CN1703144A - Fatty acid desaturases from fungi - Google Patents

Abstract

The invention relates generally to methods and compositions concerning fungal desaturase enzymes that modulate the number and location of double bonds in long chain poly-unsaturated fatty acids (LC-PUFA's). In Particular, the invention relates to methods and compositions for improving omega-3 fatty acid profiles in plant products and parts using desaturase enzymes and nucleic acids encoding for such enzymes. In particular embodiments, the desaturase enzymes are fungal -15 desaturases. Also provided are improved canola oil compositions having SDA and maintaining beneficial oleic acid content.

Description

Derive from the fatty acid dehydrogenase of fungi

Background of invention

The application requires that application number is 60/382,391, the applying date is on May 22nd, 2002, and application number is 60/453,125, the applying date is the priority of the U.S. Provisional Patent Application on March 7th, 2003.Especially with above-mentioned each apply for that disclosed full content is all as the application's reference.

1. invention field

The present invention relates generally to the number of regulating two keys in the long-chain polyunsaturated fatty acid (LC-PUFA ' s) and dehydrase and the using method and the composition of position.Specifically, the present invention relates to utilize dehydrase to improve the characteristic of fatty acid and the nucleic acid of fixed these dehydrases of coding in fungi.

2. description of related art

In most organisms, the synthetic primary product of fatty acid biological is 16-and 18-carbon compound.The chain length of these fatty acid differs greatly with species are different with the relative ratios of degree of unsaturation.For example mammal mainly produces saturated and single saturated fatty acid, however most higher plant produce and contain one, the fatty acid of two or three two keys, two of back just comprise polyunsaturated fatty acid (PUFA ' s).

Two kinds of primary categories of PUFA ' s are omega-3 fatty acid (also use " n-3 " fatty acid representative), with the eicosapentaenoic acid be example (EPA, 20:4, n-3); And Ω-6 fatty acid (also using the representative of " n-6 " fatty acid), be that (ARA, 20:4 n-6) are example to example with the arachidonic acid.PUFAs is the important component of cytoplasma membrane and adipose tissue, and wherein they exist with the form of phosphatide and triglycerides separately.PUFAs is essential to the growth of baby's brain and formation, the reparation of tissue particularly for mammiferous normal development.

Fatty acid can be treated some diseases.Shown and replenished the ISR ratio that PUFAs can reduce postangioplasty.The document play-by-play has also been arranged beneficial effect (Simopoulos, 1997 of some edible omega-3 fatty acid to angiocardiopathy and rheumatoid arthritis; James etal., 2000).In addition, PUFAs has been proposed and has been used for treating asthma and trichophytosis.Evidence suggests that PUFAs may participate in calcium metabolism, this prompting PUFAs can be used for the treatment of or prevention of osteoporosis and kidney or lithangiuria.Wholesome material evidence comes from long chain omega-3 fat, EPA in fish and the fish oil and DHA.Based on these evidences, Canada (ScientificReview Committee, 1990, Nutrition Recommendations, Minister ofNational Health and Welfare, Canada, Ottowa), Europe (de Deckereret al., 1998), Britain (The British Nutrition Foundation, 1992, Unsaturatedfatty-acids-nutritional and physiological significance:The report of theBritish Nutrition Foundation ' s Task Force, Chapman and Hall, London) and the health agency of the U.S. (Simopoulos et al., 1999) and the nutritionist consumption of having advised improving these PUFAs in the meals.

PUFAs also can be used to treat diabetes (U.S.Pat.No.4,826,877; Horrobin etal., 1993).Verified in diabetic animal, change has taken place in fatty acid metabolism and composition.This points out these to change the long-term complications that causes with some diabetes, and it is relevant to comprise that retinopathy, neuropathy, ephrosis and genital system damage.The primrose oil that contains GLA has demonstrated and can prevent and treat the diabetes nerve damage.

PUFAs, for example linoleic acid (LA, 18:2, Δ 9,12) and α-linoleic acid (ALA, 18:3, Δ 9,12,15) are considered to fatty acid essential in the diet, because mammal lacks synthetic these sour abilities.Yet capable LA that will absorb of mammal and ALA are metabolized to the form of middle n-6 of long-chain polyunsaturated fatty acid (LC-PUFA) and n-3.These LC-PUFA ' s are important cell components, and it is as the precursor of the biologically active quasi-eicosane of regulating normal physiological function, as prostaglandin, prostacyclin and leukotrienes, give the flowability of film and functional.

In mammal, the rate-limiting step of the formation of LC-PUFA is Δ 6 dehydrogenations, wherein LA is converted into gamma-linoleic acid (GLA, 18:3, Δ 6,9,12), changes ALA into SDA (18:4, Δ 6,9,12,15).Shown that many physiology and pathological condition can suppress this metabolism step, finally suppress the generation of LC-PUFA.Yet, replenish EPA or DHA by diet and avoid Δ 6 dehydrogenations and can effectively alleviate many and the low-level relevant pathological conditions of PUFA.Yet as following more detailed elaboration, owing to multiple reason, it is not satisfied can using the source of PUFA at present.Caused interest for the needs in the source of a reliable and economic PUFA ' s to alternative source of PUFA ' s.

Important long-chain PUFAs mainly comprise the DHA mainly in dissimilar fish oil, found (DHA, 22:6, n-3) and EPA, and the arachidonic acid of in filamentous fungi, finding (ARA, 20:4, n-6).For DHA, the existing multiple source that is used to commercially produce comprises oil and the yolk part of multiple ocean organism, cold water marine fishes.The source of commercially producing SDA comprises that Trichodesma and Echium belong to.Yet commercially producing PUFAs by natural origin has several shortcomings.The natural origin of PUFAs, for example animal and plant often has very high different types of oil and forms.For example, the oil that obtains from the Echium seed except SDA, almost contains the quite Ω of level-6 fatty acid GLA.Therefore the oil require that obtains from these sources is further purified target P UFAs or the production oil that is rich in one or more PUFA that obtains one or more with separation.

The PUFAs of natural origin has also met with uncontrollable fluctuation aspect availability.The shoal of fish might experience nature change or may be owing to excessive amount of fishing exhausts.In addition, even there are a large amount of evidences to show their result of treatment, do not arouse attention about the recommendation of omega-3 fatty acid diet.Fish oil has taste beastly and the smell that can not remove economically from target product, these products can not be accepted as food additives.Animal oil, particularly fish oil can cause the environmental contaminants accumulation.Food can add fish oil, but need be pointed out that once more, because cost and the decay of the worldwide shoal of fish, this interpolation also is problematic.Be problematic in that it is inconvenient consuming and absorbing full fish.Even so, accepted by society if increase the health and fitness information of the amount of fish, the demand that satisfies fish just becomes problem probably.In addition, be problematic in that this industry sustainable development capacity depends critically upon the wild shoal of fish (Naylor et al., 2000) that is used for the aquatic products raising.

Other restriction naturally impels the method for seeking a kind of new production omega-3 fatty acid.Weather and disease can cause the fluctuation of the output that relies on fish and plant resources.The farmland that is used for produce oil crop growth alternately is being faced with to be competed, and competition comes from that population continues amplification and accordingly to produce the increase in demand of food on the existing soil ploughed.Crops produce PUFAs really, Common Borage for example, but be not suitable for commercially producing, can not well implement single cropping.Crops bigger with profit, that be easier to plant are compared, and plant this crops and do not possess economically competitiveness.The expense of the organism of large scale fermentation such as Mortierella also is expensive.Natural animal tissue contains a spot of ARA and is difficult to the processing processing.Microorganism such as Porphyidium and Mortierella are difficult to carry out commercial-scale cultivation.

Many enzymes participate in the PUFA biosynthesis.Generate LA (18:2, Δ 9,12) by Δ 12-dehydrase by oleic acid (OA, 18:1, Δ 9), and generate ALA (18:3) by LA by Δ 15 desaturases.Generate SDA (18:4, Δ 6,9,12,15) and GLA (18:3, Δ 6,9,12) by Δ 6 desaturases by LA and ALA.Yet, as mentioned above, mammal can not be on than 9 farther positions of Δ dehydrogenation, therefore oleic acid can not be transformed into LA.Same, mammal can not be synthesized ALA.Other eucaryote comprises fungi and plant, contains the enzyme of dehydrogenation on the position of carbon 12 and carbon 15.Therefore the most of polyunsaturated fatty acids in the animal come from that the prolongation of diet and the dehydrogenation by subsequently and LA in the diet and ALA obtains.

U.S.Pat.No.5,952,544 have described the nucleic acid fragment of the coding fatty acid dehydrogenase that separates and clone from Brassica napus.Being expressed in the plant of the nucleic acid fragment of ' 544 patents carried out, and the result accumulates ALA.Yet in the genetically modified plants of expressing plant Δ 15-dehydrase, a large amount of LA are not still transformed by dehydrase.The active better enzyme that more LA can be transformed into ALA will be very favourable.The conversion of increase from LA to ALA can produce more substantial ALA.When with the nucleic acid coexpression of coded delta 15-dehydrase, the level of the ALA of rising can impel Δ 6-dehydrase to act on ALA, thereby produces higher levels of SDA.Owing to use the multiple beneficial effect of SDA, need increase substantially SDA output.Explore to improve SDA output at the nucleic acid in various sources.Yet still can only largely post the innovation of commercially producing (seeing e.g., Reed et al., 2000) that is contemplated for the crops of improving on the soil.In addition, using the dehydrase polynucleotides derive from Caenorhabditis elegans (Meesapyodsuk et al., 2000) is unfavorable for the commercially producing of plant seed oils of enrichment.

The nucleic acid of coded delta 15-dehydrase separates from Cyanophyceae and plant several kinds, comprises arabidopsis, soybean and parsley.The amino acid sequence that these dehydrases are inferred shows the similitude of height, and the most significant is that this is not subjected to any one one theory in the motif zone of 3 enrichment histidines that are considered to participate in the iron combination.Yet, from any fungi, all be not separated to Δ 15-dehydrase.In addition,, use the complex calculations rule, utilize known Δ 15-dehydrase cDNA and amino acid sequence also not to find Δ 15-dehydrase at Aspergillus and the comparison of NeurosporaDNA database even with the gene order-checkings of several fungies.

Therefore, acquisition participates in the biosynthetic genetic material of PUFA and at families of plant, it is favourable particularly expressing the material that separates in the crops system of epigeal land, and this system can provide one or more PUFA ' s of commercialization output.Owing to need to increase the intake of humans and animals Ω-3 fat, multiple food that is rich in Ω-3 and food additives need be provided, thereby make people can select feed, feed ingredient, food and food ingredient to satisfy their diet custom.At present, have only a kind of omega-3 fatty acid, ALA can obtain in vegetable oil.Yet the ALA of picked-up has only the long-chain omega-3 fatty acid that is transformed on a small quantity as EPA and DHA.This point confirms in the autre action pendante U. S. application 10/384,639 " treatment of inflammation disorder and prevention ", by use Linseed oil per capita the ALA intake brought up to for 14 gram/every days from 1 gram/every day, be the appropriate level that has increased kytoplasm phosphatide EPA.The ALA intake increases by 14 times and only causes kytoplasm phosphatide EPA to increase by 2 times (Manzioris et al., 1994).

Therefore, finally also need to utilize fatty acid dehydrogenase, encode they gene and produce their the efficient and enforceable production of the commercialization PUFAs of recombination method.Need to produce and contain relative scale oil higher and/or that be rich in specific PUFA ' s, contain their food compositions and additive.Also need discovery to produce the method for the reliable economy of specific PUFA ' s.

Although poor efficiency and low yield as mentioned above produced omega-3 fatty acid by land uncooked food chain, particularly produce cause useful of SDA to publilc health.As mentioned above, have only a small amount of ALA to be transformed into EPA, so the SDA particular importance.This is that initial enzyme Δ 6-dehydrase activity in human body is very low, has limited speed because (need Δ 6, Δ 12 and Δ 15) in these three kinds of enzymatic reaction processes.The evidence of Δ 6-dehydrase maximum speed limit comes from has proved its substrate A of conversion LA in mouse and rat, than transforming its product S DA to the lower research of the efficient of EPA (Yamazaki et al., 1992; Huang, 1991).

Based on these research, show commercialization oilseed crops, for example in double-low rapeseed, soybean, corn, sunflower, safflower or flax, typical certain part single and polyunsaturated fatty acid in their seed oils is transformed into SDA, need the expression of the seed specific of multiple dehydrase, comprise Δ 6-and Δ 12 and the enzyme of Δ 15-dehydrogenase activity is arranged.Come from the oil of the plant that Δ 6, Δ 12 and Δ 15-dehydrase expression improve and be rich in SDA and other omega-3 fatty acid.These oil can be used for producing food and the food additives that are rich in omega-3 fatty acid, and consume the level that such food can effectively improve EPA and DHA in the tissue.Food and the raw-food material of making and preparing with the oil that is rich in Ω-3 will produce curative benefit as milk, margarine and sausage fully.Shown that people do not change eating habit, utilize the food be rich in omega-3 fatty acid to absorb to be equivalent to every days at least 1.8 gram EPA and the Ω-3 of DHA (Naylor, supra.).Therefore, the nucleic acid that is starved of new Δ 15-dehydrase is used for transgenic crop is rich in PUFAs with preparation oil.Need be rich in PUFAs, particularly as the new plant seed oil of the omega-3 fatty acid of parinaric acid.

Summary of the invention

On the one hand, the invention provides coding can be at the nucleic acid of the separation of the polypeptide (Δ 15-dehydrase) of 15 dehydrogenations of fatty acid molecule carbon.These can be used to transformant or improve plant or the fatty acid of the oil that plant produces composition.One embodiment of the invention are polynucleotide sequences of the separation that separates from the fungi kind with unique dehydrogenase activity.The polynucleotides of this separation preferably are subordinated to and are selected from by Zygomycota (zygomycota), separate in the fungi kind in the door in the group of load mattress door (basidiomycota) and Ascomycota (ascomycota) composition.In some instances, the polynucleotides of separation are from being selected from by Neuraspora crassa (Neurospora crassa), separating in the fungi kind in the group of aspergillus nidulans (aspergillus nidulans) and grey mold (Botrytis cinerea) formation.

On the other hand, the invention provides the polynucleotides that are selected from following separation: (a) polynucleotides of the polypeptide of coding SEQID NO:3, SEQ ID NO:5 or SEQ ID NO:34; (b) contain the polynucleotides of the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:33; (c) with SEQ ID NO:1, SEQ ID NO:2, SEQ IDNO:4 or SEQ ID NO:33 or its complement in one or more, the polynucleotides of under 5 * SSC, 50% formamide and 42 ℃ of conditions, hybridizing; (d) coding has the fungi polynucleotides of the polypeptide of at least one following amino acid motif:

TrpIleLeuAlaHisGluCysGlyHisGlyAlaSerPhe (WILAHECGHGASF) (SEQ IDNO:6); LeuAlaHisGluCysGlyHis (LAHECGH) (SEQ ID NO:7); HisSerPheLeuLeuValProTyrPheSerTrpLys (HSFLLVPYFSWK) (SEQ ID NO:8); LeuLeuValProTyrPheSerTrpLys (LLVPYFSWK) (SEQ ID NO:9); His (His/Ala) ArgHisHisArg (Phe/Tyr) ThrThr (H (H/A) RHHR (F/Y) TT) (SEQ ID NO:10, SEQ IDNO:19, SEQ ID NO:20, or SEQ ID NO:21); TrpValHisHisTrpLeuValAlaIleThrTyrLeu (His/Gln) HisThrHis (WVHHWLVAITYL (H/Q) HTH) (SEQ ID NO:11); AlaIleThrTyrLeu (His/Gln) HisThr (AITYL (H/Q) HT) (SEQ ID NO:12); GlyAlaLeuAlaThrValAspArg (GALATVDR) (SEQ ID NO:13) or HisValValHisHisLeuPheXaaArgIleProPheTyr (HVVHHLFXRIPFY) (SEQ ID NO:14 or SEQID NO:22).

Yet, on the other hand, the invention provides the recombinant vector of the polynucleotides that contain separation of the present invention.Use term " recombinant vector " here, comprise that any hope is incorporated into a DNA recombinant fragment in host cell, tissue and/or the organism with it, particularly including the expression cassette that separates from initial polynucleotides.Recombinant vector can be linear or ring-type.Aspect various, recombinant vector can comprise at least one extra sequence of selecting from organize down: the regulating and controlling sequence that is connected with the polynucleotides operability; The selection markers that is connected with the polynucleotides operability; The flag sequence that is connected with the polynucleotides operability; The purification part that is connected with the polynucleotides operability; The target sequence that is connected with the polynucleotides operability.

On the other hand, the invention provides with polynucleotides cell transformed of the present invention, for example mammal, plant, insect, yeast and bacterial cell.In further embodiment, use and except that polynucleotides of the present invention, also contain structural and recombinant vector transformant tissue-specific promoter.In some particular instance of the present invention, the nucleotide sequence that these cells are further defined to the polypeptide that is encoded transforms, and this polypeptide has the dehydrogenase activity of dehydrogenation on 6 of fatty acid carbons.

On the other hand, the invention provides the polypeptide that has at the dehydrogenase activity of 15 dehydrogenations of fatty acid molecule carbon, comprise fragment and albumen.In an example of the present invention, polypeptide contains at least a following amino acid motif: TrpIleLeuAlaHisGluCysGlyHisGlyAlaSerPhe (WILAHECGHGASF) (SEQ ID NO:6); LeuAlaIIisGluCysGlyHis (LAHECGH) (SEQ ID NO:7); HisSerPheLeuLeuValProTyrPheSerTrpLys (HSFLLVPYFSWK) (SEQ ID NO:8); LeuLeuValProTyrPheSerTrpLys (LLVPYFSWK) (SEQ ID NO:9); His (His/Ala) ArgHisHisArg (Phe/Tyr) ThrThr (H (H/A) RHHR (F/Y) TT) (SEQ ID NO:10, SEQ IDNO:19, SEQ ID NO:20, or SEQ ID NO:21); TrpValHisHisTrpLeuValAlaIleThrTyrLeu (His/Gln) HisThrHis (WVHHWLVAITYL (H/Q) HTH) (SEQ ID NO:11); AlaIleThrTyrLeu (His/Gln) HisThr (AITYL (H/Q) HT) (SEQ ID NO:12); GlyAlaLeuAlaThrValAspArg (GALATVDR) (SEQ ID NO:13) or HisValValHisHisLeuPheXaaArgIleProPheTyr (HVVHHLFXRIPFY) (SEQ ID NO:14 or SEQID NO:22).

In further embodiment, polypeptide further is restricted to and contains all above-mentioned amino acid motifs.The present invention also provides and contains SEQ ID NO:3, SEQ ID NO:5, or the fungi polypeptide of the amino acid sequence of SEQ IDNO:34 or its fragment, and it has the dehydrogenase activity in 15 dehydrogenations of fatty acid molecule carbon.

On the other hand, the invention provides a kind ofly, comprise that step (a) obtains the seed of plant of the present invention by the method for producing the seed oil contain omega-3 fatty acid in the plant seed; (b) from described seed, extract oil.These plant seeds comprise double-low rapeseed, soybean, soya bean, rape seed, sunflower, cotton, cocoa bean, peanut, safflower, coconut, flax, coconut oil, oilseed rape and corn.The preferred method that transforms these plant cells comprises Ti and Ri plasmid, electroporation and the bombardment of high speed trajectory of using Agrobacterium.

On the other hand, provide to comprise introducing recombinant vector of the present invention in a kind of oil-produced vegetable, and produced the method for the plant of the seed oil that contains altered omega-3 fatty acid level.In the method, import recombinant vector and can comprise cultivation of plants and step: (a) use the recombinant vector transformed plant cells; (b) by described plant cell aftergrowth, wherein the omega-3 fatty acid level of plant is changed.In the method, plant can be selected in the group that the plant of Citrus plant, generation nut and berry is formed from comprising for example arabidopsis, oilseeds Brassicas, rape seed, sunflower, safflower, double-low rapeseed, corn, soybean, cotton, flax, jojoba, Chinese Chinese tallow tree, tobacco, cocoa bean, peanut, fruit tree.This plant can be further defined to the nucleotide sequence that has at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon with coding and transform, and the content of SDA increases in the plant.The method also may further include recombinant vector is incorporated in the multiple oil-produced vegetable, screening heredity have the plant or a filial generation of plant recombinant vector of the omega-3 fatty acid characteristic of expection.

On the other hand, the invention provides a kind of endogenous double-low rapeseed seed oil, its SDA content is from about 8% to about 27%, the content of oleic acid from about 40% to about 70%.In some instances, double-low rapeseed seed oil can be further defined to ALA acid, LA and the GLA that contains less than 10% mixing.This oil comprises SDS content and can also be further defined to from about 10% to about 20%, comprises from about 12% to about 20%, about 15% to about 20%, about 10% to about 17%, about 12% to about 17%.In further embodiment of the present invention, the oleic acid content of double-low rapeseed seed oil can be further defined to from about 45% to about 65%, comprises from about 50% to about 65%, about 50% to about 60%, about 55% to about 65%.In the present invention further in the embodiment, the content of SDA is further defined to from about 12% to about 17%, and oleic acid content is further defined to from about 55% to about 65%.In a concrete example, this double-low rapeseed seed oil comes from colea (Brassica napus) or turnip (Brassica rapa) seed.In some instances, Ω in the oil that provides-6 is from about 1: 1 to about 1: 4 with the ratio of omega-3 fatty acid, comprises from about 1: 2 to about 1: 4.

On the other hand, the invention provides a kind of method that improves the nutritive value of the edible product that humans and animals consumes, comprise double-low rapeseed seed oil provided by the invention is added in the edible product.In instantiation, product is the food of people and/or animal.Edible product also can be animal feed and/or food additives.In the method, double-low rapeseed seed oil can improve the SDA content of edible product and/or reduce the ratio of Ω-6 and omega-3 fatty acid in the edible product.Edible food can lack SDA before adding double-low rapeseed seed oil.

On the other hand, the invention provides the method for producing food or feed, comprise and add double-low rapeseed seed oil provided by the invention in raw material food or the feed ingredient production food and feed.In the example of some, this method is further defined to the method for producing food and/or feed.The present invention also provides food or the feed of being made by this method.

On the other hand, the present invention includes the method that SDA is provided to humans and animals, comprise giving the described double-low rapeseed seed of described human or animal's claim 1 oil.In the method, double-low rapeseed seed oil can give with the form of edible composition, and it comprises food or feed.The example of food comprises beverage, infusion of food, sauce, flavouring, salad dressing, fruit juice, syrup, dessert, sugar-coat and cake filling, soft freezing product, sweet food or intermediate food.Edible composition can be a liquid or solid basically.Edible composition also can be food additives and/or health products.In the method, can administration of human and/or animal double-low rapeseed seed oil.The examples of animals that gives oil can comprise livestock or poultry.

The accompanying drawing summary

Following accompanying drawing has constituted the part of this specification and has further proved some aspect of the present invention.By can better understand the present invention with reference to one or more these figure and the detailed description that is combined in the particular instance of this record.From the description of following figure, can understand the present invention more fully:

Fig. 1 is presented at the coding region of fungi Δ 15-dehydrase NcD15D in the pCR2.1 box (pMON67004).

Fig. 2 is presented at the coding region of fungi Δ 15-dehydrase NcD15D among the Yeast expression carrier pYES2.1 (pMON77208).

Fig. 3 is presented at the level of (seed is divided into two halves) ALA in 200 half seeds, press ALA from minimum to the highest order.

Fig. 4 shows flow chart or the plasmid map that obtains plasmid pMON77214 and pMON77217.

Fig. 5 shows that the dehydrase polypeptide comprises the canonical system tree graph of N.crassa Δ 15-dehydrase.

Fig. 6 shows the sequence alignment result of typical dehydrase polypeptide and N.crassa Δ 15-dehydrase.

Fig. 7 A-7H shows the plasmid figure of preparation construct.

Detailed Description Of The Invention

The present invention has overcome the limitation of prior art by the method and composition of the plant for preparing the PUFA content with improvement is provided.Adjustment generation to content of fatty acid in the organism of for example plant has many benefits, comprises nutrition and healthy and helpful improvement.Adjust content of fatty acid can be used to plant, plant part and plant product, comprise the level or the situation that obtain the useful PUFA ' s of expection in the plant seed oils.For example, when producing the PUFA ' s of expection in the seed tissue plant, can from specific seed, separate fuel-displaced, thereby obtain high-load expection PUFAs oil or have the content of fatty acid of expection or the oil of situation, they can be used to provide the useful characteristic of raw-food material and other products subsequently.The present invention provides the endogenous double-low rapeseed seed that contains SDA and useful oleic acid content oil especially.

Different aspect of the present invention comprises the method and composition of adjusting cell PUFA content, for example, adjusts the PUFA content of plant cell.Composition related to the present invention comprises the polynucleotide sequence, polynucleotide constructs of new separation and with the part of polynucleotides plant transformed of the present invention and/or plant.The polynucleotides of this separation can encode the fungi fatty acid dehydrogenase and the fungi Δ 15-dehydrase of specifically can encoding.Can use host cell to express the polynucleotides of the dehydrase polypeptide of coding catalysis fatty acid dehydrogenation.

Aspects more of the present invention comprise various dehydrase polypeptide and its coded polynucleotide.Different embodiment of the present invention is the specificity of dehydrase polynucleotides and coding thereof can be relied on the polypeptide of host cell, the availability of substrate, and the target end-product joins together to use." dehydrase " is meant a peptide species, and it can make between the continuous carbon atom of one or more fatty acid dehydrogenation or the two keys of catalysis form, and produces single or many-unsaturated fatty acid or its precursor.It should be noted that especially and can be transformed into oleic acid by the catalysis stearic acid, oleic acid is transformed into LA, and LA is transformed into ALA, or ALA is transformed into the polypeptide of SDA, comprising at the enzyme of 12,15 or 6 dehydrogenations.Term " polypeptide " is meant any amino acid chain, do not consider its length or the translation after modification (for example, glycosylation or phosphorylation).Select a kind of specific polypeptide with dehydrogenase activity to consider but be not limited to the optimal pH of polypeptide, whether polypeptide is rate-limiting enzyme or its composition, and the dehydrase that whether uses is PUFA synthetic necessary of expection, and/or the needed co-factor of polypeptide.Polypeptide expressed preferably has and its characteristic at the locational biochemical environmentally compatible of host cell.For example, the polypeptide substrate of perhaps having to compete.

Can whether be adapted at specifying production, level or the situation of adjusting PUFAs in the host cell with the polypeptide that decides a kind of appointment to the Km of polypeptide and the analysis of activity specific.The polypeptide of Shi Yonging is that a kind of can having had ready conditions in the host cell of expection issues the polypeptide of waving specific effect under specific circumstances, yet in other respects, can also inquire into the dehydrase polypeptide that any characteristic with expection maybe can be modified the corresponding production of PUFA (s), level or character or any other expection proterties of expection at this.The substrate of the enzyme of expressing can provide by the host cell generation or by external source.In order to realize expressing, polypeptide of the present invention is by following polynucleotide encoding.

The present inventor has separated and has prepared the enzyme of the demonstration Δ 15-dehydrogenase activity of originated from fungus.Originated from fungus is including, but not limited to aspergillus (Aspergillus), for example aspergillus nidulans; Botrytis (Botrytis), for example Botrytis cinerea; Chain spore enzyme belongs to (Neurospora), for example neurospora crassa; And the fungi of other demonstration Δ 15-dehydrogenase activity.

Being worth interested especially is coarse arteries and veins spore mattress and/or aspergillus nidulans Δ 15-dehydrase.The amino acid sequence of N.crassa Δ 15-dehydrase is listed by SEQ ID NO:3, by the nucleic acid sequence encoding of SEQ ID NO:1 and SEQ ID NO:2, measures its molecular weight and is approximately 49,123.37 dalton.Sequence is made up of 429 amino acid; Wherein 32 is strong basicity amino acid (lysine, arginine); Wherein 35 is highly acid amino acid (aspartic acid, glutamic acid); 170 hydrophobic amino acids (alanine, isoleucine, leucine, phenyl alanine, tryptophan, valine); With 100 polar amino acids (N, cysteine, glutamine, serine, threonine, tyrosine).The isoelectric point of SEQ ID NO:3 is 7.187; Electric charge is 1.634 when pH7.0; Davis, Botsein, the Roth melting temperature is 89.65 ℃, the Wallace temperature is 5098.00.

The amino acid sequence of A.nidulans Δ 15-dehydrase is listed by SEQ ID NO:5, and its nucleotide sequence of encoding is listed by SEQ ID NO:4, and molecular weight is approximately 46,300 dalton after measured.This sequence is made up of 401 amino acid; Wherein there are 31 to be alkaline (lysine, arginine); 34 is highly acid (aspartic acid, glutamic acid); 161 hydrophobic amino acids (alanine, isoleucine, leucine, phenyl alanine, tryptophan, valine); With 1 00 polar amino acids (asparagine, cysteine, glutamine, serine, threonine, tyrosine).The isoelectric point of SEQ ID NO:5 is 6.83.

The sequence of coding Neuraspora crassa and/or aspergillus nidulans Δ 15-dehydrase can be expressed in genetically modified plants, microorganism or animal, and makes the synthetic increase of LA to ALA, and SDA is like this too.Also can use other polynucleotides, as long as it is the same with N.crassa and/or A.nidulans Δ 15-dehydrase polynucleotides basically, or its encoded polypeptides is the same with N.crassa and/or A.nidulans Δ 15-dehydrase polypeptide basically." basically the same " is meant that amino acid sequence or nucleotide sequence show with the nucleotide sequence of N.crassa and/or A.nidulans Δ 15-dehydrase amino acid sequence or encoding amino acid sequence and have at least 80%, 90% or 95% uniformity by incremental order preferably.Can use sequence analysis software to come comparison polypeptide or polynucleotides, for example, sequence analysis software bag GCG Wisconsin wraps (Accelrys, San Diego, CA), MEGAlign (DNAStar, Inc., 1228S, Park St., Madison, Wis.56-3715) and Mac carrier (Oxford Molecular Group, 2105 S.BascomAvenue, Suite 200, Campbell, Calif, 95008).These softwares are by determining the similar or consistent similar sequence of degree coupling.

The present invention comprises and comes from identical or other relevant organic relevant dehydrase.These relevant dehydrases are included in the variant of the known Δ 15-dehydrase that generates naturally in the identical or different fungi kind.Corresponding dehydrase can be brought into play with the ability of the known basic identical effect of dehydrase by it and identify; Promptly can effectively change LA into ALA, change GLA into SDA.Corresponding dehydrase can also be identified by the following method, by the sequence of screening sequence library searching with known dehydrase homology, by the library hybridization that makes up based on the probe of known dehydrase and former organism, or the mRNA by utilizing the organism source carries out RT-PCR with primer based on known dehydrase.

Fragment and the mutation that comprises fungi Δ 15-dehydrase polypeptide in a certain respect of the present invention, and encoding those has the nucleotide of the polypeptide of dehydrogenase activity.Another aspect of the present invention is the carrier that contains nucleic acid or its fragment, wherein contains promotor, Δ 15-desaturase coding sequence and stops the zone, and this carrier can be transferred in the organism of promotor and terminator performance function.The present invention provides the organism that produces reorganization Δ 15-dehydrase accordingly.Another aspect of the present invention provides the Δ 15-dehydrase of separation, and it can pass through method purifying (for example, seeing Ausubel et al., 1987) from the reorganization organism of the protein purification of standard.

Different aspect of the present invention comprises the nucleotide sequence of described coding dehydrase.Nucleic acid can include, but are not limited to separate Neurospora crassa, aspergillus nidulans, the Botrytis cinerea etc. from fungi.The chromosome of these fungies all through the order-checking, known each all be rich in ALA.Can be used to measure single clone's sequence as clone's strategy of the blast search of the Oligonucleolide primers of the sequence of potential fatty acid dehydrogenase and N.crassa genomic DNA database based on being used to increase.These clones just can obtain function then and characterize.

Nucleic acid construct can provide by self-replicating (for example additional copy) in the genome that is integrated into host cell or in host cell.In order to produce ALA and/or SDA, normally used expression cassette (be the polynucleotides of encoding proteins, it operationally is connected with nucleotide sequence, instructs polynucleotides to express) comprises that the polynucleotides to coded delta 15-dehydrase provide the expression cassette of expression.In some instances, host cell can have the content of wild type oleic acid.

When considering instruction provided by the invention, it is that those of ordinary skills are conspicuous that the method and composition of construction of expression vector is expressed the fungi dehydrase.Described expression vector is DNA or the RNA molecule that is designed to the controlled expression polynucleotide of interest, for example polynucleotides of coded delta 15-dehydrase.The example of carrier comprises plasmid, phage, clay or virus.Also consider shuttle plasmid for example (Wolk et al., 1984 according to the present invention; Bustos et al., 1991).The summary of carrier and prepare the method for using carrier and can in Sambrook et al. (1989), Goeddel (1990) and Perbal (1988), find.The sequential element of energy effective expression polynucleotides comprises promotor, enhancer, upstream activating sequence, transcription stop signals and many acyls glycosidation site.

The polynucleotides of coding dehydrase can place transcribing under the control of strong promoter.In some cases, this can cause the increase of the amount of the dehydrase of expressing, and follows the output of the fatty acid that enzymic catalytic reaction generates also to increase.There is the various plants promoter sequence to can be used to impel the tissue specific expression of the polynucleotides of coding dehydrase in the genetically modified plants.For example, napin promotor and acetyl carrier protein promotor before were used to adjust seed oil composition (Knutzon et al., 1999) by the antisense form of expressing dehydrase.Similarly, the promotor of the β-subunit of soybean β-companion's globulin has demonstrated high active and be formed on tissue specific expression (Bray et al., 1987) in the genetically modified plants of the kind except soybean.Arondel et al. (1992) places transcribing under the control of strong composing type cauliflower mosaic virus 35S promoter by the fad3 gene with the endoplasmic reticulum location, intends improving linolenic content (18:3) in the southern tissue that is situated between genetically modified plants.

Those of ordinary skill can be determined the carrier and the controlling element (comprising the promotor and the coding region that can be operatively connected) that are adapted at expressing in the particular host cell." can be operatively connected " herein and be meant that promotor and terminator sequence effectively bring into play the adjusting functional transcription.Further example is, the carrier that is suitable for expressing Δ 15-dehydrase in genetically modified plants can comprise the promoter sequence of seed specific, it derives from and can be operationally connected to Δ 15-dehydrase coding region, and sunflower methyl orange element, napin or the glycinin that further can be operationally connected to seed storage protein termination signal or rouge alkali synthetase termination signal.Further example is, the carrier that is used in plant expressing Δ 15-dehydrase can comprise with Δ 15-dehydrase coding region and can be operatively connected, and the promotor or the tissue-specific promoter of the composing type that further can be operatively connected with composing type or tissue specificity terminator or rouge alkali synthetase termination signal.

Modification with the nucleotide sequence of function of the present invention or adjusting factor disclosed here all within the scope of the present invention.Such modification comprises insertion, replaces and deletion, and the specific replacement that reflects the genetic code degeneracy.

The standard technique that makes up this type of recombinant vector is well-known to those skilled in the art, can be with reference to as Sam brook et al. (1989), or the experimental implementation handbook about recombinant DNA technology that uses of any wide model.The various strategies that are used to connect dna fragmentation should be selected according to the characteristic of dna fragmentation end.Needs are further considered according to the present invention is to be used to the nucleotide sequence elements cloning, express or process, for example the sequence of code signal peptide, coding are used for the sequence of KDEL or coding that albumen is trapped in endoplasmic reticulum and instruct Δ 15-dehydrase to be transported to the sequence of the transit peptides in the chloroplast, introduce in the nucleic acid carrier.These sequences are known to those of ordinary skills.For example people (1985) such as Van den Broeck has described a kind of preferred transport protein.Protokaryon and eucaryon burst have been disclosed as people such as Michaelis (1982).

In certain embodiments, expression cassette can comprise and is used for particularly respectively producing or picked-up LA or ALA host cell provide the box of Δ 6-and/or Δ 15-dehydrogenase activity.Host's organism that can not produce ALA is favourable to the generation of Ω-6 type unsaturated fatty acid such as LA.Generation by inhibition Δ 15-dehydrogenase activity host ALA is to be removed, reduction and/or inhibition.This can utilize provides Δ 15-dehydrase antisense expression box, destroys target Δ 15-dehydrogenase gene by inserting, lack, replace part or all of target gene, or finishes by the standard screening method of adding Δ 15-dehydrogenase inhibitor.Similarly, the expression cassette that utilizes Δ 6 antisenses to transcribe by destruction Δ 6-dehydrogenase gene, or by using Δ 6-dehydrogenase inhibitor, makes microorganism or animal with Δ 6-dehydrogenase activity more help producing LA or ALA.

The polynucleotides of coding purpose dehydrase can be identified by several different methods.For example, the source of purpose dehydrase, for example the probe with detectable enzymatic reaction or chemosynthesis screens genome or the cDNA library that Neurospora originates, and this probe can be prepared by nucleotide or its mixture that DNA, RNA or non-natural occur.Probe can be synthetic from known dehydrase polynucleotides enzymatic, is used for using at cross method standard or that reduce preciseness.Oligonucleotide probe also can be used for screening source, and this probe is based on known dehydrase sequence, comprises the conserved sequence in the known dehydrase, or the peptide sequence that obtains based on the destination protein of purifying.Oligonucleotide probe based on amino acid sequence can degenerate to the degeneracy that comprises genetic code, or can preference become organic preferred codon.Oligonucleotides also can be used as from the PCR primer of the reverse transcription mRNA in known or doubtful source; The PCR product can be the probe that the cDNA of total length or can be used to prepares the purpose cDNA of total length.Alternatively, destination protein can all be checked order and the DNA of complete this polypeptide of composite coding.

In case genes of interest group or cDNA are separated, just can be by known method order-checking.Art-recognized these methods can be made mistakes, so the multiple order-checking to same area is necessary, and still there is a certain proportion of mistake in expectation in the speculated sequence that obtains, particularly repeat region, a large amount of secondary structure are being arranged, or unusual base composition, in the zone of for example high GC base contents.When difference occurring, can check order once more and can use special method.Special method comprises the order-checking condition of using that changes: different temperature, different enzymes, change oligonucleotides form the albumen of higher ordered structure ability; The nucleotide that changes for example ITP or methylated dGTP, different gels form for example add formamide, different primer or with different primer or different templates, for example the single stranded DNA s of problem area distance.Also can check order to mRNA.

Coding has some or all sequences of the polypeptide of dehydrogenase activity to obtain from natural origin.Yet in some cases, wish to modify all or part of codon, for example by using host's preference codon to strengthen expression.The codon that occurs highest frequency during according to great expression albumen in specific target host type is determined host's preference codon.Like this, coding has the sequence of the polypeptide of dehydrogenase activity to be synthesized or partly to synthesize by complete.Also can synthesize all DNA or its part DNA and remove any unstable sequence or the secondary structure zone that in transcript mRNA, occurs.Can synthesize also that all or part of DNA changes base composition so that its preference more in the purpose host cell.Composition sequence and the existing in the literature fully record of method that sequence is lumped together.Can use external sudden change and screening, rite-directed mutagenesis, or other means obtain the mutator gene of naturally occurring dehydrogenase gene, be used for preparing the polypeptide of the dehydrogenase activity that better physics and dynamics functional parameter are arranged in the host cell body, for example purpose has the polyunsaturated fatty acid of longer half life period or higher productive rate.

The polynucleotides of dehydrase polypeptide in case obtain encoding can be put into it the carrier that can duplicate at host cell, or increase by PCR or long round pcr external.Replicating vector can comprise plasmid, phage, virus, clay etc.The carrier of wishing comprises that those help the carrier to genes of interest suddenlys change or genes of interest is expressed in host cell.Long round pcr has made at the big construct of amplification in vitro becomes possibility, like this, genes of interest is modified, and for example the structure of sudden change or interpolation expression signal and amplification generation can not use replicating vector or host cell external carrying out fully.

In order to express the dehydrase polypeptide, will there be transcribing of function operationally to be connected with the polynucleotides of coding dehydrase polypeptide with the termination zone with translation initiation.The expression in peptide coding zone can or take place in host cell in external generation.Transcribe with translation initiation and stop the zone and obtain, comprise polynucleotides, the known that to express or gene, expression vector, the chemosynthesis that expection can be expressed in the expection system or come from endogenous site in the host cell from multiple non-single source.

Expression in host cell can be instantaneous or stable finishing.The construct of introducing that contains the expression signal that function is arranged in the host, construct not reproducible also be incorporated in the host cell hardly, or transient expression takes place can not rise in value the time in host cell.Also can finish transient expression by the activity of inducing the regulatable promotor that is operably connected with genes of interest, the derivable system of even now shows low-level background expression often.Can be incorporated into host genome or can in host cell, finish stably express by the self-replicating construct by introducing.But the stably express of genes of interest can be by utilizing the selection markers of locating or using the expression construct transfection, and the cell that then screens the presentation markup thing screens.When integrate producing stably express, in host genome the integration of construct can take place at random, or contain effectively by use and to carry out the target reorganization with the host site and realize locating with the construct in the zone of host genome homology.When the construct target navigates to endogenous site, all or part ofly transcribe and translate control band and can provide by endogenous site.

When the dehydrase polypeptide expression in wishing organism increases, can use several method.Can in host's organism, introduce the gene of extra coding dehydrase polypeptide.Can be derived from the expression in original dehydrase site by the homologous recombination increase, for example by in host genome, inserting the increase that a stronger promotor causes expression, remove the unstable sequence of mRNA or encoded protein by the information of leaving out host genome, or by adding critical sequences (U.S.Pat.No.4 to mRNA, 910,141).

Can consider in host cell, to introduce and the increase polynucleotides of a kind of dehydrase of a plurality of codings or the polynucleotides of the multiple dehydrase of encoding by the expression vector that uses episome or integration.When two or more genes when independently replicating vector is expressed separately, be that each carrier all has the different means of duplicating ideally.Whether no matter the construct of each introducing integrated, and different screening techniques all should be arranged and all lack autoploidy to keep stable expression and to prevent that the element in the construct from redistributing with other construct.The wisdom of control band, screening means and the amplification method of the construct of introducing selects can come by experiment to determine that the polynucleotides of all introducings are expressed and satisfied the synthetic of purpose product like this on essential level.

When needs transformed, Δ 15-desaturase coding sequence of the present invention can be inserted into plant conversion carrier, for example the described binary vector of Bevan (1984).Plant conversion carrier can obtain by modifying natural gene transfer system Agrobacterium tumefaciems.The natural series turnkey is drawn together big Ti (tumour-the induce)-plasmid that contains a big fragment, promptly known T-DNA, and it can be transferred in the plant transformed.Another Ti-plasmids fragment, the vir zone is used for the transfer of T-DNA.T-DNA repeats to adjoin with end in the zone.In the binary vector of modifying, the gene of tumor inducing is left out, utilizes the function in vir zone to shift the foreign DNA that is adjoined by the T-DNA border sequence.The T-zone also comprises the antibiotic selection markers of tolerance and is used for inserting the multiple clone site of metastasis sequence.The bacterial strain of these through engineering approaches is named as " unloading first (disarmed) " A.tumefaciens bacterial strain, the sequence by the T-region deviding effectively can be changed in the nuclear gene group of plant.

The present invention finds many application.Discovery can or detect in the organic method of expressing dehydrase and use in the method for separating correlation molecule based on the probe of polynucleotides of the present invention.When using as probe, polynucleotides or oligonucleotides must be detectable.This is normally by connecting mark and realize in inner site or at 5 ' end or 3 ' end, for example by mixing the residue of modification.Such mark can directly detect, can be incorporated on the secondary molecule of detectable mark, or can be incorporated on the unmarked secondary molecule and three grades of molecules of detectable mark on; As long as unacceptable background signal do not occur in the operation, and obtain satisfied detectable signal, this process just can continue to carry out.Secondary, three grades or bridge system can comprise the antibody that uses directly anti-any other molecule, comprise mark or other antibody; Maybe can comprise any molecule that mutually combines, for example biotin-streptavidin/avidin system.Typical detectable mark comprises radioisotope, and is chemosynthesis or that enzyme process produces or change luminous molecule, but produces the enzyme, magnetic molecule, fluorescence molecule of detection reaction product or according in conjunction with the molecule that changes fluorescence or emission light characteristic.The example of labeling method can be with reference to U.S.Pat.No.5, and 011,770.The variation of solution heat when perhaps being attached on the target by isothermal titration calorimetry probe, or by probe or target are coated in the surface go up and detect target or probe in conjunction with the time surface light scattering that produces variation, these can be finished by the BIAcore system separately.

The construct that comprises target gene can be incorporated in the host cell by routine techniques.For convenience, in this host cell called after " conversion " or " reorganization " that contain dna sequence dna or construct that will handle by any method.For example whether be incorporated into genome according to gene, increase or appear at the addition chromosome element that has the multicopy number, target host can be contained the copy of a at least expression construct, also can contain two or more copies.

Transformed host cells can be identified by the selection markers that contains on the construct of introducing.Alternative, independent mark construct can be introduced into together with the purpose construct, as many transformation technologies introduce many dna moleculars in the host cell.Representative is to select the growing ability on the medium to screen host transformed according to host transformed.Select to mix antibiotic or lack the factor that it is essential that unconverted host grows, for example trophic factors or growth factor in the medium.Therefore the marker gene of introducing can be given antibiotic patience, or encode essential growth factor or enzyme, and can grow on the selection medium when host transformed is expressed.When detecting the labelled protein of expression, can directly or indirectly transform host's screening.Labelled protein can single expression or and other protein fusion expression.Can be according to enzymic activity certification mark albumen; For example, beta galactosidase can be transformed into substrate X-gal coloured product, and luciferase can be transformed into fluorescein light emission product.Labelled protein can detect by its product light or modification characteristic; Fluoresce when for example, Aequorea Victoria green fluorescent protein is with blue light illumination.Can use antibody to come labelled protein or molecular label on the testing goal albumen.Can screen the cell of presentation markup albumen or label, for example by range estimation, or by as FACS or utilize the panning technique of antibody.It should be noted that tolerance to kanamycin and aminoglycoside G418, and the growing ability in the medium that lacks uracil, leucine, lysine or tryptophan.

Interested especially is the generation of the PUFA ' s of Δ 15-dehydrase-mediation in eukaryotic host cell.Eukaryotic comprises plant cell, but for example comes from the plant cell of crops of produce oil and the cell of other genetic manipulation that comprises the fungal cell.Cell can be cultivated becomes or forms the organism host who partly or entirely comprises plant.In a preferred examples, the host produces and/or can absorb the Δ 15-dehydrase substrate that external source is supplied with, and preferably produces the plant cell of the substrate of a large amount of one or more.

Transformed host cells is grown under the suitable condition that is suitable for the purpose end-product.For host cell is grown in medium, optimal conditions is to obtain maximum or most economical PUFA ' s output, and this dehydrogenase activity with screening is relevant.Can optimised culture medium condition comprise: the maintenance of vegetative period, pH, density and screening when the substrate final concentration of carbon source, nitrogenous source, interpolation substrate, interpolation, the substrate form of interpolation, aerobic or anaerobic growth, growth temperature, derivant, inducing temperature, the vegetative period when inducing, results.

Another aspect of the present invention provides genetically modified plants or the plant offspring of the DNA of the present invention that contains separation.Monocotyledon and dicotyledon can be considered.Use above-mentioned any methods for plant transformation that the DNA of plant cell with separated coding Δ 15-dehydrase transformed.The plant transformed cell is usually in a callus medium or Ye Panshang, and it is by the known renewable one-tenth of method of those of ordinary skills genetically modified plants (for example, Horsch etal., 1985) completely.In an example, genetically modified plants are selected from by the plant of arabidopsis, double-low rapeseed, soybean, soya bean, rape seed, sunflower, cotton, cocoa bean, peanut, safflower, coconut, flax, oil palm, oilseeds viticula, corn, jojoba, Chinese Chinese tallow tree, tobacco, fruit tree, Citrus or produce the group of the plant of nut and berry.Since the descendant inheritting of plant transformed the polynucleotides of coded delta 15-dehydrase, transform the seed of plant or transplant a cutting and can be used for keeping genetically modified plants system.

The present invention further provides the method that render transgenic has the ALA and/or the SDA content of rising.This method comprises, for example the DNA of coded delta 15-dehydrase is incorporated into to lack or have low-level ALA or SDA but contain in the plant cell of LA, from the renewable ALA of genetically modified cell and/or SDA content increase plant.In certain embodiments of the invention, the DNA of coded delta 6-and/or Δ 12-dehydrase be directed in the plant cell.These plants also can comprise or not comprise endogenous Δ 6-and/or Δ 12-dehydrogenase activity.In certain embodiments, the business-like plantation crops that consideration will be transformed are as the transgenosis organism, including, but not limited to arabidopsis, double-low rapeseed, soybean, soya bean, rape seed, sunflower, cotton, cocoa bean, peanut, safflower, coconut, flax, oil palm, oilseeds rape and corn, jojoba, be the plant of middle Chinese tallow tree, tobacco, fruit tree, Citrus or the plant that produces nut and berry.

The present invention further provides and can the render transgenic plant contain the ALA that improves the standard and/or the method for SDA, wherein said improving the standard is level height than existing in the unconverted plant.This method can comprise that the polynucleotides with one or more coded delta 15-dehydrase are incorporated into and lack or low-level ALA, but contain in the plant of LA.The expression vector that contains the DNA of coded delta 15-dehydrase or Δ 15-dehydrase and Δ 6-dehydrase can make up (Sambrook et al., 1989) by the method for ordinary skill recombinant technique known to the skilled.Specifically, business-like plantation crops are considered as the transgenosis organism, including but not limited to, arabidopsis, double-low rapeseed, soybean, soya bean, rape seed, sunflower, cotton, cocoa bean, peanut, safflower, coconut, flax, oil palm, oilseeds rape and corn.

For food additive, the PUFAs of purifying, plant transformed or plant part, or derivatives thereof can be impregnated in oily, the fatty or synthetic margarine of culinary art, so that the amount that the eater during normal use just can obtain wishing.PUFAs also can be incorporated in baby preparation, nourishing additive agent or other food product, can also be used as anti-inflammatory or cholesterol reducing agent.

" edible composition " is defined as the composition that can be absorbed by mammal as used herein, as raw-food material, nutriment and Pharmaceutical composition." raw-food material " is meant the material that can be used to or prepare mammiferous food as used herein, comprises the material that can be used to prepare food (for example fried oil) or food additives.For example, raw-food material comprises and is used for animal that the people eats or by the product in its source, for example egg.The typical food products raw material is including but not limited to beverage (soft drink for example, carbonated drink, the beverage that is used to mix), cure food (for example fruits and vegetables), sauce, flavouring, salad dressing, fruit juice, syrup, sweet food (pudding for example, gelatin, sugar-coat and cake filling, the frozen confection of cooking food and for example ice cream and sherbet), soft frozen product (for example soft freezing cream, soft freezing ice cream and yoghourt, condiment above the soft chilled topping food, for example dairy produce or non-dairy produce stir gravy with meat or vegetables poured over rice or noodles condiment above the food), oil and emulsification goods (for example make the loose grease of millet cake, margarine, mayonnaise, butter, culinary art oil and salad dressing) and middle moist food (for example rice and dog grain).

In addition, edible composition described here also can be used as the additive that contains or enriching substance and is ingested in Food ﹠ Drink.These can be prepared together with nutriment such as various vitamin and mineral matter, and are incorporated in the composition that is essentially liquid, for example nutritious drink, soymilk and soup; Be essentially in the composition of solid; And gelatin or be incorporated in the different food with powder-form is used.Content of effective can be similar to the dosage that contains in the typical medicament in such function or healthy food.

The PUFAs of purifying, plant transformed or plant part also may be incorporated in the feed of animal, particularly domestic animal.Like this, animal itself can be benefited from the diet that is rich in PUFA, and the human consumption person who consumes the food of making from these domestic animals simultaneously equally also can benefit from it.Expect that the SDA in the animal will be transformed into EPA in some instances, animal can be by being benefited the EPA that increases from consumption SDA like this.

For medicinal usage (people or for animals), composition is oral administration normally, but also can be by any administration that can successfully absorb, for example parenterai administration (promptly subcutaneous, muscle or intravenous injection), rectally, vagina administration or topical are for example as barrier cream or washing lotion.PUFAs plant transformed of the present invention or plant part can be individually dosed or with medicinal acceptable carrier or excipient administration.Gelatine capsule is the preferred dosage form of applicable oral administration.The top diet additive of mentioning also can adopt oral administration.Unsaturated acids of the present invention can be with the form administration of combination, or with salt, ester, acid amides or the prodrug of fatty acid.The present invention includes any medicinal acceptable salt; Preferred especially sodium, potassium or lithium salts.Also comprise N-alkyl polyhydroxy alcohol amine salt, for example N-methyl glutamine discloses WO96/33155 referring to PCT.Preferred ester is an ethyl ester.As solid salt, PUFAs also can be with the form administration of tablet.For intravenously administrable, the PUFAs or derivatives thereof also can mix in the commercialization preparation as Intralipids.

By the sudden change of routine, the activity of then expressing the mutant polypeptide that produces and measuring them can be determined the dehydrase polypeptide zone very important to dehydrogenase activity.Sudden change can comprise replacement, disappearance, insertion and site mutation, or they unite use.Replacement can be according to conservative hydrophobicity or hydrophily (Kyte and Doolittle, 1982), or finishes according to the ability (Chou and Fasman, 1978) that forms similar polypeptide secondary structure.A typical functions analysis starts from N-and the C-end limit that the function indispensable protein is determined in deletion mutation, carries out inside disappearance then, inserts or site mutation determines that further function must distinguish.The technology that also can use other is cassette mutagenesis or complete synthetic for example.For example finish deletion mutation by using exonuclease to remove 5 ' or 3 ' coding region successively.Such technology can be carried out with kit.After the disappearance, by the oligonucleotides that will contain initial or termination codon be connected to 5 ' or 3 ' disappearance after the disappearance coding region make coding region complete.Alternatively be, comprise positional mutation, mutagenesis PCR or by being connected with the DNA that digests on the restriction site that exists, oligonucleotides initial or terminator is inserted into coding region with encoding by various methods.

Similarly, inner disappearance can comprise and use the restriction site that exists among the DNA by various methods, uses mutagenic primer to finish through positional mutation or mutagenesis PCR.Insertion be by as connection-scanning mutagenesis, the method for positional mutation or mutagenesis PCR is finished.Point mutation is by finishing as the sudden change of site decision or the method for mutagenesis PCR.Chemical mutation also can be used for determining the vital dehydrase polypeptide of activity zone.These structural-functional analysis can determine which zone can be left out, and which zone can tolerate insertion, and who point mutation plays a role mutain basically as natural dehydrase.All these mutains and their nucleotide sequence of coding all comprise within the scope of the invention.

As mentioned above, some concrete example of the present invention is relevant with the Plant Transformation construct.For example, one aspect of the present invention is to comprise one or more dehydrogenase genes or cDNA ground plant conversion carrier.The representational coded sequence that the present invention uses comprises Neurospora crassa gene Δ 15-dehydrase NcD 15D (SEQ ID NO:1 and SEQ ID NO:2) and aspergillus nidulans Δ 15-dehydrogenase A nD 15D (SEQ ID NO:4).In some example, the present invention also can use antisense dehydrase sequence.Also can use typical dehydrase code nucleic acid, comprise at least 20,40,80,120,300 and up to the nucleotide sequence total length of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQID NO:33.In some particular aspects, nucleic acid can encode 1,2,3,4 or more kinds of dehydrase.Specific example is that nucleic acid can coded delta 6 and Δ 15-dehydrase.

In some example of the present invention, provide at the coded sequence that justice is arranged or effectively be connected with allogeneic promoter in the antisense orientation.The expression construct that comprises these sequences also is provided, the structure (can with Plant Transformation coupling) of using the construct that these or other sequence of the present invention carries out be those of ordinary skills according to of the present invention openly can know (see for example Sambrook etal., 1989, Gelvin et al., 1990).Therefore, technology of the present invention is not limited to any specific nucleotide sequence.

A kind of purposes of sequence provided by the invention be by change with the dehydrogenase gene genetic transformation plant phenotype, for example oil composition, specific example is a fungi Δ 15-dehydrase.Other sequence also can with the dehydrogenase gene coupling.Use when effable coding region (needing not to be the label coding zone) and label coding regional combination, can on identical or different dna fragmentation, use independent coding region to transform.Under latter event, different carriers is delivered to recipient cell simultaneously to realize maximized cotransformation.

Often to select the extra element that uses with desaturase coding sequence according to the purpose that transforms.A main purpose that transforms crops is the characteristic commercial expection and important to agricultural economy that increases plant.Known PUFAs gives many useful health effects, and the increase of the SDA output of following also is useful, and this can obtain by the expression of fungi Δ 15-dehydrase.In some example of the present invention, the increase of SDA can comprise the expression of Δ 6 and/or Δ 12 dehydrases like this, comprises fungi or plant Δ 6 and/or Δ 12 dehydrases.

Being used for the carrier of Plant Transformation can comprise, for example plasmid, clay, YACs (yeast artificial chromosome), BACs (bacterial artificial chromosome) or any clone's system that other is fit to, and the dna fragmentation that gets from them.Like this, when using term " carrier " or " expression vector ", comprising all aforesaid bearer types with separate the nucleotide sequence that obtains from them.Consider that clone's system of using intrusion to go into ability can introduce the big dna sequence dna that contains above a specific gene.According to the present invention, this can be used for introducing various dehydrase code nucleic acids.Can be by using bacterium or yeast artificial chromosome's (being respectively BACs or YACs), or or even the plant artificial chromosome introduce these sequences.For example, people (1996) such as Hamilton has disclosed the conversion that BACs is used for Agrobacterium-mediation.

The expression cassette that separates from these carriers is useful especially for conversion.Certainly the gene that the dna fragmentation that is used for transformed plant cells can comprise cDNA, gene usually or wish to introduce and expressed at host cell.These dna fragmentations can further comprise for example promotor, enhancer, multi-link head, or purpose structure such as controlling gene.To often be coded in to express in the recombinant cell that obtains to form and to screen or the albumen of selectable characteristic thereby be selected for dna fragmentation that cell introduces or gene, and/or give the albumen of the phenotype that the genetically modified plants of generation improve.Yet not always not like this, the present invention also comprises and is inserted with the genetically modified genetically modified plants of not expressing.The component that preferably may be included in used carrier of the present invention is as described below.

Use specific promotor in one embodiment of the invention.The example of the promotor of using among the present invention comprise but be not limited to 35SCaMV (cauliflower mosaic virus), 34SFMV (figwort mosaic virus) (sees for example U.S. patent No. 5,378,619, its content is at this all as a reference), Napin (coming from Brassicas), 7S (coming from soya bean), Glob and Lec (coming from corn).The 35SCaMV promotor and the promotor that the plant seed ripening period is regulated be in an application of the invention the institute interested especially.Consideration in reproducible expression vector separately or unite that to use all these promotors and transcription regulatory element be that those of ordinary skills are known.

For example people (1990) such as Restrepo has described the CaMV 35S promoter.The adjusting sequence with sudden change of genetic transformation causes seed-specific expression, also can be used to produce the seed oil compositions of improvement.These modifications of the present invention are that those of ordinary skills are conspicuous.

Dna sequence dna between the starting point of transcription initiation site and coded sequence, the homing sequence of for example not translating also can influence gene expression.Therefore specific homing sequence can be used for transformation construct of the present invention.The preferred homing sequence of considering is to comprise that those contain the sequence that precognition instructs the suitableeest expression of accompanying gene, for example comprises the homing sequence of preferred unanimity, the stability that it can increase or keep mRNA with prevent to translate incorrect initial.According to of the present invention open, the selection of this class sequence is that those of ordinary skills are known.The preferred sequence that obtains by typical cance high-expression gene in the plant.

Typical transformation construct prepared in accordance with the present invention comprises 3 ' terminal dna sequence dna, and this sequence is as stopping transcribing signal, can be by making the poly-adenosine of the mRNA of generation with the sequence that dehydrogenase gene (for example cDNA) effectively is connected.In one embodiment of the invention, use the terminator of natural dehydrogenase gene.Alternative is that 3 ' end of allos can strengthen the expression of dehydrase coding region.The example of thinking the source of useful terminator comprises Agrobacterium tumefaciems (nos3 ' end) (people such as Bevan, 1983) rouge alkali synthetase gene, the T7 transcription terminator of the octopine synthase gene of Agrobacterium tumefaciems, the protease of potato or tomato suppress the 3 ' end and the CaMV 35S terminator (tml3 ') of sub-I or II gene.If desired, regulating element is an Adh intron (people such as Callis, 1987) for example, and sucrose synthase intron (people such as Vasil, 1989) or TMV Ω element (people such as Gallie, 1989) are also further included.

By using the selectable labelled protein that maybe can screen, can provide or strengthen the ability of differentiating transformant." marker gene " is to give the gene of the unique phenotype of cell of presentation markup albumen, and cell transformed and the cell difference that does not have mark are come.Can pass through chemical method according to marking whether to give, for example by using a kind of selective reagent (weed killer herbicide for example, antibiotic etc.) characteristic that just can screen, or it is not only to be can be by observing or test, the characteristic that just can identify by " screening " (for example green fluorescent protein) for example, this gene selectable mark that maybe can screen of just can encoding.Certainly, the example of many suitable labelled proteins is known in the art and practical application in the present invention.

In fact the method that is suitable for conversion plant of the present invention or other cell comprises any method that DNA is incorporated into cell, for example the protoplast transformation method by PEG mediation directly transmits DNA (people such as Omirulleh, 1993), the DNA picked-up by drying/inhibition mediation people such as (, 1985) Potrykus, by electroporation (U.S. patent 5,384,253, in this special incorporated as a reference), by stir (people such as Kaeppler, 1990 with silicon carbide fibre; U.S. patent 5,302,523, in this special incorporated as a reference; U.S. the patent No. 5,464,765, in this special incorporated as a reference), by conversion (the U.S. patent No. 5,591,616 and the U.S. patent No. 5,563,055 of Agrobacterium mediation; In this all special incorporated as a reference) and acceleration (the U.S. patent No. 5,550,318 of the particle by DNA bag quilt; U.S. the patent No. 5,538, and 877; With the U.S. patent No. 5,538,880; Each all special incorporated is as a reference at this) or the like.By using these technology, the cell of in fact any plant can stable conversion, and these cells can develop into genetically modified plants.

After effective DNA with external source was delivered to recipient cell, next step normally was used for the transformant of further cultivation and plant regeneration about evaluation.In order to improve the ability of identifying transformant, the selectable marker gene that maybe can screen that should use conversion carrier prepared in accordance with the present invention to have.In this case, next to maybe to screen the cell of the marker gene characteristic that has expection usually by cellular exposure is analyzed potential cell transformed group in selective reagent.

Cell of surviving after being exposed to selective reagent or the cell that is positive in screening is analyzed should be cultivated in keeping the medium of plant regeneration.In an exemplary, improve MS and N6 medium by the material of other adding such as growth regulating.Growth regulating of these uses is dicamba or 2,4-D.Yet also can use other growth regulating, comprise NAA, NAA+2,4-D or picloram.Found by this way or cell growth that similarly medium improved of mode helps the specific developmental stage of cell.Tissue can continued growth in containing the minimal medium of growth regulator, up to the tissue that forms the capacity that can begin plant regeneration, or then repeat artificial screening, be fit to regeneration up to tectology, usually will at least 2 weeks, then it is transferred in the medium that is of value to embryo's maturation.Per two weeks are transferred to culture on this medium.Growing sprouting means and can be transferred in the medium that lacks growth regulating.

In order to confirm in aftergrowth, to have foreign DNA or " transgenosis ", can carry out various mensuration.Such mensuration comprises that for example " molecular biology " is identified, for example Southern and the Northern marking and PCR ^TM" biochemistry " identify, for example detect the existence of protein product, for example by immune means (ELISAs and Western marking method) or the function by enzyme; The evaluation of plant part, for example leaf or root are identified; Also can be by analyzing the phenotype of whole aftergrowth.

Except directly transform specific plant gene type with construct prepared in accordance with the present invention, the plant of DNA that also can be by will having selection of the present invention is made genetically modified plants with the other plant hybridization of this DNA of disappearance.The plant cultivation technology also can be used for introducing multiple dehydrase, for example with Δ 6, and Δ 12, and/or Δ 15-dehydrase is introduced in the independent plant.In this way, Δ 15-dehydrase can be raised effectively.Have the plant homozygote of Δ 15-dehydrogenase activity and/or other dehydrogenase activity (for example Δ 6-and/or Δ 12-dehydrogenase activity) by preparation, can increase metabolite useful in the plant.

As mentioned above, the dehydrogenase gene of selecting can be incorporated in the specific plant species by hybridization, and not need directly to transform given plant species.Therefore, the present invention not only comprise direct plant transformed or according to the present invention cell transformed and the plant that regenerates, also comprise the offsprings of these plants.Term " offspring " is meant the offspring of any generation of parental generation plant prepared in accordance with the present invention as used herein, and offspring wherein comprises the DNA construct of selection prepared in accordance with the present invention." hybridization " of plant can provide with respect to the initiator cell cording one or more extra transgenosiss or allelic department of botany, as of the present invention, its be defined as be by initial system with contain transgenosis of the present invention or the hybridization of allelic donor department of botany, realize particular sequence is incorporated in the department of botany.For this reason, should carry out for example following steps: (a) seed of plantation first (initial system) and second (transgenosis or the allelic donor department of botany of containing expectation) parental generation plant; (b) plant that the cultivating seeds one-tenth of the first and second parental generation plants is bloomed; (c) pollinate for the flower of first parental generation plant with the pollen of the plant that comes from second parental generation; (d) results are containing the seed that produces on the parental generation plant of the flower of being fertilized.

To backcross at this and to be defined as the process that comprises the following steps: the first genotypic plant and the second genotype plant hybridization that lacks described genes of interest, dna sequence dna or element that (a) will contain genes of interest, dna sequence dna or element; (b) select one or more progeny plants that contain genes of interest, dna sequence dna or element; (c) with the progeny plants and the second genotype plant hybridization; (d) repeating step (b) and (c) its objective is the target DNA sequence in the first genotype plant is transferred in the second genotype plant.

The DNA element genes is incorporated into the result who is defined the transition process of backcrossing in the genotype of plant.The plant gene type that mixes dna sequence dna can be considered to backcross change genotype, be, inbreeding or crossbred.Similarly, the plant gene type that lacks the target DNA sequence can be considered to a genotype that does not have transformation, is inbreeding or crossbred.

Embodiment

The following examples are used for illustrating embodiment of the present invention.Those skilled in the art should admit that the technology that discloses in an embodiment followed the representative art of being found by the present inventor, have brought into play good effect in practical application of the present invention.Yet according to prior art, those of ordinary skills will be appreciated that in the specific situation that discloses can produce many variations, but still is not deviated from the same or analogous result of notion of the present invention, spirit and scope.More specifically be that clearly some can substitute reagent described herein at related reagent aspect chemistry and the physiology, will obtain same or analogous result simultaneously.For those skilled in the art, all these similar alternative and modifications are conspicuous, are considered to be within spirit of the present invention, scope and the notion as appended claim definition.

Embodiment 1

Bacterial strain and growth conditions

Neurospora crassa hybridization A type and aspergillus nidulans Glasgow wild type come from fungi heredity storage center.Culture in Vogel ' s medium N, grow (people such as Case, NeurosporaNewsletter, 8:25-26,1965).Liquid culture is inoculated with cystospore, and cultivates 3 days at 15 ℃ of following 100RPM shaking tables.In Buchner funnel through Whatmanl filter paper filter to collect mycelium and 80 ℃ of storages be used for isolation of RNA or directly freeze drying carry out fatty acid compositional analysis by gas-chromatography.The Wine brewing yeast strain that uses is INVSc1, is the auxotrophic dliploid bacterial strain of histidine, leucine, tryptophan and uracil (Invitrogen).Cell at 30 ℃, is preserved in the YPD medium.

Embodiment 2

The separation of fungal rna

Use Chomczynski and Sacchi (1987, Tri-Reagent, guanidine hydrochloride SIGMA)-phenol-chloroform method separates total RNA from the fungi mattress filament of 3 kinds of bacterial strains described in the embodiment 1.The method is pulverized 500 milligrams of mycelium in liquid nitrogen, be added to then among 7 milliliters of Tri-Reagent.Add chloroform, water phase separated from organic facies.With RNA with before isopropanol precipitating is then in being resuspended in deionized water with 70% ethanol rinsing

Embodiment 3

The clone of N.crassa Δ 12 and Δ 15-dehydrase sequence

According to the contrast of the sequence of N.crassa genome sequence, the increase Δ 12-dehydrase (Nc111F2 and Nc111R3) and Δ 15-dehydrase (Nc94F6 and the Nc94R8) code area of deduction of total length of the specific primer of design gene.Forward primer is designed at initial methionine 5 ' end 3 nucleotide are arranged

Nc111F2：5’-AAGATGGCGTCCGTCTCCTCTGCCCTTCCC-3’(SEQ?ID?NO：15)

Nc111?R3：5’-TTAGTTGGTTTTGGGGAGCTTGGCAGGCTTG-3’(SEQ?ID?NO：16)

Nc94F6：5’-GCGGCCGCAACATGACGGTCACCACCCGCAGCCA-3’(SEQ?ID?NO：17)。5 ' the terminal NotI site that is added in oligonucleotides is represented with italics.

Nc94R8：5’-CCTGCAGGTTACTGGGTGCTCTGAACGGTGTGCG-3’(SEQ?ID?NO：18)。5 ' the terminal Sse8387I site that is added in oligonucleotides is represented with italics.

The cDNA of N.crassa prepares with Marathon cDNA amplification kit (ClontechLaboratories).By gene magnification PCR system 9700 (PE AppliedBiosystems), under the cycling condition of recommending, use the dehydrase that these primers and 3 '-RACE readycDNA amplification is inferred.To be connected to pCR2.1-TOPO (Invitrogen) with the PCR product that oligonucleotides Nc94F6 and Nc94R8 produce, and called after pMON67004 (Fig. 1).With the cDNA order-checking, at amino acid/11 24-128, find 3 " histidine-box " on 160-164 and the 359-363 position, this is a kind of conservative characteristic of film in conjunction with dehydrase.

Compare with Δ 15-dehydrase in conjunction with Δ 12 with other film, find that final " HXXHH " histidine box motif also is intact.Corresponding Δ 15-dehydrase (NcD15D) nucleotide and peptide sequence are listed in SEQ ID NO:2 and SEQ ID NO:3 respectively, and genomic clone is listed in SEQ ID NO:1.With pMON67004 with EcoRI digestion and be connected on the EcoR1 site of Yeast expression carrier pYES2/CT and form pMON77208 (Fig. 2).For plant conversion carrier, pMON67004 is digested with EcoR1, then carry out filling-in, cut with the Sse8387I enzyme then.Genetic fragment is connected on the binary vector pMON73270, and this carrier with NotI digestion, then carries out filling-in, cuts with the Sse8387I enzyme then.In the carrier pMON77214 (Fig. 4) that produces like this, Δ 15-dehydrogenase gene NcD15D is under the adjusting of seed specific Napin promotor.The dna fragmentation of EcoRI/Sse8387I-digestion also is connected on the binary vector pMON73273, produces pMON77217 (Fig. 4) thus, and NcD15D is under the adjusting of 35S promoter of composing type in the pMON77217 that produces.

The PCR product that produces with oligonucleotides Nc111R3 and Nc111F2 is directly connected to pYES2.1/V5-His-TOPO (Invitrogen) formation pMON67005 (Fig. 7 A).With the cDNA order-checking, and, find 3 " histidine-box " on 194-198 and the 394-398 position at amino acid whose 158-162.Compare with Δ 15-dehydrase with other membrane-bound Δ 12, find that final " HXXHH " histidine box motif also is intact.The nucleotide and the peptide sequence of the Δ 12-dehydrase of inferring (NcD12D) are listed in SEQ ID NO:39 and SEQ IDNO:40 respectively.

Embodiment 4

Yeast conversion and expression

The PEG/LiAc experimental program of putting down in writing in the handbook of use Invitrogen about pYES2.1/V5-His-TOPO is incorporated into the construct of pMON67005 and pMON77208 among the host bacterium S.cerevisiae INVSc1 (uracil auxotrophy).Do not containing uracil, containing on the flat board that the SC Min. medium of 2% glucose makes and select transformant.The transformant clone is inoculated into 5 milliliters does not contain uracil, contain in the SC Min. medium of 2% glucose 30 ℃ of following overnight incubation.In order to induce, with the yeast cells centrifugation of stationary phase, do not containing uracil, mend in the SC Min. medium of 2% galactose resuspendedly, cultivated 3 days down at 15 ℃.When in medium, adding external source fatty acid, add 0.01% LA (Δ 9,12-18:2) and 0.1% emulsifier Tergitol.Culture was grown 3 days under 15 ℃ of conditions, followed centrifugal collection culture.With the TE buffer solution for cleaning cell mass of aseptic pH7.5 once, remove medium, and freeze-drying 24 hours.With the carrier host transformed bacterium that contains the LacZ gene, with its as all the experiment in negative control.

In order to carry out fatty acid analysis, after aforementioned operation, carry out the extraction of yeast lipid.Briefly, with the yeast cell mass of freeze-drying with 15 ml methanol and 30 milliliters of chloroform extraction that contain 100 microgram tridecanoin.After the extraction, at first with the saponification of yeast lipid, with free fatty acid methylization.Use then and be equipped with luminous ionization detection instrument and molten silicon capillary post (Supelcomega; 50 meters * 0.25 millimeter, internal diameter, Supelco, Bellefonte, (Hewlett-Packard, Palo Alto CA) carry out gas-chromatography (GC) analysis to the distribution of fatty acid methyl ester to Hewlett-Packard5890II Plus gas chromatograph PA).

Contain in the yeast that the expression vector of LacZ transforms in contrast usefulness, in the cell-line of not adding the LA growth, do not detect LA or ALA (18:3).In the yeast that the expression vector that contains NcD15D or BnD15D transforms, do not add LA, just there is not the ALA accumulation.In the yeast that contains the conversion of NcD12D expression vector, do not add LA, LA is accumulated to and accounts for 22% of fatty acid, shows the D12D activity.When LA joins in the yeast system of expressing NcD15D, ALA reduces to 1% of fatty acid.In expressing the yeast system of Brassica napus Δ 15-dehydrase (BnD15D), behind the adding LA, ALA reduces to 0.2% of fatty acid.In the Lacz contrast, do not detect ALA behind the interpolation LA.

Table 1 Yeast expression data

Fatty acid % in the yeast
									Construct pMON77208 pMON67003 PMON67005 LacZ pMON77208 pMON67003 LacZ	Title NcD15D BnD15D NcD12D LacZ NcD15D BnD15D LacZ	The FA substrate that adds does not have no 18:2 18:2 18:2	????16：0 ????％ ????13.96 ????13.22 ????15.24 ????14.01 ????18.34 ????18.45 ????19.26	?16：1 ?％ ?48.33 ?48.15 ?47.95 ?49.61 ?25.98 ?26.19 ?18.87	??18：0 ??％ ??5.06 ??5.18 ??5.18 ??5.27 ??5.94 ??5.91 ??6.00	??18：1 ??％ ??29.07 ??29.82 ??10.3 ??27.29 ??16.09 ??16.26 ??10.82	??18：2 ??％ ??0.02 ??0.00 ??22.3 ??0.02 ??30.30 ??30.61 ??42.47	??18：3 ??％ ??0.02 ??0.00 ??0 ??0.01 ??1.04 ??0.20 ??0.01

Embodiment 5

Transform Arabidopsis with NcD15D

Present embodiment has been described conversion and the regeneration of the transgenic arabidopsis plant of expressing heterologous Δ 15-desaturase coding sequence.(the Arabidopsis plant is cultivated in jar OH) by SCOTTS Co., Ltd, Colombia at 4 inches contain reverse osmosis water (ROW) and saturated MetroMix 200 with planting seed.In the unit that jar is placed on the covering wet top, in 4-7 ℃ culturing room, illumination every day 8 hours, the manual method that reaches 4-7 days promotes development of plants.With this element be transferred to that 22 ℃, relative moisture are 55%, illumination every day 16 hours, mean flow rate is in about 160-200Mol/ * second square metre the culturing room.After germination, lift the top and move 1 backward " to guarantee the circulation of appropriate moist air.When real leaf forms the time shift top of drying.As needs, with ROW irrigating plant root, up to germinateing back 2-3 week.Then, as needs, use PLANTEX18-18-5 solution (Plantex Co., Ltd Ottawa, Canada) under the condition of 50ppm nitrogen, the irrigating plant root.Jar is very thin to have 1 strain plant so that 2-3 week keep every jar after germination.In case plant begins bolting, should prune elementary inflorescence to promote the growth of axil a kind of sedge.

Use the known method of prior art that conversion carrier pMON77214 and pMON77217 are incorporated among the Agrobacterium tumefaciems strains A BI.As acquisition transgenosis A.thaliana plant as described in (1993) such as (1994) such as Bent or Bechtold.In brief, the culture of Agrobacterium that contains binary vector pMON77214 or pMON77217 is in LB (10% bacterium-tryptone, 5% yeast extract and contain 10% sodium chloride of kanamycin (75 mg/litre), chloramphenicol (25 mg/litre) and spectinomycin (100 mg/litre)) grow overnight.Bacterium liquid is centrifugal and resuspended in 5% sucrose+.05%Silwet-77.The gas first portion of whole A.thaliana plant (age in about 5-7 week) is dipped in 2-3 second in the solution that obtains.Go excessive solution with the paper handkerchief suction.The plant that to soak is sidelong on the unit of lid is arranged and transfers in 19 ℃ the culturing room.After 16 to 24 hours, remove the top and make plant upright.When development of plants is ripe, 2 to the 7 days results seeds of cutting off the water.The seed of results is through the choosing of stainless (steel) wire hole sizer.

In order to select transformant, seed is coated on the agar medium of the glyphosate that contains 50mg/L.Select green seedling and migrate to 4 " jar in and growth under these conditions.When leafage is in the 4-leaf state, collect leaf and carry out fatty acid analysis.After the freeze drying, analyze leaf fatty acid as stated above.

Embodiment 6

N.crassa clone's functional expression

In order to estimate N.crassa D15D clone's function specificity, the code area of pMON67004 is cloned in the plant expression vector, wherein the 35S promoter of composing type drives genetically modified expression.The construct pMON77217 that obtains is transformed among the A.thaliana and the leaf of the T2 plant that transforms has been carried out the analysis that fatty acid is formed.About 20% fatty acid is LA in non-conversion is, about 48% fatty acid is ALA.The level of LA reduces to about 3% and 5% independently in the A.thaliana transformation experiment at two, and the level of ALA increases to 65% and 63% respectively, has shown Δ 15-dehydrogenase activity in the plant.These data are summed up in table 2.Specify CONT to be contrast.

The content of fatty acid of table 2 arabidopsis leaf

Incident	??16：0	??16：1	????18：0	????18：1	??18：2(LA)	18：3(ALA)
							????CONT1 ????CONT2 ????CONT3 ????ATG174 ????ATG717 ????ATG716 ????ATG718 ????ATG709	??14.9 ??15.3 ??14.5 ??15.6 ??15.3 ??14.9 ??15.3 ??17.0	??0.8 ??0.9 ??0.9 ??1.0 ??0.7 ??0.6 ??0.8 ??0.9	????1.4 ????1.4 ????1.4 ????1.6 ????1.4 ????1.6 ????1.8 ????1.9	????4.8 ????5.1 ????5.1 ????4.6 ????4.2 ????3.1 ????4.0 ????4.3	??19.7 ??20.5 ??19.6 ??15.4 ??17.9 ??15.8 ??5.4 ??3.5	48.2 49.2 49.5 51.9 52.1 55.1 63.7 64.0

Be cloned in the function specificity that promotes the ALA generation in the seed in order to estimate N.crassa D15D, the code area of pMON67004 be cloned in the seed-specific expression carrier the wherein genetically modified expression of Napin promoters driven.The construct pMON77214 that obtains is transformed among the A.thaliana, and the seed of the T2 plant that transforms is carried out fatty acid compositional analysis.In non-conversion system, about 26% seed lipid is to occur with LA, and about 18% occurs with ALA.The level of LA reduces to about 14% and 13% independently in the A.thaliana transformation experiment at two, and the level of ALA increases to 26% and 30% respectively, is presented at Δ 15-dehydrogenase activity in the seed.These data show at table 3.

The content of fatty acid of table 3 arabidopsis seed

Incident	??16：0	??16：1	??18：0	??18：1	??18：2(LA)	??18：3(ALA)
							Contrast contrast G709 G711 G705 G707	??6.86 ??7.11 ??7.1 ??7.08 ??7.75 ??8.12	??0.39 ??0.37 ??0.37 ??0.37 ??0.38 ??0.36	??2.94 ??3.33 ??3.13 ??3.16 ??3.09 ??2.98	??14.7 ??15.22 ??13.16 ??13.49 ??12.62 ??14.2	??27.95 ??26.48 ??24.58 ??24.24 ??19.26 ??15.71	??17.75 ??18.11 ??20.85 ??21.07 ??26.3 ??29.74

These results show that Neurospora NcD15D cDNA encoded protein is functional Δ 15-dehydrase and can instruct in leaf and seed that ALA's is synthetic in the plant.

Embodiment 7

Neurospora crassa Δ 15-dehydrogenase activity in the double-low rapeseed

Construct pMON77214 transformation cell lines with the Neurospora Δ 15-dehydrase that contains the Napin promoters driven.QUantum and Ebony rape kind are all transformed, and comprise the contrast of the two.Data presented is from R in the table 4 ₀The percentage of 18:2 (LA) and 18:3 (ALA) in the mixture of 20 seeds of plant.

Table 4 is from R ₀The percentage of PUFAs in the mixture of 20 seeds of plant

Bacterial strain ID	????18：2(LA)	????18：3(ALA)
			????EBONY ????EBONY ????EBONY ????QUANTUM ????QUANTUM ????EBONY ????QUANTUM ????QUANTUM ????BN_G1289 ????BN_G1248 ????BN_G1275 ????BN_G1256 ????BN_G1251 ????BN_G1311 ????BN_G1282 ????BN_G1321 ????BN_G1317 ????BN_G1283 ????BN_G1281 ????BN_G1272 ????BN_G1312 ????BN_G1249 ????BN_G1270 ????BN_G1271	????19.78 ????18.13 ????19.46 ????22.51 ????23.39 ????19.11 ????23.05 ????21.04 ????12.48 ????12.55 ????12.67 ????9.33 ????12.3 ????10.07 ????11.41 ????8.98 ????11.17 ????10.54 ????11.66 ????8.12 ????10.36 ????15.65 ????10.46 ????9.45	????5.94 ????7.51 ????7.56 ????11.09 ????11.17 ????11.49 ????12.03 ????12.27 ????12.53 ????13.31 ????13.45 ????13.7 ????13.89 ????14.08 ????14.69 ????14.83 ????14.84 ????15.05 ????15.24 ????15.71 ????15.9 ????16.09 ????16.48 ????16.48

??BN_G1322 ??BN_G1347 ??BN_G1353 ??BN_G1348 ??BN_G1323 ??BN_G1287 ??BN_G1318 ??BN_G1389 ??BN_G1295 ??BN_G1319 ??BN_G1286 ??BN_G1316 ??BN_G1355 ??BN_G1400 ??BN_G1354 ??BN_G1285 ??BN_G1392 ??BN_G1385 ??BN_G128B ??BN_G1386 ??BN_G1250 ??BN_G1393 ??BN_G1280 ??BN_G1315 ??BN_G1329 ??BN_G1328 ??BN_G1279 ??BN_G1387 ??BN_G1284 ??BN_G1447 ??BN_G1401 ??BN_G1298 ??BN_G1297 ??BN_G1350 ??BN_G1405 ??BN_G1390 ??BN_G1351 ??BN_G1398 ??BN_G1296 ??BN_G1394 ??BN_G1395

????9.57 ????7.18 ????9.84 ????15.69 ????7.33 ????5.95 ????11 ????13.72 ????10.46 ????7.53 ????7.88 ????5.67 ????9.86 ????14.17 ????6.4 ????8.97 ????8.71 ????9.53 ????7.88 ????14.81 ????3.78 ????10.49 ????5.81 ????8.82 ????8.21 ????3.71 ????5.47 ????11.1 ????4.28 ????7.7 ????4.97 ????9.7 ????7.4 ????5.41 ????7.86 ????7.74 ????9.05 ????6.24 ????4.05 ????7.43 ????9.8

????16.61 ????17.15 ????17.17 ????17.27 ????17.52 ????17.53 ????17.96 ????18 ????18.03 ????18.44 ????19.11 ????19.32 ????19.38 ????19.4 ????19.72 ????19.77 ????19.84 ????19.89 ????20.04 ????20.16 ????20.28 ????20.55 ????20.63 ????20.76 ????20.77 ????21.09 ????21.18 ????21.32 ????21.33 ????21.76 ????21.82 ????21.99 ????22.15 ????23.5 ????23.73 ????24.52 ????24.78 ????24.82 ????25.04 ????27.34 ????30.17

The ALA level that produces in these are is higher than 12% of seed fatty acid and shows the Δ 15-dehydrogenase activity with external source.The highest ALA level of observing from this conversion is present in BN-G1395 system, wherein contains 30.17% ALA.

For several expression pMON77214 be for, measured the fatty acid in the single seed, strain is made progress to the next generation.With the expection the same, with respect to mixture, the ALA level is increased to nearly 2 times in single seed, has shown the genetically modified homozygosity of segregant single in each siliqua.In BN-1296 system, R1 seed mixture contains 25.04% ALA.In being the single seed of (BN-G1296-14), this has found to be up to 48.2% ALA.In Fig. 3, shown the ALA level in 200 semispecies, arranged to the highest ALA order by minimum.

Embodiment 8

The Δ 15-dehydrase sequence of A.nidulans and the Δ 12-of B.cinerea and

The clone of Δ 15-dehydrase sequence

According to carrying out sequence contrast with Δ .nidulans genome sequence, the increase full length coding region territory of the Δ 15-dehydrase (AnD15-F1 and AnD15-R1) inferred of design gene-specific primer.The forward primer of design contains 3 nucleotide at 5 ' end of initial methionine

AnD15-F1：5’-AATATGGCTGCAACTGCAACAACCC-3’(SEQ?IDNO：23)

AnD15-R1：5’-TTCCGCTTTGGCACCCTTCTTC-3’(SEQ?IDNO：24)

According to the increase full length coding region territory of B.cinerea Δ 12-dehydrase of the Oligonucleolide primers BcD12F1 of portion gene group sequence (the part gDNA clone that the Monsanto that finds with BLASTALL has) design and BcD12R1.Design degenerate primer D15D-R9 comes the B.cinerea Δ 15-dehydrase of any supposition of amplification in 5 '-RACE reaction.Design oligonucleotides BCD15-F1 is used to carry out 3 ' the RACE reaction of the PCR product that produced by oligonucleotides D15D-R9.The increase code area of total length of the B.cinerea Δ 15-dehydrase inferred of design oligonucleotides BcD15F3 and BcD15R1F.

BcD12F1:5 '-GTCGACACCATGGCCTCTACCACTGCTCTC-3 ', 5 ' end contains SalI (SEQ ID NO:25)

BcD12R1:5 '-CTGCAGTGCCTTGAGCTTCATTGGTGGTGTA-3 ', 5 ' end contains PstI (SEQ ID NO:26)

D15D-R9：5’-GCCRTGNCCRCAYTCRTGNGCANGDAT-3’(SEQID?NO：27)

BcD15-F1：5’-ACGATGACTCTCGATTACACAAGTCACCCG-3’(SEQ?ID?NO：28)

BcD15-F3:5 '-GTCGACACGATGACTCTCGATTACACAAGTCACC-3 ', 5 ' end contains SalI (SEQ ID NO:29)

BcD15R1:5 '-CTGCAGAATGCTTGAGCTATCAGCAGATCCCAA-3 ', 5 ' end contains PstI (SEQ ID NO:30)

Use GeneRacer kit (Invitrogen) preparation A.nidulans and B.cinereacDNA.Use gene A mpPCR system 9700 (PE APPLIED BIOSYSTEMS), under the cycling condition of recommending, these primers and 3 '-RACE ready cDNA is used for the dehydrase that increases and infer together.PCR product with oligonucleotides AnD15-F1 and AnD15-R1 amplification coding A.nidulans Δ 15-dehydrase connects into pYES2.1-TOPO (Invitrogen) and called after pMON67010 (Fig. 7 B).With the cDNA order-checking, and find 3 " histidine-box " to occur on amino acid whose 93-97,129-133 and 327-331 position, this is conservative characteristic in the membrane-bound dehydrase.Corresponding Δ 15-dehydrase (AnD15D) nucleotide and peptide sequence are listed in SEQ ID NO:4 and SEQ ID NO:5 respectively.

Carry out the cDNA of coded delta 12-dehydrase among the pcr amplification B.cinerea with oligonucleotides BcD12F1 and BcD12R1, then it is directly connected to pYES2.1/V5-His-TOPO (Invitrogen) and forms pMON67022 (Fig. 7 D)., and find that occur 3 " histidine-box " on 191-195 and the 390-394 position, this is that film is in conjunction with a conservative characteristic in the dehydrase with the cDNA order-checking at amino acid whose 155-159.Δ 12-dehydrase (BcD12D) nucleotide and the peptide sequence inferred are listed in SEQ ID NO:31 and SEQ ID NO:32 respectively.

For from B.cinerea clone Δ 15-dehydrase, produce the oligonucleotides of degeneracy according to the comparison of the amino acid sequence of N.crassa and Aspergillus sp. Δ 12 and Δ 15-dehydrase.According to the condition of manufacturer recommendation, use GeneRacer kit (Invitrogen, Carlsbad CA) to carry out 5 '-RACE reaction.Behind the synthetic cDNA, utilize the oligonucleotides D15D-R9 of degeneracy that the 5 ' end of inferring Δ 15-dehydrase is carried out pcr amplification, and be connected to pCR2.1-TOPO.With the sequencing fragment of the 742bp that obtains, and determine by inferring with the similitude of the amino acid sequence of the Δ 15-dehydrase of other fungi.Use 3 '-RACE reaction from the B.cinerea Δ 15-dehydrase 3 ' end inferred with the oligonucleotides BcD15-F1 fragment of 664bp that increases, and be connected to pCR2.1-TOPO.According to 5 '-and the multiplexed sequence design oligonucleotides BcD15F3 and the BcD15R1 of 3 '-RACE product, react the B.cinerea Δ 15-dehydrase cDNA of the supposition of the total length that increases by 3 '-RACE, and be connected to pYes2.1-TOPO.With the plasmid called after pMON67021 (Fig. 7 C) that obtains.Δ 15-dehydrase (BcD15D) corresponding nucleotide and the peptide sequence inferred are listed in SEQ ID NO:33 and SEQ ID NO:34 respectively.

In order to estimate the Δ 15-dehydrogenase activity of the AnD15D that in the Yeast expression test, infers, in the yeast of expressing the Δ 15-dehydrase of inferring, provide the substrate of this enzyme, i.e. LA, the ALA that quantitatively produces then.To compare with the data of A.niduIans Δ 15-dehydrase by the data of N.crassa Δ 15-dehydrase pMON67023 generation ALA, as shown in table 5.PMON67023 (Fig. 7 E) makes up as follows:

Nc94F2：5，-AACATGACGGTCACCACCCGCAGCCACAAG-3’(SEQ?ID?NO：35)

Nc94R2：5，-CTGGGTGCTCTGAACGGTGTGCGCCCAAAT-3’(SEQ?ID?NO：36)

The NcD15D coding region that does not have terminator with primer Nc94F2 and Nc94R2 amplification.The fragment that obtains is connected to pYES2.1-TOPO, produces reading frame between NcD15D coding region that contains and V5 epitope and the 6-histidine zone and merge in the pYES2.1 expression vector.

Table 5 prepares ALA by Neurospora crassa Δ 15-dehydrase and aspergillus nidulans Δ 15-dehydrase

Construct	Gene	The substrate that adds	LA (adding) as substrate	????ALA
					?pMON67010 ?pMON67010 ?pMON67023 ?pMON67023	?AnD15D ?AnD15D ?NcD15D ?NcD15D	????LA ????LA ????LA ????LA	????28.43 ????24.66 ????47.98 ????47.52	????20.32 ????19.65 ????10.94 ????9.24

These results show that the specific activity NcD15D of A.nidulans dehydrase in this expression system is high about 2 times.

The analysis of AnD15D substrate utilization in table 6 yeast

Construct	Gene	The substrate that adds	????GLA	????ALA	????SDA
						pMON67010 pMON67010 pMON67010 pMON67010 pMON67010 pMON67010 pMON67010 pMON67010	?AnD15D ?AnD15D ?AnD15D ?AnD15D ?AnD15D ?AnD15D ?AnD15D ?AnD15D	- LA GLA LA+GLA - LA GLA LA+GLA	????0 ????0 ????9.19 ????9.46 ????0 ????0 ????8.36 ????8.1	????0.54 ????16.45 ????0.27 ????5.99 ????0.64 ????14.96 ????0.27 ????6.31	????0 ????0 ????8.82 ????5.35 ????0 ????0 ????8.63 ????5.48

These results show that in this expression system A.nidulansD15D can make LA and GLA dehydrogenation.

Embodiment 9

Codon optimized from A.nidulans and N.crassa. Δ 15-dehydrase that is used for soybean

Make up codon by the seed specific albumen (conglycinin, glycinin, globulin) of 8 high expresseds that come from soybean and the seed specific albumen (cuciferin, napin, oleosin) that derives from 17 high expresseds of double-low rapeseed and use table.NcD15D and AnD15D nucleotide sequence, use table together with above-mentioned codon, be sent to the Blue HeronBiotechnology (Bothell of Co., Ltd, Wa), the said firm utilizes all algorithms to obtain final optimizing codon sequence then, and this sequence has the free energy of minimum formation RNA secondary structure.The optimizing codon sequence of NcD15D is synthetic and called after NcD15Dnno (SEQ ID NO:37) by Blue Heron Biotechnology Co., Ltd.The optimizing codon sequence of AnD15D is by Midland (Midland, TX) synthetic and called after AnD15Dnno (SEQID NO:38).

Embodiment 10

Neurospora Δ 15-dehydrase and Mortierella alpina Δ 6 Hes

The activity of Δ 12-dehydrase associating

The activity of Neurospora Δ 15-dehydrase and Mortierella alpina Δ 6 and the associating of Δ 12-dehydrase is estimated by transforming double-low rapeseed with construct pMON77216 (Fig. 7 G), and this construct contains 3 dehydrases by the control of Napin promotor.Yet in the many systems that obtain, find that Δ 12-dehydrase is partly left out.Measured content of fatty acid from 10 seed mixtures of independent R0 plant.Following table 6 shown stearic acid (18:0) (SA), oleic acid (18: 1) (OA), the level of LA, ALA, SDA and GLA.Control series is Ebony.The seed mixture that obtains from a plurality of transgenic experiments contains measurable SDA, and SDA is accumulated to above 10% of fatty acid in 8 experiments.

Relative area percentage result (approximate weight percentage) in the table 6 R1 seed mixture

Fatty acid (percentage by weight)
							Event id	????SA	????OA	????LA	????GLA	????ALA	????SDA
Contrast contrast contrast BN_G1116 BN_G1117 BN_G1118 BN_G1119 BN_G1120 BN_G1121 BN_G1122 BN_G1123 BN_G1124 BN_G1125 BN_G1126 BN_G1127 BN_G1128 BN_G1129 BN_G1130 BN_G1131 BN_G1132 BN_G1133 BN_G1124 BN_G1135 BN_G1136 BN_G1137 BN_G1138 BN_G1139 BN_G1140 BN_G1141 BN_G1143 BN_G1144 BN_G1145 BN_G1146 BN_G1147 BN_G1148 BN_G1149 BN_G1150	????1.43 ????1.43 ????1.63 ????1.66 ????1.59 ????1.78 ????1.97 ????1.43 ????1.56 ????1.74 ????1.4 ????1.91 ????2.32 ????1.69 ????2.03 ????1.78 ????1.74 ????2.23 ????1.84 ????2.14 ????1.92 ????1.66 ????1.53 ????2.08 ????1.77 ????1.89 ????2.17 ????2.31 ????1.49 ????1.7 ????1.66 ????1.87 ????1.87 ????2.34 ????1.85 ????1.63 ????2.72	????66.47 ????60.27 ????64.93 ????49.77 ????41.96 ????47.16 ????47.88 ????44.98 ????43.29 ????38.92 ????56.41 ????49.21 ????41.71 ????65.41 ????37.12 ????39.25 ????31.83 ????31.55 ????46.36 ????32.57 ????36.46 ????43.74 ????43.95 ????35.91 ????40.53 ????42.24 ????51.7 ????43.1 ????40.03 ????41.86 ????40.28 ????38.9 ????34.99 ????35.19 ????29.28 ????37.03 ????35.99	????16.85 ????19.65 ????17.07 ????25.58 ????33.82 ????25.91 ????24.81 ????27.22 ????26.56 ????30.67 ????19.49 ????24.06 ????22.05 ????11.8 ????20.39 ????22.36 ????27.51 ????22.8 ????22.06 ????25.79 ????25.41 ????22.34 ????22.08 ????27.18 ????23.41 ????21.84 ????17.44 ????21.72 ????22.99 ????22.61 ????22.74 ????22.98 ????24.42 ????23.37 ????29.24 ????22.9 ????20.19	????0 ????0.52 ????0.54 ????7.16 ????4.09 ????10.44 ????11.54 ????8.43 ????13.58 ????12.01 ????3.13 ????4.42 ????18.62 ????7.79 ????25.19 ????20.9 ????21.83 ????29.28 ????6.47 ????23.37 ????19.25 ????6.57 ????6.86 ????7.23 ????9.63 ????7 ????8.07 ????8.25 ????5.93 ????7.97 ????8.3 ????8.72 ????8.54 ????8.63 ????12.95 ????9.66 ????10.53	????8.7 ????11.94 ????9.68 ????8.33 ????10.58 ????7.66 ????7.09 ????10.19 ????7.42 ????8.53 ????11.7 ????11.66 ????7.12 ????4.93 ????6.07 ????7.4 ????8.77 ????5.39 ????14.99 ????7.48 ????8.3 ????17.25 ????16.79 ????18.86 ????15.83 ????18.34 ????11.56 ????15.12 ????19.6 ????16.57 ????17.09 ????17.88 ????21 ????20.12 ????16.18 ????20.16 ????19.67	????0 ????0.07 ????0.11 ????0.7 ????0.71 ????0.89 ????0.91 ????0.97 ????1.08 ????1.11 ????1.19 ????1.59 ????1.61 ????1.69 ????1.73 ????1.9 ????2.04 ????2.05 ????2.08 ????2.16 ????2.2 ????2.45 ????2.6 ????2.71 ????2.73 ????2.77 ????3.02 ????3.04 ????3.06 ????3.18 ????3.27 ????3.56 ????3.67 ????3.86 ????3.95 ????4.29 ????4.47

BN_G1151 BN_G1152 BN_G1153 BN_G1154 BN_G1155 BN_G1156 BN_G1157 BN_G1158 BN_G1159 BN_G1160 BN_G1161 BN_G1162 BN_G1163 BN_G1164 BN_G1165 BN_G1166 BN_G1167 BN_G1168 BN_G1169 BN_G1170 BN_G1171 BN_G1172 BN_G1173 BN_G1174 BN_G1175 BN_G1176 BN_G1177 BN_G1178 BN_G1179 BN_G1180 BN_G1181 BN_G1182 BN_G1183 BN_G1184 BN_G1185 BN_G1186 BN_G1187 BN_G1188 BN_G1189 BN_G1190 BN_G1191

????1.62 ????2.4 ????2.45 ????2.31 ????1.84 ????1.73 ????1.87 ????2.98 ????2.17 ????1.85 ????1.94 ????1.74 ????1.84 ????1.96 ????1.86 ????1.95 ????2.62 ????2.78 ????2.92 ????2.57 ????2.24 ????2.79 ????1.88 ????2.36 ????3.43 ????2.06 ????1.74 ????1.62 ????1.72 ????2.55 ????2.53 ????1.75 ????2.42 ????2.2 ????2.58 ????1.13 ????2.22 ????2.5 ????2.41 ????2.29 ????2.31

????32.92 ????30.12 ????35.53 ????26.49 ????34.83 ????55.09 ????34.84 ????29.18 ????36.41 ????40.01 ????29.5 ????33.78 ????34.83 ????37.43 ????36.5 ????29.59 ????25.92 ????48.4 ????37.66 ????26.3 ????24.1 ????26.16 ????28.4 ????24.04 ????24.83 ????30.09 ????64.72 ????25.75 ????30.98 ????21.39 ????21.81 ????24.68 ????31.08 ????26.92 ????63.63 ????55.27 ????37.22 ????26.64 ????26.12 ????36.61 ????18.94

????23.19 ????25.47 ????22.92 ????19.78 ????21.08 ????8.75 ????21.19 ????22.71 ????18.63 ????17.37 ????25.74 ????20.98 ????21.13 ????17.03 ????18.9 ????24.52 ????22.63 ????12.78 ????17.21 ????22.62 ????20.08 ????20.37 ????20.84 ????17.6 ????20.39 ????18.23 ????7.85 ????19.49 ????19.19 ????19.93 ????21.21 ????20 ????16.43 ????17.92 ????4.49 ????9.21 ????14.97 ????18.05 ????18.44 ????12.21 ????12.95

????9.25 ????14.34 ????11.87 ????6.29 ????11.55 ????2.81 ????10.88 ????17.48 ????10.27 ????13.86 ????9.15 ????12.79 ????10.28 ????5.79 ????11.28 ????13.72 ????15.39 ????6.28 ????13.51 ????11.07 ????28.31 ????13.4 ????21.11 ????28.46 ????21.68 ????13.06 ????2.46 ????9.12 ????11.78 ????26.55 ????15.3 ????14.66 ????15.08 ????17.43 ????5.11 ????4.08 ????13.19 ????19.8 ????16.81 ????14.29 ????18.11

????21.68 ????15.85 ????15.36 ????31.62 ????18.46 ????20.2 ????19.14 ????14.23 ????20.3 ????13.79 ????20.3 ????16.98 ????18.76 ????24.34 ????18.7 ????18.95 ????19.76 ????17.57 ????14.14 ????22.43 ????10.8 ????21.15 ????13.55 ????10.82 ????15.5 ????20.9 ????8.1 ????27.3 ????20.65 ????12.19 ????22.58 ????22.4 ????17.5 ????18.69 ????6.18 ????12.73 ????16.2 ????14.58 ????19.27 ????14.68 ????22.1

????4.88 ????4.93 ????4.93 ????5.06 ????5.36 ????5.39 ????5.41 ????5.9 ????5.98 ????6.11 ????6.12 ????6.24 ????6.27 ????6.45 ????6.68 ????6.69 ????6.69 ????6.71 ????7.22 ????7.25 ????7.53 ????7.8 ????7.93 ????8.13 ????8.23 ????8.23 ????8.29 ????8.6 ????8.95 ????9.07 ????9.16 ????9.36 ????9.48 ????10 ????10.29 ????10.29 ????10.46 ????10.83 ????11.01 ????13.31 ????17.95

One-seeded fatty acid data from experiment BN-G1824 comprise homozygote and heterozygote, show in following table 7.In an example, observe 18.6% SDA, 17.8% ALA, 11.2% LA, 24% oleic acid and 18.8% GLA.This example is considered to the example of the high GLA of high SDA/.Observe 16.8% SDA, 7% ALA, 2% LA, 62.1% oleic acid and 3.1%GLA in the another kind of seed in this example, this example is considered to the low GLA of high SDA/ system.Molecular data shows that in the low GLA of high SDA/ system, Δ 12 coded sequences do not have function.Also show especially, the low GLA of high SDA/ system has comprised a single copy that independent part T-DNA inserts, and the left margin of Mortierellaalpina Δ 12-dehydrase code area has been lost in this insertion and all between terminal 51 base-pairs are inserted DNA (for example last 51 bases of SEQ ID NO:41).It should be noted that being on close level of in the low GLA of high SDA/ system oleic acid level and wild type, and in the high GLA of high SDA/ system, compare that the oleic acid level reduces by 2.5 times approximately with wild type.What show the high oleic acid phenotype of high SDA/ is outstanding with grey.

The one-seeded relative area percentage result of the R1 of table 7 BN_G1190 (approximate weight percentage)

In order further to estimate Neurospora crassa. the activity of Δ 15-dehydrase and M.alpina Δ 6-and the associating of Δ 12-dehydrase, with the construct pMON77214 that the contains NcD15D homozygous system of transformation construct pCGN5544 (containing M.alpina Δ 6-and Δ 12-dehydrase) once more, contain GLA in its seed oil up to 35%.Analyzed from 11 kinds of R ₀The mixture of 20 seeds of plant.These are that the level of middle LA, ALA, SDA and GLA is displayed in Table 8.

The relative area percentage result (approximate weight percentage) of table 8 R1 seed mixture is analyzed

Strain	????LA	????ALA	????SDA	????GLA
					Ebony contrast Ebony contrast BN_1569 BN_1561 BN_1566 BN_1564 BN_1644 BN_1527 BN_1563 BN_1609 BN_1622 BN_1680 BN_1624	????16.05 ????17.46 ????21.19 ????25.35 ????29.26 ????17.92 ????24.25 ????22 ????20.13 ????22.46 ????9.1 ????21.47 ????12.95	????8.7 ????9.05 ????11 ????14.7 ????14.03 ????26.51 ????16.1 ????15.97 ????17.26 ????23.76 ????15.77 ????19.19 ????22.1	????0 ????0 ????0.11 ????1.57 ????1.75 ????2.33 ????4.05 ????4.17 ????4.52 ????5.22 ????6.33 ????11.19 ????17.95	????0 ????0 ????30.1 ????6.03 ????9.04 ????4.5 ????16.64 ????10.44 ????12.11 ????11.39 ????5.23 ????19.07 ????18.11

Embodiment 11

Neurospora crassa. the activity of Δ 15-dehydrase and the associating of Mortierella.alpina Δ 6-dehydrase

Transform double-low rapeseed by construct pMON77215 (Fig. 7 F), estimate Neurospora crassa with two dehydrases that contain the control of Napin promotor. the activity of Δ 15-dehydrase and the associating of Mortierella.alpina Δ 6-dehydrase.This carrier by NotI digestion, wherein have a pCGN5536 (U.S. patent No. .6 that the M..alpina Δ 6-dehydrase (MaD6D) of Napin promoters driven is expressed, 459,018 B1) makes up, then the expression cassette fragment is connected on the NotI site of binary vector pMON70660 and forms pMON77212.The structure of pMON77215 plasmid is by digesting pMON77214 with PmeI and AscI, then the Napin-NcD15D expression cassette fragment that obtains is connected to SwaI and the AscI site of pMON77212, forming the construct that contains MaD6D and NcD15D simultaneously.

Measured content from fatty acid in the mixture of 10 seeds in the single R0 double-low rapeseed transformant.The level that in following table 9, has shown SA, OA, LA, ALA, SDA and GLA.Control series is Ebony (SP30052).The mixture of the seed that produces from a plurality of transgenic experiments contains measurable SDA, and the SDA of (in 40 10) is accumulated to above 10% of fatty acid in 25% the experiment.

Relative area percentage result (approximate weight percentage) in the R1 seed mixture of table 9 pMON77215

	Fatty acid (percentage by weight)
							Event id	????SA	????OA	????LA	????GLA	??ALA	????SDA
Ebony contrast BN_G2463 BN_G2444 BN_G2443 BN_G1700 BN_G2082 BN_G2316 BN_G2083 BN_G2413 BN_G2317 BN_G2412 BN_G2315 BN_G2028 BN_G2357 BN_G2027 BN_G2360 BN_G2390 BN_G2029 BN_G2414 BN_G2416 BN_G2250 BN_G1698 BN_G2356 BN_G1937 BN_G2319 BN_G1699 BN_G2359 BN_G2460 BN_G2409 BN_G2318 BN_G2358 BN_G1697 BN_G1803 BN_G2391 BN_G1859 BN_G2389 BN_G1860 BN_G2410 BN_G2445 BN_G2361	????1.43 ????1.98 ????1.62 ????1.47 ????1.69 ????1.84 ????2.19 ????1.89 ????1.97 ????2.74 ????2.31 ????2.91 ????1.91 ????2.51 ????2.13 ????2.51 ????3.2 ????1.78 ????2.07 ????2.26 ????2.19 ????1.82 ????2.82 ????2 ????1.99 ????1.74 ????2.96 ????2.54 ????3.27 ????2.54 ????2.76 ????2.58 ????1.13 ????2.83 ????2.33 ????2.54 ????2.22 ????3.24 ????2.77 ????2.31	????66.47 ????63.51 ????60.61 ????59.39 ????65.41 ????59.51 ????66.1 ????61.57 ????64.12 ????66.72 ????61.63 ????64.38 ????61.48 ????64.17 ????53.72 ????62.75 ????63.66 ????61.89 ????57.13 ????65.01 ????61.99 ????68.26 ????62.46 ????56.02 ????58.47 ????64.72 ????64.17 ????62.4 ????57.85 ????61.04 ????62.33 ????63.63 ????55.27 ????58.33 ????52.66 ????59.21 ????51.02 ????55.96 ????57.67 ????56.5	????16.85 ????17.96 ????19.58 ????17.8 ????11.8 ????16.72 ????11.49 ????12.61 ????9.74 ????6.92 ????8.48 ????10.22 ????10.25 ????8.28 ????12.39 ????9.47 ????8.44 ????10.41 ????11 ????7.17 ????8.8 ????6.4 ????11.52 ????10.92 ????9.63 ????7.85 ????7.09 ????5.33 ????9.71 ????7.6 ????5.88 ????4.49 ????9.21 ????11.45 ????9.71 ????6.97 ????9.49 ????7.03 ????6.21 ????8.86	????0 ????0.13 ????0.13 ????3.42 ????7.79 ????4.45 ????7.17 ????7.29 ????1.58 ????0.44 ????1.66 ????0.91 ????2.2 ????0.85 ????2.6 ????4.89 ????0.5 ????1.44 ????2.36 ????0.83 ????1.93 ????3.76 ????1.75 ????2.24 ????5.86 ????2.46 ????2.05 ????1.43 ????3.97 ????2.37 ????2.06 ????5.11 ????4.08 ????2.42 ????2.98 ????3.88 ????4.62 ????3.1 ????2.78 ????3.77	??8.7 ??9.9 ??11.38 ??10.2 ??4.93 ??10.16 ??4.24 ??7.02 ??11.09 ??10.42 ??13.6 ??6.07 ??11.59 ??10.42 ??15.72 ??7.17 ??10.2 ??11.12 ??14.07 ??11.86 ??9.72 ??6.55 ??6.99 ??12.6 ??9.05 ??8.1 ??7.67 ??11.43 ??7.44 ??8.43 ??8.72 ??6.18 ??12.73 ??6.6 ??12.19 ??8.07 ??10.5 ??8.88 ??9.62 ??6.48	????0 ????0.1 ????0.36 ????1.1 ????1.69 ????1.73 ????2.24 ????2.28 ????4.63 ????5.13 ????5.21 ????5.28 ????5.59 ????5.62 ????5.78 ????5.84 ????5.88 ????6.35 ????6.44 ????6.45 ????6.6 ????6.65 ????6.84 ????7.81 ????7.91 ????8.29 ????8.88 ????9.63 ????9.87 ????9.99 ????10.08 ????10.29 ????10.29 ????10.57 ????11.03 ????11.84 ????13.44 ????13.82 ????14.14 ????14.78

One-seeded fatty acid data from experiment BN-G1860 comprise homozygote and heterozygote, as showing in the following table 10.In an example, observe SDA up to 19%, 10% ALA, 7% LA, 48% oleic acid and 5% GLA.

The area percentage result that the single R1 seed of the pMON77215 of table 10 BN_G1860 is relative (approximate weight percentage)

	Fatty acid (percentage by weight)
							Event id	????SA	??OA	????LA	????GLA	????ALA	????SDA
BN_G1860-1 BN_G1860-2 BN_G1860-3 BN_G1860-4 BN_G1860-5 BN_G1860-6 BN_G1860-7 BN_G1860-8 BN_G1860-9 BN_G1860-10 BN_G1860-11 BN_G1860-12 BN_G1860-13 BN_G1860-14 BN_G1860-15 BN_G1860-16 BN_G1860-17 BN_G1860-18 BN_G1860-19 BN_G1860-20 BN_G1860-21 BN_G1860-22 BN_G1860-23 BN_G1860-24 BN_G1860-25 BN_G1860-26 BN_G1860-27 BN_G1860-28 BN_G1860-29 BN_G1860-30 BN_G1860-31 BN_G1860-32 BN_G1860-33 BN_G1860-34 BN_G1860-35 BN_G1860-36 BN_G1860-37 BN_G1860-38 BN_G1860-39 BN_G1860-40	????1.57 ????1.4 ????1.74 ????1.77 ????2.37 ????1.72 ????2.53 ????2.21 ????2.12 ????3.12 ????2.2 ????2.25 ????2.03 ????1.76 ????2.77 ????1.43 ????2.91 ????1.92 ????1.85 ????2.45 ????1.88 ????1.91 ????3.01 ????2.94 ????2.34 ????2.75 ????1.7 ????2.3 ????2.9 ????1.8 ????2.67 ????2.31 ????2.18 ????2.38 ????1.99 ????2.87 ????2.35 ????3.15 ????2.31 ????3.26	??65.11 ??57.32 ??60.16 ??56.85 ??57.88 ??60.18 ??55.86 ??56.83 ??60.21 ??56.6 ??53.64 ??55.58 ??57.57 ??54.42 ??57.4 ??55.39 ??53.02 ??60.27 ??59.6 ??58.84 ??57.95 ??55.15 ??59.08 ??56.48 ??53.88 ??52.92 ??57.28 ??53.15 ??54.49 ??58.02 ??54.97 ??56.01 ??55.92 ??54.85 ??58.89 ??55.91 ??53.18 ??51.6 ??55.68 ??54.62	????16.5 ????19.05 ????19.44 ????8.11 ????5.26 ????5.03 ????9.31 ????7.48 ????4.83 ????10.33 ????12.32 ????10.53 ????7.08 ????7.16 ????8.5 ????9.93 ????10.79 ????3.72 ????4.72 ????6.51 ????5 ????6.02 ????5.36 ????6.78 ????8.64 ????7.04 ????4.41 ????9.42 ????6.2 ????4 ????7.32 ????5.09 ????8.83 ????8.52 ????4.14 ????6.55 ????8.89 ????10.29 ????6.08 ????6.54	????0 ????0 ????0 ????6.79 ????2.94 ????2.87 ????6.08 ????5.93 ????2.8 ????4.54 ????5.54 ????5.07 ????4.19 ????6.43 ????4.17 ????5.62 ????4.34 ????1.96 ????2.56 ????3.66 ????2.85 ????5.3 ????2.88 ????3.95 ????4.49 ????4.38 ????2.99 ????5.79 ????3.73 ????2.41 ????4.68 ????4.34 ????4.06 ????4.01 ????2.09 ????2.8 ????4.73 ????4.85 ????4.52 ????3.55	????10.47 ????15.3 ????11.95 ????9.11 ????12.72 ????11.42 ????5.96 ????8.52 ????10.13 ????4.5 ????4.73 ????5.42 ????8.15 ????8.99 ????5.73 ????6.38 ????5.89 ????10.7 ????9.85 ????6.88 ????10.56 ????9.2 ????7.33 ????7.83 ????6.42 ????9.4 ????10.74 ????6.53 ????7.92 ????10.67 ????7.92 ????9.93 ????5.46 ????5.76 ????9.74 ????7.37 ????6.45 ????5.68 ????7.81 ????7.53	????0.01 ????0.02 ????0.03 ????9.96 ????11.48 ????11.71 ????12.23 ????12.38 ????12.43 ????12.48 ????12.88 ????13.53 ????13.69 ????13.77 ????13.78 ????13.82 ????13.92 ????13.92 ????14.16 ????14.22 ????14.42 ????14.75 ????14.85 ????14.86 ????14.94 ????14.96 ????15.05 ????15.29 ????15.38 ????15.42 ????15.44 ????15.47 ????15.54 ????15.56 ????15.58 ????15.66 ????15.71 ????15.78 ????15.92 ????16.19

BN_G1860-41 BN_G1860-42 BN_G1860-43 BN_G1860-44 BN_G1860-45 BN_G1860-46 BN_G1860-47 BN_G1860-48 BN_G1860-49 BN_G1860-50

??2.09 ??2.33 ??2.37 ??2.04 ??2.1 ??2.14 ??2.42 ??1.94 ??1.46 ??2.41

??56.03 ??53.62 ??57.86 ??51.3 ??53.32 ??53.01 ??50.96 ??49.97 ??55.32 ??47.66

??6.27 ??6.48 ??5.24 ??11.41 ??8.75 ??6.85 ??7.83 ??10.64 ??4.57 ??6.83

????4.04 ????5.35 ????2.81 ????5.03 ????4.04 ????4.3 ????4.13 ????4.78 ????2.67 ????5.46

????7.56 ????7.97 ????7.32 ????5.09 ????6.44 ????7.82 ????7.91 ????5.74 ????9.98 ????9.91

????16.35 ????16.62 ????16.77 ????16.94 ????17.12 ????17.16 ????17.44 ????17.84 ????18 ????19.23

Embodiment 12

From codon optimized to corn of the Δ 15-dehydrase sequence of N.crassa.

Use table by the gene constructed codon of the seed specific of 9 high expresseds of corn (6 zeins and 3 oleosins).Utilize this table, usefulness QuikChange rite-directed mutagenesis kit (CA) two codons with NcD15D suddenly change for Stratagene, La Jolla, and with the sequence called after NcFAD3m (SEQ ID NO:42) that produces.It is as follows to change the codon operation: 1) obtain a preferred translation initiation site, first base by changing second codon (among the SEQ ID NO:42 the 4th) becomes GCG with ACG, and makes an alanine among the SEQ ID NO:2 be replaced by threonine; With 2) in order to remove a rare codon, (SEQ ID NO:42) upward changes GTG into from GTA to the codon of a valine in 882 positions.

Embodiment 13

EPA is equal to value

The measurement seed oil is that EPA is equal to value for the standard of health quality.This value has reflected that metabolism changes into the ratio of EPA.By the percentage of ALA divided by 14 with the percentage of SDA divided by 4 mutually the Calais draw this value.The double-low rapeseed fluid composition that the present inventor obtains has high EPA and is equal to value, is presented to have the characteristic that improves relevant health advantages with the EPA level in the humans and animals.Compare by the embodiment that traditional double-low rapeseed oil and the high SDA oil that typically contains 10%ALA and 15%SDA are formed, obtain following analysis result.The double-low rapeseed oil of tradition kind contains 12% ALA and 0%SDA approximately, and the value that is equal to of its EPA is 12/14+0/4=0.8.Opposite, the EPA of the embodiment that high SDA oil is formed is equal to value and is 10/14+15/4=4.4.Corresponding value shows below.This value is based on weight %, rather than based on application.Huge difference shows the importance of the SDA that produces in double-low rapeseed oil.

Table 11 EPA is equal to value relatively

Vegetable oil	Total Ω-3 (% fatty acid)	N-6: n-3 ratio (% fatty acid)	Corresponding EPA equivalence (weight %ALA+SDA)
				Double-low rapeseed	????12	??2.6∶1	??0.8
The SDA double-low rapeseed	????50	??1∶5	??4.4

List of references

Quote the list of references listed below in the present invention as a reference, with they as a supplement, explain, provide background technology or method taught, technology and/or composition as used herein.

U.S.Patent?4,535,060

U.S.Patent?4,666,701

U.S.Patent?4,758,592

U.S.Patent?4,826,877

U.S.Patent?4,910,141

U.S.Patent?5,011,770

U.S.Patent?5,116,871

U.S.Patent?5,302,523

U.S.Patent?5,322,783

U.S.Patent?5,378,619

U.S.Patent?5,384,253

U.S.Patent?5,464,765

U.S.Patent?5,508,184

U.S.Patent?5,508,468

U.S.Patent?5,538,877

U.S.Patent?5,538,880

U.S.Patent?5,545,818

U.S.Patent?5,550,318

U.S.Patent?5,563,055

U.S.Patent?5,591,616

U.S.Patent?5,610,042

U.S.Patent?5,952,544

Abdullah?et?al.，Biotechnology，4：1087，1986.

Arondel，Science，258(5086)：1353-1355，1992.

Ausubel?et?al.，In：Current?Protocols?in?Molecular?Biology，Green?Publishing?Assoc.，NY，1987.

Barton?et?al.，Cell，32：1033，1983.

Bates，Mol.Biotechnol.，2(2)：135-45，1994.

Battraw?and?Hall，Theor.App.Genet.，82(2)：161-168，1991.

Bechtold?et?al.，CR.Acad.Sci.Life?Sci.，316：1194-1199，1993.

Becker?and?Guarente，Methods?Enzymol.，194：182-187，1991.

Bent?et?al.，Science，265：1856-1860，1994.

Bent?et?al.(1994)，Science?265：1856-1860

Bevan?et?al.，Nucleic?Acids?Res.，11(2)：369-385，1983.

Beyan，Nucleic?Acids?Res.，12：8111，1984.

Bhattacharjee，An，Gupta，J.Plant?Bioch.Biotech.，6(2)：69-73.1997.

Bouchez?et?al.，EMBO?Journal，8(13)：4197-4204，1989.

Bower?et?al.，J.Plant，2：409-416.1992.

Bray，1987

Brenner?et?al.，Adv.Exp.Med.Biol.，83：85-101，1976.

Buchanan-Wollaston?et?al.，Plant?Cell?Reports，11：627-631.1992

Buising?and?Benbow，Mol.Gen.Genet.，243(1)：71-81，1994.

Bustos?et?al.，J.Bacteriol.，174：7525-7533，1991.

Callis?et?al.，Genes?Dev.，1：1183-1200，1987.

Casa?et?al.，Proc.Natl.Acad.Sci.USA，90(23)：11212-11216，1993.

Case?et?al.，Neurospora?Newsletter，8：25-26，1965.

Chandler?et?al.，The?Plant?Cell，1：1175-1183，1989.

Chomczynski?and?Sacchi，Anal.Biochem.，162(1)：156-159，1987.

Chou?and?Fasman，Adv.Enzymol.，47：45-148，1978.

Christou?et?al.，Proc.Natl.Acad.Sci.USA，84(12)：3962-3966，1987.

Conkling?et?al.，Plant?Physiol.，93：1203-1211，1990.

Crozier，Lipids，24：460，1989.

De?Block?et?al.，Plant?Physiol.，91：694-701，1989.

De?Block?et?al.，The?EMBO?Journal，6(9)：2513-2518，1987.

De?Deckerer，Eur.J.Clin.Nutr.，52：749，1998.

DeBlock?et?al.，J.EMBO，2：2143，1984.

Dellaporta?et?al.，In：Chromosome?Structure?and?Function：Impact?of?New?Concepts，18th

Stadler?Genetics?Symposium，11：263-282，1988.

Denmark?Appl.DE?3642?829

D′Halluin?et?al.，Plant?Cell，4(12)：1495-1505，1992.

Ebert?et?al.，Proc.Natl.Acad.Sci.USA，84：5745-5749，1987

Ellis?et?al.，EMBO?Journal，6(11)：3203-3208，1987.

Europ.Appl.154，204

Fraley?et?al.，Bio/Technology，3：629-635，1985.

Fromm?et?al.，Nature?319：791-793，1986

Fromm?et?al.，Nature，319：791-793，1986.

Gallie?et?al.，The?Plant?Cell，1：301-311，1989.

Gelvin?et?al.，In：Plant?Molecular?Biology?Manual，1990.

Ghosh-Biswas?et?al.，J.Biotechnol.，32(1)：1-10，1994.

Goeddel，In：Methods?in?Enzymology，Perbal(Ed.)，Academic?Press，John?Wiley?and?Sones，185，

1988.

Hagio，Blowers，Earle，Plant?Cell?Rep.，10(5)：260-264，1991.

Hamilton?et?al.，Proc.Natl.Acad.Sci.USA，93(18)：9975-9979，1996.

Haseloff?et?al.，Proc.Natl.Acad.Sci.USA，94(6)：2122-2127，1997.

He?et?al.，Plant?Cell?Reports，14(2-3)：192-196，1994.

Hensgens?et?al.，Plant?Mol.Biol.，22(6)：1101-1127，1993.

Hiei?et?al.，Plant.Mol.Biol.，35(1-2)：205-218，1997.

Hinchee?et?al.，Bio/technol.，6：915-922，1988.

Horrobin?et?al.，Am.J.Clin.Nutr.，57(Suppl)：732S-737S，1993.

Horsch?et?al.，Science，223：496，1984.

Horsch?et?al.，Science，227：1229，1985.

Hou?and?Lin，Plant?Physiology，111：166，1996.

Huang，Biochem.Biophys.Acta，1082：319，1991.

Hudspeth?and?Grula，Plant?Mol.Biol.，12：579-589，1989.

Ikuta?et?al.，Bio/technol.，8：241-242，1990.

Ishidia?et?al.，Nat.Biotechnol.，14(6)：745-750，1996.

IUPAC-IUB，Nucl.Acid?Res.，13：3021-3030，1985.

James?et?al.，Can.J.Physiol.Pharmacol.，75：234，1997.

James?et?al.，Semin.Arthritis?Rheum.，28：85，2000.

Kaeppler?et?al.，Plant?Cell?Reports，9：415-418，1990.

Kaeppler?et?al.，Theor.Appl.Genet.，84(5-6)：560-566，1992.

Katz?et?al.，J.Gen.Microbiol.，129：2703-2714，1983.

Klee?et?al.，Bio-Technology，3(7)：637-642，1985.

Klein?et?al.，Nature，327：70，1987.

Knittel?et?al.，Plant?Cell?Reports，14(2-3)：81-86，1994.

Knutzon?et?al.，Proc.Natl.Acad.Sci.USA，89(7)：2624-2628，1992.

Kyte?and?Doolittle，J.Mol.Biol.，157：105-132，1982.

Lawton?et?al.，Plant?Mol.Biol.9：315-324，1987.

Lazzeri，Methods?Mol.Biol.，49：95-106，1995.

Lee?et?al.，Environ.Mol.Mutagen.，13(1)：54-59，1989.

Lorz?et?al.，Mol?Gen?Genet，199：178-182，1985.

Manzioris?et?al.，Am.J.Clin.Nutr.，59：1304，1994.

Marcotte?et?al.，Nature，335：454，1988.

McCabe，Martinell，Bio-Technology，11(5)：596-598，1993.

McCormac?et?al.，Euphytica，99(1)：17-25，1998.

Meesapyodsuk?et?al.，Biochemistry，39(39)：11948-11954，2000.

Michaelis?et?al.，Ann.Rev.Microbiol.，36：425，1982.

Murakami?et?al.，Mol.Genn.Genet.，205：42-50，1986.

Nagatani?et?al.，Biotech.Tech.，11(7)：471-473，1997.

Naylor?et?al.，Nature，405：1017，2000.

Odell?et?al.，Nature，313：810-812，1985.

Ogawa?et?al.，Sci.Rep.，13：42-48，1973.

Omirulleh?et?al.，Plant?Mol.Biol.，21(3)：415-28，1993.

Ow?et?al.，Science，234：856-859，1986.

PCT?Appl.WO?9217598

PCT?Appl.WO?94/09699

PCT?Appl.WO?95/06128

PCT?Appl.WO?96/33155

PCT?Appl.WO?97/4103

PCT?Appl.WO?97/41228

Potrykus?et?al.，Mol.Gen.Genet.，199(2)：169-77，1985.

Potrykus?et?al.，Mol.Gen.Genet.，199：183-188，1985.

Prasher?et?al.，Biochem.Biophys.Res.Commun.，126(3)：1259-1268，1985.

Reed?et?al.，Plant?Physiol.，122：715-720，2000.

Reichel?et?al.，Proc.Natl.Acad.Sci.USA，93(12)p.5888-5893.1996

Restrepo?et?al.，Plant?Cell，2：987，1990.

Rhodes?et?al.，Methods?Mol.Biol.，55：121-131，1995.

Ritala?et?al.，Plant?Mol.Biol.，24(2)：317-325，1994.

Rogers?et?al.，Methods?Enzymol.，153：253-277，1987.

Sambrook?et?al.，In：Molecular?cloning，Cold?Spring?Harbor?Laboratory?Press，Cold?Spring?Harbor，

NY，1989.

Sheen?et?al.，Plant?Journal，8(5)：777-784，1995.

Simopoulos?et?al.，Am.Coll，Nutr，18：487，1999.

Singsit?et?al.，Transgenic?Res.，6(2)：169-176，1997.

Spencer?et?al.，Plant?Molecular?Biology，18：201-210，1992.

Stalker?et?al.，Science，242：419-422，1988.

Sullivan?et?al.，Mol.Gen.Genet.，215(3)：431-440，1989.

Sutcliffe，Proc.Natl.Acad?Sci.USA，75：3737-3741，1978.

Thillet?et?al.，J.Biol.Chem.，263：12500-12508，1988.

Thompson?et?al.，Euphytica，85(1-3)：75-80，1995.

Thompson?et?al.，The?EMBO?Journal，6(9)：2519-2523，1987.

Tian?et?al.，Plant?Cell?Rep.，16：267-271，1997.

Tingay?et?al.，Plant?J.，11(6)：1369-1376，1997.

Tomes?et?al.，Plant?Mol.Biol.，14(2)：261-268，1990.

Torbet?et?al.，Crop?Science，38(1)：226-231，1998.

Torbet?et?al.，Plant?Cell?Reports，14(10)：635-640，1995.

Toriyama?et?al.，Theor?Appl.Genet.，73：16，1986.

Tsukada?et?al.，Plant?Cell?Physiol.，30(4)599-604，1989.

Twell?et?al.，Plant?Physiol.，91：1270-1274，1989.

Uchimiya?et?al.，Mol.Gen.Genet.，204：204，1986.

Van?den?Broeck?et?al.，Nature，313：358，1985.

Van?Eck，Blowers；Earle，Plant?Cell?Reports，14(5)：299-304，1995.

Vasil?et?al.，Plant?Physiol.，91：1575-1579，1989.

Vasil?et?al.，Plant?Physiol.，91：1575-1579，1989.

Walker?et?al.，Proc.Natl.Acad.Sci.USA，84：6624-6628，1987.

Wang?et?al.，Molec.Cell.Biol.，12(8)：3399-3406，1992.

Wolk?et?al.，Proc.Natl.Acad.Sci.USA，1561-1565，1984.

Yamada?et?al.，Plant?Cell?Rep.，4：85，1986.

Yamazaki?et?al.，Biochem.Biophys.Acta，1123：18，1992.

Yang?and?Russell，Proc.Natl.Acad.Sci.USA，87：4144-4148，1990.

Zheng?and?Edwards，J.Gen.Virol.，71：1865-1868，1990.

Zhou?et?al.，Plant?Cell?Reports，12(11)：612-616，1993.

Zukowsky?et?al.，Proc.Natl.Acad.Sci.USA，80：1101-1105，1983.

Sequence table

<110>URSIN，VIRGINIA

VOELKER，TONI

FROMAN，BRYON

＜120〉derive from the fatty acid dehydrogenase of fungi

<130>MONS：021WO

<140>PCT/US03/16144

<141>2003-05-21

<150>60/453,125

<151>2003-03-07

<150>60/382,391

<151>2002-05-22

<160>43

<170>PatentIn?Ver.2.1

<210>1

<211>2125

<212>DNA

＜213〉Neurospora crassa

<400>1

gagcctcttc?gttttcctcc?catcaccaat?ttctttttct?gaaagaggtg?tgtcgagtgt?60

gagttgaacc?tcaggtcttc?ttccacacta?cctctaccct?cctcttccta?ccctctttct?120

tcacttcttg?gatatcctca?agaaatatca?ccacacccaa?caaacatgac?ggtcaccacc?180

cgcagccaca?aggccgcggc?cgccaccgag?cccgaggttg?tcagcaccgg?cgttgacgcc?240

gtctctgctg?ctgctccctc?ctcctcctcc?tcctcttcca?gccaaaagtc?ggccgagccc?300

atcgaatacc?ccgacatcaa?gaccatccgc?gacgccatcc?ccgaccactg?cttccgcccg?360

cgcgtctgga?tctccatggc?ctacttcatc?cgcgacttcg?ccatggcctt?tggcctcggc?420

tacctcgcct?ggcagtacat?ccccctgatc?gcctccaccc?cgctccgcta?cggcgcctgg?480

gctctgtacg?gctacctcca?gggtctcgtc?tgcacgggcatctggattct?ggcgcacgag??540

tgcggccacg?gcgccttctc?gaggcacacg?tggttcaaca?acgtcatggg?gtggattggc?600

cactccttcc?tcttggtccc?ttacttcagc?tggaagttca?gccaccatcg?ccaccatcgc?660

ttcaccggcc?acatggagaa?ggacatggcg?tttgtgcctg?ccaccgaggc?tgatcgcaac?720

cagaggaagc?tggccaactt?gtacatggac?aaggagacgg?ccgagatgtt?tgaggatgtg?780

cccattgtcc?agctcgtcaa?gctcatcgcc?caccagctgg?ccggctggca?gatgtacctc?840

ctcctcaacg?tctccgccgg?taagggcagc?aagcagtggg?agactggcaa?gggcggcatg?900

ggctggttga?gggttagcca?ctttgagcct?tcctctgctg?tgttccgcaa?ctccgaggcc?960

atctacattg?ccctgtccga?tcttggtctc?atgatcatgg?gctatatcct?ctaccaggcc?1020

gcgcaggttg?ttggctggca?gatggtaggt?ctgctgtact?tccagcagta?cttctgggtt?1080

caccattggt?tgggtaagtt?gtctctcgcc?catttcgcct?ctgtctggtg?gttcttgtga?1140

tctttgtgga?attagcgcac?taactctcgc?tccctctcaa?aacagtcgcc?atcacttacc?1200

tccaccacac?ccacgaggaa?gtccaccact?ttgacgccga?ctcgtggacc?ttcgtcaagg?1260

gcgctctcgc?caccgtcgac?cgcgattttg?gcttcattgg?caagcacctc?ttccacaaca?1320

ttatcgacca?ccacgtcgtc?caccacttgt?tcccgtaagt?cttcagatca?gatatccctg?1380

ctattttctc?atttaaaacc?atcccctcaa?tgtccctcgc?taacgcccca?aatcctgcac?1440

agtcgcatcc?ccttctacta?cgccgaagaa?gccaccaact?cgatccgccc?catgctcggc?1500

cccctctacc?accgcgacga?ccgctccttc?atgggccagc?tgtggtacaa?cttcacccac?1560

tgcaagtggg?tcgttccgga?cccccaggtc?cccggcgcgc?ttatttgggc?gcacaccgtt?1620

cagagcaccc?agtaagcagt?tcttttctgc?ttcctggggc?actctgagga?ggctacctac?1680

ctacctaggt?actcgagtgc?tggctgctgc?cctggtttag?tgctacctac?ttcggtagct?1740

ctaaccggta?ccagaagaac?gatgttggaa?aaaaggaggg?agaaagactg?gaagaaaagg?1800

aaaacaaaga?aatctcaact?cttcttcatg?attgatggat?ctgtgccacg?ttctgattgg?1860

ttcggtcggt?caaaaggcgt?acataacggt?caccattgaa?aggtctggat?aactcggtac?1920

ctggaatttc?acatcaaaca?agtgatagac?gagagagaga?gtctggtaga?atagaggtat?1980

ggtagatctg?gaagctatta?gacttactag?agctatagat?agacaaagag?gatagagcga?2040

gggtatgtgt?gtgtagaggt?agagatgcat?catagaaggg?agggcatgca?tgcatgattg?2100

aagaaccaaa?agaatgatac?ccacc???????????????????????????????????????2125

<210>2

<211>1290

<212>DNA

＜213〉Neurospora crassa

<220>

<221>CDS

<222>(1)..(1290)

<400>2

atg?acg?gtc?acc?acc?cgc?agc?cac?aag?gcc?gcg?gcc?gcc?acc?gag?ccc???48

Met?Thr?Val?Thr?Thr?Arg?Ser?His?Lys?Ala?Ala?Ala?Ala?Thr?Glu?Pro

1???????????????5??????????????????10??????????????????15

gag?gtt?gtc?agc?acc?ggc?gtt?gac?gcc?gtc?tct?gct?gct?gct?ccc?tcc???96

Glu?Val?Val?Ser?Thr?Gly?Val?Asp?Ala?Val?Ser?Ala?Ala?Ala?Pro?Ser

20??????????????????25??????????????????30

tcc?tcc?tcc?tcc?tct?tcc?agc?caa?aag?tcg?gcc?gag?ccc?atc?gaa?tac???144

Ser?Ser?Ser?Ser?Ser?Ser?Ser?Gln?Lys?Ser?Ala?Glu?Pro?Ile?Glu?Tyr

35??????????????????40??????????????????45

ccc?gac?atc?aag?acc?atc?cgc?gac?gcc?atc?ccc?gac?cac?tgc?ttc?cgc????192

Pro?Asp?Ile?Lys?Thr?Ile?Arg?Asp?Ala?Ile?Pro?Asp?His?Cys?Phe?Arg

50??????????????????55??????????????????60

ccg?cgc?gtc?tgg?atc?tcc?atg?gcc?tac?ttc?atc?cgc?gac?ttc?gcc?atg????240

Pro?Arg?Val?Trp?Ile?Ser?Met?Ala?Tyr?Phe?Ile?Arg?Asp?Phe?Ala?Met

65??????????????????70??????????????????75??????????????????80

gcc?ttt?ggc?ctc?ggc?tac?ctc?gcc?tgg?cag?tac?atc?ccc?ctg?atc?gcc????288

Ala?Phe?Gly?Leu?Gly?Tyr?Leu?Ala?Trp?Gln?Tyr?Ile?Pro?Leu?Ile?Ala

85??????????????????90??????????????????95

tcc?acc?ccg?ctc?cgc?tac?ggc?gcc?tgg?gct?ctg?tac?ggc?tac?ctc?cag????336

Ser?Thr?Pro?Leu?Arg?Tyr?Gly?Ala?Trp?Ala?Leu?Tyr?Gly?Tyr?Leu?Gln

100?????????????????105?????????????????110

ggt?ctc?gtc?tgc?acg?ggc?atc?tgg?att?ctg?gcg?cac?gag?tgc?ggc?cac????384

Gly?Leu?Val?Cys?Thr?Gly?Ile?Trp?Ile?Leu?Ala?His?Glu?Cys?Gly?His

115?????????????????120?????????????????125

ggc?gcc?ttc?tcg?agg?cac?acg?tgg?ttc?aac?aac?gtc?atg?ggg?tgg?att????432

Gly?Ala?Phe?Ser?Arg?His?Thr?Trp?Phe?Asn?Asn?Val?Met?Gly?Trp?Ile

130?????????????????135?????????????????140

ggc?cac?tcc?ttc?ctc?ttg?gtc?cct?tac?ttc?agc?tgg?aag?ttc?agc?cac????480

Gly?His?Ser?Phe?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Phe?Ser?His

145?????????????????150?????????????????155?????????????????160

cat?cgc?cac?cat?cgc?ttc?acc?ggc?cac?atg?gag?aag?gac?atg?gcg?ttt????528

His?Arg?His?His?Arg?Phe?Thr?Gly?His?Met?Glu?Lys?Asp?Met?Ala?Phe

165?????????????????170?????????????????175

gtg?cct?gcc?acc?gag?gct?gat?cgc?aac?cag?agg?aag?ctg?gcc?aac?ttg????576

Val?Pro?Ala?Thr?Glu?Ala?Asp?Arg?Asn?Gln?Arg?Lys?Leu?Ala?Asn?Leu

180?????????????????185?????????????????190

tac?atg?gac?aag?gag?acg?gcc?gag?atg?ttt?gag?gat?gtg?ccc?att?gtc????624

Tyr?Met?Asp?Lys?Glu?Thr?Ala?Glu?Met?Phe?Glu?Asp?Val?Pro?Ile?Val

195?????????????????200?????????????????205

cag?ctc?gtc?aag?ctc?atc?gcc?cac?cag?ctg?gcc?ggc?tgg?cag?atg?tac????672

Gln?Leu?Val?Lys?Leu?Ile?Ala?His?Gln?Leu?Ala?Gly?Trp?Gln?Met?Tyr

210?????????????????215?????????????????220

ctc?ctc?ttc?aac?gtc?tcc?gcc?ggt?aag?ggc?agc?aag?cag?tgg?gag?act????720

Leu?Leu?Phe?Asn?Val?Ser?Ala?Gly?Lys?Gly?Ser?Lys?Gln?Trp?Glu?Thr

225?????????????????230?????????????????235?????????????????240

ggc?aag?ggc?ggc?atg?ggc?tgg?ttg?agg?gtt?agc?cac?ttt?gag?cct?tcc????768

Gly?Lys?Gly?Gly?Met?Gly?Trp?Leu?Arg?Val?Ser?His?Phe?Glu?Pro?Ser

245?????????????????250?????????????????255

tct?gct?gtg?ttc?cgc?aac?tcc?gag?gcc?atc?tac?att?gcc?ctg?tcc?gat????816

Ser?Ala?Val?Phe?Arg?Asn?Ser?Glu?Ala?Ile?Tyr?Ile?Ala?Leu?Ser?Asp

260?????????????????265?????????????????270

ctt?ggt?ctc?atg?atc?atg?ggc?tat?atc?ctc?tac?cag?gcc?gcg?cag?gtt????864

Leu?Gly?Leu?Met?Ile?Met?Gly?Tyr?Ile?Leu?Tyr?Gln?Ala?Ala?Gln?Val

275?????????????????280?????????????????285

gtt?ggc?tgg?cag?atg?gta?ggt?ctg?ctg?tac?ttc?cag?cag?tac?ttc?tgg????912

Val?Gly?Trp?Gln?Met?Val?Gly?Leu?Leu?Tyr?Phe?Gln?Gln?Tyr?Phe?Trp

290?????????????????295?????????????????300

gtt?cac?cat?tgg?ttg?gtc?gcc?atc?act?tac?ctc?cac?cac?acc?cac?gag????960

Val?His?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?His?His?Thr?His?Glu

305?????????????????310?????????????????315?????????????????320

gaa?gtc?cac?cac?ttt?gac?gcc?gac?tcg?tgg?acc?ttc?gtc?aag?ggc?gct????1008

Glu?Val?His?His?Phe?Asp?Ala?Asp?Ser?Trp?Thr?Phe?Val?Lys?Gly?Ala

325?????????????????330?????????????????335

ctc?gcc?acc?gtc?gac?cgc?gat?ttt?ggc?ttc?att?ggc?aag?cac?ctc?ttc????1056

Leu?Ala?Thr?Val?Asp?Arg?Asp?Phe?Gly?Phe?Ile?Gly?Lys?His?Leu?Phe

340?????????????????345?????????????????350

cac?aac?att?atc?gac?cac?cac?gtc?gtc?cac?cac?ttg?ttc?cct?cgc?atc????1104

His?Asn?Ile?Ile?Asp?His?His?Val?Val?His?His?Leu?Phe?Pro?Arg?Ile

355?????????????????360?????????????????365

ccc?ttc?tac?tac?gcc?gaa?gaa?gcc?acc?aac?tcg?atc?cgc?ccc?atg?ctc????1152

Pro?Phe?Tyr?Tyr?Ala?Glu?Glu?Ala?Thr?Asn?Ser?Ile?Arg?Pro?Met?Leu

370?????????????????375?????????????????380

ggc?ccc?ctc?tac?cac?cgc?gac?gac?cgc?tcc?ttc?atg?ggc?cag?ctg?tgg????1200

Gly?Pro?Leu?Tyr?His?Arg?Asp?Asp?Arg?Ser?Phe?Met?Gly?Gln?Leu?Trp

385?????????????????390?????????????????395?????????????????400

tac?aac?ttc?acc?cac?tgc?aag?tgg?gtc?gtt?ccg?gac?ccc?cag?gtc?ccc??1248

Tyr?Asn?Phe?Thr?His?Cys?Lys?Trp?Val?Val?Pro?Asp?Pro?Gln?Val?Pro

405?????????????????410?????????????????415

ggc?gcg?ctt?att?tgg?gcg?cac?acc?gtt?cag?agc?acc?cag?taa??????????1290

Gly?Ala?Leu?Ile?Trp?Ala?His?Thr?Val?Gln?Ser?Thr?Gln

420?????????????????425?????????????????430

<210>3

<211>429

<212>PRT

＜213〉Neurospora crassa

<400>3

Met?Thr?Val?Thr?Thr?Arg?Ser?His?Lys?Ala?Ala?Ala?Ala?Thr?Glu?Pro

1???????????????5??????????????????10??????????????????15

Glu?Val?Val?Set?Thr?Gly?Val?Asp?Ala?Val?Ser?Ala?Ala?Ala?Pro?Set

20??????????????????25??????????????????30

Ser?Ser?Ser?Ser?Ser?Ser?Ser?Gln?Lys?Ser?Ala?Glu?Pro?Ile?Glu?Tyr

35??????????????????40??????????????????45

Pro?Asp?Ile?Lys?Thr?Ile?Arg?Asp?Ala?Ile?Pro?Asp?His?Cys?Phe?Arg

50??????????????????55??????????????????60

Pro?Arg?Val?Trp?Ile?Ser?Met?Ala?Tyr?Phe?Ile?Arg?Asp?Phe?Ala?Met

65??????????????????70??????????????????75??????????????????80

Ala?Phe?Gly?Leu?Gly?Tyr?Leu?Ala?Trp?Gln?Tyr?Ile?Pro?Leu?Ile?Ala

85??????????????????90??????????????????95

Ser?Thr?Pro?Leu?Arg?Tyr?Gly?Ala?Trp?Ala?Leu?Tyr?Gly?Tyr?Leu?Gln

100?????????????????105?????????????????110

Gly?Leu?Val?Cys?Thr?Gly?Ile?Trp?Ile?Leu?Ala?His?Glu?Cys?Gly?His

115?????????????????120?????????????????125

Gly?Ala?Phe?Ser?Arg?His?Thr?Trp?Phe?Asn?Ash?Val?Met?Gly?Trp?Ile

130?????????????????135?????????????????140

Gly?His?Ser?Phe?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Phe?Ser?His

145?????????????????150?????????????????155?????????????????160

His?Arg?His?His?Arg?Phe?Thr?Gly?His?Met?Glu?Lys?Asp?Met?Ala?Phe

165?????????????????170?????????????????175

Val?Pro?Ala?Thr?Glu?Ala?Asp?Arg?Asn?Gln?Arg?Lys?Leu?Ala?Asn?Leu

180?????????????????185?????????????????190

Tyr?Met?Asp?Lys?Glu?Thr?Ala?Glu?Met?Phe?Glu?Asp?Val?Pro?Ile?Val

195?????????????????200?????????????????205

Gln?Leu?Val?Lys?Leu?Ile?Ala?His?Gln?Leu?Ala?Gly?Trp?Gln?Met?Tyr

210?????????????????215?????????????????220

Leu?Leu?Phe?Asn?Val?Ser?Ala?Gly?Lys?Gly?Ser?Lys?Gln?Trp?Glu?Thr

225?????????????????230?????????????????235?????????????????240

Gly?Lys?Gly?Gly?Met?Gly?Trp?Leu?Arg?Val?Ser?His?Phe?Glu?Pro?Ser

245?????????????????250?????????????????255

Ser?Ala?Val?Phe?Arg?Ash?Ser?Glu?Ala?Ile?Tyr?Ile?Ala?Leu?Ser?Asp

260?????????????????265?????????????????270

Leu?Gly?Leu?Met?Ile?Met?Gly?Tyr?Ile?Leu?Tyr?Gln?Ala?Ala?Gln?Mal

275?????????????????280?????????????????285

Val?Gly?Trp?Gln?Met?Val?Gly?Leu?Leu?Tyr?Phe?Gln?Gln?TyrPhe?Trp

290?????????????????295?????????????????300

Mal?His?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?His?His?Thr?His?Glu

305?????????????????310?????????????????315?????????????????320

Glu?Val?His?His?Phe?Asp?Ala?Asp?Ser?Trp?Thr?Phe?Val?Lys?Gly?Ala

325?????????????????330?????????????????335

Leu?Ala?Thr?Val?Asp?Arg?Asp?Phe?Gly?Phe?Ile?Gly?Lys?His?Leu?Phe

340?????????????????345?????????????????350

His?Asn?Ile?Ile?Asp?His?His?Val?Val?His?His?Leu?Phe?Pro?Arg?Ile

355?????????????????360?????????????????365

Pro?Phe?Tyr?Tyr?Ala?Glu?Glu?Ala?Thr?Asn?Ser?Ile?Arg?Pro?Met?Leu

370?????????????????375?????????????????380

Gly?Pro?Leu?Tyr?His?Arg?Asp?Asp?Arg?Ser?Phe?Met?Gly?Gln?Leu?Trp

385?????????????????390?????????????????395?????????????????400

Tyr?Asn?Phe?Thr?His?Cys?Lys?Trp?Mal?Val?Pro?Asp?Pro?Gln?Val?Pro

405?????????????????410?????????????????415

Gly?Ala?Leu?Ile?Trp?Ala?His?Thr?Val?Gln?Ser?Thr?Gln

420?????????????????425

<210>4

<211>1206

<212>DNA

＜213〉aspergillus nidulans

<220>

<221>CDS

<222>(1)..(1206)

<400>4

atg?gct?gca?act?gca?aca?acc?cta?gca?gag?att?gaa?aag?aaa?aaa?gaa???48

Met?Ala?Ala?Thr?Ala?Thr?Thr?Leu?Ala?Glu?lle?Glu?Lys?Lys?Lys?Glu

1???????????????5??????????????????10??????????????????15

gaa?ata?act?ctg?cag?aca?atc?aaa?aat?gcg?att?ccc?aaa?cac?tgc?ttc???96

Glu?Ile?Thr?Leu?Gln?Thr?Ile?Lys?Asn?Ala?Ile?Pro?Lys?His?Cys?Phe

20??????????????????25??????????????????30

aac?cgc?tct?ctc?ctc?att?tcc?tct?gcc?tac?gtc?gtc?cgc?gat?ctc?ctc????144

Asn?Arg?Ser?Leu?Leu?Ile?Ser?Ser?Ala?Tyr?Val?Val?Arg?Asp?Leu?Leu

35??????????????????40??????????????????45

tac?gcc?tcc?gtc?ctc?ttc?tac?ttt?gcc?ctg?cac?att?gac?acc?ctc?ttt????192

Tyr?Ala?Ser?Val?Leu?Phe?Tyr?Phe?Ala?Leu?His?Ile?Asp?Thr?Leu?Phe

50??????????????????55??????????????????60

tcc?tcg?caa?ctc?ctc?cgc?atc?ctc?gcc?tgg?acc?gcc?tac?ggt?ttc?atg????240

Ser?Ser?Gln?Leu?Leu?Arg?Ile?Leu?Ala?Trp?Thr?Ala?Tyr?Gly?Phe?Met

65??????????????????70??????????????????75??????????????????80

caa?ggc?tgc?gtc?ggc?acc?gga?atc?tgg?atc?ctc?gca?cac?gaa?tgc?ggc????288

Gln?Gly?Cys?Val?Gly?Thr?Gly?Ile?Trp?Ile?Leu?Ala?His?Glu?Cys?Gly

85??????????????????90??????????????????95

cat?gga?gct?ttc?tcc?cca?tac?caa?acg?tgg?aac?gat?gtc?gtc?gga?tgg????336

His?Gly?Ala?Phe?Ser?Pro?Tyr?Gln?Thr?Trp?Asn?Asp?Val?Val?Gly?Trp

100?????????????????105?????????????????110

aca?ttg?cac?tcc?ctc?ctg?atg?gtc?ccg?tat?ttc?agc?tgg?aag?atc?acg????384

Thr?Leu?His?Ser?Leu?Leu?Met?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Ile?Thr

115?????????????????120?????????????????125

cac?gct?cga?cac?cac?cgg?tac?aca?aac?aac?aca?gag?cga?gat?aca?gca????432

His?Ala?Arg?His?His?Arg?Tyr?Thr?Asn?Asn?Thr?Glu?Arg?Asp?Thr?Ala

130?????????????????135?????????????????140

ttt?gtc?ccc?tgg?aca?gag?aag?gaa?tac?gac?act?cgc?ccg?cgc?tac?ttc????480

Phe?Val?Pro?Trp?Thr?Glu?Lys?Glu?Tyr?Asp?Thr?Arg?Pro?Arg?Tyr?Phe

145?????????????????150?????????????????155?????????????????160

cct?gcc?tgg?ttt?gag?atg?ttt?gag?gac?acg?ccc?gtc?tac?aac?ctt?att????528

Pro?Ala?Trp?Phe?Glu?Met?Phe?Glu?Asp?Thr?Pro?Val?Tyr?Asn?Leu?Ile

165?????????????????170?????????????????175

agc?cta?ctg?gcg?cat?cag?atc?gca?gga?tgg?cag?atg?tat?ctc?tgt?ttt????576

Ser?Leu?Leu?Ala?His?Gln?Ile?Ala?Gly?Trp?Gln?Met?Tyr?Leu?Cys?Phe

180?????????????????185?????????????????190

tac?gtt?agc?gcc?ggc?gca?aag?agt?aag?cct?gta?ccg?cag?gga?aaa?cag????624

Tyr?Val?Ser?Ala?Gly?Ala?Lys?Ser?Lys?Pro?Val?Pro?Gln?Gly?Lys?Gln

195?????????????????200?????????????????205

agc?ggg?tgg?ttt?gga?ggc?cag?cag?agc?gcc?agc?cac?ttt?gat?ccg?ggc????672

Ser?Gly?Trp?Phe?Gly?Gly?Gln?Gln?Ser?Ala?Ser?His?Phe?Asp?Pro?Gly

210?????????????????215?????????????????220

agt?tcg?ctg?tgg?acg?gaa?aac?cag?cgg?cat?ctg?att?gcg?att?tcg?gac????720

Ser?Ser?Leu?Trp?Thr?Glu?Asn?Gln?Arg?His?Leu?Ile?Ala?Ile?Ser?Asp

225?????????????????230?????????????????235?????????????????240

ctg?ggg?ttg?ctg?ctt?gtt?gcg?gcg?gca?aat?tgg?tac?ctt?gcg?cag?caa????768

Leu?Gly?Leu?Leu?Leu?Val?Ala?Ala?Ala?Asn?Trp?Tyr?Leu?Ala?Gln?Gln

245?????????????????250?????????????????255

gtg?ggc?gtg?ctc?cgc?atg?gtg?ctg?atc?tat?gtt?gtg?ccg?tac?ttc?tgg????816

Val?Gly?Val?Leu?Arg?Met?Val?Leu?Ile?Tyr?Val?Val?Pro?Tyr?Phe?Trp

260?????????????????265?????????????????270

gtg?cac?cat?tgg?ctt?gtg?gcg?atc?acg?tac?ctc?cac?cac?aca?cac?ccc????864

Val?His?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?His?His?Thr?His?Pro

275?????????????????280?????????????????285

tcg?atc?ccg?cac?tac?act?gat?agc?acc?tgg?acg?ttc?acc?aaa?ggc?gct????912

Ser?Ile?Pro?His?Tyr?Thr?Asp?Ser?Thr?Trp?Thr?Phe?Thr?Lys?Gly?Ala

290?????????????????295?????????????????300

ctg?tcc?acc?gtc?gac?cgc?gac?ttc?ggt?ttc?atc?ggg?cgg?cat?ttc?ttc????960

Leu?Ser?Thr?Val?Asp?Arg?Asp?Phe?Gly?Phe?Ile?Gly?Arg?His?Phe?Phe

305?????????????????310?????????????????315?????????????????320

cac?cat?atc?att?gac?cac?cat?gtc?gtg?cat?cac?ttg?ttt?aac?cgg?atc????1008

His?His?Ile?Ile?Asp?His?His?Val?Val?His?His?Leu?Phe?Asn?Arg?Ile

325?????????????????330?????????????????335

ccg?ttc?tac?cat?gcc?gag?gag?gcg?act?aat?gcc?att?att?ccc?gta?ctc????1056

Pro?Phe?Tyr?His?Ala?Glu?Glu?Ala?Thr?Asn?Ala?Ile?Ile?Pro?Val?Leu

340?????????????????345?????????????????350

ggg?gac?atg?tat?cat?cgc?gaa?gag?acc?ggc?ttc?ttg?tgg?agt?tta?atg????1104

Gly?Asp?Met?Tyr?His?Arg?Glu?Glu?Thr?Gly?Phe?Leu?Trp?Ser?Leu?Met

355?????????????????360?????????????????365

gag?acg?tac?aag?aac?tgt?cgg?ttt?gta?ggc?gtt?gaa?aat?gat?gtt?gga????1152

Glu?Thr?Tyr?Lys?Asn?Cys?Arg?Phe?Val?Gly?Val?Glu?Asn?Asp?Val?Gly

370?????????????????375?????????????????380

aag?gag?ggc?gtt?ttg?cat?tgg?gtt?ttt?gag?gag?aag?aag?ggt?gcc?aaa??1200

Lys?Glu?Gly?Val?Leu?His?Trp?Val?Phe?Glu?Glu?Lys?Lys?Gly?Ala?Lys

385?????????????????390?????????????????395?????????????????400

gcg?gaa??????????????????????????????????????????????????????????1206

Ala

<210>5

<211>401

<212>PRT

＜213〉aspergillus nidulans

<400>5

Met?Ala?Ala?Thr?Ala?Thr?Thr?Leu?Ala?Glu?Ile?Glu?Lys?Lys?Lys?Glu

1???????????????5??????????????????10??????????????????15

Glu?Ile?Thr?Leu?Gln?Thr?Ile?Lys?Asn?Ala?Ile?Pro?Lys?His?Cys?Phe

20??????????????????25??????????????????30

Asn?Arg?Ser?Leu?Leu?Ile?Ser?Ser?Ala?Tyr?Val?Val?Arg?Asp?Leu?Leu

35??????????????????40??????????????????45

Tyr?Ala?Ser?Val?Leu?Phe?Tyr?Phe?Ala?Leu?His?Ile?Asp?Thr?Leu?Phe

50??????????????????55??????????????????60

Ser?Ser?Gln?Leu?Leu?Arg?lle?Leu?Ala?Trp?Thr?Ala?Tyr?Gly?Phe?Met

65??????????????????70??????????????????75??????????????????80

Gln?Gly?Cys?Val?Gly?Thr?Gly?lle?Trp?lle?Leu?Ala?His?Glu?Cys?Gly

85??????????????????90??????????????????95

His?Gly?Ala?Phe?Ser?Pro?Tyr?Gln?Thr?Trp?Asn?Asp?Val?Val?Gly?Trp

100?????????????????105?????????????????110

Thr?Leu?His?Ser?Leu?Leu?Met?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Ile?Thr

115?????????????????120?????????????????125

His?Ala?Arg?His?His?Arg?Tyr?Thr?Asn?Asn?Thr?Glu?Arg?Asp?Thr?Ala

130?????????????????135?????????????????140

Phe?Val?Pro?Trp?Thr?Glu?Lys?Glu?Tyr?Asp?Thr?Arg?Pro?Arg?Tyr?Phe

145?????????????????150?????????????????155?????????????????160

Pro?Ala?Trp?Phe?Glu?Met?Phe?Glu?Asp?Thr?Pro?Val?Tyr?Asn?Leu?Ile

165?????????????????170?????????????????175

Ser?Leu?Leu?Ala?His?Gln?Ile?Ala?Gly?Trp?Gln?Met?Tyr?Leu?Cys?Phe

180?????????????????185?????????????????190

Tyr?Val?Ser?Ala?Gly?Ala?Lys?Ser?Lys?Pro?Val?Pro?Gln?Gly?Lys?Gln

195?????????????????200?????????????????205

Ser?Gly?Trp?Phe?Gly?Gly?Gln?Gln?Ser?Ala?Ser?His?Phe?Asp?Pro?Gly

210?????????????????215?????????????????220

Ser?Ser?Leu?Trp?Thr?Glu?Asn?Gln?Arg?His?Leu?Ile?Ala?Ile?Ser?Asp

225?????????????????230?????????????????235?????????????????240

Leu?Gly?Leu?Leu?Leu?Val?Ala?Ala?Ala?Asn?Trp?Tyr?Leu?Ala?Gln?Gln

245?????????????????250?????????????????255

Val?Gly?Val?Leu?Arg?Met?Val?Leu?lle?Tyr?Val?Val?Pro?Tyr?Phe?Trp

260?????????????????265?????????????????270

Val?His?His?Trp?Leu?Val?Ala?lle?Thr?Tyr?Leu?His?His?Thr?His?Pro

275?????????????????280?????????????????285

Ser?Ile?Pro?His?Tyr?Thr?Asp?Ser?Thr?Trp?Thr?Phe?Thr?Lys?Gly?Ala

290?????????????????295?????????????????300

Leu?Ser?Thr?Val?Asp?Arg?Asp?Phe?Gly?Phe?lle?Gly?Arg?His?Phe?Phe

305?????????????????310?????????????????315?????????????????320

His?His?Ile?lle?Asp?His?His?Val?Val?His?His?Leu?Phe?ASh?Arg?Ile

325?????????????????330?????????????????335

Pro?Phe?Tyr?His?Ala?Glu?Glu?Ala?Thr?Asn?Ala?Ile?Ile?Pro?Val?Leu

340?????????????????345?????????????????350

Gly?Asp?Met?Tyr?His?Arg?Glu?Glu?Thr?Gly?Phe?Leu?Trp?Ser?Leu?Met

355?????????????????360?????????????????365

Glu?Thr?Tyr?Lys?Asn?Cys?Arg?Phe?Val?Gly?Val?Glu?Ash?Asp?Val?Gly

370?????????????????375?????????????????380

Lys?Glu?Gly?Val?Leu?His?Trp?Val?Phe?Glu?Glu?Lys?Lys?Gly?Ala?Lys

385?????????????????390?????????????????395?????????????????400

Ala

<210>6

<211>13

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>6

Trp?Ile?Leu?Ala?His?Glu?Cys?Gly?His?Gly?Ala?Ser?Phe

1???????????????5??????????????????10

<210>7

<211>7

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>7

Leu?Ala?His?Glu?Cys?Gly?His

1???????????????5

<210>8

<211>12

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>8

His?Ser?Phe?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys

1???????????????5??????????????????10

<210>9

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>9

Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys

1???????????????5

<210>10

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>10

His?His?Arg?His?His?Arg?Phe?Thr?Thr

1???????????????5

<210>11

<211>16

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>11

Trp?Val?His?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?His?His?Thr?His

1???????????????5??????????????????10??????????????????15

<210>12

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>12

Ala?Ile?Thr?Tyr?Leu?His?Gln?His?Thr

1???????????????5

<210>13

<211>8

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>13

Gly?Ala?Leu?Ala?Thr?Val?Asp?Arg

1???????????????5

<210>14

<211>13

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>14

His?Val?Val?His?His?Leu?Phe?Xaa?Arg?Ile?Pro?Phe?Tyr

1???????????????5?????????????????10

<210>15

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>15

aagatggcgt?ccgtctcctc?tgcccttccc?????????????????????????????????30

<210>16

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>16

ttagttggtt?ttggggagct?tggcaggctt?g????????????????????????????????31

<210>17

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>17

gcggccgcaa?catgacggtc?accacccgca?gcca?????????????????????????????34

<210>18

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>18

cctgcaggtt?actgggtgct?ctgaacggtg?tgcg?????????????????????????????34

<210>19

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>19

His?His?Arg?His?His?Arg?Tyr?Thr?Thr

1???????????????5

<210>20

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>20

His?Ala?Arg?His?His?Arg?Phe?Thr?Thr

1???????????????5

<210>21

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>21

His?Ala?Arg?His?His?Arg?Tyr?Thr?Thr

1???????????????5

<210>22

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic peptide

<400>22

Trp?Val?His?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?Gln?His?Thr

1???????????????5??????????????????10??????????????????15

<210>23

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>23

aatatggctg?caactgcaac?aaccc???????????????????????????????????????25

<210>24

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>24

ttccgctttg?gcacccttct?tc??????????????????????????????????????????22

<210>25

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>25

gtcgacacca?tggcctctac?cactgctctc??????????????????????????????????30

<210>26

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>26

ctgcagtgcc?ttgagcttca?ttggtggtgt?a????????????????????????????????31

<210>27

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<220>

<221>modified_base

<222>(7)..(12)

<223>N＝A，C，G，or?T/U

<220>

＜223〉artificial sequence description: synthetic primer

<400>27

gccrtgnccr?caytcrtgng?cnagdat????????????????????????????????????27

<210>28

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>28

acgatgactc?tcgattacac?aagtcacccg??????????????????????????????????30

<210>29

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>29

gtcgacacga?tgactctcga?ttacacaagt?cacc????????????????????????????34

<210>30

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>30

ctgcagaatg?cttgagctat?cagcagatcc?caa??????????????????????????????33

<210>31

<211>1428

<212>DNA

＜213〉gray botrytis

<400>31

atggcctcta?ccactgctct?cccaaagcgc?accgccgttc?aaagaacggt?gacctcctcc?60

actgccgaat?cagctccctc?gacagctgcc?ggttccccca?atgatacccc?aagacaatcc?120

ccctcgtcta?cttctctgtc?atctatgtca?tctctaggcg?aagatgttaa?gagcaccaag?180

ccatatggca?aactcatcga?tacttacgga?aacgaatttg?agcttccaga?ttataccgtc?240

aatgacatcc?gtaacgcaat?tccaaagcat?tgttacgagc?gatctggagt?aaggggtttg?300

gcttatgttg?ctcgcgatat?tgccagctta?gccaccacat?tcttcctctt?caacaaatac?360

cttacaccag?aaaacgttcc?ctcaactyca?gcgcgcgctg?tgctgtgggc?tttatacacc?420

gttgttcagg?gtttgtttgg?tactggtctc?tgggttcttg?ctcatgagtg?tggccatcaa?480

tctttctcga?cttcaaaggt?cttgaacgat?acaactggat?ggatctgcca?ctctgctctt?540

ctcgtcccat?acttttcatg?gaagatctct?cacggcaagc?atcacaaagc?tactggcaac?600

atggagcgtg?atatggtttt?cgttccaaag?acccgtcaag?attatgctac?ccgcgtcggc?660

aagttcgttc?atgagcttca?cgagctcacc?gaggagactc?caatcgcaac?tcttattcac?720

tccatcggac?aacaacttgc?tggctggcct?ttgtacttat?tcatgaacgt?caccggtcac?780

aacaaccatg?agcgtcaaca?tgagggtcgt?ggaaagggta?aggtcaacag?tttctggacc?840

gtcagtcact?tcaacccagc?cagtcctctt?tatgaagcta?aggatgccaa?attgatcttg?900

ttgagtgatc?tcggtatcgc?catcaccgcc?gctgtcctta?tcatgcttag?caagacatac?960

ggattttaca?acatggctat?ctggtacttc?attccatacc?tctgggtaaa?ccactggctt?1020

gttgctatca?ccttcctcca?acacaccgac?ccaactcttc?ctcactactc?tggcgagagc?1080

tggaactatg?ttcgtggagc?cgcagcaacc?atcgatcgtg?aattcggatt?catcggacgc?1140

actcttcttc?acggtatcat?cgagacccac?gttcttcacc?actacgtcag?caccattcct?1200

ttctaccacg?ccgatgaggc?taccgaggcc?atcaagccta?tcatgggtcg?tcactacaga?1260

gccgatgttc?gaggcggatc?ccttggattt?ttgaagagct?tgtggtccag?cgctcgttgg?1320

tgccagtggg?tcgagccatc?tgagggtgct?gaaggtgagg?gcaagaaggt?attcttcttc?1380

cgtaaccgca?atggactcgg?tacaccacca?atgaagctca?aggcataa??????????????1428

<210>32

<211>475

<212>PRT

＜213〉gray botrytis

<400>32

Met?Ala?Ser?Thr?Thr?Ala?Leu?Pro?Lys?Arg?Thr?Ala?Val?Gln?Arg?Thr

1???????????????5??????????????????10??????????????????15

Val?Thr?Ser?Ser?Thr?Ala?Glu?Ser?Ala?Pro?Ser?Thr?Ala?Ala?Gly?Ser

20??????????????????25??????????????????30

Pro?Asn?Asp?Thr?Pro?Arg?Gln?Ser?Pro?Ser?Ser?Thr?Ser?Leu?Ser?Ser

35??????????????????40??????????????????45

Met?Ser?Ser?Leu?Gly?Glu?Asp?Val?Lys?Ser?Thr?Lys?Pro?Tyr?Gly?Lys

50??????????????????55??????????????????60

Leu?Ile?Asp?Thr?Tyr?Gly?Asn?Glu?Phe?Glu?Leu?Pro?Asp?Tyr?Thr?Val

65??????????????????70??????????????????75??????????????????80

Asn?Asp?Ile?Arg?Asn?Ala?Ile?Pro?Lys?His?Cys?Tyr?Glu?Arg?Ser?Gly

85??????????????????90??????????????????95

Val?Arg?Gly?Leu?Ala?Tyr?Val?Ala?Arg?Asp?Ile?Ala?Ser?Leu?Ala?Thr

100?????????????????105?????????????????110

Thr?Phe?Phe?Leu?Phe?Asn?Lys?Tyr?Leu?Thr?Pro?Glu?Asn?Val?Pro?Ser

115?????????????????120?????????????????125

Thr?Xaa?Ala?Arg?Ala?Val?Leu?Trp?Ala?Leu?Tyr?Thr?Val?Val?Gln?Gly

130?????????????????135?????????????????140

Leu?Phe?Gly?Thr?Gly?Leu?Trp?Val?Leu?Ala?His?Glu?Cys?Gly?His?Gln

145?????????????????150?????????????????155?????????????????160

Ser?Phe?Ser?Thr?Ser?Lys?Val?Leu?Asn?Asp?Thr?Thr?Gly?Trp?Ile?Cys

165?????????????????170?????????????????175

His?Ser?Ala?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Ile?Ser?His?Gly

180?????????????????185?????????????????190

Lys?His?His?Lys?Ala?Thr?Gly?Asn?Met?Glu?Arg?Asp?Met?Val?Phe?Val

195?????????????????200?????????????????205

Pro?Lys?Thr?Arg?Gln?Asp?Tyr?Ala?Thr?Arg?Val?Gly?Lys?Phe?Val?His

210?????????????????215?????????????????220

Glu?Leu?His?Glu?Leu?Thr?Glu?Glu?Thr?Pro?Ile?Ala?Thr?Leu?Ile?His

225?????????????????230?????????????????235?????????????????240

Ser?Ile?Gly?Gln?Gln?Leu?Ala?Gly?Trp?Pro?Leu?Tyr?Leu?Phe?Met?Asn

245?????????????????250?????????????????255

Val?Thr?Gly?His?Asn?Asn?His?Glu?Arg?Gln?His?Glu?Gly?Arg?Gly?Lys

260?????????????????265?????????????????270

Gly?Lys?Val?Asn?Ser?Phe?Trp?Thr?Val?Ser?His?Phe?Asn?Pro?Ala?Ser

275?????????????????280?????????????????285

Pro?Leu?Tyr?Glu?Ala?Lys?Asp?Ala?Lys?Leu?Ile?Leu?Leu?Ser?Asp?Leu

290?????????????????295?????????????????300

Gly?Ile?Ala?Ile?Thr?Ala?Ala?Val?Leu?Ile?Met?Leu?Ser?Lys?Thr?Tyr

305?????????????????310?????????????????315?????????????????320

Gly?Phe?Tyr?Asn?Met?Ala?Ile?Trp?Tyr?Phe?Ile?Pro?Tyr?Leu?Trp?Val

325?????????????????330?????????????????335

Asn?His?Trp?Leu?Val?Ala?Ile?Thr?Phe?Leu?Gln?His?Thr?Asp?Pro?Thr

340?????????????????345?????????????????350

Leu?Pro?His?Tyr?Ser?Gly?Glu?Ser?Trp?Asn?Tyr?Val?Arg?Gly?Ala?Ala

355?????????????????360?????????????????365

Ala?Thr?Ile?Asp?Arg?Glu?Phe?Gly?Phe?Ile?Gly?Arg?Thr?Leu?Leu?His

370?????????????????375?????????????????380

Gly?Ile?Ile?Glu?Thr?His?Val?Leu?His?His?Tyr?Val?Ser?Thr?Ile?Pro

385?????????????????390????????????????395?????????????????400

Phe?Tyr?His?Ala?Asp?Glu?Ala?Thr?Glu?Ala?Ile?Lys?Pro?Ile?Met?Gly

405?????????????????410?????????????????415

Arg?His?Tyr?Arg?Ala?Asp?Val?Arg?Gly?Gly?Ser?Leu?Gly?Phe?Leu?Lys

420?????????????????425?????????????????430

Ser?Leu?Trp?Ser?Ser?Ala?Arg?Trp?Cys?Gln?Trp?Val?Glu?Pro?Ser?Glu

435?????????????????440?????????????????445

Gly?Ala?Glu?Gly?Glu?Gly?Lys?Lys?Val?Phe?Phe?Phe?Arg?Asn?Arg?Asn

450?????????????????455?????????????????460

Gly?Leu?Gly?Thr?Pro?Pro?Met?Lys?Leu?Lys?Ala

465?????????????????470?????????????????475

<210>33

<211>1293

<212>DNA

＜213〉gray botrytis

<400>33

atgactctcg?attacacaag?tcacccggcg?gagctggtca?aaggagggga?ggtccctaca?60

aaccctaaag?tgactgtcaa?ggatttgcgc?aatgcgattc?ctgagcactg?cttcaagcca?120

tcttacaagc?tttcattttg?gtaccttttc?agagacctat?ttgttgctac?aataacggtg?180

gttgtagcat?atttatatat?acctcgaatc?gagactaacg?tgcttcgtta?tgcggcttgg?240

gctacttatg?gagttattca?aggactaacg?gctactggca?tctgggtact?tggccatgag?300

tgtggacact?ctgcattctc?cccgtccgac?attttgaatg?atactctggg?ctggattctg?360

cattctgctc?tcctcacgcc?ctacttctcc?tggcaatcta?gccatcgacg?ccatcatata?420

tatgcaaatc?atttggtaaa?agaccacaac?tacgtgcccc?taccaaagga?tgagtatgcc?480

gcgctcttat?ctgttgacgt?tagtcgacta?gaagagctta?ctgaggattc?tcccatttac?540

acattactac?gcatagtagc?acaacatctc?ttcggttttc?cattgtacct?tacagcgaac?600

atcactgcat?ctcaaggttc?actgaatcag?gctcaatcca?aaaatattct?aggcaacagt?660

cacttctcac?cagcaagcac?actatttcgt?cccgaggaat?cacatctcat?tattctttcg?720

gatattggca?ttggccttgt?cgtgtttgga?ctttggtacg?ctagccaaat?atttggtgga?780

tccatgattg?cattgttgta?tcttcaacct?tatctctggg?tcaaccactg?gattgtcgct?840

atcacctatc?tgcatcatac?acaccctgat?gtacccaaat?acgaaccgga?agcatggaca?900

tttcttaaag?gtgcacttgc?aacagttgat?cgggagctgg?ggtgggtggg?aaagcacatg?960

ctacacaaca?ttgccgagtt?ccatgttatt?caccacctat?tttcacgtat?ccctcaatat?1020

cacgctgagg?aagcgaccaa?ggctattatg?ccattgctga?aaagctctta?ccgtagtgat?1080

aagaagcgaa?acttttggat?gtgtatgtgg?gagtctttta?ctaagtgcca?gtacgttgtt?1140

ccatatgacg?ttaaggctaa?gctagaagat?cgtacaatgg?tctacaaggg?tggtccaacg?1200

ccaacctcag?agatctttat?gaggaagaaa?ggatgggtca?aggaggtgaa?tcagagtaaa?1260

cagttgggat?ctgctgatag?ctcaagcatt?tga??????????????????????????????1293

<210>34

<211>430

<212>PRT

＜213〉gray botrytis

<400>34

Met?Thr?Leu?Asp?Tyr?Thr?Ser?His?Pro?Ala?Glu?Leu?Val?Lys?Gly?Gly

1???????????????5??????????????????10??????????????????15

Glu?Val?Pro?Thr?Asn?Pro?Lys?Val?Thr?Val?Lys?Asp?Leu?Arg?Asn?Ala

20??????????????????25??????????????????30

Ile?Pro?Glu?His?Cys?Phe?Lys?Pro?Ser?Tyr?Lys?Leu?Ser?Phe?Trp?Tyr

35??????????????????40??????????????????45

Leu?Phe?Arg?Asp?Leu?Phe?Val?Ala?Thr?Ile?Thr?Val?Val?Val?Ala?Tyr

50??????????????????55??????????????????60

Leu?Tyr?Ile?Pro?Arg?Ile?Glu?Thr?Ash?Val?Leu?Arg?Tyr?Ala?Ala?Trp

65??????????????????70??????????????????75??????????????????80

Ala?Thr?Tyr?Gly?Val?Ile?Gln?Gly?Leu?Thr?Ala?Thr?Gly?Ile?Trp?Val

85??????????????????90??????????????????95

Leu?Gly?His?Glu?Cys?Gly?His?Ser?Ala?Phe?Ser?Pro?Ser?Asp?Ile?Leu

100?????????????????105?????????????????110

Asn?Asp?Thr?Leu?Gly?Trp?Ile?Leu?His?Ser?Ala?Leu?Leu?Thr?Pro?Tyr

115?????????????????120?????????????????125

Phe?Ser?Trp?Gln?Ser?Ser?His?Arg?Arg?His?His?Ile?Tyr?Ala?Ash?His

130?????????????????135?????????????????140

Leu?Val?Lys?Asp?His?Asn?Tyr?Val?Pro?Leu?Pro?Lys?Asp?Glu?Tyr?Ala

145?????????????????150?????????????????155?????????????????160

Ala?Leu?Leu?Ser?Val?Asp?Val?Ser?Arg?Leu?Glu?Glu?Leu?Thr?Glu?Asp

165?????????????????170?????????????????175

Ser?Pro?Ile?Tyr?Thr?Leu?Leu?Arg?Ile?Val?Ala?Gln?His?Leu?Phe?Gly

180?????????????????185?????????????????190

Phe?Pro?Leu?Tyr?Leu?Thr?Ala?Asn?Ile?Thr?Ala?Ser?Gln?Gly?Ser?Leu

195?????????????????200?????????????????205

Asn?Gln?Ala?Gln?Ser?Lys?Asn?Ile?Leu?Gly?Asn?Ser?His?Phe?Ser?Pro

210?????????????????215?????????????????220

Ala?Ser?Thr?Leu?Phe?Arg?Pro?Glu?Glu?Ser?His?Leu?Ile?Ile?Leu?Ser

225?????????????????230?????????????????235?????????????????240

Asp?Ile?Gly?Ile?Gly?Leu?Val?Val?Phe?Gly?Leu?Trp?Tyr?Ala?Ser?Gln

245?????????????????250?????????????????255

Ile?Phe?Gly?Gly?Ser?Met?Ile?Ala?Leu?Leu?Tyr?Leu?Gln?Pro?Tyr?Leu

260?????????????????265?????????????????270

Trp?Val?Asn?His?Trp?Ile?Val?Ala?Ile?Thr?Tyr?Leu?His?His?Thr?His

275?????????????????280?????????????????285

Pro?Asp?Val?Pro?Lys?Tyr?Glu?Pro?Glu?Ala?Trp?Thr?Phe?Leu?Lys?Gly

290?????????????????295?????????????????300

Ala?Leu?Ala?Thr?Val?Asp?Arg?Glu?Leu?Gly?Trp?Val?Gly?Lys?His?Met

305?????????????????310?????????????????315?????????????????320

Leu?His?Asn?Ile?Ala?Glu?Phe?His?Val?Ile?His?His?Leu?Phe?Ser?Arg

325?????????????????330?????????????????335

Ile?Pro?Gln?Tyr?His?Ala?Glu?Glu?Ala?Thr?Lys?Ala?Ile?Met?Pro?Leu

340?????????????????345?????????????????350

Leu?Lys?Ser?Ser?Tyr?Arg?Ser?Asp?Lys?Lys?Arg?Asn?Phe?Trp?Met?Cys

355?????????????????360?????????????????365

Met?Trp?Glu?Ser?Phe?Thr?Lys?Cys?Gln?Tyr?Val?Val?Pro?Tyr?Asp?Val

370?????????????????375?????????????????380

Lys?Ala?Lys?Leu?Glu?Asp?Arg?Thr?Met?Val?Tyr?Lys?Gly?Gly?Pro?Thr

385?????????????????390?????????????????395?????????????????400

Pro?Thr?Ser?Glu?Ile?Phe?Met?Arg?Lys?Lys?Gly?Trp?Val?Lys?Glu?Val

405?????????????????410?????????????????415

Asn?Gln?Ser?Lys?Gln?Leu?Gly?Ser?Ala?Asp?Ser?Ser?Ser?Ile

420?????????????????425?????????????????430

<210>35

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>35

aacatgacgg?tcaccacccg?cagccacaag??????????????????????????????????30

<210>36

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: synthetic primer

<400>36

ctgggtgctc?tgaacggtgt?gcgcccaaat??????????????????????????????????30

<210>37

<211>1290

<212>DNA

＜213〉Neurospora crassa

<400>37

atggctgtca?ctactaggtc?acacaaagcc?gccgctgcca?ccgaacctga?agttgtgtct?60

acaggagtgg?atgcagtcag?cgctgccgca?ccaagcagta?gtagctcctc?atcctcccaa?120

aagtcagctg?agcctatcga?atatccagac?atcaagacaa?ttcgtgacgc?tataccagac?180

cactgcttta?gacctcgcgt?ttggatatcc?atggcgtact?ttattcgcga?ttttgcaatg?240

gctttcggcc?tcggatactt?ggcatggcaa?tacatccctt?tgattgcaag?taccccattg?300

agatacggag?cttgggcttt?gtacggttac?ctccagggac?tcgtctgtac?tggaatttgg?360

atcttggctc?acgaatgcgg?tcacggagcc?ttttctagac?acacctggtt?caacaacgtt?420

atgggttgga?ttggtcactc?tttcctacta?gtcccatatt?ttagctggaa?attttcccat?480

caccgtcatc?ataggttcac?cggacatatg?gaaaaagata?tggcgttcgt?tccagccacg?540

gaggcggaca?gaaatcagag?aaaactagct?aatctctata?tggacaaaga?gactgcggag?600

atgttcgagg?atgttcctat?tgtgcagttg?gttaaactaa?ttgctcacca?actcgccggt?660

tggcagatgt?atctcttgtt?caacgttagt?gccggaaaag?gctccaaaca?gtgggaaacc?720

ggcaaaggtg?gaatgggatg?gctccgcgtg?agccatttcg?aaccaagttc?agccgttttc?780

agaaacagcg?aagcaattta?catagctcta?agcgatctcg?gacttatgat?tatgggatac?840

attctctacc?aggcagccca?agttgttgga?tggcaaatgg?ttggtctctt?gtattttcaa?900

cagtacttct?gggttcacca?ttggctcgtt?gccatcactt?accttcatca?cacacacgaa?960

gaagttcacc?actttgatgc?agattcttgg?acatttgtta?agggtgccct?cgctaccgtg?1020

gacagagact?tcggtttcat?cggcaagcac?ctcttccata?acatcattga?ccatcatgtt?1080

gttcatcacc?tcttcccaag?aatccctttc?tactacgctg?aagaagctac?caattcaata?1140

agacctatgc?tcggacctct?ttaccacaga?gatgaccgtt?ctttcatggg?gcaactctgg?1200

tacaacttca?cacactgcaa?atgggttgtc?cctgatcctc?aagtgccagg?tgctctaatc?1260

tgggctcaca?ccgttcagag?tactcagtaa??????????????????????????????????1290

<210>38

<211>1209

<212>DNA

＜213〉aspergillus nidulans

<400>38

atggccgcaa?ccgcgaccac?tctcgctgaa?atagaaaaga?agaaggaaga?gattacacta?60

cagacaatca?agaatgccat?accaaagcac?tgttttaacc?gtagtttgct?tatttcaagt?120

gcctacgtcg?tcagagacct?cctctacgca?tcagttttgt?tctattttgc?acttcatatt?180

gatacgctct?tctcatccca?gctccttagg?atcttggcat?ggacagctta?cggtttcatg?240

caaggctgcg?tgggaacggg?tatatggata?ttggcacatg?aatgcggaca?cggagctttt?300

agcccttacc?aaacctggaa?cgacgttgtt?gggtggaccc?ttcattctct?tctcatggtc?360

ccttacttct?cttggaaaat?aacccacgca?aggcaccaca?gatatacgaa?caataccgag?420

agggacacag?ccttcgttcc?ctggaccgag?aaggaatacg?acaccagacc?tcgttacttc?480

cctgcatggt?tcgagatgtt?tgaagacaca?ccagtgtata?acttgatttc?attgctcgcc?540

catcagatcg?ccggctggca?aatgtacctc?tgcttctacg?tctcagccgg?agccaaaagt?600

aagcctgttc?cacaaggcaa?gcagtccgga?tggtttggag?gtcaacaatc?tgcatcacac?660

tttgacccag?gaagctctct?atggaccgaa?aaccagcgcc?atctaatcgc?aatctccgac?720

cttggactcc?ttctcgtggc?cgccgcgaat?tggtacttgg?ctcaacaagt?tggtgttcta?780

agaatggtgc?tcatttacgt?cgtcccctac?ttttgggtcc?accactggct?agtcgccatc?840

acgtacctcc?accacactca?cccatccata?ccacactaca?ccgactctac?ctggacattc?900

actaaaggag?cactctcaac?agtggatcgt?gacttcggat?ttataggaag?gcacttcttt?960

caccacatca?ttgatcacca?cgtcgttcat?cacttgttca?ataggatacc?attctatcac?1020

gcagaggaag?ctactaacgc?aataatacca?gttctcggtg?atatgtacca?tagagaagaa?1080

accggattcc?tctggagtct?tatggaaact?tataaaaact?gtcgctttgt?tggcgtggag?1140

aacgatgtgg?gtaaggaggg?agttctccat?tgggttttcg?aagaaaagaa?aggcgctaaa?1200

gctgaatag?????????????????????????????????????????????????????????1209

<210>39

<211>1446

<212>DNA

＜213〉Neurospora crassa

<400>39

atggcgtccg?tctcctctgc?ccttcccgag?ggcaacaagc?ctgccctgcg?caggacccaa?60

accgaggcca?cctccgactc?ataccctggt?accgctgatg?cctctccctt?cgactctccc?120

cttgagcgct?cggcctccaa?cacctcgctt?tcttcccagg?cctctgacaa?cgtcaagacc?180

gacaaggccg?agttcggcaa?gctgctcgac?acgtatggca?acgagttcga?ggtccccgac?240

ttcaccatca?aggacatccg?cgatgccatc?cccgcccact?gctttgagcg?ttcggctctt?300

cacagcttgg?cgcacgtcgt?ccgcgacatc?atttacctca?ccgtcacttt?ttacgtctgg?360

aacaagtatg?tcactcccga?gtacatcccc?atgaaggctg?cccgtgtcgt?cctctggggt?420

ctgtacacct?tcatgcaggg?ccttttcggc?accggtctct?gggttcttgc?ccatgagtgc?480

ggtcaccagg?ctttctcccc?gtccaggttg?atcaacgaca?ccgtcggctg?ggtcctccac?540

tctgcccttc?tcgtccccta?cttctcgtgg?aagttctccc?acagcaagca?ccacaaggcc?600

accggcaaca?tcgagcgtga?catggtcttc?gttcctcgga?cccgcgagca?gtttgcgtct?660

cgcatcggcc?gtttcgtcca?tgagatttcc?gagttgaccg?aggagacccc?catctacacc?720

ttgatccacc?ttatcggtca?gcagctcatc?ggctggccca?actacctcat?gaccaacgtc?780

accggccaca?acttccacga?gaggcagcgc?gagggtcgtg?gcaagggcaa?gaagaacggc?840

tggttcactg?gtgtcaacca?cttcaacccc?agctctcccc?tctatgagga?gcgtgaggcc?900

ccctggatca?tcgtctccga?catcggtatc?gctatcgccg?ccaccgccct?catctacctc?960

ggcaacacct?tcggctggtc?caacatgttc?gtctggtact?tccttcccta?cctctgggtc?1020

aaccactggc?ttgttgccat?cacctacctc?cagcacaccg?acccctcgct?cccccactac?1080

acccctgatc?agtggaactt?tgtccgtggt?gccgccgcga?ctattgaccg?cgagttcggc?1140

ttcatcggcc?gtcacctcct?ccacggcatt?atcgagaccc?acgttctcca?ccactacgtc?1200

agcaccattc?ccttttacca?cgccgacgag?gcctccgagg?ccatcaagaa?ggtcatgggc?1260

cgtcactacc?gcgctgacgt?ccaagatggc?cccatcggtt?tcatcaaggc?catgtggaag?1320

gctgctcgtt?ggtgccagtg?ggttgagcct?accgagggcg?ctgagggtaa?gggcaagggc?1380

gtcttgttct?accgcaacca?gaacggtctc?ggtgtcaagc?ctgccaagct?ccccaaaacc?1440

aactaa????????????????????????????????????????????????????????????1446

<210>40

<211>481

<212>PRT

＜213〉Neurospora crassa

<400>40

Met?Ala?Ser?Val?Ser?Ser?Ala?Leu?Pro?Glu?Gly?Asn?Lys?Pro?Ala?Leu

1???????????????5??????????????????10??????????????????15

Arg?Arg?Thr?Gln?Thr?Glu?Ala?Thr?Ser?Asp?Ser?Tyr?Pro?Gly?Thr?Ala

20??????????????????25??????????????????30

Asp?Ala?Ser?Pro?Phe?Asp?Ser?Pro?Leu?Glu?Arg?Ser?Ala?Ser?Asn?Thr

35??????????????????40??????????????????45

Ser?Leu?Ser?Ser?Gln?Ala?Ser?Asp?Asn?Val?Lys?Thr?Asp?Lys?Ala?Glu

50??????????????????55??????????????????60

Phe?Gly?Lys?Leu?Leu?Asp?Thr?Tyr?Gly?Asn?Glu?Phe?Glu?Val?Pro?Asp

65??????????????????70??????????????????75??????????????????80

Phe?Thr?Ile?Lys?Asp?Ile?Arg?Asp?Ala?Ile?Pro?Ala?His?Cys?Phe?Glu

85??????????????????90??????????????????95

Arg?Ser?Ala?Leu?His?Ser?Leu?Ala?His?Val?Val?Arg?Asp?Ile?Ile?Tyr

100?????????????????105?????????????????110

Leu?Thr?Val?Thr?Phe?Tyr?Val?Trp?Asn?Lys?Tyr?Val?Thr?Pro?Glu?Tyr

115?????????????????120?????????????????125

Ile?Pro?Met?Lys?Ala?Ala?Arg?Val?Val?Leu?Trp?Gly?Leu?Tyr?Thr?Phe

130?????????????????135?????????????????140

Met?Gln?Gly?Leu?Phe?Gly?Thr?Gly?Leu?Trp?Val?Leu?Ala?His?Glu?Cys

145?????????????????150?????????????????155?????????????????160

Gly?His?Gln?Ala?Phe?Ser?Pro?Ser?Arg?Leu?Ile?Asn?Asp?Thr?Val?Gly

165?????????????????170?????????????????175

Trp?Val?Leu?His?Ser?Ala?Leu?Leu?Val?Pro?Tyr?Phe?Ser?Trp?Lys?Phe

180?????????????????185?????????????????190

Ser?His?Ser?Lys?His?His?Lys?Ala?Thr?Gly?Asn?Ile?Glu?Arg?Asp?Met

195?????????????????200?????????????????205

Val?Phe?Val?Pro?Arg?Thr?Arg?Glu?Gln?Phe?Ala?Ser?Arg?Ile?Gly?Arg

210?????????????????215?????????????????220

Phe?Val?His?Glu?Ile?Ser?Glu?Leu?Thr?Glu?Glu?Thr?Pro?Ile?Tyr?Thr

225?????????????????230?????????????????235?????????????????240

Leu?Ile?His?Leu?Ile?Gly?Gln?Gln?Leu?Ile?Gly?Trp?Pro?Asn?Tyr?Leu

245?????????????????250?????????????????255

Met?Thr?Asn?Val?Thr?Gly?His?Asn?Phe?His?Glu?Arg?Gln?Arg?Glu?Gly

260?????????????????265?????????????????270

Arg?Gly?Lys?Gly?Lys?Lys?Asn?Gly?Trp?Phe?Thr?Gly?Val?Asn?His?Phe

275?????????????????280?????????????????285

Asn?Pro?Ser?Ser?Pro?Leu?Tyr?Glu?Glu?Arg?Glu?Ala?Pro?Trp?Ile?Ile

290?????????????????295?????????????????300

Val?Ser?Asp?Ile?Gly?Ile?Ala?Ile?Ala?Ala?Thr?Ala?Leu?Ile?Tyr?Leu

305?????????????????310?????????????????315?????????????????320

Gly?Asn?Thr?Phe?Gly?Trp?Ser?Asn?Met?Phe?Val?Trp?Tyr?Phe?Leu?Pro

325?????????????????330?????????????????335

Tyr?Leu?Trp?Val?Asn?His?Trp?Leu?Val?Ala?Ile?Thr?Tyr?Leu?Gln?His

340?????????????????345?????????????????350

Thr?Asp?Pro?Ser?Leu?Pro?His?Tyr?Thr?Pro?Asp?Gln?Trp?Asn?Phe?Val

355?????????????????360?????????????????365

Arg?Gly?Ala?Ala?Ala?Thr?Ile?Asp?Arg?Glu?Phe?Gly?Phe?Ile?Gly?Arg

370?????????????????375?????????????????380

His?Leu?Leu?His?Gly?Ile?Ile?Glu?Thr?His?Val?Leu?His?His?Tyr?Val

385?????????????????390?????????????????395?????????????????400

Ser?Thr?Ile?Pro?Phe?Tyr?His?Ala?Asp?Glu?Ala?Ser?Glu?Ala?Ile?Lys

405?????????????????410?????????????????415

Lys?Val?Met?Gly?Arg?His?Tyr?Arg?Ala?Asp?Val?Gln?Asp?Gly?Pro?Ile

420?????????????????425?????????????????430

Gly?Phe?Ile?Lys?Ala?Met?Trp?Lys?Ala?Ala?Arg?Trp?Cys?Gln?Trp?Val

435?????????????????440?????????????????445

Glu?Pro?Thr?Glu?Gly?Ala?Glu?Gly?Lys?Gly?Lys?Gly?Val?Leu?Phe?Tyr

450?????????????????455?????????????????460

Arg?Asn?Gln?Asn?Gly?Leu?Gly?Val?Lys?Pro?Ala?Lys?Leu?Pro?Lys?Thr

465?????????????????470?????????????????475?????????????????480

Asn

<210>41

<211>1200

<212>DNA

<213>Mortierella?alpina

<400>41

atggcacctc?ccaacactat?cgatgccggt?ttgacccagc?gtcatatcag?cacctcggcc?60

ccaaactcgg?ccaagcctgc?cttcgagcgc?aactaccagc?tccccgagtt?caccatcaag?120

gagatccgag?agtgcatccc?tgcccactgc?tttgagcgct?ccggtctccg?tggtctctgc?180

cacgttgcca?tcgatctgac?ttgggcgtcg?ctcttgttcc?tggctgcgac?ccagatcgac?240

aagtttgaga?atcccttgat?ccgctatttg?gcctggcctg?tttactggat?catgcagggt?300

attgtctgca?ccggtgtctg?ggtgctggct?cacgagtgtg?gtcatcagtc?cttctcgacc?360

tccaagaccc?tcaacaacac?agttggttgg?atcttgcact?cgatgctctt?ggtcccctac?420

cactcctgga?gaatctcgca?ctcgaagcac?cacaaggcca?ctggccatat?gaccaaggac?480

caggtctttg?tgcccaagac?ccgctcccag?gttggcttgc?ctcccaagga?gaacgctgct?540

gctgccgttc?aggaggagga?catgtccgtg?cacctggatg?aggaggctcc?cattgtgact?600

ttgttctgga?tggtgatcca?gttcttgttc?ggatggcccg?cgtacctgat?tatgaacgcc?660

tctggccaag?actacggccg?ctggacctcg?cacttccaca?cgtactcgcc?catctttgag?720

ccccgcaact?ttttcgacat?tattatctcg?gacctcggtg?tgttggctgc?cctcggtgcc?780

ctgatctatg?cctccatgca?gttgtcgctc?ttgaccgtca?ccaagtacta?tattgtcccc?840

tacctctttg?tcaacttttg?gttggtcctg?atcaccttct?tgcagcacac?cgatcccaag?900

ctgccccatt?accgcgaggg?tgcctggaat?ttccagcgtg?gagctctttg?caccgttgac?960

cgctcgtttg?gcaagttctt?ggaccatatg?ttccacggca?ttgtccacac?ccatgtggcc?1020

catcacttgt?tctcgcaaat?gccgttctac?catgctgagg?aagctaccta?tcatctcaag?1080

aaactgctgg?gagagtacta?tgtgtacgac?ccatccccga?tcgtcgttgc?ggtctggagg?1140

tcgttccgtg?agtgccgatt?cgtggaggat?cagggagacg?tggtcttttt?caagaagtaa?1200

<210>42

<211>1290

<212>DNA

＜213〉Neurospora crassa

<400>42

atggcggtca?ccacccgcag?ccacaaggcc?gcggccgcca?ccgagcccga?ggttgtcagc?60

accggcgttg?acgccgtctc?tgctgctgct?ccctcctcct?cctcctcctc?ttccagccaa?120

aagtcggccg?agcccatcga?ataccccgac?atcaagacca?tccgcgacgc?catccccgac?180

cactgcttcc?gcccgcgcgt?ctggatctcc?atggcctact?tcatccgcga?cttcgccatg?240

gcctttggcc?tcggctacct?cgcctggcag?tacatccccc?tgatcgcctc?caccccgctc?300

cgctacggcg?cctgggctct?gtacggctac?ctccagggtc?tcgtctgcac?gggcatctgg?360

attctggcgc?acgagtgcgg?ccacggcgcc?ttctcgaggc?acacgtggtt?caacaacgtc?420

atggggtgga?ttggccactc?cttcctcttg?gtcccttact?tcagctggaa?gttcagccac?480

catcgccacc?atcgcttcac?cggccacatg?gagaaggaca?tggcgtttgt?gcctgccacc?540

gaggctgatc?gcaaccagag?gaagctggcc?aacttgtaca?tggacaagga?gacggccgag?600

atgtttgagg?atgtgcccat?tgtccagctc?gtcaagctca?tcgcccacca?gctggccggc?660

tggcagatgt?acctcctctt?caacgtctcc?gccggtaagg?gcagcaagca?gtgggagact?720

ggcaagggcg?gcatgggctg?gttgagggtt?agccactttg?agccttcctc?tgctgtgttc?780

cgcaactccg?aggccatcta?cattgccctg?tccgatcttg?gtctcatgat?catgggctac?840

atcctctacc?aggccgcgca?ggttgttggc?tggcagatgg?tgggtctgct?gtacttccag?900

cagtacttct?gggttcacca?ttggttggtc?gccatcactt?acctccacca?cacccacgag?960

gaagtccacc?actttgacgc?cgactcgtgg?accttcgtca?agggcgctct?cgccaccgtc?1020

gaccgcgatt?ttggcttcat?tggcaagcac?ctcttccaca?acattatcga?ccaccacgtc?1080

gtccaccact?tgttccctcg?catccccttc?tactacgccg?aagaagccac?caactcgatc?1140

cgccccatgc?tcggccccct?ctaccaccgc?gacgaccgct?ccttcatggg?ccagctgtgg?1200

tacaacttca?cccactgcaa?gtgggtcgtt?ccggaccccc?aggtccccgg?cgcgcttatt?1260

tgggcgcaca?ccgttcagag?cacccagtaa??????????????????????????????????1290

<210>43

<211>1617

<212>DNA

<213>Mortierella?alpina

<400>43

cgacactcct?tccttcttct?cacccgtcct?agtccccttc?aacccccctc?tttgacaaag?60

acaacaaacc?atggctgctg?ctcccagtgt?gaggacgttt?actcgggccg?aggttttgaa?120

tgccgaggct?ctgaatgagg?gcaagaagga?tgccgaggca?cccttcttga?tgatcatcga?180

caacaaggtg?tacgatgtcc?gcgagttcgt?ccctgatcat?cccggtggaa?gtgtgattct?240

cacgcacgtt?ggcaaggacg?gcactgacgt?ctttgacact?tttcaccccg?aggctgcttg?300

ggagactctt?gccaactttt?acgttggtga?tattgacgag?agcgaccgcg?atatcaagaa?360

tgatgacttt?gcggccgagg?tccgcaagct?gcgtaccttg?ttccagtctc?ttggttacta?420

cgattcttcc?aaggcatact?acgccttcaa?ggtctcgttc?aacctctgca?tctggggttt?480

gtcgacggtc?attgtggcca?agtggggcca?gacctcgacc?ctcgccaacg?tgctctcggc?540

tgcgcttttg?ggtctgttct?ggcagcagtg?cggatggttg?gctcacgact?ttttgcatca?600

ccaggtcttc?caggaccgtt?tctggggtga?tcttttcggc?gccttcttgg?gaggtgtctg?660

ccagggcttc?tcgtcctcgt?ggtggaagga?caagcacaac?actcaccacg?ccgcccccaa?720

cgtccacggc?gaggatcccg?acattgacac?ccaccctctg?ttgacctgga?gtgagcatgc?780

gttggagatg?ttctcggatg?tcccagatga?ggagctgacc?cgcatgtggt?cgcgtttcat?840

ggtcctgaac?cagacctggt?tttacttccc?cattctctcg?tttgcccgtc?tctcctggtg?900

cctccagtcc?attctctttg?tgctgcctaa?cggtcaggcc?cacaagccct?cgggcgcgcg?960

tgtgcccatc?tcgttggtcg?agcagctgtc?gcttgcgatg?cactggacct?ggtacctcgc?1020

caccatgttc?ctgttcatca?aggatcccgt?caacatgctg?gtgtactttt?tggtgtcgca?1080

ggcggtgtgc?ggaaacttgt?tggcgatcgt?gttctcgctc?aaccacaacg?gtatgcctgt?1140

gatctcgaag?gaggaggcgg?tcgatatgga?tttcttcacg?aagcagatca?tcacgggtcg?1200

tgatgtccac?ccgggtctat?ttgccaactg?gttcacgggt?ggattgaact?atcagatcga?1260

gcaccacttg?ttcccttcga?tgcctcgcca?caacttttca?aagatccagc?ctgctgtcga?1320

gaccctgtgc?aaaaagtaca?atgtccgata?ccacaccacc?ggtatgatcg?agggaactgc?1380

agaggtcttt?agccgtctga?acgaggtctc?caaggctgcc?tccaagatgg?gtaaggcgca?1440

gtaaaaaaaa?aaacaaggac?gttttttttc?gccagtgcct?gtgcctgtgc?ctgcttccct?1500

tgtcaagtcg?agcgtttctg?gaaaggatcg?ttcagtgcag?tatcatcatt?ctccttttac?1560

cccccgctca?tatctcattc?atttctctta?ttaaacaact?tgttcccccc?ttcaccg????1617

Claims (82)

1. the polynucleotides of a separation, it contains the nucleotide sequence of the peptide species of encoding, and described polypeptide has the dehydrogenase activity of dehydrogenation on 15 in the carbon of fatty acid molecule, and wherein these polynucleotides are selected from:

(a) polynucleotides of the polypeptide of coding SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:34;

(b) contain the polynucleotides of the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQ IDNO:33;

(c) with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQ IDNO:33 or its complementary series in one or more, the polynucleotides of under the condition of 5 * SSC, 50% formamide and 42 ℃, hybridizing; With

(c) coding has the fungi polynucleotides of the polypeptide of at least one following amino acid motif:

TrpIleLeuAlaHisGluCysGlyHisGlyAlaSerPhe (WILAHECGHGASF) (SEQ ID NO:6); LeuAlaHisGluCysGlyHis (LAHECGH) (SEQ ID NO:7); HisSerPheLeuLeuValProTyrPheSerTrpLys (HSFLLVPYFSWK) (SEQ ID NO:8); LeuLeuValProTyrPheSerTrpLys (LLVPYFSWK) (SEQ ID NO:9); His (His/Ala) ArgHisHisArg (Phe/Tyr) ThrThr (H (H/A) RHHR (F/Y) TT) (SEQ ID NO:10, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21); TrpValHisHisTrpLeuValAlaIleThrTyrLeu (His/Gln) HisThrHis (WVHHWLVAITYL (H/Q) HTH) (SEQ ID NO:11); AlaIleThrTyrLeu (His/Gln) HisThr (AITYL (H/Q) HT) (SEQ ID NO:12); GlyAlaLeuAlaThrValAspArg (GALATVDR) (SEQ ID NO:13) or HisValValHisHisLeuPheXaaArgIleProPheTyr (HVVHHLFXRIPFY) (SEQ IDNO:14 or SEQ ID NO:22).

2. the polynucleotides of the described separation of claim 1, wherein said polynucleotides are selected from Zygomycota, Basidiomycota and Ascomycota.

3. the polynucleotides of the described separation of claim 1, wherein said polynucleotides are selected from as sowing: Neurospora crassa, aspergillus nidulans and Botrytis cinerea.

4. the polynucleotides of the described separation of claim 1, wherein polynucleotide encoding has the polypeptide of at least one following amino acid motif: IrpIleLeuAlaHisGluCysGlyHisGlyAlaSerPhe (WILAHECGHGASF) (SEQ ID NO:6); LeuAlaHisGluCysGlyHis (LAHECGH) (SEQ ID NO:7); HisSerPheLeuLeuValProTyrPheSerTrpLys (HSFLLVPYFSWK) (SEQ ID NO:8); LeuLeuValProTyrPheSerTrpLys (LLVPYFSWK) (SEQ ID NO:9); His (His/Ala) ArgHisHisArg (Phe/Tyr) ThrThr (H (H/A) RHHR (F/Y) TT) (SEQ ID NO:10, SEQ IDNO:19, SEQ ID NO:20, or SEQ ID NO:21); TrpValHisHisTrpLeuValAlaIleThrTyrLeu (His/Gln) HisThrHis (WVHHWLVAITYL (H/Q) HTH) (SEQ ID NO:11); AlaIleThrTyrLeu (His/Gln) HisThr (AITYL (H/Q) HT) (SEQ ID NO:12); GlyAlaLeuAlaThrValAspArg (GALATVDR) (SEQ ID NO:13) or HisValValHisHisLeuPheXaaArgIleProPheTyr (HVVHHLFXRIPFY) (SEQ ID NO:14 or SEQID NO:22).

5. the polynucleotides of the described separation of claim 1, the wherein polypeptide of polynucleotide encoding SEQ IDNO:3, SEQ ID NO:5 or SEQ ID NO:34.

6. the polynucleotides of the described separation of claim 1, wherein polynucleotides comprise the nucleotide sequence of SEQ IDNO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:33.

7. the polynucleotides of the described separation of claim 1, wherein polynucleotides under the condition of 5 * SSC, 50% formamide and 42 ℃ with SEQ ID NO:1, SEQ ID NO:2, SEQ IDNO:4 or SEQ ID NO:33 in one or more hybridization.

8. recombinant vector that contains the polynucleotides of the described separation of claim 1.

9. the described recombinant vector of claim 8, it further comprises at least a following appended sequence that is selected from:

(a) regulating and controlling sequence that is connected with the polynucleotides operability;

(b) selected marker that is connected with the polynucleotides operability;

(c) flag sequence that is connected with the polynucleotides operability;

(d) purification part that is connected with the polynucleotides operability; With

(e) target sequence that is connected with the polynucleotides operability.

10. the described recombinant vector of claim 8, it is further defined to and contains the promotor that is connected with described polynucleotides operability of separating.

11. the described recombinant vector of claim 10, wherein promotor is that developmental regulation, organelle are specific, tissue-specific, promotor composing type or cell-specific.

12. the described recombinant vector of claim 10, wherein said promotor are selected from the group of being made up of 35SCaMV, 34S FMV, Napin, 7S, Glob and Lec.

13. the described recombinant vector of claim 8, it is restricted to a kind of expression cassette of separation.

14. the described recombinant vector of claim 8, it is further defined to and contains coding and have nucleotide sequence at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon, and/or coding has the nucleotide sequence at the polypeptide of the dehydrogenase activity of 12 dehydrogenations of fatty acid molecule carbon.

15. the polynucleotides of a separation, it contains coding and has nucleotide sequence at the polypeptide of the dehydrogenase activity of 12 dehydrogenations of fatty acid molecule carbon, and these polynucleotides are selected from:

(a) polynucleotides of the polypeptide of coding SEQ ID NO:32 or SEQ ID NO:40;

(b) contain the polynucleotides of the nucleotide sequence of SEQ ID NO:31 or SEQ ID NO:39; With

(c) with SEQ ID NO:31 or SEQ ID NO:39 or its complementary series in one or more, the polynucleotides of under the condition of 5 * SSC, 50% formamide and 42 ℃, hybridizing; With

16. the polynucleotides of the described separation of claim 15, wherein said polynucleotides are selected from Zygomycota, Basidiomycota and Ascomycota.

17. the polynucleotides of the separation of claim 15, wherein polynucleotides are selected from Neurospora crassa and Botrytis cinerea.

18. recombinant vector that contains the polynucleotides of the described separation of claim 15.

19. described recombinant vector of claim 18, it further is restricted to and contains a kind of coding and have nucleotide sequence at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon, and/or a kind of coding has the nucleotide sequence at the polypeptide of the dehydrogenase activity of 15 dehydrogenations of fatty acid molecule carbon.

20. fungi polypeptide or its fragment, it has at the dehydrogenase activity of 15 dehydrogenations of fatty acid molecule carbon and contains at least a following amino acid motif:

TrpIleLeuAlaHisGluCysGlyHisGlyAlaSerPhe (WILAHECGHGASF) (SEQ ID NO:6); LeuAlaHisGluCysGlyHis (LAHECGH) (SEQ ID NO:7); HisSerPheLeuLeuValProTyrPheSerTrpLys (HSFLLVPYFSWK) (SEQ ID NO:8); LeuLeuValProTyrPheSerTrpLys (LLVPYFSWK) (SEQ ID NO:9); His (His/Ala) ArgHisHisArg (Phe/Tyr) ThrThr (H (H/A) RHHR (F/Y) TT) (SEQ ID NO:10, SEQ IDNO:19, SEQ ID NO:20, or SEQ ID NO:21); TrpValHisHisTrpLeuValAlaIleThrTyrLeu (His/Gln) HisThrHis (WVHHWLVAITYL (H/Q) HTH) (SEQ ID NO:11); AlaIleThrTyrLeu (His/Gln) HisThr (AITYL (H/Q) HT) (SEQ ID NO:12); GlyAlaLeuAlaThrValAspArg (GALATVDR) (SEQ ID NO:13) or HisValValHisHisLeuPheXaaArgIleProPheTyr (HVVHHLFXRIPFY) (SEQ ID NO:14 or SEQID NO:22).

21. the described fungi polypeptide of claim 20, it further is restricted to and contains all described amino acid motifs.

22. the fungi polypeptide, it contains the amino acid sequence of SEQ ID NO:3, SEQ ID NO:5 or SEQ IDNO:34; Or it has the fragment of the dehydrogenase activity of 15 dehydrogenations of fatty acid molecule carbon.

23. the fungi polypeptide, it contains the amino acid sequence of SEQ ID NO:32 or SEQ ID NO:40; Or it has the fragment of the dehydrogenase activity of 12 dehydrogenations of fatty acid molecule carbon.

24. with the described recombinant vector transgenic plant transformed of claim 8.

25. the described genetically modified plants of claim 24, it is further defined to the nucleotide sequence that has at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon with a kind of coding and transforms.

26. with the described recombinant vector transformed host cells of claim 8.

27. the described host cell of claim 26, wherein said host cell expression is by the albumen of described vector encoded.

28. the described host cell of claim 26, wherein cell from the ancestral heredity of cell recombinant vector.

29. the described host cell of claim 26, wherein cell is transformed by described recombinant vector.

30. the described host cell of claim 26, wherein said host cell is a plant cell.

31. with the described recombinant vector transgenic plant transformed of claim 15.

32. the described genetically modified plants of claim 31, it further is restricted to a kind of coding that contains has nucleotide sequence at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon, and/or the nucleotide sequence that a kind of coding has at the polypeptide of the dehydrogenase activity of 15 dehydrogenations of fatty acid molecule carbon transforms.

33. with the described recombinant vector transformed host cells of claim 15.

34. the described host cell of claim 33, wherein said host cell expression is by the albumen of described vector encoded.

35. the described host cell of claim 33, wherein cell from the ancestral heredity of cell recombinant vector.

36. the described host cell of claim 33, wherein cell is transformed by described recombinant vector.

37. the described host cell of claim 33, wherein said host cell is a plant cell.

38. a method for preparing the seed oil that contains the omega-3 fatty acid that comes from plant seed, it comprises the steps:

(a) obtain plant seed according to claim 24; With

(b) from described seed, extract oil.

39. a method that produces plant, the omega-3 fatty acid level changes in the seed oil that described plant comprises, and it comprises the described recombinant vector of claim 8 is imported in the oil-produced vegetable.

40. the described method of claim 39 wherein imports the cultivation that recombinant vector comprises plant.

41. the described method of claim 39 wherein imports recombinant vector and comprises the following steps:

(a) with the described recombinant vector transformed plant cells of claim 8; With

(b) from the plant cell described plant that regenerates, wherein the level of the omega-3 fatty acid of plant changes.

42. the described method of claim 39, wherein plant is selected from by arabidopsis, oilseeds Brassicas, rape seed, sunflower, safflower, double-low rapeseed, corn, soybean, cotton, flax, jojoba, the group that the plant of Chinese Chinese tallow tree, tobacco, cocoa bean, peanut, fruit tree, orange, generation nut and berry is formed.

43. the described method of claim 39, wherein plant is further defined to the nucleotide sequence that has at the polypeptide of the dehydrogenase activity of 6 dehydrogenations of fatty acid molecule carbon with a kind of coding and transforms.

44. the described method of claim 43, wherein parinaric acid increases.

45. the described method of claim 39, it is further defined to and comprises the described recombinant vector of claim 8 is imported in the multiple oil-produced vegetable, and from described plant or its heredity the offspring of recombinant vector, screening has the plant of omega-3 fatty acid situation of expection.

46. the method for the plant of a seed oil for preparing the level that contains the omega-3 fatty acid that changes comprises the described recombinant vector of claim 15 is incorporated in a kind of plant of produce oil.

47. the described method of claim 46 wherein imports the cultivation that recombinant vector comprises plant.

48. the described method of claim 46 wherein imports recombinant vector and may further comprise the steps:

(a) with the described recombinant vector transformed plant cells of claim 15; With

(b) from the plant cell described plant that regenerates, wherein plant has the omega-3 fatty acid level of change.

49. the described method of claim 46, wherein plant is selected from by arabidopsis, oilseeds Brassicas, rape seed, sunflower, safflower, double-low rapeseed, corn, soybean, cotton, flax, jojoba, the group that the plant of Chinese Chinese tallow tree, tobacco, cocoa bean, peanut, fruit tree, orange, generation nut and berry is formed.

50. an endogenous double-low rapeseed seed oil, the wherein content from about 40% to about 70% of content of parinaric acid from about 8% to about 27% and oleic acid.

51. the described double-low rapeseed seed of claim 50 oil, it is further defined to and contains α-linoleic acid, linoleic acid and the gamma-linoleic acid that is lower than 10% mixing.

52. the described double-low rapeseed seed of claim 50 oil, wherein the content of parinaric acid further is restricted to from about 10% to about 20%.

53. the described double-low rapeseed seed of claim 50 oil, wherein the content of parinaric acid further is restricted to from about 12% to about 17%.

54. the described double-low rapeseed seed of claim 50 oil, wherein the content of oleic acid further is restricted to from about 45% to about 65%.

55. the described double-low rapeseed seed of claim 50 oil, wherein the content of oleic acid further is restricted to from about 55% to about 65%.

56. the described double-low rapeseed seed of claim 50 oil, wherein the content of parinaric acid further is restricted to from about 12% to about 17%, and the content of oleic acid further is restricted to from about 55% to about 65%.

57. the described double-low rapeseed seed of claim 50 oil, it further is restricted to from the colea seed.

58. the described double-low rapeseed seed of claim 50 oil further is restricted to from the turnip seed.

59. the described double-low rapeseed seed of claim 50 oil, wherein Ω in the oil-6 is from about 1: 1 to about 1: 4 with the ratio of omega-3 fatty acid.

60. the double-low rapeseed seed oil of claim 59, wherein Ω in the oil-6 is further defined to from about 1: 2 to about 1: 4 with the ratio of omega-3 fatty acid.

61. improve the method for the nutritive value of the edible product that the human or animal consumes, it comprises the described double-low rapeseed seed of claim 50 oil is added in the edible product.

62. the described method of claim 61, wherein edible product is human food.

63. the described method of claim 61, wherein edible product is an animal feed.

64. the described method of claim 61, wherein edible product is food additives.

65. the described method of claim 61, wherein double-low rapeseed seed oil has increased the stearidonic acid content in the edible product.

66. claim 61 described method, wherein double-low rapeseed seed oil has reduced the ratio of Ω-6 and omega-3 fatty acid in the edible product.

67. the described method of claim 61, wherein edible product lacked parinaric acid before adding double-low rapeseed seed oil.

68. a method of producing food or feed, it comprises the described double-low rapeseed seed of claim 50 oil added to and prepares food or feed in raw material food or the feed ingredient.

69. the described method of claim 68, it is further defined to the method for producing food.

70. the described method of claim 68, it is further defined to the method for processing feed.

71. food or feed according to the preparation of the method for claim 68.

72. one kind for the human or animal provides the method for parinaric acid, it comprises and gives described human or animal with the described double-low rapeseed seed of claim 50 oil.

73. the described method of claim 72, wherein double-low rapeseed seed oil gives with edible composition.

74. the described method of claim 73, wherein edible composition is food or feed.

75. the described method of claim 74, wherein food comprises beverage, infusion of food, sauce, flavouring, salad dressing, fruit juice, syrup, dessert, sugar-coat and cake filling, soft freezing product, sweet food or intermediate food.

76. the described method of claim 73, wherein edible composition is liquid basically.

77. the described method of claim 73, wherein edible composition is solid basically.

78. the described method of claim 73, wherein edible composition is food additives.

79. the described method of claim 73, wherein edible composition is a health food.

80. the described method of claim 72, wherein double-low rapeseed seed oil administration of human.

81. the described method of claim 72, wherein double-low rapeseed seed oil gives animal.

82. the described method of claim 81, wherein double-low rapeseed seed oil gives livestock or poultry.

Images