CN1712545A - Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom - Google Patents
Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom Download PDFInfo
- Publication number
- CN1712545A CN1712545A CN 200410049687 CN200410049687A CN1712545A CN 1712545 A CN1712545 A CN 1712545A CN 200410049687 CN200410049687 CN 200410049687 CN 200410049687 A CN200410049687 A CN 200410049687A CN 1712545 A CN1712545 A CN 1712545A
- Authority
- CN
- China
- Prior art keywords
- site
- haplotype
- gene
- agtr1 gene
- agtr1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
A detecting method and application of nucleic acid polymorphism site of angiotensin II type I receptor, AGTR1 gene. It also refers detecting method and application of monomer which is useful for precaution and diagnosis of myocardial infarct.
Description
Technical field
The present invention relates to a kind of I type angiotensin-ii receptor (angiotensin II type I receptor, AGTR1) gene label mononucleotide polymorphism site and detection method thereof and application.The invention still further relates to haplotype and detection method and the application formed by AGTR1 gene label mononucleotide polymorphism site.
Background technology
Coronary atherosclerotic heart disease is the coronary artery luminal stenosis that causes owing to atherosclerosis, thereby makes coronary insufficiency and cause myocardial ischemia, thereby causes various clinical symptom, is called for short coronary heart disease.This disease is if myocardium temporary ischemic can cause stenocardia; If coronary artery is stopped up by sludged blood, or neurospasm takes place, blood can not circulate, myocardial infarction that Here it is.Myocardial infarction (myocardial infarction) is usually expressed as coronary occlusion, and blood flow interrupts, and the part cardiac muscle because of serious persistence ischemic local necrosis takes place.Have clinically that acutely and persistent retrosternal pain, heating, leukocytosis, erythrocyte sedimentation rate are accelerated, serum myocardium enzyme vigor increases and carrying out property electrocardiogram(ECG changes, irregular pulse, shock or heart failure can take place.At present, in western countries' Acute Myocardial Infarction is the highest and fatal diseases of sickness rate, 7 main pharmacy market, the world in 1999 country (U.S., France, Germany, Italy, Spain, Britain and Japan) has more than 1,700 ten thousand people to suffer from Acute Myocardial Infarction, wherein 1/4 death.Only in the annual about 800,000 routine myocardial infarctions that take place of the U.S..Estimated to rise to 2,000,000 people by 2009 in above-mentioned 7 national center muscle infarction numbers.China's annual Acute Myocardial Infarction patient number is about 1,100,000 people.Age is at the 40-74 thick annual morbidity of crowd's myocardial infarction in year: 124.7/10 ten thousand; Mortality ratio: 58.4/10 ten thousand.Although the M ﹠ M of China's Acute Myocardial Infarction is lower than most developed countries, lift velocity is very fast, and the absolute number of patient and death is huge.Disease surveillance and cause of the death statistics show that the mortality ratio of Acute Myocardial Infarction in China and world wide in 20 years and sickness rate will be in rising trend from now on.
The obvious genetic that has of myocardial infarction is inclined to, and be subjected to the close influence of environmental factors simultaneously again, so it is typical multi-factor disease.From the basis to clinical, people have carried out a large amount of research to this, and accumulated a large amount of knowledge aspect the physiopathology that takes place in the Hazard Factor of myocardial infarction and myocardial infarction, but the analysis of the hereditary basis that takes place for myocardial infarction does not obtain important breakthrough yet.And explain, prevent and/or diagnosing cardiac infarction is to need at present the matter of utmost importance that solves from genetic angle.
Angiotensin II (Ang II) is an important products of renin-angiotensin system (RAS), in blood pressure regulation and cardiovascular systems vital role is arranged.The I type Ang II acceptor (AGTR1) that is positioned at cell surface has mediated the nearly all cardiovascular effect of Ang II, comprises the secretion of blood vessel and myocardial contraction, pituitrin and aldosterone, water sodium heavily absorbs and cell proliferation hypertrophy etc.Vascular smooth muscle cell, cardiac muscle and kidney and other organs all have widely, and AGTR1 exists.The AGTR1 gene is positioned at euchromosome 3q21-3q25, and the about 45kb of total length is made up of 5 exons, the 5th whole 359 amino acid of exons coding wherein, and its expressing protein belongs to G protein coupled receptor family, has 7 and strides film hydrophilic area structure.The GenBank sequence number of AGTR1 gene (Gene ID:185), gene structure as shown in Figure 1.But, pair systematic study of AGTR1 gene monomer type is not arranged at present as yet, the report that does not yet have respective labels SNP (mononucleotide polymorphic) does not more have the relation between AGTR1 genovariation and the myocardial infarction, and the report of these application of variation in prediction and new drug development.
SNP (Single Nucleotide Polymorphisms) is the abbreviation of mononucleotide polymorphic, and it is the variant of dna sequence dna, and single Nucleotide in genome sequence (A, T, C or G) SNP will occur when changing.In the present invention, the SNP nomenclature mo is as follows: first Nucleotide of first exon is defined as+1,5 ' updrift side Nucleotide is defined as-1 successively ,-2..., 3 ' downstream direction Nucleotide is defined as successively+2 ,+3....Mononucleotide polymorphic is if be positioned at non-coding region, and then this is polymorphic with Nucleotide respective change and the location definition of this Nucleotide in nucleotide sequence; If be positioned at the coding region, then with Nucleotide respective change and the location definition of this Nucleotide in nucleotide sequence this polymorphic or with the amino acid respective change of this nucleotide coding and the location definition of this amino acid in aminoacid sequence this is polymorphic.
Summary of the invention
At the problems referred to above, an object of the present invention is to provide a kind of tagged single-nucleotide polymorphic loci of AGTR1 gene; An object of the present invention is to provide a kind of AGTR1 gene protection haplotype of forming by the tagged single-nucleotide polymorphic loci of AGTR1 gene; An object of the present invention is to provide a kind of dangerous haplotype of forming by the tagged single-nucleotide polymorphic loci of AGTR1 gene of AGTR1 gene; An object of the present invention is to provide a kind of method that detects the tagged single-nucleotide polymorphic loci of AGTR1 gene of the present invention; An object of the present invention is to provide a kind of protected monomer type of the AGTR1 of detection gene or the method for dangerous haplotype; Another object of the present invention provides a kind of method of vitro detection myocardial infarction genes involved; Another object of the present invention provides the method that whether contains AGTR1 gene protection haplotype or dangerous haplotype in a kind of vitro detection testing sample; Another object of the present invention provides a kind of external prediction individual method of suffering from the danger of myocardial infarction to be measured: another object of the present invention provides a kind of test kit of polymorphism of tagged single-nucleotide polymorphic loci of the AGTR1 of detection gene.
The invention provides the tagged single-nucleotide polymorphic loci of AGTR1 gene, this site be respectively the AGTR1 gene-1106A/T, 10208A/G, 32091A/G, Leu191Leu (43730T/C), 44323A/C and 45035A/G mononucleotide site.Above-mentioned pleomorphism site is to draw on the basis of a large amount of experiments.In an embodiment of the invention, to the AGTR1 gene promoter area, exon district and exon junction region have been carried out large scale sequencing, and examination goes out to be distributed in wherein 16 SNP, and on this basis, utilize LD (linkage disequilibrium) to analyze and find to have strong LD between some SNPs, draw-1106A/T (the 1106th of first Nucleotide upstream of first exon) first, 10208A/G (the 10208th of first nucleotides downstream of first exon), 32091A/G (the 32091st of first nucleotides downstream of first exon), 43730T/C (the 43730th of first nucleotides downstream of first exon), 6 SNPs such as 44323A/C (the 44323rd of first nucleotides downstream of first exon) and 45035A/G (the 45035th of first nucleotides downstream of first exon) can be used as the label SNPs of AGTR1 gene.Specifically define referring to table 4.These labels SNPs provides new method for research AGTR1 gene, because on a large amount of experimental results of the present invention basis, these labels SNPs can represent other SNPs fully.In extensive association study, label SNPs is chosen under the prerequisite that guarantees the research power of a test, can effectively reduce the research link, reduces research cost like this.
On the basis of above-mentioned label SNP, the present invention is again to having carried out extensive studies by-common haplotype (frequency＞3%) that 6 tSNPs such as 1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G form.Found that: with haplotype A-G-A-T-A-A (at-1106A/T, 10208A/G, 32091A/G, Leu191Leu, the mononucleotide in 44323A/C and 45035A/G site is respectively A, G, A, T, A, A) compare, haplotype A-A-A-T-A-A (-1106A/T, 10208A/G, 32091A/G, Leu191Leu, the mononucleotide in 44323A/C and 45035A/G site is respectively A, A, A, T, A, A), T-A-G-C-A-A (-1106A/T, 10208A/G, 32091A/G, Leu191Leu, the mononucleotide in 44323A/C and 45035A/G site is respectively T, A, G, C, A, A) and A-A-A-C-A-G (at-1106A/T, 10208A/G, 32091A/G, Leu191Leu, the mononucleotide in 44323A/C and 45035A/G site is respectively A, A, A, C, A, G) be A allelotrope the 2nd position, along with the 1st position T allelotrope, the 4th position C allelotrope and the 6th the allelic appearance successively of position G, the danger that such individuality is suffered from myocardial infarction raises gradually.
Thereby; on the one hand; the invention provides the AGTR1 gene protection haplotype of being made up of tagged single-nucleotide polymorphic loci of the present invention, this haplotype is respectively A, G, A, T, A, A (haplotype A-G-A-T-A-A) at-mononucleotide in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site.With definite experimental result this problem has been described in an embodiment of the invention; use haplo.score program (people such as Schaid; 2001; http://www.mayo.edu/hsr/people/schaid.html); proofread and correct age, BMI, hypertension, smoking, drink, behind triglyceride level, high-density lipoprotein (HDL) and the blood sugar; haplotype A-G-A-T-A-A and myocardial infarction significant correlation, and have significant protective effect (P=0.0064).
On the other hand, the invention provides the dangerous haplotype of the AGTR1 gene be made up of tagged single-nucleotide polymorphic loci of the present invention, this haplotype is respectively A, A, A, T, A, A (haplotype A-A-A-T-A-A) at-mononucleotide in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site; T, A, G, C, A, A (haplotype T-A-G-C-A-A) or A, A, A, C, A, G (haplotype A-A-A-C-A-G).Carry dangerous significantly raise (OR value be respectively 1.33,1.75 and 2.64) of the individuality of so dangerous haplotype with definite experimental data proof in an embodiment of the invention than the individuality trouble myocardial infarction of carrying the protected monomer type.Can find, these dangerous haplotypes are A allelotrope at the 10208th bit base, along with-1106T, Leu191LeuC (43730C) and the allelic appearance successively of 45035G, individual danger of suffering from myocardial infarction raises gradually, points out between these sites to have synergy.Thus, as can be seen, the method that the present invention adopts the mode of haplotype to detect the danger of individual allegiant muscle infarction has more cogency than the method that detects single nucleotide polymorphism separately, and the result is also more reliable.
The invention provides a kind of method that detects the tagged single-nucleotide polymorphic loci of AGTR1 gene of the present invention.Available
Multiple technologies known in the art detect the tagged single-nucleotide polymorphic loci of AGTR1 gene of the present invention at dna level, rna level.For example, can suddenly change with differential point with the hybridization of the dna sequence dna after radiolabeled sense-rna or dna probe and the amplification.Also can be based on the change of known nucleotide sequence, normally synthetic and suddenly change PCR primer, in the substrate of polymerase chain reaction (PCR reaction), add fluorescently-labeled Nucleotide, according to having or not fluorescence to occur in the reaction product, determine in the used primer of amplification, to have or not base to change, thereby detect sudden change.Also can adopt pvuii restriction fragment analysis (RFLP) to come the mutational site of vitro detection AGTR1 gene order.The principle of restriction fragment length polymorphism analytical procedure is: because transgenation; cause the restriction enzyme digestion sites change, disappear or produce new site; if with certain digestion with restriction enzyme genomic dna; then enzyme is cut the back and is produced the dna fragmentation different with the normal gene group length; detect the size and the quantity of these dna fragmentations, judge whether to produce sudden change.When with after PCR combines, the susceptibility and the specificity of this detection method are higher.
In an embodiment of the invention, provide a kind of utilization with the polymerase chain reaction combine with the restriction fragment length polymorphism analysis (PCR-RFLP) detect the method for the tagged single-nucleotide polymorphic loci of AGTR1 gene.The concrete grammar that this PCR-RFLP of utilization detects testing gene is: when the experiment of design pcr amplification, primer is positioned at the both sides at transgenation position, earlier goal gene is increased, make it be easy to detect, if sudden change causes existing restriction endonuclease sites and changes, then can be earlier with corresponding digestion with restriction enzyme amplified production, carry out gel electrophoresis again and observe, judge according to product segment size or quantity and normal control.If sudden change is failed to cause restriction endonuclease sites and is changed, then introduce a known limitation restriction enzyme site by base mispairing, make sudden change cause that this restriction endonuclease sites changes.In embodiments of the invention 1, provide an exemplary method, adopt PCR reaction system separately, pcr amplification reaction is carried out in tagged single-nucleotide polymorphic loci-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site to AGTR1 gene of the present invention, adopt corresponding restriction enzyme that pcr amplification product is carried out enzyme then and cut, judge according to product segment size or quantity and normal control.Those of ordinary skills are known, and above-mentioned primer, restriction enzyme and corresponding restriction enzyme mapping thereof can change as required as long as be fit to detect tagged single-nucleotide polymorphic loci of the present invention.
In addition, also can directly disclose crt gene by dna direct order-checking and carry sequence difference between the mutator gene.Can use commercial sequencing kit or automatic sequencer that dna direct is checked order at present.Also available ordinary method of the mensuration of the nucleotide sequence of various DNA and dna fragmentation such as dideoxy chain termination are finished.When being used in combination with PCR, the susceptibility of this method improves greatly.
(referring to embodiment 1) in an embodiment of the invention provides with combine with the direct sequencing method of the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene of polymerase chain reaction.Concrete grammar is as follows: utilize Oligo6.53 software design PCR primer, promoter region (with about 1.2kb zone, transcription initiation site upstream), whole 5 exons of amplification AGTR1 gene, and the exon juncture area, and on the ABI3700 sequenator, finish order-checking (sequencing result is respectively SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5).On the SUN workstation, use the Phred/Phrap/consed program then and carry out the identification (result is referring to Fig. 2-17) of sequence assembly and mutant dna sequence.If only detect the tagged single-nucleotide polymorphic loci of AGTR1 gene of the present invention then can only near this tagged single-nucleotide polymorphic loci, (for example design primer, the primer that is used for pcr amplification in the embodiments of the invention 1 at PCR-RFLP), near increase zone this tagged single-nucleotide polymorphic loci, and on sequenator, finish order-checking.Compare with the relative sequence of the disclosed gene of Genbank then, thus determine this tagged single-nucleotide polymorphic loci whether with the relative sequence unanimity of the disclosed gene of Genbank, thereby determine whether to undergo mutation.
The present invention also provides a kind of protected monomer type of the AGTR1 of detection gene or the method for dangerous haplotype, and this method comprises the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene.
The method of any detection single nucleotide polymorphism that the method for the tagged single-nucleotide polymorphic loci of detection AGTR1 gene can be known in the art, for example can utilize radiolabeled sense-rna or dna probe to detect for this specification sheets is above-mentioned, utilize pvuii restriction fragment analysis or direct order-checking etc.Preferably utilize the polymerase chain reaction to combine or the polymerase chain reaction combines with direct sequencing and detects with the restriction fragment length polymorphism analysis.In addition, the present invention's method of detecting the protected monomer type of AGTR1 gene or dangerous haplotype also can comprise the detected result of described tagged single-nucleotide polymorphic loci is carried out statistical study.Statistical study can be this area method (as software packages such as EH and PHASE) commonly used.In an embodiment of the invention; a kind of method of carrying out statistical study is provided; this method is utilized haplo.score and haplo.glm program (people such as Schaid; 2001; http://www.mayo.edu/hsr/people/schaid.html); proofread and correct the age; BMI; hypertension; smoking; drink; triglyceride level; behind high-density lipoprotein (HDL) and the blood sugar; result by tagged single-nucleotide polymorphic loci of the present invention is carried out statistical study; especially the haplotype of being made up of tagged single-nucleotide polymorphic loci of the present invention is carried out statistical study, thereby drawn the protected monomer type or the dangerous haplotype of AGTR1 gene.
The present invention also provides a kind of method of vitro detection myocardial infarction genes involved, and this method comprises the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G.The present invention is on the basis of a large amount of experiments and statistical study, the men's health contrast of having chosen 419 routine myocardial infarction male patients and 400 routine age-matched is as research object, proved the relation of AGTR1 gene and myocardial infarction with definite experimental data, thereby the myocardial infarction genes involved is provided.
The present invention also provides protected monomer or the dangerous monomer methods that whether contains the AGTR1 gene in a kind of vitro detection testing sample, and this method comprises:
1) DNA of extraction testing sample carries out pcr amplification at the tagged single-nucleotide polymorphic loci of AGTR1 gene :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G design primer;
2) described whole PCR products are analyzed;
Whether 3) the mononucleotide polymorphic in evaluation-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site, the haplotype of its formation are: A-G-A-T-A-A, A-A-A-T-A-A, T-A-G-C-A-A or A-A-A-C-A-G.
The testing sample that contains gene of the present invention can obtain Tathagata autoblood, urine, saliva, gastric juice, hair, the cell of examination of living tissue and necrotomy material from the cell from the experimenter.Preferably come autoblood.Can obtain to contain the testing sample of gene of the present invention earlier from experimenter's cell, extract the DNA of gene then according to ordinary method, and at the tagged single-nucleotide polymorphic loci of AGTR1 gene :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G design primer carry out pcr amplification; Described whole PCR products are analyzed, determined whether amplified fragments is suitable; Identify by-haplotype that the mononucleotide polymorphic in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site constitutes and whether be: A-G-A-T-A-A, A-A-A-T-A-A, T-A-G-C-A-A or A-A-A-C-A-G.
The invention provides a kind of external prediction individual method of suffering from the danger of myocardial infarction to be measured, this method comprises the tagged single-nucleotide polymorphic loci of vitro detection from AGTR1 gene in the sample of individuality to be measured :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G, the individuality that wherein carries the haplotype A-A-A-T-A-A, the T-A-G-C-A-A that are made up of the mononucleotide in above-mentioned site or A-A-A-C-A-G suffer from the danger of myocardial infarction is suffered from myocardial infarction than the individuality that carries haplotype A-G-A-T-A-A dangerous significantly rising.Described individuality to be measured is preferably Chinese han population.The present invention is by a large amount of experiments (the men's health contrast of having chosen 419 routine myocardial infarction male patients and 400 routine age-matched is as research object), use haplo.glm program (people such as Lake, 2003, http://www.mayo.edu/hsr/people/schaid.html), proofread and correct the age, BMI, hypertension, smoking, drink, triglyceride level, behind high-density lipoprotein (HDL) and the blood sugar, A-G-A-T-A-A compares with haplotype, carries haplotype A-A-A-T-A-A, the individual danger of suffering from myocardial infarction of T-A-G-C-A-A and A-A-A-C-A-G significantly raises, and (the OR value is respectively 1.33,1.75 and 2.64).Especially the probability that the individuality that carries the haplotype of A-A-A-C-A-G conformation is suffered from myocardial infarction increases greatly, and risk increases to 2.64 times.In view of the above, the doctor can instruct this individuality to change bad life habits, reduces environmental factors bringing out disease.On the basis of the statistical study of large sample of the present invention, can use method of the present invention separately, vitro detection is from the tagged single-nucleotide polymorphic loci of AGTR1 gene in the sample of individuality to be measured :-1106A/T, 10208A/G, 32091A/G, 43730T/C, the haplotype that 44323A/C and 45035A/G constitute, with the external prediction individual danger of suffering from myocardial infarction to be measured, also can consider other environmental risk factors simultaneously, for example whether smoking, hypertension whether, diabetes whether, blood fat disorder and whether have the inclination to obstruct family history etc. whether is to reach the external prediction individual purpose of suffering from myocardial infarction danger to be measured.
On the other hand, the present invention also provides a kind of test kit of polymorphism of tagged single-nucleotide polymorphic loci of the AGTR1 of detection gene, and test kit contains:
1) primer in amplification-1106A/T site, 10208A/G site, 32091A/G site, 43730T/C site, 44323A/C site and/or 45035A/G site;
2) pcr amplification enzyme and corresponding damping fluid;
3) reagent of the loci polymorphism in detection-1106A/T, 10208A/G site, 32091A/G site, 43730T/C site, 44323A/C site and/or 45035A/G site.
In the described test kit one or more containers can be housed, one or more components that contain the AGTR1 gene of described pleomorphism site in order to detection are housed in the container.According to the difference of concrete detection method and detection pleomorphism site, test kit can contain different components.What provide simultaneously with it can be through medication management mechanism of government audit, relevant medicine or biological products manufacturing, the information using and sell.Those of ordinary skills are known, the primer of the described pleomorphism site of described amplification, can be according to the known nucleotide sequence design of the present invention, be generally 15-30 base, GC content is about 45%-50%, combine with template specificity under suitable temperature, it can utilize special computer programming, for example (Oligo 6.53 softwares).The enzyme of pcr amplification can be TagDNA polysaccharase, Klenow fragment, the Tth archaeal dna polymerase, and VENT archaeal dna polymerase etc. can be used in the enzyme of pcr amplification.The reagent that detects described polymorphism in the test kit is according to the difference of detection method and difference.For example, when adopting the polymerase chain reaction to detect described pleomorphism site with the restriction fragment length polymorphism analysis method of combining, can contain restriction enzyme and corresponding restriction enzyme mapping in the test kit, for example restriction enzyme described in the embodiment of the invention 1 and corresponding restriction enzyme mapping.The test kit of the polymorphism of the tagged single-nucleotide polymorphic loci of described detection AGTR1 gene can be used for vitro detection myocardial infarction genes involved, and the vitro detection individual danger of suffering from myocardial infarction to be measured.
Description of drawings
Fig. 1 AGTR1 gene is at No. 3 chromosomal structural representations.
The polymorphic order-checking collection of illustrative plates of Fig. 2 AGTR1 gene-1 106A/T; From top to bottom, be respectively AA, AT and TT genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 3 AGTR1 gene-778T/A; From top to bottom, be respectively AA, TT and TA genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 4 AGTR1 gene-681T/G; From top to bottom, be respectively GG, TT and TG genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 5 AGTR1 gene-478C/T; From top to bottom, be respectively TT, CT and CC genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 6 AGTR1 gene 9920G/A; From top to bottom, be respectively GG and GA genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 7 AGTR1 gene 10208A/G; From top to bottom, be respectively GG, GA and AA genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 8 AGTR1 gene 32091A/G; From top to bottom, be respectively AA and AG genotype.
The polymorphic order-checking collection of illustrative plates of Fig. 9 AGTR1 gene 32203A/G; From top to bottom, be respectively AA and AG genotype.
The polymorphic order-checking collection of illustrative plates of Figure 10 AGTR1 gene 32399A/G; From top to bottom, be respectively AA and AG genotype.
The polymorphic order-checking collection of illustrative plates of Figure 11 AGTR1 gene 41880G/T; From top to bottom, be respectively GG and GT genotype.
The polymorphic order-checking collection of illustrative plates of Figure 12 AGTR1 gene 41977T/C; From top to bottom, be respectively TT and TC genotype.
The polymorphic order-checking collection of illustrative plates of Figure 13 AGTR1 gene 43042G/T; From top to bottom, be respectively GG and GT genotype.
The polymorphic order-checking collection of illustrative plates of Figure 14 AGTR1 gene Leu191Leu; From top to bottom, be respectively TT and TC genotype.
The polymorphic order-checking collection of illustrative plates of Figure 15 AGTR1 gene 44323A/C; From top to bottom, be respectively AA and AC genotype.
The polymorphic order-checking collection of illustrative plates of Figure 16 AGTR1 gene 45035A/G; From top to bottom, be respectively AA and AG genotype.
The polymorphic order-checking collection of illustrative plates of Figure 17 AGTR1 gene 45126T/C; From top to bottom, be respectively TT and TC genotype.
Figure 18 AGTR1 gene-1 106A/T restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 1 is dna marker DL2000.
Figure 19 AGTR1 gene 10208A/G restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 9 is dna marker DL2000.
Figure 20 AGTR1 gene 32091A/G restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 1 is dna marker DL2000.
Figure 21 AGTR1 gene Leu191Leu restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 9 is dna marker DL2000.
Figure 22 AGTR1 gene 44323A/C restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 9 is dna marker DL2000.
Figure 23 AGTR1 gene 45035A/G restriction enzyme digestion and electrophoresis result schematic diagram, wherein swimming lane 1 is dna marker DL2000.
Embodiment
Selection and the detection of embodiment 1 AGTR1 gene label SNPs
1, the case-control sample characteristics is described
The selected Case definition of case is Acute Myocardial Infarction Case definition (according to WHO a Case definition in 1979): promptly the typical chest pain symptom continues more than 30 minutes; Continuous 2 the ST sections of leading of electrocardiogram(ECG are raised (limb leads 0.1mv, chest leads 0.2mv) and serial dynamic change are arranged; The serum marker substrate concentration of myocardial necrosis raises, and raises as troponin (TNT/TNI), and myocardium isozyme (CK-MB) raises greater than high 2 times of limitting of normal value.Valvular heart disease, congenital heart disease, heart failure, serious kidney and hepatic diseases, secondary hypertension, myocardosis, familial hypercholesterolemia and suspicious patients with coronary heart disease except every inspection.During September in October, 1997 to calendar year 2001, the male sex's myocardial infarction patient who is chosen in the Beijing area that China Medical Sciences Academy Fu Wai Hospital is in hospital at random is totally 419 examples; Picked at random is lived in Beijing simultaneously, the male sex crowd of community 400 examples of age and case coupling.The control group inclusion criteria: previously there are not coronary heart disease or other Atheromatosis histories, no pectoralgia, cardiac symptom such as uncomfortable in chest, electrocardiogram(ECG does not have obvious ischemic change.Case group and control group are Chinese han population, and consanguinity-less relation.Clinical symptoms is described and is seen Table 1.
Table 1 case-control sample Clinical symptoms is described
| Case (n=419) | Contrast (n=400) | The P value | |
| Age 8BMI (kg/m 2) whether whether smoking (being/no) whether drink (being/no) of hyperpietic's (being/no) of the total courage of the low degree of systolic pressure (mmHg) diastolic pressure (mmHg) high density T-CHOL (mg/dl) week alcohol (mg/dl) T-CHOL (mg/dl) triglycerides (mg/dl) blood sugar (mg/dl) | ????54.27±9.74 ????26.61±3.11 ????127.42±19.84 ????76.83±11.18 ????40.52±9.10 ????125.21±38.86 ????198.91±40.94 ????167.5±142.19 ????106.32±34.36 ????198/219 ????321/98 ????239/180 | ????54.23±9.41 ????24.56±3.15 ????128.66±18.99 ????80.91±10.30 ????48.34±11.12 ????124.5±33.65 ????197.57±36.49 ????123.96±76.19 ????97.28±23.57 ????137/263 ????286/114 ????208/191 | ????0.9496 ????＜0.0001 ????0.3643 ????＜0.0001 ????＜0.0001 ????0.7790 ????0.6191 ????＜0.0001 ????＜0.0001 ????0.0001 ????0.0951 ????0.1585 |
Numerical value is means standard deviation; BMI: weight index
2, AGTR1 gene order variation examination
Random choose 48 routine myocardial infarction patients constitute 96 karyomit(e)s as the examination object from the case group, and this sample size can provide 95% power of a test to detect rare gene frequency greater than 1% sequence variations.All individualities are Han nationality, and do not have any genetic connection.From NCBI public data storehouse, obtain AGTR1 complete genome sequence (Genbank sequence number: 185).The method that detects polymorphism is to utilize the PCR product directly to check order.Utilize Oligo6.53 software design PCR primer, promoter region (with about 1.2kb zone, transcription initiation site upstream), whole 5 exons of amplification AGTR1 gene, and exon juncture area.Primer sequence sees Table 2.
Table 2 AGTR1 sequencing primer sequence
| Reaction type | The order-checking zone | 5 ' upstream primer | 3 ' downstream primer |
| Sequence amplification+sequencing reaction | Exons 1-1 relevant range | 5’CGTTGTCTTCCGTTATTATGTG?3’ (SEQ?ID?NO：6) | 5’TTTCCTATGAGTAACTCGAACTT?3’ (SEQ?ID?NO：7) |
| Sequence amplification+sequencing reaction | Exons 1-2 relevant range | 5’TGTCCACCCTTGAATTTCATAAC?3’ (SEQ?ID?NO：8) | 5’GAACGCCTTGCAGAGTCATAC?3’ (SEQ?ID?NO：9) |
| Sequence amplification+sequencing reaction | The exon 2 relevant range | 5’AAGAAATGGCTAGGAATGAGA?3’ (SEQ?ID?NO：10) | 5’ATATTGGAGGGGATGTGGTAA?3’ (SEQ?ID?NO：11) |
| Sequence amplification+sequencing reaction | The exon 3 relevant range | 5’CCCCTTGCTGGTACTTTA?3’ (SEQ?ID?NO：12) | 5’CCAGCAGGATGTCATCTAGT?3’ (SEQ?ID?NO：13) |
| Sequence amplification+sequencing reaction | Exon 4 relevant ranges | 5’GAAGGCAAAGAGACCACTTA?3’ (SEQ?ID?NO：14) | 5’AATAGGTTTGGCTAGGATTATCA?3’ (SEQ?ID?NO：15) |
| Sequence amplification | Exon 5 relevant ranges | 5’GCTTTCTTAGGCTTTATCAGTT?3’ (SEQ?ID?NO：16) | 5’ACGATGTGTTTATTCCATGAC?3’ (SEQ?ID?NO：17) |
| Sequencing reaction | Exon 5-1 relevant range | 5’GCTTTCTTAGGCTTTATCAGTT?3’ (SEQ?ID?NO：18) | |
| Exon 5-2 relevant range | 5’ATTGCTTCAGCCAGCGTCAGT?3’ (SEQ?ID?NO：19) | ||
| Exon 5-3 relevant range | 5’TTCCCCACCAAATATTCACTT?3’ (SEQ?ID?NO：20) | ||
| Exon 5-4 relevant range | 5’CAGATGACGGCTGCTCGAAGA?3’ (SEQ?ID?NO：21) | ||
| Exon 5-5 relevant range | 5’ACGATGTGTTTATTCCATGAC?3’ (SEQ?ID?NO：22) |
Sequencing primer in the table 2 because exons 1 merges the nearly 1.9kb of promoter region, carries out PCR and sequencing reaction so the exons 1 relevant range is divided into 2 partly overlapping fragments.As a same reason, the about 2kb in exon 5 relevant ranges, after the sequence amplification reaction, every approximately 500bp increases a sequencing primer.Increase and sequencing reaction on the regular-PCR instrument, its product reads sequence on ABI3700 sequenator (U.S. PE company).
Wherein, (25 μ l) is as follows for the PCR reaction system: genomic templates DNA 50ng (from blood preparation, intraleukocytic DNA with benzene phenol-chloroform method or with salting-out process extracted get final product according to ordinary method), dNTPs200 μ mol/L, Taq enzyme (Takara company) 1U, MgCl
22.0mmol/L, Tris-HCl 10mmol/L, KCl 50mmol/L and primer 2 00pmol/L.The PCR reaction conditions sees Table 3.
Table 3 AGTR1 gene SNP s examination pcr amplification reaction condition
The result: the sequencing result of finishing on ABI3700 (U.S. PE company) sequenator is as follows: see SEQ ID NO:1 (the nucleotide sequence the-1196-718 position that is equivalent to the AGTR1 complete genome sequence), SEQ ID NO:2 (the nucleotide sequence 9854-10384 position that is equivalent to the AGTR1 complete genome sequence), SEQ ID NO:3 (the nucleotide sequence 32109-32656 position that is equivalent to the AGTR1 complete genome sequence), SEQ ID NO:4 (the nucleotide sequence 41816-42414 position that is equivalent to the AGTR1 complete genome sequence) and SEQ ID NO:5 (the nucleotide sequence 43035-45585 position that is equivalent to the AGTR1 complete genome sequence).The 1197-1540 position of SEQ ID NO 1 wherein; The 308-391 position of SEQ ID NO 2; The 289-346 position of SEQ ID NO3; The 200-358 position of SEQ ID NO 4; The 172-1184 position of SEQ ID NO 5 is respectively exons 1,2,3,4 and 5.
On the SUN workstation, use the Phred/Phrap/consed program and carry out the identification of sequence assembly and mutant dna sequence.Polypred is a program that is used for sequence assembly, can come the result of dna sequencing is analyzed with it, also can be used to seek the SNP site.Its workplatform is the SUN workstation, and the long-distance user can operate under Linux community's face.Its principle with the aid of pictures is exactly to give distinct colors with four kinds of bases respectively: A is green; T is red; G is orange; C is blue.Phred/Phrap/consed is four orders wherein.Concrete operations are as follows:
Login enters Linux
Create four folder: edit_dir; Phd_dir; Chromat_dir; Poly_dir
Atlas analysis is the result come out, and directly can see the SNP site that system marks with redness with range estimation.
The result: the order-checking collection of illustrative plates of 16 SNPs is seen Fig. 2-17.Wherein, Fig. 5,8,9, the 10th, DNA minus strand sequence, these 4 polymorphic names are according to defining with its complementary normal chain base.For example, Fig. 5 shows that G/A is polymorphic, gets its complementary base, then the 4th SNP is defined as-478C/T is polymorphic.
3, the selection of AGTR1 gene label SNPs
In recent years, and linkage disequilibrium in effective utilization of SNP site information and the genome range (linkagedisequilibrium, LD) further developing of research found to have strong LD between some SNPs, and some of them SNPs can represent other SNPs fully.These representative SNPs be called as label SNPs or tagged single-nucleotide polymorphic (taggingSNPs, tSNPs).In extensive association study, label SNPs is chosen under the prerequisite that guarantees the research power of a test, can effectively reduce research cost.At present, the system of selection of label SNPs can divide two classes substantially: the one, and select minimum SNPs to explain maximum haplotype (haplotype) degrees of variation; Two are based on relation conefficient (R
2) select to have maximum R between gathering with whole SNPs
2Optimum SNPs set.Program based on first kind method is surrounded by HaploBlockFinder (people such as Zhang, 2002, http://cgi.uc.edu/cgi-bin/kzhang/haploBlockFinder.cgi), SNPtagger (Ke and Cardon, 2003, http://www.well.ox.ac.uk/-xiayi/haplotype/index.html) etc.Program based on second class is surrounded by tagSNPs (people such as Stram, 2003, http://www-rcf.usc.edu/-stram/tagsnpsvl.zip) and htSNP2 (people such as Chapman, 2003, http://www-gene.cimr.cam.ac.uk/clayton/software).The tagSNPs routine package is adopted in this research, and its algorithm is based on R
2The optimum SNPs set of selecting measurable common haplotype is as label SNPs.Parameter is provided with: the haplotype of cumulative frequency 〉=80% is defined as common haplotype; R
2〉=0.7.
At the above-mentioned 48 routine cases of selecting at random, to the promoter region of AGTR1 gene, whole 5 exons, and on the exon juncture area basis of directly checking order, examination to 16 SNPs altogether, it distributes and frequency sees Table 4.LD analyzes and finds to have strong LD (table 5) between some SNPs.
Position, mutation type and the rare gene frequency of table 4 tSNPs on the AGTR1 gene
| The SNP title | Distributed areas | Position on AGTR1 gene of the present invention | Position in the sequence of sequence table | Mutation type | DbSNP storehouse coding * | Frequency |
| -1106A/T | 5 ' flank | -1106 | The 185th of SEQ ID NO 1 | A sports T | ??rs275650 | ?0.202 |
| -778T/A | 5 ' flank | -778 | The 513rd of SEQ ID NO 1 | T sports A | ??rs275651 | ?0.202 |
| -681T/G | 5 ' flank | -681 | The 610th of SEQ ID NO 1 | T sports G | ??rs275652 | ?0.202 |
| -478C/T | 5 ' flank | -478 | The 803rd of SEQ ID NO 1 | C sports T | ??rs1492078 | ?0.262 |
| 9920G/A | Introne 1 (5 ' UTR) | 9920 | The 162nd of SEQ ID NO2 | G sports A | ??NONE | ?0.024 |
| 10208A/G | Intron 2 (5 ' UTR) | 10208 | The 450th of SEQ ID NO2 | A sports G | ??rs2276736 | ?0.345 |
| 32091A/G | Intron 2 (5 ' UTR) | 32091 | The 78th of SEQ ID NO 3 | A sports G | ??rs388915 | ?0.19 |
| 32203A/G | Intron 2 (5 ' UTR) | 32203 | The 190th of SEQ ID NO 3 | A sports G | ??NONE | ?0.024 |
| 32399A/G | Introne 3 (5 ' UTR) | 32399 | The 387th of SEQ ID NO 3 | A sports G | ??NONE | ?0.012 |
| 41880G/T | Introne 3 (5 ' UTR) | 41880 | The 160th of SEQ ID NO4 | G sports T | ??NONE | ?0.012 |
| 41977T/C | Exon 4 (5 ' UTR) | 41977 | The 257th of SEQ ID NO4 | T sports C | ??rs1800766 | ?0.179 |
| 43042G/T | Intron 4 (5 ' UTR) | 43042 | The 103rd of SEQ ID NO 5 | G sports T | ??NONE | ?0.036 |
| Leu191Leu | Exon 5 (Leu191Leu) | 43730 | The 791st of SEQ ID NO 5 | T sports C | ??rs5182 | ?0.25 |
| 44323A/C | Exon 5 (3 ' UTR) | 44323 | The 1384th of SEQ ID NO 5 | A sports C | ??rs5186 | ?0.036 |
| 45035A/G | Exon 5 (3 ' UTR) | 45035 | The 2096th of SEQ ID NO 5 | A sports G | ??rs380400 | ?0.083 |
| 45126T/C | 3 ' flank | 45126 | The 2187th of SEQ ID NO 5 | T sports C | ??NONE | ?0.012 |
*NONE represents this polymorphic dbSNP storehouse that is not present in
Linkage disequilibrium coefficient between 16 SNPs of table 5 (D ', following triangle) and P value (going up triangle)
Reach the D ' value (P＜0.0004) of significance,statistical behind 120 multiple checks of shadow representation correction
The result:
This research examination goes out to be distributed in 16 SNP of AGTR1 gene promoter area, exon district and exon junction region, and LD analyzes and finds to have strong LD (table 5) between some SNPs.Use tagSNPs routine package (Stram etc., 2003), according to the above-mentioned parameter definition, we find in Chinese han population, 6 SNPs such as-1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G can be used as the label SNPs of AGTR1 gene, its body R
2Value sees Table 6.
The selection of distribution of table 6 Han People of North China AGTR1 gene monomer type and label SNP
| ?ID a | Haplotype b | Frequency c(％) | Cumulative frequency (%) | ??R h 2 d |
| ?A ?B ?C ?D ?E ?F | ??0000010000000000 ??0000000000000000 ??1111001000101000 ??1111000000000000 ??0000001000101000 ??0000000000001010 | ????31.2 ????29.4 ????7.0 ????5.5 ????4.3 ????3.3 | ??31.2 ??60.6 ??67.6 ??73.1 ??77.4 ??80.7 | ??0.85 ??0.80 ??0.73 ??0.70 ??0.91 ??0.70 |
A haplotype numbering
The b polymorphic site is respectively SNP1-SNP16 from left to right, and 0=is common polymorphic, and 1=is rarely polymorphic
C is by EM algorithm estimate sheet build frequency (the tagSNPs routine package provides)
6 R that SNPs obtains as label SNP such as d selection-1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G
2Value
4, the detection method of AGTR1 gene tSNPs
The AGTR1 gene tSNPs that utilizes the PCR-RFLP method to detect.
In the Chinese han population, the PCR reaction system of 6 label SNPs of AGTR1 gene is 10 μ l: genomic templates DNA50ng, dNTPs200 μ mol/L, Taq enzyme (Takara company) 1U, MgCl
22.0mmol/L, Tris-HCl 10mmol/L, KCl 50mmol/L and primer 2 00pmol/L.PCR reaction conditions and the enzyme system of cutting see Table 7.
Table 7 label SNPs gene type PCR reaction conditions and enzyme are cut system
The PCR primer of 6 tSNPs of AGTR1 gene and extension increasing sequence and restriction enzyme are as follows:
1.-1106A/T
Upstream primer 5 ' TGTAGGCTTTGTCCATTTTT 3 ' (20bp) (SEQ ID NO:23)
Downstream primer 5 ' ATTGCACTGATTTGATCTTT 3 ' (20bp) (SEQ ID NO:24)
Base mismatch 5 '------------3 '
Restriction enzyme DraI
Pcr amplification sequence 234bp
5’-
TACTTCTTTAAATTTATTTTTATTGATACACAATAGATGTACACTTTTTAGGTACATGCAATAATTTAATGCCCCTCACTATAAATTCGGAGCTGCCTCCTCGCCGATGATTCCAGCGCCTGACAGCCAGGACCCCAGGCAGCAGCGAGTGACAGGACTTTTTAGGTACATGCAATAATTTAATGCATTCATAT
-3’(SEQ?ID?NO：25)
2.10208A/G
Upstream primer 5 ' CAGCAGTTTTCTTTAATGTGTCAcC 3 ' (25bp) (SEQ ID NO:26)
Downstream primer 5 ' AGAACACTGCTCAAAGGAATCA 3 ' (22bp) (SEQ ID NO:27)
Base mismatch 5 '------G-＞c------3 '
Restriction enzyme HpaII
Pcr amplification sequence 282bp
5’-
TGGGGAGAGCGCAAAAACCCACACACACCATTATCTTGTGAAAGAAGTAGAGGAAGCAGAAAATAATGAAATCCCAGTGTTACCACATCCCCTCCAATATACAGATTAAGAGCGTTTGTATTTATATGGTTTTAAACATAAATAACATCAGAATTACTAAGCTATTTCCATTCATGTACTGATAATGAATCATGTGAGAAAGTCCTTTGGCAAGGACTCCACATGGCCACAGG
-3’(SEQ?ID?NO：28)
3.32091A/G
Upstream primer 5 ' CCCAATgTCTCTTACCCAAATTTGaT 3 (26bp) (SEQ ID NO:29)
Downstream primer 5 ' TCTGGAAAATGATGATAATAATA 3 ' (23bp) (SEQ ID NO:30)
Base mismatch 5 '------T-＞g---C-＞a------3 '
Restriction enzyme BclI
Pcr amplification sequence 239bp
5’-
CAGGGAAAAAAATAAATTAAATTAGCCATTTACACCACAGTGTGAACTTAATAACACCAACAAAAGTTCCAAAGCTCTAGGGTCTCATAGCACCTCCAGATCCATGATCTCATTCGGTGTTTCCAACAATGTTTTGCACCAAACTGGACACATGCTTGCTACTTCATCATCCTCATCGTGAACATTAT
-3’(SEQ?ID?NO：31)
4.Leu191Leu
Upstream primer 5 ' CAAAGTCACCTGCATCATCA 3 ' (20bp) (SEQ ID NO:32)
Downstream primer 5 ' AGGAAACAGGAAACCCAGTAT 3 ' (21bp) (SEQ ID NO:33)
Base mismatch 5 '--------3 '
Restriction enzyme Hpy188I
Pcr amplification sequence 187bp
5’-
TTTGGCTGCTGGCAGGCTTGGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCTTTCCATTATGAGTCCCAAAATTCAACCCTTCCGATAGGGCTGGGCCTGACCAAAAAT
-3’(SEQ?ID?NO：34)
5.44323A/C
Upstream primer 5 ' CAGCACTTCACTACCAAATagGC 3 ' (23bp) (SEQ ID NO:35)
Downstream primer 5 ' GGAGATTGCATTTCTGTCAGTA 3 ' (22bp) (SEQ ID NO:36)
Base mismatch 5 '------G-＞a---A-＞g------3 '
Restriction enzyme HaeIII
Pcr amplification sequence 236bp
5’-
TTAGCTACTTTTCAGAATTGAAGGAGAAAATGCATTATGTGGACTGAACCGACTTTTCTAAAGCTCTGAACAAAAGCTTTTCTTTCCTTTTGCAACAAGACAAAGCAAAGCCACATTTTGCATTAGACAGATGACGGCTGCTCGAAGAACAATGTCAGAAACTCGATGAATGTGTTGATTTGAGAATTT
-3’(SEQ?ID?NO：37)
6.45035A/G
Upstream primer 5 ' AAAAGTATATATTCTACACAcATAT 3 ' (25bp) (SEQ ID NO:38)
Downstream primer 5 ' TCATTCAAGGTAGTCTTATT 3 ' (20bp) (SEQ ID NO:39)
Base mismatch 5 '------T-＞c------3 ';
Restriction enzyme NdeI
Pcr amplification sequence 180bp
5’-
TATATGTATATCTATATCTCTAAACTGCTGTTAATTGATTAAAATCTGGCAAAGTTATATTTACTTTAAAATAAAATAATTTTATTGCAATGTATTTATCTTCATTACTTAAAATAGATGCTAATTTATTTTAAAATAA
-3’(SEQ?ID?NO：40)
In the above-mentioned extension increasing sequence, the nucleotides sequence that has shading is classified primer sequence as; The nucleotide sequence that has underscore is the restriction enzyme digestion recognition site; The nucleotides sequence of lowercase is classified base mismatch as; Italic Nucleotide is the SNP sudden change.
The restriction enzyme digestion and electrophoresis result of 6 tSNPs of AGTR1 gene sees Figure 18-23 respectively.In the restriction enzyme digestion and electrophoresis result, dna marker uses DL2000, and segment is respectively 100bp, 250bp, 500bp, 750bp, 1000bp and 2000bp from small to large.
(1)-and the polymorphic gene type of 1106A/T: on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 56 ℃ 30 seconds, 72 ℃ 40 seconds, 35 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected DraI restriction enzyme (Takara company, Japan), restriction endonuclease recognition sequence TTT for use
*AA
A(
*Represent enzyme to cut the position, underscore is represented the mutational site), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): DraI enzyme 10U, Buffer:1.5 μ l, ddH
2O:2.8 μ l, PCR product: 10 μ l, 37 ℃ are spent the night.
The result: when SNP is an A allelotrope, the PCR product that 234 bases are long is cut into 31 and 203 two segments; If T allelotrope, then the PCR product is not cut.As shown in figure 18, the generation 234 of 1,2 and 8 swimming lanes and 203 two kind of segment, institute thinks the A/T heterozygote; 3,4,5 and 6 swimming lanes only produce 203 segments, and institute thinks the AA homozygote; 7 swimming lanes only produce 234 segments, and institute thinks the TT homozygote.(annotate: the 31bp segment under the cutting fails to be presented on the figure because less)
(2) the polymorphic gene type of 10208A/G: on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 61 ℃ 30 seconds, 72 ℃ 40 seconds, 30 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected HpaII restriction enzyme (MBI company, Canada), restriction endonuclease recognition sequence C for use
*C
GG (
*Represent enzyme to cut the position, underscore is represented the mutational site), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): HpaII enzyme 10U, Buffer:1.5 μ l, ddH
2O:2.5 μ l, PCR product: 10 μ l, 37 ℃ are spent the night.
The result: when SNP is a G allelotrope, the PCR product that 282 bases are long is cut into 24 and 258 two segments; If A allelotrope, then the PCR product is not cut.As shown in figure 19, the generation 282 of 1,2,3 and 6 swimming lanes and 258 two kind of segment, institute thinks the A/G heterozygote; 4 swimming lanes only produce 258 segments, and institute thinks the GG homozygote; 5,7 and 8 swimming lanes only produce 282 segments, and institute thinks the AA homozygote.(annotate: the 24bp segment under the cutting fails to be presented on the figure because less)
(3) the polymorphic gene type of 32091A/G: on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 56 ℃ 30 seconds, 72 ℃ 40 seconds, 30 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected BclI restriction enzyme (MBI company, Canada), restriction endonuclease recognition sequence T for use
*GATC
A(
*Represent enzyme to cut the position, underscore is represented the mutational site), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): BclI enzyme 8U, Buffer:1.5 μ l, ddH
2O:2.7 μ l, PCR product: 10 μ l, 55 ℃ are spent the night.
The result: when SNP is an A allelotrope, the PCR product that 239 bases are long is cut into 23 and 216 two segments; If G allelotrope, then the PCR product is not cut.As shown in figure 20, the generation 239 of 1 and 7 swimming lanes and 216 two kind of segment, institute thinks the A/G heterozygote; 2-6 and 8 swimming lanes only produce 216 segments, and institute thinks the AA homozygote.This figure does not have GG homozygote banding pattern.(annotate: the 23bp segment under the cutting fails to be presented on the figure because less)
(4) the polymorphic gene type of Leu191Leu (43730T/C): on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 60 ℃ 30 seconds, 72 ℃ 40 seconds, 35 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected Hpy188I restriction enzyme (NEB company, the U.S.), restriction endonuclease recognition sequence TCN for use
*GA (
*Represent enzyme to cut the position, underscore is represented the mutational site, and N represents any base), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): Hpy188I enzyme 8U, Buffer:1.5 μ l, ddH
2O:2.7 μ l, PCR product: 10 μ l, 37 ℃ are spent the night.
The result: when SNP is a T allelotrope, the PCR product that 187 bases are long is cut into 141 and 46 two segments; If C allelotrope, then the PCR product is not cut.As shown in figure 21, the generation 187 of 1,2,4,5,6 and 8 swimming lanes and 141 two kind of segment, institute thinks the T/C heterozygote; 3 swimming lanes only produce 141 segments, and institute thinks the TT homozygote.7 swimming lanes only produce 187 segments, and institute thinks the CC homozygote.(annotate: the 46bp segment under the cutting fails to be presented on the figure because less)
(5) the polymorphic gene type of 44323A/C: on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 56 ℃ 30 seconds, 72 ℃ 40 seconds, 30 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected HaeIII restriction enzyme (MBI company, Canada), restriction endonuclease recognition sequence GG for use
*C
C(
*Represent enzyme to cut the position, underscore is represented the mutational site), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): Haem enzyme 10U, Buffer:1.5 μ l, ddH
2O:2.5 μ l, PCR product: 10 μ l, 37 ℃ are spent the night.
The result: when SNP is a C allelotrope, the PCR product that 236 bases are long is cut into 22 and 213 two segments; If A allelotrope, then the PCR product is not cut.As shown in figure 22, the generation 236 of 3 swimming lanes and 213 two kind of segment, institute thinks the A/C heterozygote; 1,2 and the 4-8 swimming lane only produce 236 segments, institute thinks the AA homozygote.This figure does not have CC homozygote banding pattern.(annotate: the 22bp segment under the cutting fails to be presented on the figure because less)
(6) the polymorphic gene type of 45035A/G: on the PCR reaction system is seen.In the reaction of the enterprising performing PCR of 96 hole PCR automated cycle instrument 9700 (U.S. PE company), the PCR loop parameter: 95 ℃ of pre-sex change 5 minutes, through 94 ℃ 45 seconds, 48 ℃ 30 seconds, 72 ℃ 40 seconds, 30 week of circulation the back extended 7 minutes in 72 ℃.The PCR product is selected Nde restriction enzyme (Takara company, Japan), restriction endonuclease recognition sequence CA for use
*TAT
G(
*Represent enzyme to cut the position, underscore is represented the mutational site, and N represents any base), the enzyme tangent condition is referring to producer's operational manual.Enzyme is cut system (15 μ l): Hpy188I enzyme 8U, Buffer:1.5 μ l, ddH
2O:2.5 μ l, PCR product: 10 μ l, 37 ℃ are spent the night.
The result: when SNP is a G allelotrope, the PCR product that 180 bases are long is cut into 22 and 158 two segments; If A allelotrope, then the PCR product is not cut.As shown in figure 23, the generation 180 of 3 swimming lanes and 158 two kind of segment, institute thinks the A/G heterozygote; 2 and the 4-8 swimming lane only produce 180 segments, institute thinks the AA homozygote.1 swimming lane only produces 158 segments, and institute thinks the GG homozygote.(annotate: the 22bp segment under the cutting fails to be presented on the figure because less).
The dependency of AGTR1 gene tSNPs and myocardial infarction among the embodiment 2 China Han male sex crowds
1, case-control sample
Feature description is specifically seen embodiment 1.
2, the frequency distribution of AGTR1 gene tSNPs in the case-control sample
The polymorphic T gene frequency of-1106A/T case group is significantly higher than control group, the polymorphic A gene frequency of 10208A/G case group is significantly higher than control group, the 45035A/G genotype is distributed in case group and control group, and there were significant differences, and all the other polymorphic genotype distribute and gene frequency does not all have significant difference in case group and control group.See Table 8.
The frequency distribution of table 8 AGTR1 gene tSNPs in the case-control sample
| Case | Contrast | The P value | ||
| ?(n＝419) | ????(n＝400) | |||
| ?-1106A/T ?10208A/G ?32091A/G ?Leu191Leu ?44323A/C ?45035A/G | ??AA/AT/TT ??A/T ??AA/AG/GG ??A/G ??AA/AG/GG ??A/G ??TT/TC/CC ??T/C ??AA/AC/CC ??A/C ??AA/AG/GG ??A/G | ?300/101/16 ?0.84/0.16 ?176/186/56 ?0.64/0.36 ?273/126/18 ?0.81/0.19 ?189/195/32 ?0.69/0.31 ?372/44/1 ?0.94/0.06 ?310/105/3 ?0.87/0.13 | ????308/80/7 ????0.88/0.12 ????145/174/71 ????0.59/0.41 ????264/115/16 ????0.81/0.19 ????204/158/35 ????0.71/0.29 ????357/39/4 ????0.94/0.06 ????319/71/6 ????0.90/0.10 | ??NS ??0.0187 ??NS ??0.04 ??NS ??NS ??NS ??NS ??NS ??NS ??0.0286 ??NS |
NS: not statistically significant
3, the haplotype of AGTR1 gene tSNPs composition
The common haplotype (frequency＞3%) that 6 tSNPs such as-1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G form sees Table 9.Wherein Leu191Leu is polymorphic at the 43730th T/C.The order in each site and the sequence consensus of these sites on karyomit(e) in the haplotype.
4, the relation of AGTR1 gene tSNPs haplotype and myocardial infarction
Use haplo.score program (people such as Schaid; 2001; http://www.mayo.edu/hsr/people/schaid.html); proofread and correct age, BMI, hypertension, smoking, drink, behind triglyceride level, high-density lipoprotein (HDL) and the blood sugar; haplotype A-G-A-T-A-A and myocardial infarction significant correlation, and have significant protective effect (P=0.0064).See Table 9.
After table 9 is proofreaied and correct environmental factors, the score of AGTR1 gene tSNPs haplotype and myocardial infarction dependency check
| Haplotype | Implication * | The haplotype frequency | The Score value | The P value | ||
| Case | Contrast | Add up to | ||||
| ??Hap1 ??Hap2 ??Hap3 ??Hap4 ??Hap5 ??Hap6 ??Hap7 ??Hap8 | ?A-G-A-T-A-A ?A-A-G-C-C-A ?A-A-G-C-A-A ?A-G-A-C-A-G ?T-A-A-T-A-A ?A-A-A-T-A-A ?T-A-G-C-A-A ?A-A-A-C-A-G | ??0.248 ??0.027 ??0.047 ??0.063 ??0.049 ??0.355 ??0.057 ??0.037 | ??0.290 ??0.036 ??0.061 ??0.074 ??0.050 ??0.338 ??0.043 ??0.021 | ??0.269 ??0.032 ??0.054 ??0.068 ??0.048 ??0.346 ??0.051 ??0.030 | ??-2.73 ??-0.71 ??-0.25 ??-0.24 ??0.69 ??0.73 ??1.35 ??1.94 | ??0.0064 ??0.4792 ??0.8011 ??0.8126 ??0.4876 ??0.4651 ??0.1785 ??0.0528 |
*Implication is respectively corresponding to-single the Nucleotide of 1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G pleomorphism site.For example, for haplotype Hap1, the implication of A-G-A-T-A-A is for being respectively A, G, A, T, A, A at the-mononucleotide in 1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G site, and the rest may be inferred by analogy for it.
5, improve the AGTR1 gene tSNPs haplotype of the ill danger of myocardial infarction
Use haplo.glm program (people such as Lake, 2003, http://www.mayo.edu/hsr/people/schaid.html), proofread and correct age, BMI, hypertension, smoking, drink, behind triglyceride level, high-density lipoprotein (HDL) and the blood sugar, compare with haplotype A-G-A-T-A-A (Hap1), carry dangerous significantly raise (the OR value is respectively 1.33,1.75 and 2.64) of haplotype A-A-A-T-A-A (Hap6), T-A-G-C-A-A (Hap7) and the individual allegiant muscle infarction of A-A-A-C-A-G (Hap8).See Table 10.Can find that Hap6-8 is A allelotrope at the 10208th bit base, along with-1106T, 43730C and the allelic appearance successively of 45035G, individual danger of suffering from myocardial infarction raises gradually, points out between these sites to have synergy.See Table 10.
Table 10 AGTR1 gene tSNPs haplotype is for the relative risk of myocardial infarction
| Model | Variable | The haplotype implication | ??Odds?Ratio(95％CI) | The P value |
| The environmental variance haplotype | Hypertension Smoking And Drinking age BMI triglycerides HDL blood sugar Hap1 Hap2 Hap3 Hap4 Hap5 Hap6 Hap7 Hap8 | ? ?A-G-A-T-A-A ?A-A-G-C-C-A ?A-A-G-C-A-A ?A-G-A-C-A-G ?T-A-A-T-A-A ?A-A-A-T-A-A ?T-A-G-C-A-A ?A-A-A-C-A-G | 1.27 (0.909-1.769) 1.06 (0.727-1.556) 1.06 (0.757-1.476), 1.01 (0.994-1.029) 1.15 (1.091-1.216), 1.00 (0.998-1.002) 0.93 (0.916-0.951), 1.01 (1.001-1.013) 1.00 (reference), 0.93 (0.46-1.88) 1.12 (0.64-1.95), 1.11 (0.65-1.90) 1.41 (0.78-2.53), 1.33 (0.99-1.79) 1.75 (1.00-3.08) 2.64 (1.10-6.33) | ??0.0808 ??0.375 ??0.372 ??0.103 ??1.75×10 -7??0.384 ??1.12×10 -12??0.0142 ??... ??0.424 ??0.346 ??0.353 ??0.127 ??0.029 ??0.026 ??0.015 |
*The haplotype implication is respectively corresponding to-single the Nucleotide of 1106A/T, 10208A/G, 32091A/G, Leu191Leu, 44323A/C and 45035A/G pleomorphism site.
6, conclusion
According to above-mentioned research, the present invention has found 6 the important AGTR1 genovariation sites relevant with myocardial infarction :-1106A/T, 10208A/G, 32091A/G, Leu191Leu (43730T/C), 44323A/C and 45035A/G.The particular combinations in these 6 sites has increased the individual risk of suffering from myocardial infarction greatly.This discovery has the potential using value clinically: genotype identification is carried out in these 6 sites to the AGTR1 gene, carry A-A-A-T-A-A, T-A-G-C-A-A or A-A-A-C-A-G haplotype if find certain individuality, then should compare with the individuality that carries the A-G-A-T-A-A haplotype by individuality, the risk of suffering from myocardial infarction significantly raises.Especially carry-probability that the individuality of the haplotype of 1106A 10208A 32019A 43730C 44323A 45035G conformation is suffered from myocardial infarction increases greatly, and risk increases to 2.64 times.In view of the above, the doctor can instruct this individuality to change bad life habits, reduces environmental factors bringing out disease.As seen, the haplotype formed of AGTR1 gene label SNP has important application prospects in the prediction of myocardial infarction and prevention.
Sequence table
＜110〉China Medical Sciences Academy Fu Wai Hospital
Sinogenomax Co., Ltd.
＜120〉haplotype of AGTR1 gene label mononucleotide polymorphism site and composition thereof
<130>D0404011F
<160>40
<170>PatentIn?version?3.1
<210>1
<211>1914
<212>DNA
＜213〉homo sapiens
<400>1
cgttgtcttc?cgttattatg?tgtgatatta?gttaagtttt?tcataaataa?acttcacagt?????60
ttgaggaagt?tcctattcct?agtttgttga?gtgttagcat?gaaaaagtgt?tgaattttgt?????120
ccaatagttt?ttaaaaattt?ttttagacaa?tcatgtaggc?tttgtccatt?ttttacttct?????180
ttaaatttat?ttttattgat?acacaataga?tgtacacttt?ttaggtacat?gcaataattt?????240
aatgcccctc?actataaatt?cggagctgcc?tcctcgccga?tgattccagc?gcctgacagc?????300
caggacccca?ggcagcagcg?agtgacagga?ctttttaggt?acatgcaata?atttaatgca?????360
ttcatataaa?gatcaaatca?gtgcaattgg?catatccatc?accttaaata?tttgtctttt?????420
cttcatgcta?gaaacattca?agttattttc?tcctagctac?tctgaaatat?acaatagatt?????480
actgtaaact?acagtcaccc?tactcaccta?tctaacatta?attgattttt?ggtaaactaa?????540
tctaatcttg?ctttctggca?tcaacctcac?ttgaccatgg?tgtatagtcc?ctttcatatg?????600
ttattggatt?caatttgcct?acattttgtt?gagaattttt?atctatactc?ttaagaaata?????660
ttgatctgta?gtctcgtgat?gtctttatct?ggttttgtta?tcagggtgat?actggcctca?????720
tagcatgagt?tgggagatca?tccttactct?tctatttttt?ggaagagttt?gtgaagaatt?????780
gatattattt?cttctttaaa?tatttattgg?gtttttaaaa?tacattttta?aaatgcaact?????840
tgggtagcat?gtccaatagg?aacaaatgag?tgtccaccct?tgaatttcat?aaccctggaa?????900
ttaatccatg?taatctatga?tccacaactg?tattaccaaa?gttcgagtta?ctcataggaa?????960
agagaaagaa?gttctctaat?tcgtccttaa?aagttttcca?agttcagaaa?aaaaaaatgt?????1020
tgaagaacac?gaatctccgc?aggaaatgat?actcctgtac?ccccagctcg?ctctccctca?????1080
cgacccctcg?ctaggcgggg?ttcgggacca?ggtgaacgct?gatctgatag?ttgacacggg?????1140
acgactgtgg?catcatcctt?gctgccgtca?atatcccgag?agggaggagg?ttgggccggg?????1200
agggtctccc?ggggcggggc?ggaggaggag?ggaatgcaaa?acagagcctc?gtccccggaa?????1260
cccaagaagc?agcaacgccc?ctcactataa?attcggagct?gcctcctcgc?caatgattcc?????1320
agcgcctgac?agccaggacc?ccaggcagca?gcgagtgaca?ggacgtctgg?accggcgcgc?????1380
cgctagcagc?tctgccgggc?cgcggcggtg?atcgatgggg?agcggctgga?gcggacccag?????1440
cgagtgaggg?cgcacagccg?ggacgccgag?gcggcgggcg?ggagacccgc?accagcgcag?????1500
ccggccctcg?gcgggacgtg?acgcagcgcc?cggggcgcgg?gtgagtccgc?gcggaccgcc?????1560
aggcatgctt?gggggacttc?aagggcgggg?tgctaagttt?catgtcacgg?tgtcctaact?????1620
gctggctcta?tactgggaag?ctctcgggga?ccaaggaaag?agcgaccgta?gttctggtca?????1680
gcgcctgccc?ctggagctgg?ccacactttc?ccaaatcagg?tgaggggctt?ctggaatggg?????1740
agggaacaag?gtaggtttgt?ttgccacgtg?cctcgaaatt?ctcaatccat?tttaaccaaa?????1800
ctcttccgag?tgcaaggaag?aaatctacag?aaataagatg?caattcaata?aactttcttc?????1860
ctgaggcttt?tagttaactc?ttgtatttta?gccatcatct?gagcgggaag?ccgg???????????1914
<210>2
<211>531
<212>DNA
＜213〉homo sapiens
<400>2
aagaaatggc?taggaatgag?actgcactat?tttaccctaa?aacgttcttt?ttctctttgc?????60
ctaatgtata?tctacaaggg?cattggggaa?gatgttgacc?acaggcagga?agatgatgag?????120
atcctgtgcc?caccacttaa?tgcagtctag?ctctatataa?ggaaaaatat?gttcttgatg?????180
tgaaccagat?ggtttcactc?ccttcaaaaa?cactcttaag?atgcagtgtg?gaagcttact?????240
ctgtaaatta?aaaaataaaa?acctgactat?attcagtgga?atgcgttaat?catttttttc?????300
tttttaggtt?tgatatttga?caaattgatc?taaaatggct?gggtttttat?ctgaataact?????360
cactgatgcc?atcccagaaa?gtcggcacca?ggtaaatgcc?ttacatctac?agcagtgggt?????420
ctgtcagcag?ttttctttaa?tgtgtcagca?gtggggagag?cgcaaaaacc?cacacacacc?????480
attatcttgt?gaaagaagta?gaggaagcag?aaaataatga?aatcccagtg?t??????????????531
<210>3
<211>548
<212>DNA
＜213〉homo sapiens
<400>3
ccccttgctg?gtactttagt?ttcttccact?tctagcacca?cgtgtagttt?cccaatttct?????60
cttacccaaa?tttgctcgca?gggaaaaaaa?taaattaaat?tagccattta?caccacagtg?????120
tgaacttaat?aacaccaaca?aaagttccaa?agctctaggg?tctcatagca?cctccagatc?????180
catgatctca?ttcggtgttt?ccaacaatgt?tttgcaccaa?actggacaca?tgcttgctac?????240
ttcatcatcc?tcatcgtgaa?cattattatt?attatcatca?ttttccagat?gaagaaaatg?????300
aatcacaagt?caactgacag?tccaaaggct?ccacagctca?gaggaggtaa?atcatgtgct?????360
taattcagaa?cttttggctc?ccatcactat?gctcttccca?ctgtcttaac?tctggttgtc?????420
acctgagcca?ttgtgtttct?tctcaggtag?atcttagttc?ttcctgagaa?ggtatgaagg?????480
tgggtattcc?accctacctg?aattatagga?atttcagata?tctgtgagca?gctgcaaagg?????540
ggatttta??????????????????????????????????????????????????????????????548
<210>4
<211>599
<212>DNA
＜213〉homo sapiens
<400>4
aaggcaaaga?gaccacttaa?gaactccttc?acatgtgtta?tgtcttaaaa?gctgactact?????60
ggagttgtat?cccttgcaca?gcatcccttt?gcaccaaagt?gaacactact?ctaagaacat?????120
gtgttcagct?ctcctgaatg?ccaagcacaa?ccatgcttgg?catggcagtg?gtgtcttatt?????180
tctgctcctc?tttttcccca?gggcatgcca?ttgcaagaga?atgctcagcc?atgttcatct?????240
ggggacctgc?tcctggtaga?gcaataggat?ctgtgtgccc?agcaccactg?cccacctagc?????300
tgtcctggcc?tgtgcccaat?gctgaccttc?acctcagagt?gtggctgtac?cacattcggt?????360
gatgtcactc?tcactgaacc?ttcagcctcc?ttcctgggac?ttcctgatgg?actgttatcc?????420
agggcagaat?gtgttgattt?tctaaatcac?ataaatgaat?agcttgactg?ttgattatgt?????480
agaaaatcag?agcaaatatt?tgcatggctt?tgtgcagccc?attcttgagc?atctgattct?????540
ccccagaatt?ctaaaaaacc?tgctgctttc?tcaagccctc?agtaaagaca?tgctttctt??????599
<210>5
<211>2551
<212>DNA
＜213〉homo sapiens
<400>5
gctttcttag?gctttatcag?ttcacagtgt?ttccttaaga?aatatgatcc?agtatttttt????60
cctaagacta?aagttgagtt?actacgttta?tgactgagaa?atgaatgttt?gttagtttgt????120
ttgtttacaa?taagaatttt?ttctttacca?ttttattttt?attttcccca?ggtgtatttg????180
atatagtgtt?tgcaacaaat?tcgacccagg?tgatcaaaat?gattctcaac?tcttctactg????240
aagatggtat?taaaagaatc?caagatgatt?gtcccaaagc?tggaaggcat?aattacatat????300
ttgtcatgat?tcctacttta?tacagtatca?tctttgtggt?gggaatattt?ggaaacagct????360
tggtggtgat?agtcatttac?ttttatatga?agctgaagac?tgtggccagt?gtttttcttt????420
tgaatttagc?actggctgac?ttatgctttt?tactgacttt?gccactatgg?gctgtctaca????480
cagctatgga?ataccgctgg?ccctttggca?attacctatg?taagattgct?tcagccagcg????540
tcagtttcaa?cctgtacgct?agtgtgtttc?tactcacgtg?tctcagcatt?gatcgatacc????600
tggctattgt?tcacccaatg?aagtcccgcc?ttcgacgcac?aatgcttgta?gccaaagtca????660
cctgcatcat?catttggctg?ctggcaggct?tggccagttt?gccagctata?atccatcgaa????720
atgtattttt?cattgagaac?accaatatta?cagtttgtgc?tttccattat?gagtcccaaa????780
attcaaccct?cccgataggg?ctgggcctga?ccaaaaatat?actgggtttc?ctgtttcctt????840
ttctgatcat?tcttacaagt?tatactctta?tttggaaggc?cctaaagaag?gcttatgaaa????900
ttcagaagaa?caaaccaaga?aatgatgata?tttttaagat?aattatggca?attgtgcttt????960
tctttttctt?ttcctggatt?ccccaccaaa?tattcacttt?tctggatgta?ttgattcaac????1020
taggcatcat?acgtgactgt?agaattgcag?atattgtgga?cacggccatg?cctatcacca????1080
tttgtatagc?ttattttaac?aattgcctga?atcctctttt?ttatggcttt?ctggggaaaa????1140
aatttaaaag?atattttctc?cagcttctaa?aatatattcc?cccaaaagcc?aaatcccact????1200
caaacctttc?aacaaaaatg?agcacgcttt?cctaccgccc?ctcagataat?gtaagctcat????1260
ccaccaagaa?gcctgcacca?tgttttgagg?ttgagtgaca?tgttcgaaac?ctgtccataa????1320
agtaattttg?tgaaagaagg?agcaagagaa?cattcctctg?cagcacttca?ctaccaaatg????1380
agcattagct?acttttcaga?attgaaggag?aaaatgcatt?atgtggactg?aaccgacttt????1440
tctaaagctc?tgaacaaaag?cttttctttc?cttttgcaac?aagacaaagc?aaagccacat????1500
tttgcattag?acagatgacg?gctgctcgaa?gaacaatgtc?agaaactcga?tgaatgtgtt????1560
gatttgagaa?attttactga?cagaaatgca?atctccctag?cctgcttttg?tcctgttatt????1620
ttttatttcc?acataaaggt?atttagaata?tattaaatcg?ttagaggagc?aacaggagat????1680
gagagttcca?gattgttctg?tccagtttcc?aaagggcagt?aaagttttcg?tgccggtttt????1740
cagctattag?caactgtgct?acacttgcac?ctggtactgc?acattttgta?caaagatatg????1800
ctaagcagta?gtcgtcaagt?tgcagatctt?tttgtgaaat?tcaacctgtg?tcttataggt????1860
ttccactgcc?aaaacaatgc?ccgtaagatg?gcttatttgt?ataatggtgt?tactaaagtc????1920
acatataaaa?gttaaactac?ttgtaaaggt?gctgcactgg?tcccaagtag?tagtgtcttc????1980
ctagtatatt?agtttgattt?aatatctgag?aagtgtatat?agtttgtggt?aaaaagatta????2040
tatatcataa?agtatgcctt?cctgtttaaa?aaaagtatat?attctacaca?tatatgtata????2100
tgtatatcta?tatctctaaa?ctgctgttaa?ttgattaaaa?tctggcaaag?ttatatttac????2160
tttaaaataa?aataatttta?ttgcaatgta?tttatcttca?ttacttaaaa?tagatgctaa????2220
tttattttaa?aataagacta?ccttgaatga?gtatgaatat?atttttattt?aaattttgat????2280
acaactgata?gtttaatact?attggttata?gattttttat?cctgacattg?aaaagttaaa????2340
gaaaaaacat?tttgttctac?tgcatgtcat?ggaataaaca?catcgttttg?aatttttcag????2400
tttttcacat?aacaaagaaa?aaaattaact?cttgctataa?tgctagaata?atacattatt????2460
ttacaagtaa?tttaataaca?gaatttttct?aattgtatac?attatcattg?taggaaagtt????2520
agaagatata?gaataacata?aaaataaaag?t???????????????????????????????????2551
<210>6
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>6
cgttgtcttc?cgttattatg??tg?????????????????????????????????????????????22
<210>7
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>7
tttcctatga?gtaactcgaa?ctt?????????????????????????????????????????????23
<210>8
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>8
tgtccaccct?tgaatttcat?aac?????????????????????????????????????????????23
<210>9
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>9
gaacgccttg?cagagtcata?c???????????????????????????????????????????????21
<210>10
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>10
aagaaatggc?taggaatgag?a???????????????????????????????????????????????21
<210>11
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>11
atattggagg?ggatgtggta?a???????????????????????????????????????????????21
<210>12
<211>18
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>12
ccccttgctg?gtacttta???????????????????????????????????????????????????18
<210>13
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>13
ccagcaggat?gtcatctagt?????????????????????????????????????????????????20
<210>14
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>14
gaaggcaaag?agaccactta?????????????????????????????????????????????????20
<210>15
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>15
aataggtttg?gctaggatta?tca?????????????????????????????????????????????23
<210>16
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>16
gctttcttag?gctttatcag?tt??????????????????????????????????????????????22
<210>17
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>17
acgatgtgtt?tattccatga?c??????????????????????????????????????????????21
<210>18
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>18
gctttcttag?gctttatcag?tt????????????????????????????????????????????22
<210>19
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>19
attgcttcag?ccagcgtcag?t?????????????????????????????????????????????21
<210>20
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>20
ttccccacca?aatattcact?t???????????????????????????????????????????????21
<210>21
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>21
cagatgacgg?ctgctcgaag?a???????????????????????????????????????????????21
<210>22
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉sequencing primer
<400>22
acgatgtgtt?tattccatga?c???????????????????????????????????????????????21
<210>23
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>23
tgtaggcttt?gtccattttt?????????????????????????????????????????????????20
<210>24
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>24
attgcactga?tttgatcttt?????????????????????????????????????????????????20
<210>25
<211>234
<212>DNA
<213>
<400>25
tgtaggcttt?gtccattttt?tacttcttta?aatttatttt?tattgataca?caatagatgt????60
acacttttta?ggtacatgca?ataatttaat?gcccctcact?ataaattcgg?agctgcctcc????120
tcgccgatga?ttccagcgcc?tgacagccag?gaccccaggc?agcagcgagt?gacaggactt????180
tttaggtaca?tgcaataatt?taatgcattc?atataaagat?caaatcagtg?caat??????????234
<210>26
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>26
cagcagtttt?ctttaatgtg?tcacc???????????????????????????????????????????25
<210>27
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>27
agaacactgc?tcaaaggaat?ca??????????????????????????????????????????????22
<210>28
<211>282
<212>DNA
<213>
<400>28
cagcagtttt?ctttaatgtg?tcaccggtgg?ggagagcgca?aaaacccaca?cacaccatta????60
tcttgtgaaa?gaagtagagg?aagcagaaaa?taatgaaatc?ccagtgttac?cacatcccct????120
ccaatataca?gattaagagc?gtttgtattt?atatggtttt?aaacataaat?aacatcagaa????180
ttactaagct?atttccattc?atgtactgat?aatgaatcat?gtgagaaagt?cctttggcaa????240
ggactccaca?tggccacagg?tgattccttt?gagcagtgtt?ct???????????????????????282
<210>29
<211>26
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>29
cccaatgtct?cttacccaaa?tttgat?????????????????????????????????????????26
<210>30
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>30
tctggaaaat?gatgataata?ata???????????????????????????????????????????23
<210>31
<211>239
<212>DNA
<213>
<400>31
cccaatgtct?cttacccaaa?tttgatcaca?gggaaaaaaa?taaattaaat?tagccattta????60
caccacagtg?tgaacttaat?aacaccaaca?aaagttccaa?agctctaggg?tctcatagca????120
cctccagatc?catgatctca?ttcggtgttt?ccaacaatgt?tttgcaccaa?actggacaca????180
tgcttgctac?ttcatcatcc?tcatcgtgaa?cattattatt?attatcatca?ttttccaga?????239
<210>32
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>32
caaagtcacc?tgcatcatca????????????????????????????????????????????????20
<210>33
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>33
aggaaacagg?aaacccagta?t??????????????????????????????????????????????21
<210>34
<211>187
<212>DNA
<213>
<400>34
caaagtcacc?tgcatcatca?tttggctgct?ggcaggcttg?gccagtttgc?cagctataat????60
ccatcgaaat?gtatttttca?ttgagaacac?caatattaca?gtttgtgctt?tccattatga????120
gtcccaaaat?tcaacccttc?cgatagggct?gggcctgacc?aaaaatatac?tgggtttcct????180
gtttcct??????????????????????????????????????????????????????????????187
<210>35
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>35
cagcact?tca?ctaccaaata?ggc???????????????????????????????????????????23
<210>36
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>36
ggagattgca?tttctgtcag?ta?????????????????????????????????????????????22
<210>37
<211>236
<212>DNA
<213>
<400>37
cagcacttca?ctaccaaata?ggccttagct?acttttcaga?attgaaggag?aaaatgcatt????60
atgtggactg?aaccgacttt?tctaaagctc?tgaacaaaag?cttttctttc?cttttgcaac????120
aagacaaagc?aaagccacat?tttgcattag?acagatgacg?gctgctcgaa?gaacaatgtc????180
agaaactcga?tgaatgtgtt?gatttgagaa?attttactga?cagaaatgca?atctcc????????236
<210>38
<211>25
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>38
aaaagtatat?attctacaca?catat??????????????????????????????????????????25
<210>39
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉amplimer
<400>39
tcattcaagg?tagtcttatt????????????????????????????????????????????????20
<210>40
<211>180
<212>DNA
<213>
<400>40
aaaagtatat?attctacaca?catatgtata?tgtatatcta?tatctctaaa?ctgctgttaa????60
ttgattaaaa?tctggcaaag?ttatatttac?tttaaaataa?aataatttta?ttgcaatgta????120
tttatcttca?ttacttaaaa?tagatgctaa?tttattttaa?aataagacta?ccttgaatga????180
Claims (10)
1, a kind of tagged single-nucleotide polymorphic loci of AGTR1 gene, this site are respectively AGTR1 gene-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G mononucleotide site.
2, a kind of AGTR1 gene protection haplotype of being made up of the tagged single-nucleotide polymorphic loci of the described AGTR1 gene of claim 1, this haplotype is respectively A, G, A, T, A, A at the-mononucleotide in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site.
3, the dangerous haplotype of a kind of AGTR1 gene of forming by the tagged single-nucleotide polymorphic loci of the described AGTR1 gene of claim 1, this haplotype is respectively A, A, A, T, A, A at the-mononucleotide in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site; T, A, G, C, A, A or A, A, A, C, A, G.
4, a kind of detection method of the tagged single-nucleotide polymorphic loci of AGTR1 gene according to claim 1, this method is that the polymerase chain reaction combines with the restriction fragment length polymorphism analysis or the polymerase chain reaction combines with direct sequencing.
5, a kind of method that detects AGTR1 gene protection haplotype or dangerous haplotype, this method comprise the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene.
6, detection AGTR1 gene protection haplotype as claimed in claim 5 or dangerous haplotype method, this method also comprises carries out statistical study to the detected result of described tagged single-nucleotide polymorphic loci.
7, a kind of method of vitro detection myocardial infarction genes involved, this method comprise the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G.
8, whether contain the protected monomer type of AGTR1 gene or the method for dangerous haplotype in a kind of vitro detection testing sample, this method comprises:
1) DNA of extraction testing sample carries out pcr amplification at the tagged single-nucleotide polymorphic loci of AGTR1 gene :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G design primer;
2) described whole PCR products are analyzed;
3) identify by-haplotype that the mononucleotide polymorphic in 1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G site constitutes and whether be: A-G-A-T-A-A, A-A-A-T-A-A, T-A-G-C-A-A or A-A-A-C-A-G.
9, a kind of external prediction individual method of suffering from the danger of myocardial infarction to be measured, this method comprises the tagged single-nucleotide polymorphic loci of vitro detection from AGTR1 gene in the sample of individuality to be measured :-1106A/T, 10208A/G, 32091A/G, 43730T/C, 44323A/C and 45035A/G, the individuality that wherein carries the haplotype A-A-A-T-A-A, the T-A-G-C-A-A that are made up of the mononucleotide in above-mentioned site or A-A-A-C-A-G suffer from the danger of myocardial infarction is suffered from myocardial infarction than the individuality that carries haplotype A-G-A-T-A-A dangerous significantly rising.
10, a kind of test kit of polymorphism of the tagged single-nucleotide polymorphic loci that detects the AGTR1 gene, test kit contains respectively:
1) primer in amplification-1106A/T site, 10208A/G site, 32091A/G site, 43730T/C site, 44323A/C site and/or 45035A/G site;
2) pcr amplification enzyme and corresponding damping fluid;
3) the polymorphic reagent in site in detection-1106A/T, 10208A/G site, 32091A/G site, 43730T/C site, 44323A/C site and/or 45035A/G site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2004100496874A CN1712545B (en) | 2004-06-23 | 2004-06-23 | Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2004100496874A CN1712545B (en) | 2004-06-23 | 2004-06-23 | Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1712545A true CN1712545A (en) | 2005-12-28 |
| CN1712545B CN1712545B (en) | 2010-12-08 |
Family
ID=35718339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2004100496874A Expired - Fee Related CN1712545B (en) | 2004-06-23 | 2004-06-23 | Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1712545B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107435076A (en) * | 2017-09-08 | 2017-12-05 | 银川安龙基因科技有限公司 | A kind of hypertension medication genetic test Solid phase PCR kit |
| CN111344794A (en) * | 2017-07-20 | 2020-06-26 | 华为技术有限公司 | Apparatus and method for identifying haplotypes |
| CN112921080A (en) * | 2020-04-08 | 2021-06-08 | 上海市徐汇区中心医院 | KASP typing primer for detecting AGTR1 gene SNP locus and application thereof |
-
2004
- 2004-06-23 CN CN2004100496874A patent/CN1712545B/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111344794A (en) * | 2017-07-20 | 2020-06-26 | 华为技术有限公司 | Apparatus and method for identifying haplotypes |
| CN111344794B (en) * | 2017-07-20 | 2024-04-23 | 华为技术有限公司 | Apparatus and method for identifying haplotypes |
| CN107435076A (en) * | 2017-09-08 | 2017-12-05 | 银川安龙基因科技有限公司 | A kind of hypertension medication genetic test Solid phase PCR kit |
| CN112921080A (en) * | 2020-04-08 | 2021-06-08 | 上海市徐汇区中心医院 | KASP typing primer for detecting AGTR1 gene SNP locus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1712545B (en) | 2010-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1034673C (en) | Method of detecting nucleotide sequences | |
| CN1497049A (en) | Androgen receptor compound-associated protein | |
| CN101074450A (en) | Diagnostic probe detection system | |
| CN1930306A (en) | Method evolved for recognition of thrombophilia (MERT) | |
| CN1890384A (en) | Use of genetic polymorphisms that associate with efficacy of treatment of inflammatory disease | |
| CN101056990A (en) | Polymorphisms in the epidermal growth factor receptor gene promoter | |
| CN1662651A (en) | Method of diagnosing risk of myocardial infarction | |
| CN1912139A (en) | Test chipe of cytochrome P450 gene hereditary variation and its application | |
| CN1635142A (en) | Reagent kit for forecasting susceptibility of intolerance type dementia preaecox and primer used thereby | |
| CN1712545A (en) | Label mononucleotide polymorphic site of II receptor gene of I-type angiotonin and monosomy therefrom | |
| CN101067152A (en) | Pharmacogenetic detection chip for cardiac and cerebral vascular diseases and its application | |
| CN1890387A (en) | Method for diagnosis and prognosis of breast cancer | |
| CN1761760A (en) | Use of a novel polymorphism in the hsgk1 gene in the diagnosis of hypertonia and use of the sgk gene family in the diagnosis and therapy of the long Q/T syndrome | |
| CN1503847A (en) | Genetic test for the identification of carriers of complex vertebral malformations in cattle | |
| CN1771337A (en) | A plynucleotide associated with a colon cancer comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for diagnosing a colon cancer using the polynucle | |
| CN1678741A (en) | Method of detecting gene polymorphism | |
| CN1891822A (en) | PH gene with specific mononucleotide pleimorphism, and its detecting method and use | |
| CN1634963A (en) | Coronary disease related gene, its detection method and use thereof | |
| CN1928083A (en) | Mononucleotide polymorphism of human heterogenous substance metabolism enzyme gene and application of diagnosing and treating large intestinal cancer | |
| CN1552875A (en) | Scar and hyperplastic scar differential expression gene library and its constructing method | |
| CN1891823A (en) | CETP gene with specific mononucleotide pleiomorphism, and its detecting method and use | |
| CN101037690A (en) | BRCA1 gene variant having new single nucleotide polymorphism and encoded protein variant | |
| CN101033487A (en) | Method of detecting KLK1 gene rs5517 polymorphism correlated to primary hypertension | |
| CN1961074A (en) | Polynucleotide associated with a type II diabetes comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for analyzing polynucleotide using the same | |
| CN1958605A (en) | SPG3A gene mutation, encoded production, and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20190623 |