equivalent continues to present the function of expectation, and promptly their enzymic activity and substrate selective do not reduce basically.That sudden change comprises is alternative, add, lack, exchange or insert one or more nucleotide residues.Therefore, for example, the present invention also comprises by modifying those nucleotide sequences that Δ-8-desaturase nucleotide sequence, Δ-5-desaturase nucleotide sequence and/or Δ used in the inventive method-9-prolongs the acquisition of enzyme nucleotide sequence.The purpose of described modification may be, for example, further limit wherein contained encoding sequence the border or and, as, insert other Restriction Enzyme interface.

Comparatively speaking its function that also comprises function equivalent weakens (=basically reduce) as mentioned above or is strengthened that (=enzymic activity is higher than the activity of initial enzyme with initial gene or gene fragment, be that activity is higher than 100%, preferably be higher than 110%, especially preferably be higher than 130%) those variants.

Simultaneously, nucleotide sequence can, for example, advantageously be DNA or cDNA sequence.The suitable encoding sequence that inserts expression cassette of the present invention comprises that Δ-8-desaturase, Δ-5-desaturase and/or Δ-9-that coding for example has an above-mentioned sequence prolongs enzyme and gives host excessive production Δ-8 position and there are those sequences of ability of lipid acid, oil or the lipid of two keys, the preferred lipid acid with at least 4 pairs of keys that produces simultaneously in Δ-5 position.These sequences can be homologies or allogenic.

Refer to that according to expression cassette of the present invention (=nucleic acid construct or fragment or gene construct) sequence and/or its derivative shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and/or the SEQ ID NO:9 from genetic code is connected with one or more conditioning signals are functional, with the expression that advantageously improves genetic expression and regulate encoding sequence in the host cell.These regulate sequence makes gene and protein expression can have selectivity.Depend on host organisms, this can mean that for example, gene only expresses and/or cross expression after inducing or they express and/or cross expression immediately.These examples of regulating sequence are the sequences that combine with inductor or repressor and regulate expression of nucleic acid in this way.Except these new adjusting sequences or replace these sequences, the natural adjusting before the real structure gene can still exist and can be randomly by genetic modification so that close natural adjusting so that genetic expression increases.But, also can set up gene construct more simply, promptly before described nucleotide sequence or derivatives thereof, not insert other conditioning signal and do not remove natural promoter and regulating effect thereof.Replace this, thereby adjusting no longer takes place in the natural adjusting sequence of can suddenling change and/or genetic expression increases.These promotors of having modified can also be placed on before the natural gene to improve activity with the form of partial sequence (=contain the promotor of the part of nucleotide sequence of the present invention).In addition, gene construct can advantageously also comprise the one or more so-called enhancer sequence that is connected with promoter function to strengthen the expression of nucleotide sequence.3 ' end at dna sequence dna also can insert other favourable sequence, such as other regulatory element or terminator.Δ-8 and/or Δ-5 delta 8 desaturase genes and/or Δ-9 prolong the enzyme gene and can be present in the expression cassette (=gene construct) with one or more copies.

As mentioned above, regulate the preferably favourable influence and thereby improve the genetic expression that is introduced into gene of the sequence or the factor.Therefore, transcribe signal can be realized regulatory element easily on transcriptional level enhancement by force by using such as promotor and/or enhanser etc.But, for example, also can strengthen translation in addition by the stability that improves mRNA.

In principle, promotor suitable in the expression cassette is all promotors that can regulate exogenous gene expression in the organism, described organism is: microorganism is such as protozoons such as ciliates, algae such as the green alga such as Euglena, brown alga, red algae or blue-green algae, such as bacteriums such as Gram-positive or Gram-negative bacterias, such as yeast such as yeast belong, Pichia or Schizosaccharomyces or such as fungies such as mortierella, thraustochytriale or Schizochytrium or such as plants such as Aleuritia, preferred plant or fungi.Especially preferably use plant promoter or from the promotor of plant virus.Be used for seeing for example following promotor: for example be applied to cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacl in the Gram-negative bacteria easily according to the preferred adjusting sequence of method of the present invention ^Q-, T7, T5, T3, gal, trc, ara, SP6, λ-P _ROr λ-P _LEtc. promotor.Other is preferably regulated sequence and sees, for example, gram positive bacterium promotor amy and SPO2, yeast or fungal promoters ADC1, MF α, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or plant promoter CaMV/35S[Franck etc., Cell 21 (1980) 285-294], SSU, OCS, lib4, STLS1, B33, no (=nopaline synthase promoter) or ubiquitin or phaseolin promoter.The statement box also can comprise chemical inducible promoter, can advantageously control external source Δ-8 and/or Δ-5 delta 8 desaturase genes and/or Δ-9 prolongation enzyme expression of gene in the organism in the specific time in plant in this way.For example, preferred this type of plant promoter is PRP1 promotor [Ward etc., Plant.Mol.Biol.22 (1993), 361-366], benzsulfamide inducible promoter (EP 388186), tsiklomitsin inducible promoter [Gatz etc., (1992) Plant J.2,397-404], Whitfield's ointment inducible promoter (WO 95/19443), dormin inducible promoter (EP 335528) and ethanol or pimelinketone inducible promoter (WO 93/21334).The example of other plant promoter that is easy to use is from the promotor of the kytoplasm FBPase of potato, from the ST-LSI promotor (Stockhaus etc., EMBO are (1989) 2445-245 J.8) of potato, from the phosphoribosyl pyrophosphate transamidase promotor (being found in the Gen Bank number of including U87999) of soybean (Glycine max) or the nodiene specific promoter described in the EP249676.Especially advantageously guarantee in the tissue or plant part/organ in or its precursor stage synthetic, such as the plant promoter of in the embryo of endosperm or growth, expressing at the generation fatty acid biological.Especially it is worth mentioning the favourable promotor that guarantees seed-specific expression, for example USP promotor or derivatives thereof, LEB4 promotor, phaseolin promoter or napin promotor.The especially favourable USP promotor or derivatives thereof that the present invention quoted can mediated gene utmost point early expression [Baeumlein etc., Mol Gen Genet, 1991,225 (3): 459-67] in seed development.Other the favourable seed specific promoters that can be used for monocotyledons or dicotyledons is to be suitable for dicots promotor, (US 5 such as the napin gene promoter from oilseed rape, 608,152), oleosin promotor (WO 98/45461) from Arabidopis thaliana, (US 5 from the phaseolin promoter of Kidney bean (phaseolus vulgaris), 504,200), Bce4 promotor (WO 91/13980) or beans B4 promotor (LeB4 from rape, Baeumlein etc., Plant J., 2,2,1992:233-239), perhaps be suitable for monocotyledonous promotor, hordein gene promotor such as the lpt2 in the barley or lpt1 gene promoter (WO 95/15389 and WO95/23230) or barley, the glutenin gene promotor of rice, the oryzin gene promoter of rice, the prolamine gene promoter of rice, the gliadine gene promoter of wheat, the glutenin gene promotor of wheat, the zein spirit-soluble gene promotor of corn, avenaceous glutenin gene promotor, secalin (secalin) gene promoter (described in the WO99/16890) of kasirin gene promoter of Chinese sorghum or rye.

In addition, especially preferred is to guarantee those promotors of expressing in biosynthetic tissue that lipid acid, oil and lipid or its precursor stage for example take place or plant part.It should be noted that the promotor that guarantees seed-specific expression especially.Especially be napin gene promoter (US5 from oilseed rape, 608,152), from USP promotor (the seed albumen of USP=the unknown of broad bean, Baeumlein etc., Mol Gen Genet, 1991,225 (3): 459-67), from oleosin gene promotor (WO98/45461), the phaseolin promoter (US5 of Arabidopis thaliana, 504,200) or legumin B4 gene promoter (LeB4; Baeumlein etc., 1992, Plant Journal, 2 (2): 233-9).Other promotor that can mention is the promotor (WO95/15389 and WO95/23230) from lpt2 or the lpt1 gene of barley, and they mediate the seed-specific expression in the monocotyledons.Other favourable seed specific promoters is: described in WO 99/16890 (US 5 from the promotor of rice, corn or wheat or from Amy32b, Amy6-6 or aleurain, 677,474) promotor, from Bce4 (rape, US 5,530,149), glycinin (soybean, EP 571741), Phosphoenolpyruvate carboxylase (soybean, JP 06/62870), ADR12-2 (soybean, WO 98/08962), isocitrase (rape, US 5,689,040) or the promotor of beta-amylase (barley, EP 781849).

As mentioned above, expression construct (=gene construct, nucleic acid construct) can also comprise other gene of waiting to introduce organism.These genes can separately be regulated or prolong the enzyme gene with Δ-8-and/or Δ-5-delta 8 desaturase genes and/or Δ-9-regulated by identical regulatory region.In fact, these genes are other biosynthesis genes (being preferred for the fatty acid biological synthetic) for example, and it allows synthetic being improved.The example that can be mentioned is Δ-15-, Δ-12-, Δ-9-, Δ-5-, Δ-4-delta 8 desaturase genes, α-keto acyl base reductase gene, α-keto acyl base synthase gene, prolongs enzyme or various '-hydroxylase gene and fatty acyl-acp thioesterase gene.Delta 8 desaturase genes is advantageously used in the nucleic acid construct.

What all natural promotors and adjusting sequence thereof all can be as indicated above in principle is used for like that according to expression cassette of the present invention and according in the method for the present invention.In addition, also can be convenient to use the synthetic promotor.

In the preparation of expression cassette, can operate each dna fragmentation to obtain on correct direction effective reading and to be equipped with the nucleotide sequence of correct reading frame.For dna fragmentation (=nucleic acid of the present invention) is interconnected, adapter or joint can be attached on the fragment.

Promotor can effectively be provided on transcriptional orientation and stop the subarea so that insert the joint or the polylinker of promotor and terminator region sequence with containing one or more restricted point of contacts.Usually, joint has 1-10 restricted point of contact, and major part is 1-8, preferred 2-6 restricted point of contact.The size of general regulatory region internal connection usually less than 60bp, but is at least 5bp less than 100bp.Promotor both can be natural for host organisms (for example, for host plant) or homologous also can be external source or allogenic.Expression cassette comprises the zone that promotor, coded delta-8-delta 8 desaturase genes, Δ-5-delta 8 desaturase genes and/or Δ-9-prolongs the dna sequence dna of enzyme gene and is used for Transcription Termination on 5 '-3 ' transcriptional orientation.Different terminators can exchange mutually with any desirable form.

In addition, can operate suitable restricted interface to be provided or to remove DNA redundant or restricted interface.When considering to insert, lack or substitute, during such as conversion and transversion, can use vitro mutagenesis, primer reparation, restriction enzyme digestion or connection.In suitable operation, can implement such as restriction enzyme digestion, rumination (chewing back) or mend flat overhang to form flush end, segmental complementary terminal, so that connect.

For favourable high expression level, special ER stop adhering to of signal SEKDEL etc. may be important (Schouten, A. etc., Plant Mol.Biol.30 (1996), 781-792).In this way, average expression level tripling or even four times of changes.Natural be present in the plant and animal protein and be positioned ER other stop the structure that signal also can be used for expression cassette.In another embodiment preferred, [target is in the exogenous protein (Targeting of foreign proteins to the chloroplast) of chloroplast(id) as the described plastid target of Napier J.A. sequence in use, Methods Mol.Biol., 49,1995:369-376].The carrier of preferred use that comprises said plastid target sequence is as [Guerineau F. as described in the Colin Lazarus, Woolston S., Brooks L., Mullineaux P. " exogenous protein is oriented to the expression cassette (An expression cassette for targeting foreignproteins into chloroplast) of chloroplast(id); Nucleic.Acids Res., Dec 9,16 (23), 1988:11380].

Preferred polyadenylation signal is the plant polyadenylation signal, preferably with T-DNA polyadenylation signal from Agrobacterium tumefaciens, especially with the polyadenylation signal (Gielen etc. of the T-DNA gene 3 (octopine synthase) of Ti-plasmids pTiACH5, EMBO is (1984) J.3, and 835 and following) basic corresponding those signals or function corresponding Equivalent.

Merge and form expression cassette by suitable promotor and suitable Δ-8-and/or Δ-5-desaturase dna sequence dna and/or suitable Δ-9-being prolonged enzyme dna sequence and polyadenylation signal with common reorganization and clone technology, described technology is consulted, for example, T.Maniatis, E.F.Fritsch and J.Sambrook, molecular cloning: laboratory manual (Molecular Cloning:A LaboratoryManual), cold spring harbor laboratory, the cold spring port, New York (1989) and T.J.Silhavy, M.L.Berman and L.W.Enquist, gene fusion experiment (Experiments with Gene Fusions), cold spring harbor laboratory, the cold spring port, New York (1984) and Ausubel, F.M. etc., the general handbook of molecular biology (Current Protocols in Molecular Biology), Greene Publishing Assoc.and Wiley-Interscience (1987).

In the preparation of expression cassette, can operate each dna fragmentation to produce with the correct direction effective reading and to be equipped with the nucleotide sequence of proper reading frame frame.Adapter or joint can be attached to and be used to connect dna fragmentation on the fragment.

Promotor and termination subarea can effectively provide on transcriptional orientation so that insert the joint or the polylinker of these sequences with containing one or more restricted point of contacts.Usually, joint has 1-10 restricted point of contact, and major part is 1-8, preferred 2-6 restricted point of contact.The size of general regulatory region internal connection usually less than 60bp, but is at least 5bp less than 100bp.Promotor both can be natural for host organisms (for example, for host plant) or homologous also can be external source or allogenic.Expression cassette comprises the zone that promotor, coded delta-8-and/or Δ-5-delta 8 desaturase genes and/or Δ-9-prolongs the dna sequence dna of enzyme gene and is used for Transcription Termination on 5 '-3 ' transcriptional orientation.Different terminators can exchange mutually with any desirable form.

In the preparation of expression cassette, can operate various dna fragmentations to produce with the correct direction effective reading and to be equipped with the nucleotide sequence of proper reading frame frame.Adapter or joint can be attached on the fragment so that connect these dna fragmentations.

The dna sequence dna of used nucleotide sequence in the code book inventive method, such as from Δ-8 desaturase of tiny Euglena, from Δ-9-prolongation enzyme of IsochrysisgalbauaParke and/or for example from Δ-5-desaturase of Caenorhabditis elegans, Mortierella alpina, Borrago officinalis or exhibition leaf sword-like leave moss, contain the promising required all sequences feature in correct location that reaches in lipid acid, lipid or oily biosynthesizing site.Therefore, itself do not need other target sequence.But, this location may be desirable and favourable and therefore can be by artificial modification or reinforcement that these fusion constructs also are the preferred favourable embodiments of the present invention like this.

Especially preferred is the sequence that guarantees to be oriented in the plastid.In some cases, the compartment that is oriented to other (is reported in Kermode, Crit.Rev.Plant Sci.15,4 (1996), among the 285-423) also may be desirable, as, enter vacuole, plastosome, endoplasmic reticulum (ER) but, peroxysome, lipid conformation or rest in the compartment-kytoplasm of source owing to lacking corresponding operating sequence.

Easily, be cloned in the expression cassette with at least one reporter gene according to nucleotide sequence of the present invention or gene construct, expression cassette is introduced in the organism by carrier or directly enters genome.This reporter gene should be easy to by growth test, fluorescent test, chemical test, bioluminescence test or resistant proof or by photometric determination and detected.The example of the reporter gene that can mention is microbiotic or herbicide resistance gene, hydrolase gene, fluorescence protein gene, bioluminescent gene, sugar or nucleotide metabolism gene or biosynthesis gene, such as Ura3 gene, Ilv2 gene, luciferase genes, beta-galactosidase gene, gfp gene, 2-deoxyglucose-6-phosphate phosphatase gene, β-glucuronidase gene, β-Nei Xiananmei gene, neomycin phosphotransferase gene, hygromycin phosphotransferase gene or BASTA (=gluphosinate resistance) gene.These genes make and can detect easily with quantitative gene transcription activity and resultant genetic expression.Can determine to show the genome position of different productivity in this way.

In preferred embodiments, expression cassette comprise upstream (be encoding sequence 5 ' end) promotor and downstream (i.e. 3 ' end) polyadenylation signal and with insert therebetween Δ-8-desaturase, Δ-9-and prolong enzyme and/or Δ-5-other regulatory element that enzyme DNA sequences encoding operability is connected that goes to satisfy.The connection of operability means promotor, encoding sequence, terminator and optional other regulatory element series arrangement in some way, thereby makes each regulatory element all can bring into play its function in the expression of encoding sequence in the expection mode.The sequence that is preferred for the operability connection is the target sequence that guarantees the Subcellular Localization in plastid.But, be used to guarantee Subcellular Localization in plastosome, endoplasmic reticulum (=ER), target sequence in nucleus, oil body or other compartment also can use, can also use the translation promotor, 5 ' leader sequence (Gallie etc. such as tobacco mosaic virus (TMV), Nucl.Acids Res.15 (1987), 8693-8711).

Expression cassette can comprise, and for example, constitutive promoter or tissue-specific promoter (preferred USP or napin promotor), treats that expressing gene and ER stop signal.For ER stops signal, preferably use KDEL aminoacid sequence (Methionin, aspartic acid, L-glutamic acid, leucine) or KKX aminoacid sequence (Methionin-Methionin-X-terminator codon, wherein X refers to arbitrary other known amino acid).

In order to be expressed in protokaryon or the eucaryon host biology, for example in microorganism such as fungi or the plant, expression cassette preferably inserts carrier, for example plasmid, phage or make that gene can be in host living beings among other DNA of optimum expression.Suitable plasmid example has: the pLG338 in intestinal bacteria, pACYC184, such as pBR series such as pBR322, such as pUC series such as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III ¹¹³-B1, λ gt11 or pBdCI; PIJ101 in streptomycete, pIJ364, pIJ702 or pIJ361; PUB110 in genus bacillus, pC194 or pBD214; PSA77 in coryneform bacteria or pAJ667; PALS1 in fungi, pIL2 or pBB116; Other preferred fungi carrier is consulted following document: Romanos, M.A. etc. [exogenous gene expression in (1992) yeast: the summary (Foreign gene expression in yeast:a review), Yeast 8:423-488] and van den Hondel, C.A.M.J.J. etc. [(1991), allogeneic gene expression in the filamentous fungus (Heterologous gene expression in filamentous fungi) is also referring to " the more polygene operation of fungi " (More Gene Manipulations in Fungi) [J.W.Bennet ﹠amp; L.L.Lasure edits, the 396-428 page or leaf; Academic Press:San Diego] and " be the gene transfer system and the carrier (Gene transfer systems and vectordevelopment for filamentous fungi) [van den Hondel; C.A.M.J.J. and Punt; P.J. (1991) " the application molecular genetics of fungi " (Applied Molecular Genetics ofFungi); Peberdy; editors such as J.F.; 1-28 page or leaf, Cambridge University Press:Cambridge] of filamentous fungus research and development.The example of preferred Yeast promoter is 2 μ M, pAG-1, YEp6, YEp13 or pEMBLYe23.The example of algae or plant promoter is pLGV23, pGHlac ⁺, pBIN19, pAK2004, pVKH or pDH51 (consulting Schmidt, R. and Willmitzer, L., 1988).The alternative carrier of sub-fraction in the plasmid that the derivative of carrier that more than provides or the above carrier that provides just may use.Other plasmid is well-known and can consults that for example, books " cloning vector " (Cloning Vectors) (are edited Pouwels P.H. etc. to those skilled in the art, Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).Suitable plant vector is consulted " molecular biology of plants and physiotechnology method (Methods in PlantMolecular Biology and Biotechnology) " (CRC Press), the 6/7th chapter, 71-119 page or leaf especially.Shuttle vectors or the binary vector of preferred carrier in intestinal bacteria and edaphic bacillus, duplicating.

Carrier also refers to other carrier of all except that plasmid well known by persons skilled in the art, and for example phage, virus are such as SV40, CMV, baculovirus, adenovirus, transposon, IS element, phagemid, phasmid, clay, linearity or cyclic DNA.These carriers can be in host organisms self-replicating or with chromosome duplication, preferably with chromosome duplication.

In other embodiment of carrier, also can be advantageously introduce in the organism and mode by allos or homologous recombination is integrated in the genome of host organisms with the form of linear DNA according to expression cassette of the present invention.This linear DNA can be formed or only be made up of as carrier or by forming according to nucleotide sequence of the present invention expression cassette by linearizing plasmid.

In another advantageous embodiment, also can be introduced in the organism by oneself according to nucleotide sequence of the present invention.

If except according to the nucleotide sequence of the present invention, other gene also will be introduced in the organism, they all can be introduced organism with reporter gene in single carrier, or can each gene each introduce organism with reporter gene in carrier respectively, thereby simultaneously or introduce different carriers in succession.

Carrier preferably comprise at least one copy according to nucleotide sequence of the present invention and/or according to expression cassette of the present invention (=gene construct).

For example, the expression of plants box can be positioned in ((a) Toepfer etc., 1993, Methods Enzymol., 217:66-78 in the pRT conversion carrier; (b) Toepfer etc., 1987, Nucl.Acids.Res.15:5890 ff.).

Perhaps, recombinant vectors (=expression vector) also can be transcribed and be translated external, for example, and by utilizing T7 promotor and T7 RNA polymerase.

Be applied to procaryotic expression vector and usually utilize the induced system that has and do not have fusion rotein or merge oligopeptides, wherein these fusions can take place maybe can betide in proteinic other useful structure territory with N-terminal and two kinds of forms of C-terminal.Described fusion vector has following purpose usually: i) improve the rna expression rate; Ii) improve obtainable protein synthesis rate; Iii) improve proteinic solubleness; Iv) or by the binding sequence that can be used for affinity chromatography simplify purification step.The proteolysis cleavage site also often is introduced into by fused protein, a feasible part and the purifying that can cut out fusion rotein.Described protease recognition sequence quilt, for example factor Xa, zymoplasm and enteropeptidase are discerned.

Typical favourable fusion and expression vector are the pGEX[Pharmacia Biotech Inc that contains glutathione S-transferase (GST), maltose binding protein matter or albumin A; Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40], pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ).

Other example of coli expression carrier has pTrc[Amann etc., (1988) Gene69:301-315] and pET carrier [Studier etc., Gene Expression Technology:Methodsin Enzymology 185, Academic Press, San Diego, California (1990) 60-89; Stratagene, Amsterdam, The Netherlands].

Other the favourable carrier that is used for yeast has pYepSec1 (Baldari etc., (1987) Embo is J.6:229-234), pMFa (Kurjan and Herskowitz, (1982) pJRY88 (Schultz etc. Cell 30:933-943),, Gene 54:113-123) and pYES derivative (InvitrogenCorporation (1987), San Diego, CA).The carrier that is used for filamentous fungus is consulted document: van denHondel, C.A.M.J.J.﹠amp; Punt, P.J. (1991), gene transfer system and carrier (Gene transfer systems and vector development for filamentousfungi) for the filamentous fungus research and development, " the application molecular genetics of fungi " (Applied Molecular Genetics of Fungi), editors such as J.F.Peberdy, the 1-28 page or leaf, Cambridge University Press:Cambridge.

Perhaps, also can utilize the insect cell expression carrier easily, for example, be used for expressing at the Sf9 cell.These carriers for example are, pAc series (Smith etc., (1983) Mol.CellBiol.3:2156-2165) and pVL serial carrier (Lucklow and Summers (1989) Virology 170:31-39).

In addition, vegetable cell or alga cells can be used for genetic expression easily.The example of plant expression vector can be consulted document Becker, D. etc. (1992) " but new plant binary vector (New plant binary vectors with selectable markers locatedproximal to the left border) " with the selective marker that is close to left margin, Plant Mol.Biol.20:1195-1197 or Bevan, M.W. (1984) " the binary soil bacillus carrier (Binary Agrobacteriumvectors for plant transformation) that is used for Plant Transformation " Nucl.Acid.Res.12:8711-8721.

In addition, nucleotide sequence also can be expressed in the mammalian cell, especially in the non-human mammal cell.The example of corresponding expression vectors is pCDM8 and pMT2PC, consults Seed, and (1987) EMBO such as B. (1987) Nature 329:840 or Kaufman J.6:187-195).The preferred simultaneously promotor of using viral source, for example promotor of polyomavirus, adenovirus 2, cytomegalovirus or simian virus SV40.Other protokaryon and eukaryotic expression system are consulted " molecular clonings: laboratory manual " that the people edited such as Sambrook (Molecular Cloning:A Laboratory Manual) (second edition, cold spring harbor laboratory, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY, 1989) the 16th and 17 chapters.

Host organisms (=genetically modified organism) preferably comprises at least one copy according to nucleic acid of the present invention and/or according to nucleic acid construct of the present invention.

Can will introduce in the organism (for example plant) according to nucleic acid of the present invention, expression cassette or carrier by all methods well known by persons skilled in the art in principle.The introducing of nucleotide sequence has produced reorganization or genetically modified organism.

With the microorganism is example, those skilled in the art can find appropriate means: Sambrook in below with reference to book, (1989) molecular cloning such as J.: laboratory manual (Molecular cloning:Alaboratory manual), Cold Spring Harbor Laboratory Press; The general handbook of F.M.Ausubel etc. (1994) molecular biology (Current protocols in molecular biology), John Wiley and Sons; D.M.Glover etc., dna clone (DNA Cloning) volume 1 (1995), IRL Press (ISBN 019-963476-9); Method in Kaiser etc. (1994) yeast genetics (Methods in Yeast Genetics), Cold Spring Harbor Laboratory Press or Guthrie etc., yeast genetics and molecular biology guide (Guide to Yeast Genetics andMolecular Biology), Methods in Enzymology, 1994, Academic Press.

Foreign gene is transferred to is called as conversion in the Plant Genome.For this reason, utilized and be used to transform and carry out instantaneous or stable conversion from the method for plant tissue or vegetable cell aftergrowth.Suitable method is protoplast transformation, " biological bombardment " method-be called particle bombardment method, electroporation of having utilized particle gun of being undertaken by the DNA picked-up that polyoxyethylene glycol brings out, hatch dried embryo in dna solution, microinjection and agrobacterium-mediated transgenosis.Said method is consulted, B.Jenes etc. for example, gene transfer technique (Techniques for Gene Transfer), " transgenic plant " (Transgenic Plants), volume 1, Engineering and Utilization, editor S.D.Kung and R.Wu, Academic Press (1993) 128-143 and Potrykus Annu.Rev.PlantPhysiol.Plant Molec.Biol.42 (1991) 205-225).Nucleic acid to be expressed or construct preferably are cloned into and are suitable for transforming in the carrier of Agrobacterium tumefaciens, for example pBin19 (Bevan etc., Nucl.Acids Res.12 (1984) 8711).The edaphic bacillus that is transformed by described carrier can be used for Plant Transformation in a known way then, especially in the conversion of farm crop (for example tobacco), for example the leaf of abrasive leaf of dipping bath or cutting is incubated at them in the suitable medium then in edaphic bacillus solution.Transforming plant with the modes of Agrobacterium tumefaciens can consult, for example, H fgen and Willmitzer, Nucl.Acid Res. (1988) 16,9877 or F.F.White, be used for the carrier (Vectors for Gene Transfer in Higher Plants) of higher plant transgenosis; Transgenic Plants, Vol.1, Engineering and Utilization, editor S.D.Kung and R.Wu, Academic Press, 1993, pp.15-38.

Use the edaphic bacillus that transforms according to expression vector of the present invention can be used to transform plant in a known way equally, such as test plant or crop such as cereals such as Arabidopis thalianas, corn, oat, rye, barley, wheat, soybean, rice, cotton, beet, canola, Sunflower Receptacle, flax, hemp, potato, tobacco, tomato, Radix Dauci Sativae, red pepper, oilseed rape, cassava (tapioca), cassava (cassava), arrowroot, Flower of Aztec Marigold, alfalfa, lettuce and various tree, nut and vine, especially butyraceous farm crop, such as soybean, peanut, the Viscotrol C plant, Sunflower Receptacle, corn, cotton, flax, oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa beans, for example, be incubated at then in the suitable substratum by the leaf of abrasive leaf of dipping bath or cutting in edaphic bacillus solution and with it.In order to produce PUFA, for example therapic acid, timnodonic acid and docosahexenoic acid, Borrago officinalis, linseed oil, Sunflower Receptacle, safflower or Primulaceae plant (Primulaceae) are especially suitable.For example be used to produce gamma-linoleic acid, dihomo-gamma-linoleic acid or arachidonic other suitable organism and be for example Semen Lini, Sunflower Receptacle or safflower.

The vegetable cell of genetic modification can be regenerated with all methods well known by persons skilled in the art.Appropriate means can be consulted above S.D.Kung and R.Wu, the article that Potrykus or H fgen and Willmitzer deliver.

Therefore, another aspect of the present invention relates to by at least a genetically modified organism that transforms according to nucleotide sequence of the present invention, expression cassette or carrier and the cell that derives from described biology, cell culture, tissue, leaf, root etc.-or reproductive material for the plant biological body partly-for example.Term " host organisms ", " host cell ", " reorganization (host) organism " and " transgenosis (host) cell " are in this commutative use.Certainly, these terms not only relate to specific host organisms or specific target cell, also relate to the offspring or the potential offspring of these organisms or cell.Because because sudden change or environmental influence may certain change occur in the follow-up generation, these offsprings are not necessarily identical with parental cell, but still are included in this term scope used herein.

With regard to purpose of the present invention, for example, for nucleotide sequence, contain the expression cassette (=gene construct of nucleotide sequence of the present invention, nucleic acid construct) or carrier or use the organism that transforms according to nucleotide sequence of the present invention, expression cassette or carrier, " transgenosis " or " reorganization " is meant all that construction that produces with genetic engineering method, wherein

A) nucleotide sequence or derivatives thereof or its part shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, the SEQ ID NO:9 or

B) regulate sequence with the functional heredity that is connected of nucleotide sequence described in (a), for example 3 '-and/or 5 '-heredity regulate sequence, such as promotor or terminator, or

C) (a) and (b)

Be not present in its natural genotypic environment or modified with genetic engineering method, modification wherein can be for example the substituting of one or more nucleotide residues, interpolation, disappearance, inversion or insertion.Natural genotypic environment refers to natural gene group or the chromosomal loci in source organism or host organisms or genomic library.In the situation of genomic library, preferably keep the natural genotypic environment of nucleotide sequence to small part.A side and sequence length that said environment is positioned at nucleotide sequence at least are at least 50bp, preferred 500bp at least, especially preferably at least 1,000bp, especially the most at least 5,000bp.For naturally occurring expression cassette---the natural combination that for example prolongs enzyme and/or Δ-5-delta 8 desaturase genes according to the natural promoter of nucleotide sequence of the present invention and corresponding Δ-8-desaturase, Δ-9-, it is changed into transgene expression cassette by modifying the back such as non-natural (" artificial ") synthetic methods such as mutagenesis at gene.Appropriate means is consulted, and for example US 5,565, and 350 or WO 00/15815.

Be applicable to that organism or host organisms according to nucleic acid of the present invention, expression cassette or carrier advantageously are energy synthetic fatty acid (especially unsaturated fatty acids) or all organisms that are suitable for above-mentioned recombinant gene expression in principle.Other example that can be mentioned is, plant is such as Arabidopis thaliana, such as knotweeds such as mary bush (Asteraceae) or such as soybean, peanut, the Viscotrol C plant, Sunflower Receptacle, corn, cotton, flax, oilseed rape, coconut, oil palm, farm crop such as safflower (Carthamus tinctorius) or cocoa beans, microorganism is such as fungi, genus mortierella for example, saprolegnia (Saprolegnia) or pythium (Pythium), bacterium such as Escherichia (Escherichia), yeast such as yeast belong (Saccharomyces), cyanobacteria, ciliate, algae or protozoon such as dinoflagellate belong to as Crypthecodinium cohnii.Preferably can be natural the organism of a large amount of relatively synthetic oils, such as fungi, as Mortierella alpina, Pythium insidiosum or plant such as soybean, oilseed rape, coconut, oil palm, safflower, flax, castor-oil plant, mary bush, peanut, cocoa beans or Sunflower Receptacle, or yeast such as yeast saccharomyces cerevisiae and especially preferred soybean, flax, oilseed rape, Sunflower Receptacle, mary bush, mortierella or yeast saccharomyces cerevisiae.In principle, except genetically modified organism above, transgenic animal, non-human animal advantageously, for example Caenorhabditis elegans also suits.

Other useful host cell is consulted: Goeddel, Gene Expression Technology:Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

Available is expressed strain, for example, shows that Gottesman consults in those strain systems of relatively low protease activity, S., Gene Expression Technology:Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128.

Another object of the present invention relate to will contain coded delta-8-desaturase, Δ-9-prolong the dna sequence dna of enzyme and/or Δ-5-delta 8 desaturase genes or with it the expression cassette of the dna sequence dna of hybridization be used for the conversion of vegetable cell, tissue or plant part.The purpose of using is to improve the content of lipid acid, oil or lipid that double bond content increases.

For this reason, depend on selected promotor, but Δ-8-desaturase, Δ-9-prolongation enzyme and/or Δ-5-delta 8 desaturase genes specifically expressing are in the other parts of leaf, seed, tubercle, root, stem or plant.Those excessive transgenic plant that are created in the lipid acid, oil or the lipid that have at least three two keys in the fatty acid molecule, its reproductive material and vegetable cell thereof, tissue or part are another themes of the present invention.

In addition, also can be used for the above conversion of illustrational organism according to expression cassette of the present invention or nucleotide sequence with what contain that Δ-8-desaturase, Δ-9-prolongs enzyme and/or Δ-5-delta 8 desaturase genes sequence, described organism is such as bacterium, cyanobacteria, yeast, filamentous fungus, ciliate and algae, its objective is the content that improves lipid acid, oil or lipid with at least three two keys.

In framework of the present invention, the content that improves lipid acid, oil or lipid with at least three two keys is meant, for example, the artificial proterties that obtains the raising of biosynthesizing performance, described raising is because in according to organism of the present invention, especially in according to transgenic plant of the present invention, make Δ-8-desaturase, Δ-9-prolong enzyme and/or Δ-5-delta 8 desaturase genes functional cross express due to, and described raising is to hold from generation to generation relative of at least one plant of continuing at least with the initial plant of genetic modification not.

The biosynthetic optimum position of lipid acid, oil or lipid normally, the cellular layer of seed or seed for example, Δ-8-desaturase, Δ-9-seed-specific expression of prolonging enzyme and/or Δ-5-delta 8 desaturase genes suits like this.But, apparent, the biosynthesizing of lipid acid, oil or lipid need not be confined to seed tissue, also can come across in all other parts of plant in the tissue specificity mode-for example in epidermic cell or tubercle.

In addition, the constitutive expression of external source Δ-8-desaturase, Δ-9-prolongation enzyme and/or Δ-5-delta 8 desaturase genes is favourable.But, on the other hand, but may to seem also be desirable to abduction delivering.

For example, can prolong the expression efficiency of enzyme and/or Δ-5-delta 8 desaturase genes with the merismatic propagation of stem at external definite Δ-8-desaturase, Δ-9-.In addition, the Δ that changes on character and level-8-desaturase, Δ-9-prolong the expression of enzyme and/or Δ-5-delta 8 desaturase genes and can test on test plant in greenhouse test lipid acid, oil or lipid biosynthesizing Effect on Performance.

Another object of the present invention comprise with contain according to Δ of the present invention-8-desaturase, Δ-9-prolong enzyme and/or Δ-5-delta 8 desaturase genes sequence or the genetically modified organism that transforms with the expression cassette of the dna sequence dna of its hybridization such as transgenic plant, and the transgenic cell of this plant, tissue, part and reproductive material.Preferred especially in this case transgenic crop, for example barley, wheat, rye, oat, corn, soybean, rice, cotton, beet, oilseed rape and canola, Sunflower Receptacle, flax, hemp, Ji, potato, tobacco, tomato, cassava (tapioca), cassava (cassava), arrowroot, alfalfa, lettuce and various tree, the living plant of nut and rattan.

With regard to purpose of the present invention, plant is unifacial leaf and dicotyledons, mosses and algae.More specifically, be to contain as mentioned above according to plant of the present invention according to nucleotide sequence of the present invention or according to the transgenic plant of expression cassette of the present invention.

Other purpose of the present invention is:

-transform the method for plant, comprise with contain from algae such as Euglena or Isochrysis galbana belong to, Δ-8-desaturase, Δ-9-of fungi such as genus mortierella or mosses such as sword-like leave Rhodobryum prolong enzyme and/or Δ-5-delta 8 desaturase genes sequence or with the protoplastis according to expression cassette introduced plant cell of the present invention, callus, whole strain plant or plant of the dna sequence dna of its hybridization in.

The method of-production PUFA, wherein said method comprises the transgenic organism of cultivating the carrier that contains nucleic acid described herein or coded delta-8-desaturase, Δ-9-prolongation enzyme and/or Δ-5-desaturase, its special polyunsaturated fatty acid that has at least three two keys in fatty acid molecule that synthesizes.

-utilize Δ-8-desaturase, Δ-9-to prolong enzyme and/or Δ-5-desaturase dna sequence dna or with the dna sequence dna production of its hybridization because described Δ-8-desaturase, Δ-9-prolong the plant that enzyme and/or the Δ-expression of 5-desaturase dna sequence dna in plant have lipid acid, oil or the lipid content increase of at least three two keys.

-contain the protein of aminoacid sequence or derivatives thereof shown in SEQ ID NO:2, the SEQ ID NO:8.

-utilize described protein to produce unsaturated fatty acids with sequence SEQ ID NO:2 or SEQ ID NO:8.

According to another object of the present invention is the method that is used to produce unsaturated fatty acids, comprising: with at least a nucleotide sequence described herein or contain at least a nucleic acid construct of described nucleotide sequence or carrier is introduced such as in the preferred produce oil organism such as plant or fungi; Cultivate described organism; Be separated in the oil that comprises in the described organism; And release is present in the lipid acid in the described oil.These unsaturated fatty acidss advantageously contain at least three two keys in fatty acid molecule.Lipid acid can, for example by basic hydrolysis,, preferably under the condition that exists such as alcohol such as methyl alcohol or ethanol, from oil or lipid, discharge as with NaOH or KOH or by acid hydrolysis.Said lipid acid discharges the corresponding alkyl ester that has produced free lipid acid or lipid acid.For example carrying out enzymic hydrolysis with lipase in principle also is fine.From said free fatty acids or fatty acid alkyl ester, can chemosynthesis or enzymatic synthetic glycerine monoesters, triglyceride and/or triglyceride level.In another embodiment preferred of the inventive method, effective for treatment of premature ejaculation is by carrying out the transesterify generation from oil and lipid with conventional chemical or with enzyme.Preferable methods is to produce alkyl ester under the condition that the alcoholate such as corresponding lower alcohols such as methylate or ethylate (alcohol of C1 to C10 is such as methyl alcohol, ethanol, propyl alcohol, butanols, hexanol etc.) exists.Therefore just as known as technical staff, under the condition that the alkali of catalytic amount such as NaOH or KOH exist, alcohol is added in oil or the lipid.

The method that generation has the triglyceride level of the unsaturated fatty acids that improves content comprises: will be at least a according to nucleotide sequence of the present invention or at least a according in the expression cassette introducing produce oil organism of the present invention; Cultivate said organism; And separate oil contained in the described organism; This also is one of purpose of the present invention.

Another object of the present invention is by the triglyceride level that will contain saturated or unsaturated fatty acids or saturated and unsaturated fatty acids and at least a by sequence SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10 encoded protein matter are hatched the method that produces the triglyceride level with the unsaturated fatty acids that increases content together.In the presence of the compound that can absorb or discharge reducing equivalent, advantageously implement this method.Lipid acid can discharge from triglyceride level then.

To being used to produce the described method of triglyceride level, be to utilize basic hydrolysis well known by persons skilled in the art or such as the method for enzymes such as lipase from the acid of triglyceride level release fat according to another object of the present invention with the unsaturated fatty acids that increases content.

Method above contains the lipid acid of at least three two keys easily in the synthetic fat acid molecule or has the triglyceride level of this lipid acid that increases content.

Method above contains the lipid acid of at least three two keys easily in the synthetic fat acid molecule or has the triglyceride level of this lipid acid that increases content, wherein is used for preferably linolic acid (C of substrate that Δ-8-desaturase, Δ-9-prolong enzyme and/or Δ-5-desaturase reaction _20:2 ^{Δ 9,12}) and/or alpha-linolenic acid (C _18:2 ^{Δ 9,12,15}).In this way, aforesaid method can be advantageously especially synthetic from linolic acid (C _20:2 ^{Δ 9,12}), alpha-linolenic acid (C _18:2 ^{Δ 9,12,15}) lipid acid, gamma-linoleic acid (C _18:3 ^{Δ 6,9,12}), therapic acid (C _18:4 ^{Δ 6,9,12,15}), dihomo-gamma-linoleic acid (C _20:3 ^{Δ 8,11,14}) or for example timnodonic acid and arachidonic acid.

The example that is used for the organism of method mentioned above is that plant is such as Arabidopis thaliana, Primulaceae, the Borrago officinalis, barley, wheat, rye, oat, corn, soybean, rice, cotton, beet, oilseed rape and canola, Sunflower Receptacle, flax, hemp, potato, tobacco, tomato, rape, tapioca, cassava, arrowroot, alfalfa, peanut, the Viscotrol C plant, coconut, oil palm, safflower (Carthamustinctorius) or cocoa beans, microorganism is such as fungi, genus mortierella for example, Saprolegnia belongs to or Pythium belongs to, bacterium is such as Escherichia, cyanobacteria, yeast is such as yeast belong, algae or protozoon such as dinoflagellate belong to as Crypthecodinium cohnii.The preferred organism of natural synthetic oil relatively in large quantities, such as fungi such as Mortierella alpina, Pythium insidiosum or plant such as soybean, oilseed rape, coconut, oil palm, safflower, castor-oil plant, mary bush, peanut, cocoa beans or Sunflower Receptacle, or yeast is such as yeast saccharomyces cerevisiae, and especially preferred soybean, oilseed rape, Sunflower Receptacle, flax, Primulaceae plant, Borrago officinalis, safflower or yeast saccharomyces cerevisiae.

Depend on host organisms, in the manner known to persons skilled in the art used organism in growth or cultivation the inventive method.Microorganism such as fungi or algae are incubated at carbonaceous sources (common form with sugar), nitrogenous source usually (usually with organic nitrogen source, such as yeast extract or such as the form of salt such as ammonium sulfate), in the liquid nutrient medium of trace elements (such as iron, manganese or magnesium salts) and optional VITAMIN, temperature is between 10 ℃ and 60 ℃, preferably between 15 ℃ and 40 ℃, be exposed to gaseous oxygen.The pH of nutritive medium can be remained on the fixed value for this reason, promptly be conditioned or be not conditioned at growing period pH.Cultivation can be so that form, semi-batch form or successive form are carried out in batches.Nutritive ingredient can provide or semi-continuously or continuously add when the fermentation beginning.

After the conversion, make plant regeneration at first as mentioned above, cultivate or cultivation by normal way then.

After the growth, from organism, separate lipid in normal way.For this purpose, after results, at first can or directly use described organism digestion.Advantageously use suitable solvent extraction lipid, resemble hexane or ethanol, Virahol or such as hexane/isopropyl alcohol, phenol/chloroform/mixtures such as primary isoamyl alcohol, temperature is between 0 ℃ and 80 ℃, preferably between 20 ℃ and 50 ℃ such as non-polar solvent.Usually extract biomass with excessive solvent, for example 4 times of excessive solvents are to the ratio of biomass.Remove described solvent then, for example by distillation.Also available supercritical CO ₂Extract.Extracting the remaining biomass in back can remove by for example filtering.

Can be further purified isolating in this way thick oil then, for example by handling filtration or centrifugal then to remove muddiness with polar solvent acetone or chloroform.Can also carry out further purifying by pillar.

In order from triglyceride level, to obtain free acid, in a usual manner with the triglyceride level saponification.

Another object of the present invention comprises with the above method unsaturated fatty acids that produces and triglyceride level and their application in food, animal-feed, makeup and pharmaceutical production with the unsaturated fatty acids that increases content.For this purpose triglyceride level is added in food, animal-feed, makeup or the medicine with convention amount.

What produce with aforesaid method is the result who expresses in various host organisms according to nucleic acid of the present invention according to described unsaturated fatty acids of the present invention and triglyceride level with the unsaturated fatty acids that increases content.This is total has caused comparing with the initial initial host cell that does not contain described nucleic acid, and the composition that contains the compound of unsaturated fatty acids in the described host cell changes.Compare with the protein that comprises described nucleic acid encoding under native state or the host organisms of enzyme, these change the host organisms that does not contain coded protein of described nucleic acid or enzyme under native state, and are for example more remarkable in the vegetable cell.This oil, lipid, phosphatide, sphingolipid, glycolipid, triglyceride level and/or free fatty acids that causes host organisms to contain has the more high-load PUFA that brings to few three two keys.With regard to this purpose of the present invention, the content of raising refers to compare with the initial organism that does not contain nucleic acid of the present invention, and described host organisms comprises as many as few 5%, preferably at least 10%, preferably at least 20%, especially preferably at least 30%, the most preferred at least 40% polyunsaturated fatty acid.For not containing under the native state than the how unsaturated C of long-chain ₂₀Or C ₂₂The plant of lipid acid (such as EPA or ARA), this is especially true.Because described expression of nucleic acids has produced new lipid composition in this way, this is further aspect of the present invention.

By following examples the present invention has been carried out more detailed explanation.

Embodiment

Embodiment 1: general cloning process

Cloning process, for example the purifying of restriction enzyme digestion, agarose gel electrophoresis, dna fragmentation, nucleic acid carry out as described in (1989) such as Sambrook (Cold SpringHarbor Laboratory Press:ISBN 0-87969-309-6) to being connected of the transfer of nitrocellulose filter and Ni Luo film, dna fragmentation, colibacillary conversion, the cultivation of bacterium and the sequential analysis of recombinant DNA.

Embodiment 2: the sequential analysis of recombinant DNA

Use that (Sanger et al. (1977) Proc.Natl.Acad.Sci.USA74 5463-5467) carries out the order-checking of recombinant DNA molecules by the Sanger method from the laser fluorescence dna sequencing instrument of ABI company.The fragment that the polymerase chain reaction is produced checks order and checks to avoid treating the polysaccharase mistake in the expression construct.

Embodiment 3: from the clone of Δ-8-desaturase (=SEQ ID NO:1) of tiny Euglena

The cDNA that to use from tiny Euglena strain be Z carries out pcr amplification as template.CDNA synthetic since the E.gracilis strain be the total RNA that extracts in the culture of Z.Unique primer at the initial methionine of Euglena Δ-8-desaturase and terminator codon is synthetic as follows, comprising restriction site.

Primer 1:EDELTA8BamF

ATGGATCCACCATGAAGTCAAAGCGCCAA

Primer 2: EDELTA8XhoR

ATCTCGAGTTATAGAGCCTTCCCCGC

The PCR scheme

Annealing temperature: 45 ℃ 1 minute

Denaturation temperature: 94 ℃ 1 minute

Elongating temperature: 72 ℃ 2 minutes

Cycle number: 30

On sepharose, separate the fragment that the PCR product obtains a 1270bp.The PCR fragment cloning is gone in the pGEM-T easy carrier (Promega), check order to inserting fragment then.This has shown the existence of open reading frame of 1266 base pairs of the protein of 421 amino-acid residues of encoding and terminator codon.The C-terminal of the Δ of being cloned-8-desaturase and Wallis and Browse (Archives ofBiochem.and Biophysics, Vol.365, No.2,1999) Δ-8-desaturase of being announced has the homology of height, and this enzyme it is reported it is the enzyme of one 422 residues; Also can consult the correlated series [GenBank AF139720/AAD45877] that these authors provide, it is claimed and relates to a kind of Δ-8 desaturase but described the open reading frame of one 419 residues.The deduction aminoacid sequence of Euglena Δ-8 desaturase of the present invention is distinguished with previously described sequence to some extent owing to the difference of N-terminal.Particularly, preceding 25 amino-acid residues of LARS Δ-8-desaturase are: MKSKRQALPLTIDGTTYDVS AWVNF, and the described sequence of Wallis and Browse is: MKSKRQALSPLQLMEQTYDV SAWVN (as given among the ABB 1999) or MKSKRQALSPLQLMEQTYDVVNFH (as given among the GenBank AAD45877) optionally.

The said heterogeneity that appears at desaturase sequence N-terminal is not that pcr amplification or primer cause.Described difference is a difference real between the protein.

Embodiment 4: express the structure that IsochrysisgalbauaParke prolongs the transgenic plant of enzyme component I gASE1

The clone of IgASE1 cDNA consults: Qi, B., Beaudoin, F., Fraser, T., Stobart, A.K., Napier, J.A. and Lazarus, C.M, prolong active cDNA FEBS Letters 510,159-165 (2002) from the new C18-Δ-9-polyunsaturated fatty acid specificity of micro-algae IsochrysisgalbauaParke identification code of producing docosahexenoic acid (DHA).

CDNA is by discharging and connect into the KpnI site of intermediate carrier pBlueBac 4.5 (Invitrogen) from the pCR2.1-TOPO plasmid vector with KpnI digestion.With inserting segmental direction in the EcoRI screening recombinant plasmid.Adding EcoRI with PstI will insert fragment and discharge in selected plasmid and connect into the binary vector plasmid pCB302-1 (Xiang etc., 1999) that has cut with same enzyme.So just the IgASE1 coding region is placed under the control of CaMV 35S promoter, and merge with Rubisco small subunit transit peptides (Xiang at al., 1999) translation, purpose is this to be prolonged enzyme component when expressing to be oriented to chloroplast(id) in transgenic plant.This reorganization binary vector is named as pCB302-1ASE.In order to make up the similar substrates that is used to express the prolongation enzyme component that is oriented to microsomal membrane, add SpeI digestion with BamHI and from middle carrier, shift out the IgASE1 coding region, and connect corresponding site (Xiang etal. into pCB302-3,1999, wherein the collection of illustrative plates of pCB302-3 is incorrect: it is inverse with respect to MCS2 that CaMV 35S promoter (adding the ω sequence) and no stop the subarea).This reorganization binary vector is named as pCB302-3ASE.

Embodiment 5: the expression of plants that prolongs enzyme

By electroporation binary vector is transferred among the Agrobacterium tumefaciens bacterial strain GV3101; Containing 50 μ gml ^-1The bacterium colony that selection is transformed on the substratum of kantlex.At 28 ℃ selected bacterium colony is cultured to stationary phase, centrifugal then concentrating cells also is resuspended in and contains 5% sucrose, 0.03%Silwet-177 and 10mM MgCl ₂Dipping solution in.

The seed of the environmental Columbia4 of Arabidopis thaliana (Arabidopsis thaliana) is sprouted on the Murashige of 1/2nd concentration and Skoog substratum, and seedling is transferred in the compost of 15cm flowerpot.Plant is cultured to flowering period at 21 ℃ in the growth room, wherein adopts 1 hour dark cycle of illumination in 23 hours.With Clough and Bent (1998, the dipping of flower: be used for the simplified method that agrobacterium-mediated Arabidopis thaliana transforms.Plant Journal 16,735-743 (1998)) colored dipping method carries out Plant Transformation, and is as follows basically:

For each construct, two flowerpots that will contain 16 strain plants are inverted in the dipping solution that contains the Agrobacterium tumefaciens (as indicated above) that transformed.Place dark to spend the night with the plastics bag covering and in room temperature plant then.Afterwards sack is taken away, plant is transferred in the growth room.Repeated impregnations after 5 days (with fresh Agrobacterium tumefaciens solution) also sets seeds plant.Collect to control oneself and flood a large amount of seeds (=T1 seed) of plant, about 10000 seeds are sprinkling upon in the compost of seed pan, after 2 days, be incubated in the growth room 4 ℃ of laminations.When seedling reaches 2 to 4 true leaf stages, spray Liberty weedicide (Aventis, 0.5g grass ammonium phosphine l ^-1), repeat after the week to spray.Selected 12 strain herbicide resistant plants are also undertaken potted plant by each strain system (the prolongation enzyme component of chloroplast(id) or tenuigenin orientation), and allow autogamy.With collect from the T2 of these plants seed sample concentration half Murashige and the Skoog substratum on sprout, contain Liberty (5mg grass ammonium phosphine l in the substratum ^-1).To collect then on the Liberty flat board, to sprout once more with screening and stop the isolating strain of Herbicid resistant system from the T3 seed of the plant individual of surviving.Analyze extraction and also select to have those strain systems (CB12-4 and CA1-9) of the highest C20 content from the total fatty acids of the leaf of these strains systems with prolongation enzyme component of tenuigenin orientation with prolongation enzyme component of chloroplast(id) orientation.

Embodiment 6: express the generation that IsochrysisgalbauaParke prolongs the transgenic plant of enzyme component I gASE1 and tiny Euglena Δ 8 desaturase EUGD8

Adding XhoI with BamHI is transformed into the coli strain Tam1 then from BamHI and the XhoI site that Yeast expression carrier pESC-Trp downcuts Δ-8-desaturase coding region and connects into pBlueBac 4.5 (Invitrogen).Downcut the insertion fragment with BglII and BamHI from recombinant plasmid, be connected into pBECKS ₁₉.6 BamHI site also is transformed among the coli strain Tam1.The recombinant plasmid dna for preparing 6 transformant bacterium colonies in a small amount; Digest the direction of these DNA with XhoI to determine that insert the desaturase coding region in the binary vector.To be transferred among the Agrobacterium tumefaciens GV3101 by electroporation and transform bacterium colony from quilt as mentioned above for the segmental recombinant plasmid of the insertion that for the expression of CaMV 35S promoter, contains correct direction and prepare dipping solution.

Strain is the dipping that CB12-4 and CA1-9 (seeing above) spend to Arabidopis thaliana as mentioned above.To disseminate from about 2000 T1-seeds of each strain system in containing half Murashige and Skoog (solid) substratum of concentration and (be supplemented with 50 μ g ml ^-1Kantlex) on the 15cm culture dish and in the growth room, sprout.Be transferred to 3 strain plant of 12 strain kalamycin resistance plant of CA1-9 parent system and CB12-4 parent system in the potted plant compost and further in the growth room, cultivate.Carry out fatty acid analysis on from the leaf of each T2 plant, the T2 plant is allowed to maturation and sets seeds.

Reference

McCormac, A.C., Eliott, M.C. and Chen, D-F.; PBECKS. variable series (the A flexible series of binary vectorsfor Agrobacterium-mediated plant transformation) .MolecularBiotechnology 8 that is used for the binary vector of agrobacterium-mediated Plant Transformation, 199-213 (1997).

Xiang, C., Han, P., Lutziger, I., Wang, K. and Oliver, D.J.; Little binary vector series (A mini binary vector series for planttransformation) the .Plant Molecular Biology 40 that is used for Plant Transformation, 711-717 (1999).

Embodiment 7: express the generation that IsochrysisgalbauaParke prolongs the transgenic plant of enzyme component I gASE1 and tiny Euglena Δ 8 desaturase EUGD8 and Δ 5 desaturases

To be cloned into pGPTV plasmid (Becker, the D.et al. that contains the hygromycin resistance selectable marker gene from Δ 5 desaturases of Phaeodactylum tricornutum; Plant Mol.Biol.20 (1992), 1195-1197) in.In order to carry out seed-specific expression, will be cloned into 5 ' of Δ 5 desaturase ATG-end from the USP promotor of broad bean (Vicia faber).

Binary vector is transferred to Agrobacterium tumefaciens bacterial strain GV 3101 and is containing 30 μ gml ^-1The bacterium colony that selection has transformed in the substratum of Totomycin.Selected edaphic bacillus is used for transforming (conversion of flower) to be carried and has the T-DNA that Δ 9 prolongs enzymes and Δ 5 desaturases and insert segmental arabidopsis thaliana.

The Arabidopis thaliana seedling is sprouted and resistance plant is transferred in the greenhouse.

Results are collected from the seed of plant individual and with GC methods analyst total fatty acids and are composed.

Embodiment 8: the clone who is used for the expression plasmid of plant seed-specific expression

PBin-USP is the derivative of plasmid pBin 19.PBin-USP produces from pBin19 (Bevan et al. (1980) Nucl.Acids Res.12,8711) by the USP promotor of EcoRI-BaMHI pieces is inserted among the pBin19.Polyadenylation signal is polyadenylation signal (the Gielen et al. of gene 3 of the T-DNA of Ti-plasmids pTiACH5, (1984) EMBO J.3,835), Nucleotide 11749-11939 separates as the PvuII-HindIII fragment thus, adds SphI joint rear clone between the SpHI-HindIII point of contact of carrier at place, PvuII point of contact.The USP promotor is equivalent to Nucleotide 1-684 (GenBank typing X56240), and wherein the part of the non-coding region of USP gene is included in the promotor.Utilize commercial T7 standard primer (Stratagene) and utilize the synthetic primer by the promoter fragment of PCR reaction by standard method amplification total length 684bp.

Primer sequence:

5’-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATC

C GGATCTGCTGGCTATGAA-3’

Carry among the carrier pBin19 of OCS terminator with EcoRI/SalI cutting PCR fragment and insertion.Obtain the plasmid of called after pBinUSP.This construct is used for arabidopsis thaliana transformation, oilseed rape, tobacco and flax.

Embodiment 9: the generation of transgenosis oil plant crop

The generation of transgenic plant (according to people such as Moloney, 1992, Plant Cell Reports, the method correction of 8:238-242)

In order to produce transgenic rape seed rape plant, utilized binary vector in Agrobacterium tumefaciens C58C1:pGV2260 or intestinal bacteria (Deblaere etc., 1984, Nucl.Acids.Res.13,4777-4788).In order to transform rape plant (var.Drakkar, NPZ NordeutschePflanzenzucht, Hohenlieth, Germany), used the overnight culture that transforms the edaphic bacillus bacterium colony in the positive that contains dilution in 1: 50 in the Murashige-Skoog substratum of 3% sucrose (3MS substratum) (Murashige and Skoog 1962 Physiol.Plant.15,473).Petiole or hypocotyl (each about 1cm with the rape plant of aseptic fresh sprouting ²) in culture dish, hatched 5-10 minute with the edaphic bacillus solution of dilution in 1: 50.On the 3MS substratum that is containing 0.8% Bacto-agar under 25 ℃ of dark conditions, hatched altogether 3 days subsequently.After 3 days, adopting 16 little time/8 hour dark, is to continue in the cycle to cultivate on the MS substratum that contains 500mg/l Claforan (cefotaxime sodium), 50mg/l kantlex, 20 μ M phenmethyl aminopurines (BAP) and 1.6g/l glucose with a week.The bud of growing is transferred on the MS substratum that contains 2% sucrose, 250mg/l Claforan and 0.8% Bacto-agar.If do not form root after three weeks, add the 2-indolebutyric acid in the substratum and be used to take root as tethelin.

Utilize kantlex and Claforan on the 2MS substratum, to obtain the regenerated bud, after taking root it is transferred in the soil, culture was bloomed after middle in the controlled environment chamber two weeks of growth, gathered in the crops sophisticated seed, studied the expression of Δ-8 desaturase by the lipid analysis mode.Evaluation in the strain that Δ-8 position double bond content increases is.In the transgenic line of the genetically modified stable conversion of functional expression, to find to compare with the unconverted plant of contrast, the double bond content in Δ-8 position has improved.

Carry out same step and have Δ-9-prolongation enzyme and/or Δ-active plant of 5-desaturase with foundation.

A) transgenosis line

By as Bell et al., 1999, In Vitro Cell.Dev.Biol.-Plant.35 (6): the method for 456-465, can production transgenosis line by the mode of particle bombardment.Can be for example, as (1994) such as Mlynarova, the agrobacterium-mediated conversion of the described enforcement of Plant Cell Report 13:282-285.

Embodiment 10: extract lipid from seed and leaf material

In order to make vegetable material be easier to extract, at first vegetable material (about 200mg) is carried out mechanical homogenate with stamp mill.

Propanal dimethyl acetal with 1M methanol hydrochloride solution and 5% carry out transmethylaseization at the cell precipitation 1 hour of 85 ℃ of hydrolysis fragmentation and with lipid.In hexane, extract the fatty acid methyl ester (FAME) that produces.The FAME that extracts by the gas liquid chromatography analysis with capillary column (Chrompack, WCOT fused silica, CP wax 52 CB, 25m, 0.32mm), wherein thermograde is: 170 ℃ to 240 ℃ and 5 minutes were 240 ℃ in 20 minutes.By relatively confirming the identity of fatty acid methyl ester with corresponding FAME standard substance (Sigma).Suitably chemically derived by to the FAME mixture, for example, forming 4,4-Er Jia Yang oxazolin derivs (Christie, 1998) is further analyzed the identity and the position of two keys by the GC-MS mode.

Fig. 1 has shown the fatty acid profile (FAMes) of the leaf tissue of wild-type Arabidopis thaliana in contrast.Fig. 2 has shown from expressing Isochrysis galbana and has belonged to the fatty acid profile (FAMes) of leaf tissue that Δ-9-prolongs the transgenic arabidopsis (seeing embodiment 4) of enzyme.Transform this Arabidopis thaliana strain system again with Euglena Δ-8-desaturase subsequently.The fatty acid profile (FAMes) of the Arabidopis thaliana strain system (Line IsoElo X Eu D8 des) of said dual conversion is consulted Fig. 3.

In addition, the Arabidopis thaliana strain of this dual conversion system (Line IsoElo X Eu D8 des) uses genus mortierella Δ 5 desaturases (Mort Δ 5) gene to transform subsequently again.The fatty acid profile (FAMes) of the Arabidopis thaliana strain system (LineIsoElo X EU D8 des x Mort Δ 5) of described triple conversions is consulted Fig. 4.

Embodiment 11: from the GC spectrum of the genetically modified Arabidopis thaliana leaf of difference fatty acid methyl ester

Fig. 5 has shown and extracts from wild-type (WT 5a), expresses that IsochrysisgalbauaParke Δ 9 prolongs the single transgene plant (5b) of enzyme gene Ig ASE1, the GC of Arabidopis thaliana leaf fatty acid methyl ester that expresses the dual transgenic plant (5c) of Ig ASE1 and Euglena Δ 8 desaturases (EU Δ 8) gene and express the triple turn gene plant (5d) of Ig ASE1, Eu Δ 8 and genus mortierella Δ 5 desaturases (Mort Δ 5) genes composes.

Table 1 shown preparation from wild-type (Wt), express IsochrysisgalbauaParke Ig ASE1 Δ 9 prolong the enzyme genes the single transgene plant, express the lipid acid of arabidopsis thaliana that Ig ASE1 Δ 9 prolongs the dual transgenic plant of enzyme genes and Euglena Δ 8 delta 8 desaturase genes and express the triple turn gene plant of Ig ASE1, Euglena Δ 8 and genus mortierella Δ 5 delta 8 desaturase genes and form.Analysis is from the leaf tissue of the arabidopsis thaliana of the phase of clustering (rosette stage).Each value is represented the average of twice mensuration.

Lipid acid (molecular fraction of total amount)	Plant origin
	Plant origin				Wild-type	The IgASE1 transgenosis	IgASE1+Eu Δ 8 transgenosiss	IgASE1+Eu Δ 8+Mort Δ 5 transgenosiss
	16:0	19.9	19.2	14.7	Wild-type	The IgASE1 transgenosis	IgASE1+Eu Δ 8 transgenosiss	IgASE1+Eu Δ 8+Mort Δ 5 transgenosiss	14.2
16:1	16:0	19.9	19.2	14.7	2.8	3.3	1.8	2.3	14.2
16:1	16:3	13.1	12.2	19.9	2.8	3.3	1.8	2.3	15.4
18:0	16:3	13.1	12.2	19.9	1.7	2.4	0.8	1.5	15.4
18:0	18:1n-9	1.7	5.1	1.6	1.7	2.4	0.8	1.5	3.4
18:2n-6	18:1n-9	1.7	5.1	1.6	11.2	9.0	4.2	6.6	3.4
18:2n-6	18:3n-3	50.1	31.0	36.0	11.2	9.0	4.2	6.6	31.2
20:2n-6	18:3n-3	50.1	31.0	36.0	-	7.9	0.9	3.2	31.2
20:2n-6	20:3，Δ5，11，14	-			-	7.9	0.9	3.2	1.5
20:3n-6	20:3，Δ5，11，14	-			-	-	9.1	1.5	1.5
20:3n-6	20:4n-6(ARA)	-	-		-	-	9.1	1.5	6.6
20:3n-3	20:4n-6(ARA)	-	-		-	9.9	4.0	4.8	6.6
20:3n-3	20:4Δ5，11，14，17	-	-	-	-	9.9	4.0	4.8	1.6
20:4n-3	20:4Δ5，11，14，17	-	-	-	-	-	7.2	2.9	1.6
20:4n-3	20:5n-3(EPA)	-	-	-	-	-	7.2	2.9	3.3
Total C20PUFAs	20:5n-3(EPA)	-	-	-	-	17.8	21.2	22.2	3.3

All transgenosiss are all under the control of 35S-CaMV viral promotors.With Euglena Δ 8-desaturase ^Mut175+313[T-DNA kalamycin resistance] transforms the Isochrysis galbana with SSU Rubisco transit sequence again and belongs to Δ 9 prolongation enzymes (IgASE1) [T-DNA Basta-r].(it all is the double-transformant system of isozygotying for the two that T-DNA Totomycin-r) transforms for Basta-r and kantlex-r again with genus mortierella Δ 5 desaturases.The triple transformation plants that produce isozygoty for the two for Basta-r and kantlex-r, but are heterozygosis for Totomycin-r.

Sequence table

＜110〉BASF Aktiengesellchaft

＜120〉novel method of production polyunsaturated fatty acid

<130>2002_791

<140>2002_271

<141>2202-12-18

<160>10

<170>PatentIn Ver.2.0

<210>1

<211>1266

<212>DNA

＜213〉tiny Euglena (Euglena gracilis)

<220>

<221>CDS

<222>(1)..(1266)

＜223〉delta-8-desaturase

<400>1

atg aag tca aag cgc caa gcg ctt ccc ctt aca att gat gga aca aca 48

Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr

1 5 10 15

tat gat gtg tct gcc tgg gtc aat ttc cac cct ggt ggt gcg gaa att 96

Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile

20 25 30

ata gag aat tac caa gga agg gat gcc act gat gcc ttc atg gtt atg 144

Ile Glu Asn Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met

35 40 45

cac tct caa gaa gcc ttc gac aag ctc aag cgc atg ccc aaa atc aat 192

His Ser Gln Glu Ala Phe Asp Lys Leu Lys Arg Met Pro Lys Ile Asn

50 55 60

ccc agt tct gag ttg cca ccc cag gct gca gtg aat gaa gct caa gag 240

Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu Ala Gln Glu

65 70 75 80

gat ttc cgg aag ctc cga gaa gag ttg atc gca act ggc atg ttt gat 288

Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp

85 90 95

gcc tcc ccc ctc tgg tac tca tac aaa atc agc acc aca ctg ggc ctt 336

Ala Ser Pro Leu Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu

100 105 110

gga gtg ctg ggt tat ttc ctg atg gtt cag tat cag atg tat ttc att 384

Gly Val Leu Gly Tyr Phe Leu Met Val Gln Tyr Gln Met Tyr Phe Ile

115 120 125

ggg gca gtg ttg ctt ggg atg cac tat caa cag atg ggc tgg ctt tct 432

Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp Leu Ser

130 135 140

cat gac att tgc cac cac cag act ttc aag aac cgg aac tgg aac aac 480

His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn

145 150 155 160

ctc gtg gga ctg gta ttt ggc aat ggt ctg caa ggt ttt tcc gtg aca 528

Leu Val Gly Leu Val Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr

165 170 175

tgc tgg aag gac aga cac aat gca cat cat tcg gca acc aat gtt caa 576

Cys Trp Lys Asp Arg His Asn Ala His His Ser Ala Thr Asn Val Gln

180 185 190

ggg cac gac cct gat att gac aac ctc ccc ctc tta gcc tgg tct gag 624

Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser Glu

195 200 205

gat gac gtc aca cgg gcg tca ccg att tcc cgc aag ctc att cag ttc 672

Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe

210 215 220

cag cag tat tat ttc ttg gtc atc tgt atc ttg ttg cgg ttc att tgg 720

Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp

225 230 235 240

tgt ttc cag agc gtg ttg acc gtg cgc agt ctg aag gac aga gat aac 768

Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg Asp Asn

245 250 255

caa ttc tat cgc tct cag tat aag aag gag gcc att ggc ctc gcc ctg 816

Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala Leu

260 265 270

cat tgg aca ttg aag gcc ctg ttc cac tta ttc ttt atg ccc agc atc 864

His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile

275 280 285

ctc aca tcg ctg ttg gta ttt ttc gtt tcg gag ctg gtt ggc ggc ttc 912

Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe

290 295 300

ggc att gcg atc gtg gtg ttc atg aac cac tac cca ctg gag aag atc 960

Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile

305 310 315 320

ggg gac tcg gtc tgg gat ggc cat gga ttc tcg gtt ggc cag atc cat l008

Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His

325 330 335

gag acc atg aac att cgg cga ggg att atc aca gat tgg ttt ttc gga 1056

Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly

340 345 350

ggc ttg aac tac cag atc gag cac cat ttg tgg ccg acc ctc cct cgc 1104

Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg

355 360 365

cac aac ctg aca gcg gtt agc tac cag gtg gaa cag ctg tgc cag aag 1152

His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys

370 375 380

cac aac ctg ccg tat cgg aac ccg ctg ccc cat gaa ggg ttg gtc atc 1200

His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile

385 390 395 400

ctg ctg cgc tat ctg gcg gtg ttc gcc cgg atg gcg gag aag caa ccc 1248

Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro

405 410 415

gcg ggg aag gct cta taa 1266

Ala Gly Lys Ala Leu

420

<210>2

<211>421

<212>PRT

＜213〉tiny Euglena

<400>2

Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr

1 5 10 15

Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile

20 25 30

Ile Glu Asn Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met

35 40 45

His Ser Gln Glu Ala Phe Asp Lys Leu Lys Arg Met Pro Lys Ile Asn

50 55 60

Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu Ala Gln Glu

65 70 75 80

Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp

85 90 95

Ala Ser Pro Leu Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu

100 105 110

Gly Val Leu Gly Tyr Phe Leu Met Val Gln Tyr Gln Met Tyr Phe Ile

115 120 125

Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp Leu Ser

130 135 140

His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn

145 150 155 160

Leu Val Gly Leu Val Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr

165 170 175

Cys Trp Lys Asp Arg His Asn Ala His His Ser Ala Thr Asn Val Gln

180 185 190

Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser Glu

195 200 205

Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe

210 215 220

Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp

225 230 235 240

Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg Asp Asn

245 250 255

Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala Leu

260 265 270

His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile

275 280 285

Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe

290 295 300

Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile

305 310 315 320

Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His

325 330 335

Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly

340 345 350

Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg

355 360 365

His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys

370 375 380

His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile

385 390 395 400

Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro

405 410 415

Ala Gly Lys Ala Leu

420

<210>3

<211>777

<212>DNA

＜213〉IsochrysisgalbauaParke (Isochrysis galbana)

<220>

<221>CDS

<222>(1)..(777)

＜223〉delta-9-prolongs enzyme

<400>3

atg gcc ctc gca aac gac gcg gga gag cgc atc tgg gcg gct gtg acc 48

Met Ala Leu Ala Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr

1 5 10 15

gac ccg gaa atc ctc att ggc acc ttc tcg tac ttg cta ctc aaa ccg 96

Asp Pro Glu Ile Leu Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro

20 25 30

ctg ctc cgc aat tcc ggg ctg gtg gat gag aag aag ggc gca tac agg 144

Leu Leu Arg Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala Tyr Arg

35 40 45

acg tcc atg atc tgg tac aac gtt ctg ctg gcg ctc ttc tct gcg ctg 192

Thr Ser Met Ile Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu

50 55 60

agc ttc tac gtg acg gcg acc gcc ctc ggc tgg gac tat ggt acg ggc 240

Ser Phe Tyr Val Thr Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly

65 70 75 80

gcg tgg ctg cgc agg caa acc ggc gac aca ccg cag ccg ctc ttc cag 288

Ala Trp Leu Arg Arg Gln Thr Gly Asp Thr Pro Gln Pro Leu Phe Gln

85 90 95

tgc ccg tcc ccg gtt tgg gac tcg aag ctc ttc aca tgg acc gcc aag 336

Cys Pro Ser Pro Val Trp Asp Ser Lys Leu Phe Thr Trp Thr Ala Lys

100 105 110

gca ttc tat tac tcc aag tac gtg gag tac ctc gac acg gcc tgg ctg 384

Ala Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr Ala Trp Leu

115 120 125

agg gtc tcc ttt ctc cag gcc ttc cac cac ttt ggc gcg ccg tgg gat 432

Arg Val Ser Phe Leu Gln Ala Phe His His Phe Gly Ala Pro Trp Asp

130 135 140

gtg tac ctc ggc att cgg ctg cac aac gag ggc gta tgg atc ttc atg 480

Val Tyr Leu Gly Ile Arg Leu His Asn Glu Gly Val Trp Ile Phe Met

145 150 155 160

ttt ttc aac tcg ttc att cac acc atc atg tac acc tac tac ggc ctc 528

Phe Phe Asn Ser Phe Ile His Thr Ile Met Tyr Thr Tyr Tyr Gly Leu

165 170 175

acc gcc gcc ggg tat aag ttc aag gcc aag ccg ctc atc acc gcg atg 576

Thr Ala Ala Gly Tyr Lys Phe Lys Ala Lys Pro Leu Ile Thr Ala Met

180 185 190

cag atc tgc cag ttc gtg ggc ggc ttc ctg ttg gtc tgg gac tac atc 624

Gln Ile Cys Gln Phe Val Gly Gly Phe Leu Leu Val Trp Asp Tyr Ile

195 200 205

aac gtc ccc tgc ttc aac tcg gac aaa ggg aag ttg ttc agc tgg gct 672

Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys Leu Phe Ser Trp Ala

210 215 220

ttc aac tat gca tac gtc ggc tcg gtc ttc ttg ctc ttc tgc cac ttt 720

Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu Leu Phe Cys His Phe

225 230 235 240

ttc tac cag gac aac ttg gca acg aag aaa tcg gcc aag gcg ggc aag 768

Phe Tyr Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala Lys Ala Gly Lys

245 250 255

cag ctc tag 777

Gln Leu

<210>4

<211>258

<212>PRT

＜213〉IsochrysisgalbauaParke

<400>4

Met Ala Leu Ala Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr

1 5 10 15

Asp Pro Glu Ile Leu Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro

20 25 30

Leu Leu Arg Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala Tyr Arg

35 40 45

Thr Ser Met Ile Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu

50 55 60

Ser Phe Tyr Val Thr Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly

65 70 75 80

Ala Trp Leu Arg Arg Gln Thr Gly Asp Thr Pro Gln Pro Leu Phe Gln

85 90 95

Cys Pro Ser Pro Val Trp Asp Ser Lys Leu Phe Thr Trp Thr Ala Lys

100 105 110

Ala Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr Ala Trp Leu

115 120 125

Arg Val Ser Phe Leu Gln Ala Phe His His Phe Gly Ala Pro Trp Asp

130 135 140

Val Tyr Leu Gly Ile Arg Leu His Asn Glu Gly Val Trp Ile Phe Met

145 150 155 160

Phe Phe Asn Ser Phe Ile His Thr Ile Met Tyr Thr Tyr Tyr Gly Leu

165 170 175

Thr Ala Ala Gly Tyr Lys Phe Lys Ala Lys Pro Leu Ile Thr Ala Met

180 185 190

Gln Ile Cys Gln Phe Val Gly Gly Phe Leu Leu Val Trp Asp Tyr Ile

195 200 205

Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys Leu Phe Ser Trp Ala

210 215 220

Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu Leu Phe Cys His Phe

225 230 235 240

Phe Tyr Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala Lys Ala Gly Lys

245 250 255

Gln Leu

<210>5

<211>1410

<212>DNA

＜213〉Phaeodactylum tricornutum (Phaeodactylum tricornutum)

<220>

<221>CDS

<222>(1)..(1410)

＜223〉delta-5-desaturase

<400>5

atg gct ccg gat gcg gat aag ctt cga caa cgc cag acg act gcg gta 48

Met Ala Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val

1 5 10 15

gcg aag cac aat gct gct acc ata tcg acg cag gaa cgc ctt tgc agt 96

Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser

20 25 30

ctg tct tcg ctc aaa ggc gaa gaa gtc tgc atc gac gga atc atc tat 144

Leu Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr

35 40 45

gac ctc caa tca ttc gat cat ccc ggg ggt gaa acg atc aaa atg ttt 192

Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe

50 55 60

ggt ggc aac gat gtc act gta cag tac aag atg att cac ccg tac cat 240

Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro Tyr His

65 70 75 80

acc gag aag cat ttg gaa aag atg aag cgt gtc ggc aag gtg acg gat 288

Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp

85 90 95

ttc gtc tgc gag tac aag ttc gat acc gaa ttt gaa cgc gaa atc aaa 336

Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys

100 105 110

cga gaa gtc ttc aag att gtg cga cga ggc aag gat ttc ggt act ttg 384

Arg Glu Val Phe Lys Ile Val Arg Arg Gly Lys Asp Phe Gly Thr Leu

115 120 125

gga tgg ttc ttc cgt gcg ttt tgc tac att gcc att ttc ttc tac ctg 432

Gly Trp Phe Phe Arg Ala Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu

130 135 140

cag tac cat tgg gtc acc acg gga acc tct tgg ctg ctg gcc gtg gcc 480

Gln Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala

145 150 155 160

tac gga atc tcc caa gcg atg att ggc atg aat gtc cag cac gat gcc 528

Tyr Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala

165 170 175

aac cac ggg gcc acc tcc aag cgt ccc tgg gtc aac gac atg cta ggc 576

Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly

180 185 190

ctc ggt gcg gat ttt att ggt ggt tcc aag tgg ctc tgg cag gaa caa 624

Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln Glu Gln

195 200 205

cac tgg acc cac cac gct tac acc aat cac gcc gag atg gat ccc gat 672

His Trp Thr His His Ala Tyr Thr Asn His Ala Glu Met Asp Pro Asp

210 215 220

agc ttt ggt gcc gaa cca atg ctc cta ttc aac gac tat ccc ttg gat 720

Ser Phe Gly Ala Glu Pro Met Leu Leu Phe Asn Asp Tyr Pro Leu Asp

225 230 235 240

cat ccc gct cgt acc tgg cta cat cgc ttt caa gca ttc ttt tac atg 768

His Pro Ala Arg Thr Trp Leu His Arg Phe Gln Ala Phe Phe Tyr Met

245 250 255

ccc gtc ttg gct gga tac tgg ttg tcc gct gtc ttc aat cca caa att 816

Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile

260 265 270

ctt gac ctc cag caa cgc ggc gca ctt tcc gtc ggt atc cgt ctc gac 864

Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp

275 280 285

aac gct ttc att cac tcg cga cgc aag tat gcg gtt ttc tgg cgg gct 912

Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala

290 295 300

gtg tac att gcg gtg aac gtg att gct ccg ttt tac aca aac tcc ggc 960

Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly

305 310 315 320

ctc gaa tgg tcc tgg cgt gtc ttt gga aac atc atg ctc atg ggt gtg 1008

Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu Met Gly Val

325 330 335

gcg gaa tcg ctc gcg ctg gcg gtc ctg ttt tcg ttg tcg cac aat ttc 1056

Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe

340 345 350

gaa tcc gcg gat cgc gat ccg acc gcc cca ctg aaa aag acg gga gaa 1104

Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu

355 360 365

cca gtc gac tgg ttc aag aca cag gtc gaa act tcc tgc act tac ggt 1152

Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly

370 375 380

gga ttc ctt tcc ggt tgc ttc acg gga ggt ctc aac ttt cag gtt gaa 1200

Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu

385 390 395 400

cac cac ttg ttc cca cgc atg agc agc gct tgg tat ccc tac att gcc 1248

His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala

405 410 415

ccc aag gtc cgc gaa att tgc gcc aaa cac ggc gtc cac tac gcc tac 1296

Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr

420 425 430

tac ccg tgg atc cac caa aac ttt ctc tcc acc gtc cgc tac atg cac 1344

Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met His

435 440 445

gcg gcc ggg acc ggt gcc aac tgg cgc cag atg gcc aga gaa aat ccc 1392

Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu Asn Pro

450 455 460

ttg acc gga cgg gcg taa 1410

Leu Thr Gly Arg Ala

465 470

<210>6

<211>469

<212>PRT

＜213〉Phaeodactylum tricornutum

<400>6

Met Ala Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val

1 5 10 15

Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser

20 25 30

Leu Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr

35 40 45

Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe

50 55 60

Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro Tyr His

65 70 75 80

Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp

85 90 95

Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys

100 105 110

Arg Glu Val Phe Lys Ile Val Arg Arg Gly Lys Asp Phe Gly Thr Leu

115 120 125

Gly Trp Phe Phe Arg Ala Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu

130 135 140

Gln Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala

145 150 155 160

Tyr Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala

165 170 175

Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly

180 185 190

Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln Glu Gln

195 200 205

His Trp Thr His His Ala Tyr Thr Asn His Ala Glu Met Asp Pro Asp

210 215 220

Ser Phe Gly Ala Glu Pro Met Leu Leu Phe Asn Asp Tyr Pro Leu Asp

225 230 235 240

His Pro Ala Arg Thr Trp Leu His Arg Phe Gln Ala Phe Phe Tyr Met

245 250 255

Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile

260 265 270

Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp

275 280 285

Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala

290 295 300

Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly

305 310 315 320

Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu Met Gly Val

325 330 335

Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe

340 345 350

Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu

355 360 365

Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly

370 375 380

Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu

385 390 395 400

His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala

405 410 415

Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr

420 425 430

Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met His

435 440 445

Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu Asn Pro

450 455 460

Leu Thr Gly Arg Ala

465

<210>7

<211>1344

<212>DNA

＜213〉angle tooth moss (ceratodon purpureus)

<220>

<221>CDS

<222>(1)..(1344)

＜223〉delta-5-desaturase

<400>7

atg gta tta cga gag caa gag cat gag cca ttc ttc att aaa att gat 48

Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp

1 5 10 15

gga aaa tgg tgt caa att gac gat gct gtc ctg aga tca cat cca ggt 96

Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly

20 25 30

ggt agt gca att act acc tat aaa aat atg gat gcc act acc gta ttc 144

Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe

35 40 45

cac aca ttc cat act ggt tct aaa gaa gcg tat caa tgg ctg aca gaa 192

His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu

50 55 60

ttg aaa aaa gag tgc cct aca caa gaa cca gag atc cca gat att aag 240

Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys

65 70 75 80

gat gac cca atc aaa gga att gat gat gtg aac atg gga act ttc aat 288

Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn

85 90 95

att tct gag aaa cga tct gcc caa ata aat aaa agt ttc act gat cta 336

Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu

100 105 110

cgt atg cga gtt cgt gca gaa gga ctt atg gat gga tct cct ttg ttc 384

Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe

115 120 125

tac att aga aaa att ctt gaa aca atc ttc aca att ctt ttt gca ttc 432

Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe

130 135 140

tac ctt caa tac cac aca tat tat ctt cca tca gct att cta atg gga 480

Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly

145 150 155 160

gtt gcg tgg caa caa ttg gga tgg tta atc cat gaa ttc gca cat cat 528

Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His

165 170 175

cag ttg ttc aaa aac aga tac tac aat gat ttg gcc agc tat ttc gtt 576

Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val

180 185 190

gga aac ttt tta caa gga ttc tca tct ggt ggt tgg aaa gag cag cac 624

Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His

195 200 205

aat gtg cat cac gca gcc aca aat gtt gtt gga cga gac gga gat ctt 672

Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu

210 215 220

gat tta gtc cca ttc tat gct aca gtg gca gaa cat ctc aac aat tat 720

Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr

225 230 235 240

tct cag gat tca tgg gtt atg act cta ttc aga tgg caa cat gtt cat 768

Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His

245 250 255

tgg aca ttc atg tta cca ttc ctc cgt ctc tcg tgg ctt ctt cag tca 816

Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser

260 265 270

atc att ttt gtt agt cag atg cca act cat tat tat gac tat tac aga 864

Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg

275 280 285

aat act gcg att tat gaa cag gtt ggt ctc tct ttg cac tgg gct tgg 912

Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp

290 295 300

tca ttg ggt caa ttg tat ttc cta ccc gat tgg tca act aga ata atg 960

Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met

305 310 315 320

ttc ttc ctt gtt tct cat ctt gtt gga ggt ttc ctg ctc tct cat gta 1008

Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val

325 330 335

gtt act ttc aat cat tat tca gtg gag aag ttt gca ttg agc tcg aac 1056

Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn

340 345 350

atc atg tca aat tac gct tgt ctt caa atc atg acc aca aga aat atg 1104

Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met

355 360 365

aga cct gga aga ttc att gac tgg ctt tgg gga ggt ctt aac tat cag 1152

Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln

370 375 380

att gag cac cat ctt ttc cca acg atg cca cga cac aac ttg aac act 1200

Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr

385 390 395 400

gtt atg cca ctt gtt aag gag ttt gca gca gca aat ggt tta cca tac 1248

Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr

405 410 415

atg gtc gac gat tat ttc aca gga ttc tgg ctt gaa att gag caa ttc 1296

Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe

420 425 430

cga aat att gca aat gtt gct gct aaa ttg act aaa aag att gcc tag 1344

Arg Asn Ile Ala Asn Val Ala Ala Lys Leu Thr Lys Lys Ile Ala

435 440 445

<210>8

<211>447

<212>PRT

＜213〉angle tooth moss

<400>8

Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp

1 5 10 15

Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly

20 25 30

Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe

35 40 45

His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu

50 55 60

Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys

65 70 75 80

Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn

85 90 95

Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu

100 105 110

Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe

115 120 125

Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe

130 135 140

Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly

145 150 155 160

Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His

165 170 175

Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val

180 185 190

Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His

195 200 205

Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu

210 215 220

Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr

225 230 235 240

Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His

245 250 255

Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser

260 265 270

Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg

275 280 285

Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp

290 295 300

Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met

305 310 315 320

Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val

325 330 335

Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn

340 345 350

Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met

355 360 365

Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln

370 375 380

Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr

385 390 395 400

Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr

405 410 415

Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe

420 425 430

Arg Asn Ile Ala Asn Val Ala Ala Lys Leu Thr Lys Lys Ile Ala

435 440 445

<210>9

<211>1443

<212>DNA

＜213〉exhibition leaf sword-like leave moss (Physcomitrella patens)

<220>

<221>CDS

<222>(1)..(1443)

＜223〉delta-5-desaturase

<400>9

atg gcg ccc cac tct gcg gat act gct ggg ctc gtg cct tct gac gaa 48

Met Ala Pro His Ser Ala Asp Thr Ala Gly Leu Val Pro Ser Asp Glu

1 5 10 15

ttg agg cta cga acg tcg aat tca aag ggt ccc gaa caa gag caa act 96

Leu Arg Leu Arg Thr Ser Asn Ser Lys Gly Pro Glu Gln Glu Gln Thr

20 25 30

ttg aag aag tac acc ctt gaa gat gtc agc cgc cac aac acc cca gca 144

Leu Lys Lys Tyr Thr Leu Glu Asp Val Ser Arg His Asn Thr Pro Ala

35 40 45

gat tgt tgg ttg gtg ata tgg ggc aaa gtc tac gat gtc aca agc tgg 192

Asp Cys Trp Leu Val Ile Trp Gly Lys Val Tyr Asp Val Thr Ser Trp

50 55 60

att ccc aat cat ccg ggg ggc agt ctc atc cac gta aaa gca ggg cag 240

Ile Pro Asn His Pro Gly Gly Ser Leu Ile His Val Lys Ala Gly Gln

65 70 75 80

gat tcc act cag ctt ttc gat tcc tat cac ccc ctt tat gtc agg aaa 288

Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu Tyr Val Arg Lys

85 90 95

atg ctc gcg aag tac tgt att ggg gaa tka gta ccg tct gct ggt gat 336

Met Leu Ala Lys Tyr Cys Ile Gly Glu Xaa Val Pro Ser Ala Gly Asp

100 105 110

gac aag ttt aag aaa gca act ctg rag tat gca gat gcc gaa aat gaa 384

Asp Lys Phe Lys Lys Ala Thr Leu Xaa Tyr Ala Asp Ala Glu Asn Glu

115 120 125

gat ttc tat ttg gtt gtg aag caa cga gtt gaa tct tat ttc aag agt 432

Asp Phe Tyr Leu Val Val Lys Gln Arg Val Glu Ser Tyr Phe Lys Ser

130 135 140

aac aag ata aac ccc caa att cat cca cat atg atc ctg aag tca ttg 480

Asn LVs Ile Asn Pro Gln Ile His Pro His Met Ile Leu Lys Ser Leu

145 150 155 160

ttc att ctt ggg gga tat ttc gcc agt tac tat tta gcg ttc ttc tgg 528

Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp

165 170 175

tct tca agt gtc ctt gtt tct ttg ttt ttc gca ttg tgg atg ggg ttc 576

Ser Ser Ser Val Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe

180 185 190

ttc gca gcg gaa gtc ggc gtg tcg att caa cat gat gga aat cat ggt 624

Phe Ala Ala Glu Val Gly Val Ser Ile Gln His Asp Gly Asn His Gly

195 200 205

tca tac act aaa tgg cgt ggc ttt gga tat atc atg gga gcc tcc cta 672

Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala Ser Leu

210 215 220

gat cta gtc gga gcc agt agc ttc atg tgg aga cag caa cac gtt gtg 720

Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val

225 230 235 240

gga cat cac tcg ttt aca aat gtg gac aac tac gat cct gat att cgt 768

Gly His His Ser Phe Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg

245 250 255

gtg aaa gat cca gat gtc agg agg gtt gcg acc aca caa cca aga caa 816

Val Lys Asp Pro Asp Val Arg Arg Val Ala Thr Thr Gln Pro Arg Gln

260 265 270

tgg tat cat gcg tat cag cat atc tac ctg gca gta tta tat gga act 864

Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly Thr

275 280 285

cta gct ctt aag agt att ttt cta gat gat ttc ctt gcg tac ttc aca 912

Leu Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr

290 295 300

gga tca att ggc cct gtc aag gtg gcg aaa atg acc ccc ctg gag ttc 960

Gly Ser Ile Gly Pro Val Lys Val Ala Lys Met Thr Pro Leu Glu Phe

305 310 315 320

aac atc ttc ttt cag gga aag ctg cta tat gcg ttc tac atg ttc gtg 1008

Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala Phe Tyr Met Phe Val

325 330 335

ttg cca tct gtg tac ggt gtt cac tcc gga gga act ttc ttg gca cta 1056

Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu

340 345 350

tat gtg gct tct cag ctc att aca ggt tgg atg tta gct ttt ctt ttt 1104

Tyr Val Ala Ser Gln Leu Ile Thr Gly Trp Met Leu Ala Phe Leu Phe

355 360 365

caa gta gca cat gtc gtg gat gat gtt gca ttt cct aca cca gaa ggt 1152

Gln Val Ala His Val Val Asp Asp Val Ala Phe Pro Thr Pro Glu Gly

370 375 380

ggg aag gtg aag gga gga tgg gct gca atg cag gtt gca aca act acg 1200

Gly Lys Val Lys Gly Gly Trp Ala Ala Met Gln Val Ala Thr Thr Thr

385 390 395 400

gat ttc agt cca cgc tca tgg ttc tgg ggt cat gtc tct gga gga tta 1248

Asp Phe Ser Pro Arg Ser Trp Phe Trp Gly His Val Ser Gly Gly Leu

405 410 415

aac aac caa att gag cat cat ctg ttt cca gga gtg tgc cat gtt cat 1296

Asn Asn Gln Ile Glu His His Leu Phe Pro Gly Val Cys His Val His

420 425 430

tat cca gcc att cag cct att gtc gag aag acg tgc aag gaa ttc gat 1344

Tyr Pro Ala Ile Gln Pro Ile Val Glu Lys Thr Cys Lys Glu Phe Asp

435 440 445

gtg cct tat gta gcc tac cca act ttt tgg act gcg ttg aga gcc cac 1392

Val Pro Tyr Val Ala Tyr Pro Thr Phe Trp Thr Ala Leu Arg Ala His

450 455 460

ttt gcg cat ttg aaa aag gtt gga ttg aca gag ttt cgg ctc gat ggc 1440

Phe Ala His Leu Lys Lys Val Gly Leu Thr Glu Phe Arg Leu Asp Gly

465 470 475 480

tga 1443

<210>10

<211>480

<212>PRT

＜213〉exhibition leaf sword-like leave moss

<400>10

Met Ala Pro His Ser Ala Asp Thr Ala Gly Leu Val Pro Ser Asp Glu

1 5 10 15

Leu Arg Leu Arg Thr Ser Asn Ser Lys Gly Pro Glu Gln Glu Gln Thr

20 25 30

Leu Lys Lys Tyr Thr Leu Glu Asp Val Ser Arg His Asn Thr Pro Ala

35 40 45

Asp Cys Trp Leu Val Ile Trp Gly Lys Val Tyr Asp Val Thr Ser Trp

50 55 60

Ile Pro Asn His Pro Gly Gly Ser Leu Ile His Val Lys Ala Gly Gln

65 70 75 80

Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu Tyr Val Arg Lys

85 90 95

Met Leu Ala Lys Tyr Cys Ile Gly Glu Xaa Val Pro Ser Ala Gly Asp

100 105 110

Asp Lys Phe Lys Lys Ala Thr Leu Xaa Tyr Ala Asp Ala Glu Asn Glu

115 120 125

Asp Phe Tyr Leu Val Val Lys Gln Arg Val Glu Ser Tyr Phe Lys Ser

130 135 140

Asn Lys Ile Asn Pro Gln Ile His Pro His Met Ile Leu Lys Ser Leu

145 150 155 160

Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp

165 170 175

Ser Ser Ser Val Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe

180 185 190

Phe Ala Ala Glu Val Gly Val Ser Ile Gln His Asp Gly Asn His Gly

195 200 205

Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala Ser Leu

210 215 220

Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val

225 230 235 240

Gly His His Ser Phe Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg

245 250 255

Val Lys Asp Pro Asp Val Arg Arg Val Ala Thr Thr Gln Pro Arg Gln

260 265 270

Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly Thr

275 280 285

Leu Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr

290 295 300

Gly Ser Ile Gly Pro Val Lys Val Ala Lys Met Thr Pro Leu Glu Phe

305 310 315 320

Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala Phe Tyr Met Phe Val

325 330 335

Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu

340 345 350

Tyr Val Ala Ser Gln Leu Ile Thr Gly Trp Met Leu Ala Phe Leu Phe

355 360 365

Gln Val Ala His Val Val Asp Asp Val Ala Phe Pro Thr Pro Glu Gly

370 375 380

Gly Lys Val Lys Gly Gly Trp Ala Ala Met Gln Val Ala Thr Thr Thr

385 390 395 400

Asp Phe Ser Pro Arg Ser Trp Phe Trp Gly His Val Ser Gly Gly Leu

405 410 415

Asn Asn Gln Ile Glu His His Leu Phe Pro Gly Val Cys His Val His

420 425 430

Tyr Pro Ala Ile Gln Pro Ile Val Glu Lys Thr Cys Lys Glu Phe Asp

435 440 445

Val Pro Tyr Val Ala Tyr Pro Thr Phe Trp Thr Ala Leu Arg Ala His

450 455 460

Phe Ala His Leu Lys Lys Val Gly Leu Thr Glu Phe Arg Leu Asp Gly

465 470 475 480

Claims

1. in genetically modified organism, produce the method for following compound of Formula I

Described method comprises:

A) nucleotide sequence that at least a coded delta-9-is prolonged enzyme is introduced transgenic organism,,

B) introduce at least a coded delta-8-desaturase second nucleotide sequence and

D) cultivate and gather in the crops said organism;

R ²=hydrogen-, phosphatidylcholine-, phosphatidylethanolamine-, phosphatidyl glycerol-, diphosphatidylglycerol-, phosphatidylserine-, phosphatidylinositols-, sphingolipid-, sphingoglycolipid-, sphingoglycolipid-saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl,

R ³=hydrogen-, saturated or undersaturated C ₂-C ₂₄-alkyl-carbonyl-or R ²And R ³Be the group of formula Ia independently of each other:

N=3,4 or 6, m=3,4 or 5 and p=0 or 3.

2. the nucleotide sequence that the process of claim 1 wherein encodes has Δ-8-desaturase, Δ-9-prolongs the polypeptide of enzyme or Δ-5-desaturase is selected from:

A) nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or the SEQ ID NO:9,

B) according to the genetic code degeneracy, derived from the nucleotide sequence of sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQID NO:5, SEQ ID NO:7 or the SEQ ID NO:9,

C) derivative of sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or the SEQ ID NO:9, its coding has the polypeptide of at least 50% homology and the effect that its sequence plays Δ-8-desaturase, Δ-9-prolongation enzyme or Δ-5-desaturase with the encoding sequence of aminoacid sequence shown in SEQ ID NO:2, SEQ IDNO:4, SEQ ID NO:6, SEQ ID NO:8 or the SEQ ID NO:10.

3. claim 1 or 2 method, wherein substituent R ²And R ³Be saturated or unsaturated C independently of one another ₁₀-C ₂₂-alkyl-carbonyl-.

4. the method for each of claim 1 to 3, wherein substituent R ²And R ³Be saturated or unsaturated C independently of one another ₁₆-, C ₁₈-, C ₂₀-or C ₂₂-alkyl-carbonyl-.

5. the method for each of claim 1 to 4, wherein substituent R ²And R ³Be unsaturated C independently of one another with at least three two keys ₁₆-, C ₁₈-, C ₂₀-or C ₂₂-alkyl-carbonyl-.

6. the method for each of claim 1 to 5, genetically modified organism wherein is an oil-produced vegetable.

7. the method for each of claim 1 to 6, transgenic plant wherein are selected from: oilseed rape, opium poppy, leaf mustard, hemp, castor-oil plant, flax, olive, mary bush, punica, fibert, apricot, Queensland nut, avocado, pumpkin, English walnut, bay, Pistacia vera, Flower of Beltleaf Primrose, canola, peanut, linseed oil, soybean, safflower, Sunflower Receptacle and Borrago officinalis.

8. the method for each of claim 1 to 7, wherein the compound of general formula I is separated with oil, the lipids form of its free fatty acids.

9. the method for each of claim 1 to 8, wherein the compound of general formula I is separated with the concentration that accounts for total lipid content at least 5% weight.

10. comprise the separated nucleic acid sequence of the nucleotide sequence of coded delta-8-desaturase, wherein said nucleotide sequence is selected from:

A) nucleotide sequence shown in the SEQ ID NO:1,

B) from sequence shown in the SEQ ID NO:1 according to the genetic code degeneracy and deutero-, nucleotide sequence with Δ-8-desaturase function.

11. comprise the separated nucleic acid sequence of the nucleotide sequence that is selected from following coded delta-5-desaturase:

A) nucleotide sequence shown in the SEQ ID NO:5,

B) from sequence shown in the SEQ ID NO:5 according to the genetic code degeneracy and the deutero-nucleotide sequence,

C) derivative of sequence shown in the SEQ ID NO:5, its coding has the function of polypeptide and its sequence performance Δ-5-desaturase of at least 50% homology with the encoding sequence of aminoacid sequence shown in the SEQ ID NO:6.

12. separated nucleic acid sequence amino acid sequence coded by claim 10 or claim 11.

Have claim 10 or the described gene construct with isolating nucleic acid of sequence SEQ IDNO:1 or SEQ ID NO:5 of claim 11 13. comprise, wherein said nucleic acid is connected with one or more conditioning signals are functional.

14. the gene construct of claim 13, its genetic expression increases by conditioning signal.

15. comprise the carrier of the gene construct of the nucleic acid of claim 10 or claim 11 or claim 14.

16. comprise the biology of the carrier of the gene construct of nucleic acid, claim 13 of at least one claim 10 or claim 11 or claim 15.

17. the biology of claim 16, biology wherein are microorganism, non-human animal or plant.

18. the biology of claim 16 or 17, wherein said biology is transgenic plant.