CN1699571A - Plant meiosis gene and its encoded protein and use thereof - Google Patents

Abstract

The invention discloses a plant meiosis gene and its encoded protein and use, wherein the gene is one of the following nucleic acid sequences, (1)polynucleotide of SEQ ID No:1 in the sequence table, (2) DNA of protein sequence SEQ ID No.2 in the coded sequence table, (3) nucleic acid sequence capable of hybridizing with the DNA sequence defined by SEQ ID No.1 in the sequence table.

Description

Plant meiotic gene and proteins encoded and application

Technical field

The present invention relates to plant gene and proteins encoded thereof and application, particularly relate to one with regulation and control plant reduction division relevant gene and proteins encoded and its application in the new variety that cultivate plants.

Background technology

Reduction division is that eukaryote forms normal gamogenesis cell, finishes the key link that species are multiplied, and is the basis that crop forms economic yield.On cytology, reduction division is mainly sticked together with the incident of separating several successive by homologous chromosomes joint conference, homologous recombination and karyomit(e) and is formed, and relates to complicated gene regulatory network.In recent years, utilize unicellular eukaryote-yeast in the world, cloned some important meiotic genes, as SPO11, DMC1, ZIP1, REC8 etc., wherein the single gene mutation of most of genes can cause corresponding reduction division process exception, produces lethal spore (royal cell etc., Science Bulletin 2002,46:838-842; Merino etc., PNAS 97:10477-10482; Celerin etc., EMBO 2000,19:2739-2750; Watanabe etc., Nature 1999, and 400:461-464), the proof meiotic gene is the key gene of the biological reproductive characteristic of regulation and control on molecular level.

The Rad21 of fission yeast is first separated and identify Rad21/Rec8 family gene, relevant (Birkenbihl etc. are repaired at first discover it and dna double splitting of chain, Nucl Acids Res 1992,20:6605-6611), then prove RAD21 and other 3 protein protomer SMC1, SMC3 and SCC1 form the adhesin complex body jointly, mediate (the Guacci etc. that stick together between the mitotic division sister chromosome, Cell 1997,91:47-57; Hirano, Annu Rev Biochem 2000,69:115-144; Michaelis etc., cell 1997,91:35-45; Sumara etc., J Cell Biol 2000,151:749-762; Sonoda etc., Dev Cell 2001,1:759-770; Nasmyth, Science 2000,288:1379-1384; Nasmyth, Annu Rev Genet2001,35:673-745).Another homologous gene REC8 of RAD21 is then specific expressed in the reduction division process, composition (the SMC1 of the also specific participation reduction division of its encoded protein adhesin, SMC3 and SCC1 are then total with the mitotic division adhesin), mediation and the chromosomal (Watanabe etc. that stick together of adjusting reduction division, Nature 1999,400:461-464; Buonomo etc., Cell 2000,103:387-98; Cell such as Klein 1999,98:91-103).The mitosis metaphase/the separated enzymic hydrolysis of later stage transit time RAD21, adhesin dissociates from karyomit(e), cause sister chromosome separation (Uhlmann etc., Nature 1999,400:37-42; Uhlmann etc., Cell 2000,103:375-386; Waizeneger etc., Cell 2000,103:399-410; Lee etc., Annu Rev cell Dev Biol2001,17:753-77; Nasmyth, Science 2000,288:1379-1384; Nasmyth, Annu RevGenet 2001,35:673-745) same, when meiosis I mid-term to the later stage transit time, Rec8 at first dissociates from karyomit(e) two arms under the hydrolytic action of separating enzyme, makes homologous chromosomes separated from one another.But the Rec8 in sister strand kinetochore district remain into always the meiosis II later stage (Klein etc., Cell 1999,98:91-103; Watanabe etc., Nature 1999,400:461-464) just disintegrate down from centric region, make sister chromosome separately, and adhesin is not clear from the dissociated mechanism of centric region at present.The REC8 sudden change causes reduction division karyomit(e) to stick together and separating abnormality, and the meiosis I later stage, the separation of sister strand promptly took place; The chromosomal separation of later stage II is at random, thereby (Buonomo etc., Cell 2000,103:387-398) for the active daughter cell that do not have of generation aneuploid.

Up to now, the homologous gene of Rad21/Rec8 from budding yeast (Guacci etc., Cell 1997,91:47-57; Michaelis etc., cell 1997,91:35-45; Cell such as Klein 1999,98:91-103), fission yeast (Birkenbihl etc., Nucl Acids Res 1992,20:6605-6611; Molnar etc., Genetics1995,141:61-73), fruit bat (Warren etc., Gene 2000,250:77-84), nematode (Pasierbek etc., Genes Dev 2001,15:1349-60), Africa xenopus (Losada etc., Genes Dev 1998,12:1986-97), Mammals mouse, people (McKay etc., Genomics 1996,36:305-15; Parisi etc., MolCell Biol 1999,19:3515-3528) and Arabidopis thaliana (Bai etc., plant cell 1999,11:417-30; Bhatt etc., Plant J 1999,19:463-472; Dong etc., Gene 2001,271:99-108) wait in the eukaryote to be separated.They do not have or only have extremely low conservative property on cDNA sequence level, the coded albumen similarity on aminoacid sequence generally is also very low, the homology that 10-22% is only arranged, their conservative property are mainly reflected on N-and the C-end structure territory, and region intermediate does not have conservative property substantially.Discover that although these homogenic sequence homologies are lower, they all have some identical structural domain/functional element: the N-end structure territory (pfam04825) of (1) high conservative; (2) the terminal conserved domain (pfam04824) of C-; (3) region intermediate all has the recognition sequence that separates enzyme, potential PEST sequence, nuclear localization signal etc., these for they regulate karyomit(e) stick together with separate in function all be very important (Zhang etc., J Exp Bot 2004,55:1149-1152).Expression characterization or the difference on the function according to them can be divided into it Rad21 and two subfamilies of Rec8.The Rad21 subfamily works in mitotic division, and the Rec8 subfamily then participates in the reduction division process.All there are the gene of two these families in budding yeast, fission yeast, mouse and philtrum, and one of them belongs to the Rec8 subfamily, and another belongs to the Rad21 subfamily.

SYN1 is the homologous gene of isolated yeast meiotic gene REC8 from the dicotyledons Arabidopis thaliana.But different with zooblast is, the homologous gene of three EAD21/REC8 is arranged in the Arabidopis thaliana, is respectively SYN1, SYN2 and SYN3, and its expression is neither reduction division special, and they also express (Bai etc. in vegetative organ, plantcell 1999,11:417-30; Bhatt etc., Plant J 1999,19:463-472; Dong etc., Gene 2001,271:99-108).In Arabidopis thaliana SYN1 deletion mutant, meiosis prophase I homologous chromosomes joint conference and chromosome condensation are unusual, karyomit(e) sticks together defective and promptly forms a large amount of univalents at prometaphase I, meiosis anaphase I karyomit(e) separates at random, the a large amount of sterile gametophyte (Bai etc. of final generation, plant cell 1999,11:417-30; Bhatt etc., Plant J 1999,19:463-472).Therefore SYN1 may be the homologous gene of Arabidopis thaliana reduction division specific gene REC.But, also know nothing now the function of SYN2 and SYN3.Therefore, homogenic clone of RAD21/REC8 and the function in plant reduction division and mitotic division thereof are to need the further problem of research at present.

Summary of the invention

The purpose of this invention is to provide one with regulation and control plant reduction division relevant gene and proteins encoded thereof.

Plant meiotic gene provided by the present invention, name is called OsRAD21-4, derives from Oryza paddy rice (Oryzasativa L.ssp.japonica), is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 polynucleotide;

2) SEQ ID № in the code sequence tabulation: the DNA of 2 protein sequences;

3) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

The rigorous condition of described height is: with 6 * SSC or (6 * SSPE), 0.1%SDS, 2 * Denhardt solution be 65 ℃ of hybridization, and with 0.1 * SSC, the solution of 0.1%SDS is washed film under 65 ℃.

SEQ ID № in the sequence table: 1 by 2133 based compositions, and its encoder block is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 55-the 1878th bit base.

The proteins encoded of plant meiotic gene provided by the present invention (OsRAD21-4) is the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

2) with SEQ ID № in the sequence table: 2 amino acid residue sequence has the protein of regulation and control plant reduction division function through replacement, disappearance or the interpolation of one to ten amino-acid residue.

SEQ ID № in the sequence table: 2 are made up of 608 amino-acid residues.Wherein, holding 1-the 115th amino acids residue from N is the terminal conserved domain (pfam04825) of N-, holding 554-the 608th amino acids residue from N is C-conserved domain (pfam04824), and OsRad21-4 also include the potential nuclear localization signal (hold 272-the 279th amino acids residue sequence from N: KRKKRRKD), separate enzyme recognition site (hold 411-the 421st amino acids residue sequence: ADDIEKLRGNT and hold 420-the 430th amino acids residue sequence from N from N:

NTSGEYGRDYD), the PEST sequence (hold 511-the 534th amino acids residue sequence from N:

RLSDVGPTPDLLEEIEPTQTPYEK) and a plurality of potential decorating site, as phosphorylation site (CK2, PKC, CAMP etc.), N-myristoylation site and N-glycosylation site etc.

Contain that arbitrary segmental primer also belongs to protection scope of the present invention in expression vector, transgenic cell line and the host bacterium of above-mentioned plant meiotic gene and the amplification plant meiotic gene.

The present invention utilizes RT-PCR and RACE method to be cloned into the homologous gene OsR4D21-4 of a RAD21/REC8 from paddy rice, and this gene is mainly expressed in reproductive organ, and S phase expression amount is the highest before reduction division; Transient expression studies have shown that OsRAD21-4 is a nucleoprotein; RNAi intervention experiment proof OsRAD21-4 is that sister chromosome correctly sticks together in the reduction division process, and normal joint conference of homologous chromosomes and the correct aggegation of karyomit(e) are necessary.This gene can be used to improve plant quality (as producing the s.m.p melon and fruit by transgenic technology, improve the crop contents of essential amino acids, improve the output of leaf type plant etc.), maybe this gene is used to study the control technique (as male and female sterile) of plants ' reproduction development etc.The present invention will have important use at agriculture field and be worth.

Description of drawings

The sxemiquantitative RT-PCR analytical results that Fig. 1 expresses for OsRAD21-4

Fig. 2 detects the result of endogenous OsRad21-4 expression level in the transfer-gen plant for sxemiquantitative RT-PCR

Fig. 3 detects the result of OsRad21-4 protein expression situation in the transfer-gen plant for Western blot

Fig. 4 is the result of the special siRNA of OsRad21-4 in the molecular hybridization detection transfer-gen plant

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and it is synthetic that the primer sequence is given birth to the worker by Shanghai.

The acquisition of the cDNA full length sequence of embodiment 1, OsRAD21-4

Vegetable material: paddy rice

One, the separation of paddy rice grain husk flower RNA

From the paddy rice grain husk that is in meiophase is spent, extract total RNA with Trizol test kit (GIBICO BRL company), remove DNA residual among the RNA with the DNA lytic enzyme (TaKaRa company) of no RNA lytic enzyme subsequently, obtain not having the RNA that DNA pollutes.

Two, the acquisition of the cDNA full length sequence of OsRAD21-4

The acquisition of the cDNA full length sequence of OsRAD21-4 may further comprise the steps:

1, use the Partial cDNA Sequence of the method amplification OsRAD21-4 of RT-PCR, primer sequence is as follows:

WP1：5′-ATGGCACTAAGGCTCTCC-3′；

WP2：5′-ATAGAAGAGTCGGGCAGC-3′

Spending RNA with the paddy rice grain husk that is in meiophase that is extracted is template through the first chain cDNA that reverse transcription obtains, and carries out the RT-PCR amplification under the guiding of primer WP1 and WP2.At first, reverse transcription synthesizes the first chain cDNA, reaction system and reaction conditions are: 5g RNA and 10pmol oligo-dT adapter primer (CTGATCTAGAGGTACCGGATCTTTTTTTTTTTTTTTTT) are mixed, adding sterilized water makes reaction system reach 12 μ L, behind 70 ℃ of insulation 10min, ice bath, add 4 μ L 5X, the first chain damping fluid, 1 μ L 10mM dNTPs and 2uL 0.1mMDTT is behind 42 ℃ of preheating 2min, add 1 μ L SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ L, GIBCO BRL company), 42 ℃ of reaction 50min heat 15min down at 70 ℃ at last, make the reversed transcriptive enzyme inactivation, obtain the first chain cDNA.Be template with institute's synthetic first chain cDNA again, under the guiding of primer WP1 and WP2, carry out pcr amplification, 50 μ L PCR reaction systems are: 1X LA PCR damping fluid (TaKaRa company), 1 μ L, the first chain cDNA, 10pmol WP1,10pmol WP2,200uM dNTPs and 2.5U LATaq archaeal dna polymerase (TaKaRa company), the PCR reaction conditions is: 94 ℃ of 1min of elder generation; 94 ℃ of 1min again, 55 ℃ of 1min, 72 ℃ of 3min, totally 30 circulations; Last 72 ℃ of 10min.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis to be detected, reclaim the also amplified fragments of the about 1600bp of purifying, it is cloned on the carrier pGEM-T (Promega company), obtain containing the segmental recombinant plasmid of recovery, called after W152 checks order to it, and sequencing result shows that expanding fragment length is 1587bp.

2, cDNA sequences Design specificity 3 ' the RACE primer that obtains according to step 1 (WP3:

5 '-GAAGTACAGTTGCCATCC-3 ', WP4:5 '-AGGCTTTCAGATGTTGGG-3 ') and 5 ' RACE primer (WP5:5 '-ATCCAAATCCTCCAAACG-3 ', WP6:5 '-TCATACTTGGCTTGGGTT-3 '), by further increase 5 ' and the 3 ' end fragment of OsRAD21-4cDNA of RACEs.

1) clone of 3 ' end fragment

The first chain cDNA is a template with step 1 synthetic, carries out the pcr amplification first time, and 50 μ L PCR reaction systems are: 10mM Tris-HCl (pH8.3), 50mM KCl, 2mM MgCl ₂, 0.05%Nonidet P-40,1 μ L, the first chain cDNA, 10pmol WP3,10pmol adapter primer (CTGATCTAGAGGTACCGGATC), 200uMdNTPs and 2.5U LATaq archaeal dna polymerase (TaKaRa company), the PCR reaction conditions is: 94 ℃ of 1min of elder generation; 94 ℃ of 1min again, 55 ℃ of 1min, 72 ℃ of 3min, totally 30 circulations; Last 72 ℃ of 10min.Again with the first time PCR product be template, carry out the pcr amplification second time, except that primer WP3 is replaced with the WP4, PCR reaction system and reaction conditions are with PCR is identical for the first time.After reaction finishes, to the second time PCR product carry out 1% agarose gel electrophoresis and detect, reclaim the also amplified fragments of the about 560bp of purifying, it is cloned on the carrier pGEM-T, obtain containing the segmental recombinant plasmid of recovery, called after W156 checks order to it, and sequencing result shows that 3 ' end fragment length of the OsRAD21-4cDNA of amplification is 561bp.

2) clone of 5 ' end fragment

Spending RNA with the paddy rice grain husk that is in meiophase that is extracted is template through the first chain cDNA that reverse transcription obtains, and carries out 5 ' RACE amplification.At first, reverse transcription synthesizes the first chain cDNA, reaction system and reaction conditions are: 5g RNA and 2.5pmol WP5 are mixed, adding sterilized water makes reaction system reach 12 μ L, behind 70 ℃ of insulation 10min, ice bath adds 4 μ L 5X, the first chain damping fluid, 1 μ L 10mM dNTPs and 2uL 0.1mM DTT, behind 42 ℃ of preheating 2min, add 1 μ L SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ L, GIBCO BRL company), 42 ℃ of reaction 50min, heat 15min down at 70 ℃ at last, make the reversed transcriptive enzyme inactivation, obtain the first chain cDNA, with GlassMax cartridge (GIBCO-BRL company) the purifying first chain cDNA, remove unnecessary primer.5 ' RACE test kit and reference reagent box specification sheets with GIBCO BRL company carry out 5 ' RACE reaction, and concrete grammar is: at first add poly G tail at 5 of the synthetic first chain cDNA of institute ' end; Again with 5 ' cDNA that end adds poly G tail is that template is carried out the pcr amplification first time, 50 μ L PCR reaction systems are: 1X LA PCR damping fluid (TaKaRa company), the cDNA of 1 μ L tailing, 10pmol WP5,10pmol UAP primer (test kit carries), 200uM dNTPs and 2.5ULATaq archaeal dna polymerase (TaKaRa company), the PCR reaction conditions is: 94 ℃ of 1min of elder generation; 94 ℃ of 1min again, 52 ℃ of 1min, 72 ℃ of 2min, totally 30 circulations; Last 72 ℃ of 10min.Again with the first time PCR product be template, carry out the pcr amplification second time, except that primer WP5 is replaced with the WP6, PCR reaction system and reaction conditions with the first time PCR identical.After reaction finishes, to the second time PCR product carry out 1% agarose gel electrophoresis and detect, reclaim the also amplified fragments of the about 380bp of purifying, it is cloned on the carrier pGEM-T, obtain containing the segmental recombinant plasmid of recovery, called after W155a checks order to it, and sequencing result shows that 5 ' end fragment length of the OsRAD21-4cDNA of amplification is 383bp.

3, the acquisition of the cDNA full length sequence of OsRAD21-4 and PCR thereof identify

The length of utilizing step 1 and step 2 to obtain is respectively 1587bp, overlap between 561bp and the 383bp fragment, obtain the cDNA full length sequence of OsRAD21-4 by assembling, for verifying the exactness of resulting splicing sequence, 5 ' and 3 ' end design primer WP7:5 '-CTCACTCGCTCATCCATT-3 ' and WP8:5 '-CATCTTTGGTCCCCTTGA-3 ' according to this splicing sequence, the first chain cDNA that obtains with step 1 is that template is carried out pcr amplification, after reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis to be detected, reclaim the also amplified fragments of the about 1900bp of purifying, it is cloned on the carrier pGEM-T, obtain containing the segmental recombinant plasmid of recovery, called after W157, it is checked order, sequencing result shows that the sequence of pcr amplified fragment is consistent with the splicing sequence, proof is correct through the cDNA full length sequence of the OsRAD21-4 that splicing obtains, this sequence has SEQ ID № in the sequence table: 1 polynucleotide sequence, SEQ ID № in the sequence table: 1 by 2133 based compositions, its encoder block (ORF) is from 5 ' end 55-the 1878th bit base, coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence, with this albumen called after OsRAD21-4, molecular weight is 68493 Da, and iso-electric point is 5.45.

4, sequential analysis

The cDNA full length sequence of OsRAD21-4 and the aminoacid sequence of proteins encoded (OsRAD21-4) thereof are carried out the BLAST analysis, analytical results shows that the homology of known in OsRAD21-4 and the database is lower, the homology of the aminoacid sequence of its proteins encoded and other homologous protein aminoacid sequence is also lower, and homology has only 10-22%.

But 2 characteristic conserved domains forming this proteinoid all exist in the aminoacid sequence of OsRAD21-4, wherein, holding 1-the 115th amino acids residue from N is the terminal conserved domain (pfam04825) of N-, holding 554-the 608th amino acids residue from N is the terminal conserved domain (pfam04824) of C-, and OsRad21-4 also includes the potential nuclear localization signal and (holds 272-the 279th amino acids residue sequence from N: KRKKRRKD), separating the recognition site of enzyme (holds 411-the 421st amino acids residue sequence: ADDIEKLRGNT and holds 420-the 430th amino acids residue sequence from N from N: NTSGEYGRDYD), the PEST sequence (is held 511-the 534th amino acids residue sequence from N: RLSDVGPTPDLLEEIEPTQTPYEK) and a plurality of potential decorating site, as phosphorylation site (CK2, PKC, CAMP etc.), N-myristoylation site and N-glycosylation site etc., these elements that experimental results show that in following embodiment are transported to the assembling that participates in the adhesin complex body in the nucleus for OsRAD21-4 albumen, the cell cycle the mid-term/identification of the separated enzyme of later stage transit time and cutting and all be essential in after this degraded, and these processes coordinate mutually, regulate karyomit(e) in the reduction division jointly and stick together and correctly the carrying out of sepn process.

Embodiment 2, vivoexpression OsRAD21-4 albumen and prepare its polyclonal antibody

The plasmid W157 that contains the OsRad21-4 full length cDNA sequence that confirms through order-checking that makes up with embodiment 1 is a template, under the guiding of primer WP9:5 '-CAGAATTCGGAATGCGTTTGGAGGAT-3 and primer WP10:5 '-CAGAATTCGGAATGCGTTTGGAGGAT-3 ', carry out pcr amplification, the purpose fragment is handled the flat 5 ' end of benefit with the Klenow enzyme, cut processing with restriction enzyme Sal I enzyme again, be inserted in the prokaryotic expression carrier pGEX-4T-3 (Amersham) of restriction endonuclease sma I and the processing of Sal I double digestion, obtain the recombinant expression vector of OsRAD21-4, called after pGE21-4.Use CaCl ₂Method is with fusion expression vector pGE21-4 transformed into escherichia coli DH5 α competent cell, 37 ℃ of shaking culture in the LB liquid nutrient medium, in being in the culture of logarithmic phase, add IPTG to final concentration be 2mM, induce the proteic expression of OsRad21-4,37 ℃ are continued to cultivate after 2 hours, centrifugal collection thalline, by N,O-Diacetylmuramidase cracking thalline (Worrall, Methods Mol Biol 1996,59:31-7) and utilize Glutathione sepharose 4B affinity column (GST Purification Modules, AmershamBiosciences) and with reference to the step purifying on the operational manual through the GST-OsRAD21-4 of abduction delivering fusion rotein.(Hanly etc., ILAR J 1995 37:93-118), after booster shots repeatedly, obtain the polyclonal antiserum of anti-OsRAD21-4 for fusion rotein that purifying can be obtained and freund's adjuvant hybrid injection new zealand white rabbit.(HiTrapTM Protein-A HP Amersham) and with reference to the specification sheets antagonistic Serum carries out purifying with Protein-A.

The expression characterization analysis of embodiment 3, OsRAD21-4

With paddy rice microtubule protein gene tubA compare (Ding etc., Sex Plant Reprod, 2001,13:285-288), with the expression characterization of the methods analyst OsRAD21-4 of RT-PCR.The specific primer sequence of the OsRAD21-4 that RT-PCR is used is:

WP11 (sense primer): 5 '-CAGAATTCGGAATGCGTTTGGAGGAT-3 ';

WP12 (antisense primer): 5 '-CAGAATTCGGAATGCGTTTGGAGGAT-3 '

Extract paddy rice grain husk flower respectively, leaf, young shoot, root and be in the different reproductive development grain husk flower in period (stamen and carpel formation period, pollen mother cell forms period: comprise the preceding S phase of reduction division, meiophase, monokaryon and two nuclear pollen development period and mature pollen phases) total RNA, be template with the different total RNA that is extracted respectively, reverse transcription synthesizes the first chain cDNA, reaction system and reaction conditions are: 5 μ g RNA and 10pmol oligo-dT adator primer (CTGATCTAGAGGTACCGGATCTTTTTTTTTTTTTTTTT) are mixed, adding sterilized water makes reaction system reach 12 μ L, behind 70 ℃ of insulation 10min, ice bath, add 4 μ L 5X, the first chain damping fluid, 1 μ L 10mM dNTPs and 2uL 0.1mM DTT are behind 42 ℃ of preheating 2min, add 1 μ L SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ L, GIBCO BRL company), 42 ℃ of reaction 50min heat 15min down at 70 ℃ at last, make the reversed transcriptive enzyme inactivation, obtain the first chain cDNA.Be template with institute's synthetic first chain cDNA again, under the guiding of primer WP1 and WP2, carry out pcr amplification, 50 μ L PCR reaction systems are: 1X LA PCR damping fluid (TaKaRa company), 1 μ L, the first chain cDNA, 10pmol WP11,10pmol WP12,200uM dNTPs and 2.5U LATaq archaeal dna polymerase (TaKaRa company), the PCR reaction conditions is: 94 ℃ of 1min of elder generation; 94 ℃ of 1min again, 55 ℃ of 1min, 72 ℃ of 1min, totally 25 circulations; Last 72 ℃ of 10min.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis detects, detected result as shown in Figure 1 (A is that OsRAD21-4 is spending (F) among the figure, leaf (L), young shoot (B), the expression analysis result in the root (R), tubA is reference; B is OsRAD21-4 at the grain husk flower in different reproductive development period and the expression characterization analytical results in the mature pollen grain: swimming lane 1 is stamen and the carpel formation flower in period, swimming lane 2 forms the flower of period and preceding S phase of reduction division for pollen mother cell, swimming lane 3 is the flower of meiophase, swimming lane 4 is that monokaryon and two is examined the pollen development flower in period, swimming lane 5 is the mature pollen grain, tubA is reference), show that OsRAD21-4 expression amount in the grain husk of meiophase is spent is the highest, expression amount is very low in other histoorgan.In the reproductive development process, OsRAD21-4 forms at stamen and carpel promptly higher expression period, reach the highest to the preceding S phase expression amount of reduction division, show that OsRAD21-4 has very high expression amount period in reduction division, very low at the monokaryon and the expression amount in two nuclear pollen development periods, and in mature pollen, detect expression less than OsRAD21-4.

Embodiment 4, the OsRAD21-4 meticulous cell expressing site in flower pesticide

On the basis that the expression characterization of embodiment 2OsRAD21-4 is analyzed, further use the meticulous expression site of this gene of methods analyst in floral organ of in situ hybridization.Concrete grammar is: at room temperature, with FAA (50% ethanol, 5% propionic acid and 3.7% formaldehyde) the fixing flower pesticide 16 hours of stationary liquid, dewater step by step with ethanol subsequently, by the standard method waxdip, vegetable material is embedded among the paraffin (Sigma company), and section (thickness is 10 microns) at last is attached to section on the slide glass (Sigma company) through Methionin bag quilt.Dewaxing, rehydration and in situ hybridization press Meyerowitz (Meyerowitz, Plant Mol Biol Rep, 1988, method 5:242-250) is carried out.Plasmid W152 is made its linearizing with digestion with restriction enzyme, and make template with it, with T7 or SP6RNA polysaccharase (Boehringer mannheim, Indianapolis, IN, USA) justice and the antisense probe of synthetic digoxigenin labeled, 42 ℃ of hybridization 20 hours, used hybridization solution composition was: 50%formamide (formaldehyde), 5%dextransulfte (T 500), 1%block reagent (Boehringer Mannheim, Indianapolis, IN, USA), 150mg/mL tRNA (Sigma company), 300mM NaCl, 1mM EDTA and 10mM Tris (pH7.5).(IN USA) detects hybridization signal for Boehringer Mannheim, Indianapolis to use the DIG detection kit.The in situ hybridization result shows that OsRAD21-4 only expresses before reduction division and in sexual cell that meiophase, grain husk was spent and the tapetal cell, do not express in other cell, shows that OsRAD21-4 is a paddy rice reduction division predominant expressed gene.

The acquisition of embodiment 5, OsRAD21-4RNAi transgenic paddy rice

One, the structure of OsRAD21-4RNAi interference carrier

1, the structure of RNAi interference carrier

At first using restriction enzyme EcoR I and Hind III that carrier pBI121 (CLONTECH company) is carried out enzyme cuts, obtain one and contain the dna segment that 35s promotor, Gus reporter gene and no end son, with this fragment called after P35s::GusA::Tnos, then it is connected with the carrier pCAMBIA-1300 (CAMBIA company) that handles through the same enzyme double digestion, obtain containing the recombinant vectors of P35s::GusA::Tnos, called after p1300W2.

Be template with pCAMBIA-1302 (CAMBIA company) again, under the guiding of primer to (5 '-TCTAGAGGATCCCCACTAGTGGTACCTAAGGGCCCTATGAGTAAAGGAGAAGAACT TTTCACTGGAG-3 ' and 5 '-ATTCGAGCTCGGTTACCATTTAAATGTCGACGGCGCGCCTTATTTGTATAGTTCAT CCATGAAATG-3 '), pcr amplification green fluorescence protein gene (GFP) segment.Behind GFP sheet cracked ends restriction enzyme Xba I and SacI double digestion, be connected with the carrier p1300W2 that handles through same enzyme double digestion, obtain can be used for making up the carrier of OsRAD21-4RNAi interference carrier, called after p1300MGM.

2, the structure of the amplification of OsRAD21 siRNA encoding gene and OsRAD21-4 RNAi interference carrier

According to the cDNA sequence of the non-conserved regions of OsRad21-4, design two couples of primer WP178F/WP178R (just direction) and WP179F/WP179R (antisense orientation), primer sequence is as follows:

WP178F：5′-AGTCTAGAGGGAATGCGTTTGGAGGAT-3′

WP178R：5′-TAGGTACCTGGGTTGGAAATGCCTGA-3′

WP179F：5′-TAGAGCTCGGGAATGCGTTTGGAGGAT-3′

WP179R：5′-TAGTCGACTGGGTTGGAAATGCCTGA-3′

With W157 is template, respectively under the guiding of primer to WP178F/WP178R and WP179F/WP179R, carry out pcr amplification, obtain the same section cDNA segment (the just recognition site difference of the restriction enzyme at two ends) of the non-conserved regions of OsRad21-4, i.e. the encoding gene of OsRAD21 siRNA.After will cutting with restriction enzyme XbaI and KpnI enzyme the fragment of WP178 amplification with primer, be connected with the carrier p1300MGM that cuts through the same enzyme enzyme, after will cutting with restriction enzyme SacI and SalI enzyme the fragment of WP179 amplification with primer, be connected with the carrier p1300MGM that cuts through the same enzyme enzyme and be connected with the WP178 amplified fragments, obtain the RNAi interference carrier of OsRAD21-4, called after pRAD21-4i.

Two, the acquisition of OsR4D21-4RNAi transgenic paddy rice

The pRAD21-4i plasmid is transformed Agrobacterium EHA105 by freeze-thaw method, do evaluation with the method for PCR after growing bacterial plaque, the used primer of PCR is WP178F and WP190R (WP190R:5 '-TAACCTTCGGGCATGGCAC-3 '), obtain the segmental positive clone of about 800bp through amplification, with the callus of positive colony with the agrobacterium-mediated transformation rice transformation, through the screening of 50ug/mL hygromycin resistance, obtain transforming the rice callus tissue of pRAD21-4i.Through cultivating, obtain the transgenic paddy rice seedling after the regeneration, concrete grammar can be consulted " Hiei etc., Plant J 1994,6:271-282 ".

Three, the detection of OsRAD21-4RNAi transgenic paddy rice

1, the Molecular Detection of transfer-gen plant

The transfer-gen plant that step 2 is obtained extracts genomic dna by micromethod, and as template, under the guiding of primer to WP178F and WP90R, carrying out PCR detects, can amplify about 800bp segmental is transgenic positive strain system, and then utilizes the Totomycin segment of α-32P-dCTP mark to carry out Southern hybridization affirmation for probe to be accredited as the male transgenic line through PCR.

2, the detection of endogenous OsRad21-4 expression level in the transfer-gen plant

At first utilizing sxemiquantitative RT-PCR that step 1 is obtained positive transgenic line analyzes, the first chain cDNA that total RNA of the positive transgenic line of template obtains through reverse transcription, primer is WP11 and WP12, contrast is tubulinA (primer is Tubl:5 '-TCAGATGCCCAGTGACAGA-3 ' and Tub2:5 '-TTGGTGATCTCGGCAACAGA-3 '), (swimming lane WT is the wild-type contrast to detected result as shown in Figure 2, swimming lane R1, R2, R4, R5, R6 is different transgenic line), show that the expression level of the endogenous OsRad21-4 of positive transgenic line reduces compared with the control.Simultaneously, extract above-mentioned positive transgenic line total protein, detect the proteic expression of OsRad21-4 with Western blot, as quantitatively contrast, (swimming lane WT is the wild-type contrast to the result as shown in Figure 3 with tubulin A, swimming lane R11, R12, R14, R15, R16 is different transgenic line), show the also corresponding compared with the control obviously reduction of OsRad21-4 protein expression level of transgenic line.Above-mentioned sxemiquantitative RT-PCR is identical with embodiment 3 with the expression analysis condition.Western blot analytical procedure is as described below.(Proteomics 2002, and method 2:1131-1145) is carried out according to Salekdeh etc. in the extraction of total protein.12% SDS-PAGE electrophoresis separates to total protein that (Laemmli, Nature 1970,227:680-685).Albumen on the glue by semidrying with 2mA/cm ²Current stabilization is transferred on the pvdf membrane (changeing film liquid, 10mM CAPS, 10% (v/v) methyl alcohol), and to change the film time be 1 hour.With film at confining liquid (3%BSA in TBS buffer (20mM Tris-Cl, pH7.5,150mM NaCl)) sealing is 1 hour in, 37 ℃ of incubations 1 hour in the hybridization solution (composition is identical with confining liquid) that contains OsRAD21-4 polyclonal antibody (1: 10000 dilution) then, with TTBS (0.05%Tween-20,20mM Tris-Cl, pH7.5,150mM NaCl) washes film 3 times, each 5 minutes.Then film is transferred to the two anti-(dilutions in 1: 2000 of the goat-anti rabbit that contains alkali phosphatase enzyme mark, magnificent company) 37 ℃ of incubations 1 hour in the hybridization solution are washed film, under these conditions then at TBS (20mM Tris-Cl, pH7.5,150mM NaCl) wash in the damping fluid twice each 5 minutes.In NBT/BCIP colour developing liquid (magnificent company), detect hybridization signal at last.

3, OsRad21-14 holds the detection of different little RNA

Extract total RNA of contrast (wild-type plant) and each positive transgenic line, add final concentration then and be NaCl that 5% PEG8000 and final concentration be 0.5M RNA with the precipitation macromolecule, the supernatant that will contain small molecular weight RNA after centrifugal separates on 8% polyacrylamide gel that (concrete grammar can be consulted: Hamilton etc., Science1999,286:950-952), by half-dried transfer the small molecular weight RNA that is separated to is transferred on the pvdf membrane then, OsRad21-4cDNA segment (the cDNA fragment of the non-conserved regions of OsRad21-4 of embodiment 5 steps 2 amplification) with radio isotope α-32P mark is hybridized detection, (swimming lane WT is the wild-type contrast to the result among the A as shown in Figure 4, swimming lane R1, R2, R4, R5, R6 are different transgenic lines; B represents the consistence of RNA applied sample amount), show that the siRNA molecule of the special OsRad21-4 that about 22nt is arranged in the transgenic line exists, and in not genetically modified contrast strain is, do not detect the existence of corresponding siRNA molecule.This result and above-mentioned sxemiquantitative RT-PCR result and Western blot analytical results coincide.

4, the fertility of transgenic paddy rice and pollen activity thereof detect

Setting percentage to OsRAD21-4 RNAi transgenic rice plant is analyzed, and analytical results shows that the fertility of part RNAi plant is higher, and the fertility of part RNAi plant is had a strong impact on, and 10% of not enough adjoining tree is that have even sterile fully.Pollen activity to the affected transfer-gen plant of fertility finds that by TTC dyeing and I2-KI dyeing detection its pollen activity is lower, has only 10% of normal plant, and pollen granule size heterogeneity, and the pollen number of these strain systems is less.Above result shows that the OsRAD21-4 RNAi interference carrier that changes over to is expressed and generates special siRNA in transgenic paddy rice, cause endogenous OsRad21-4 to express and be suppressed, and finally causes the pollen activity of transfer-gen plant and setting percentage to reduce.

5, the meiotic behavior analysis of transgenic paddy rice

With reference to (Ross etc. such as Ross, Chromosome Res 1996, method 4:551-559) prepares the reduction division karyomit(e) of transgenic positive plant, concrete grammar is: will be in meiophase transfer-gen plant young fringe stationary liquid (methyl alcohol: fixing acetate=3: 1), 10mM citrate buffer solution (pH4.5) flushing back in the above-mentioned damping fluid that contains 0.3% cellulase and 0.3% polygalacturonase in 37 ℃ of digestion 30 minutes.After identical damping fluid flushing, the acetate (on slide glass) that flower pesticide is placed one 60% is to discharge karyomit(e), freezing then peel, use DAPI antifade solution (the 1 μ g/mL DAPI of 5 μ L at last, 50% glycerine, 10mM citrate buffer solution and 25 μ g/mL DABCO) dyeed 5 minutes, (ZEISS AXIOSKOP40 under fluorescent microscope, HBO100) observe the chromosome behavior that is in reduction division sporule in period, discovery begins chromosome condensation in the leptotene stage of meiosis prophase I, promptly show unusually, then more obvious to zygotene stage and pachytene stage; Diplotene stage, there was univalent in homologous chromosomes joint conference defective; Separate thereby exist many univalents in advance at the diakinesis stage homeologous chromosome, meiosis I mid-term; Chromosome dyad can not be arranged on the equatorial plate, and chromosome dyad takes place to separate in advance; Later stage, there was chromosome bridge in I, the chromosome dyad segregation lag, and karyomit(e) is in the two poles of the earth maldistribution of subsequently cell; There is small nut in two daughter cell size heterogeneities of the dyad that forms.Similar phenomenon in meiosis II existence and meiosis I, two sub-cell fission simultaneously are asynchronous, therefore finally cause the generation of the pollen granule of unusual tetrad (there is small nut etc. in big or small heterogeneity) and non-activity.The above results shows that the fertility of transfer-gen plant is low, and OsRAD21-4 is a meiotic gene.Simultaneously the mitotic division behavior of transfer-gen plant is analyzed, do not found that tangible mitotic division is unusual.

The transient expression experiment of embodiment 6, onion epidermis

Utilize primer WP286F (5 '-CGCAGATCTCTCACTCGCTCATCCATT-3 ') and WP286R (5 '-GCTCTAGACATCTTTGTCCCCTTGA-3 '), with plasmid W157 is template obtains OsRad214 by pcr amplification total length ORF, it is carried out enzyme with restriction enzyme BglII and XbaI cuts, segment after then enzyme being cut connects and is contained with carrier pCAMBIA-1302 (CAMBIA company has identical sticking end through the segment behind SpeI or the XbaI enzyme cutting) after restriction enzyme BglII and SpeI enzyme are cut

The fusion expression vector of P35s::OsRad21-4::GFP, and show that through sequence verification the total length ORF fragment and the on position in carrier pCAMBIA-1302 thereof of OsRad214 of amplification is correct.Earlier this fusion expression vector is imported in Agrobacterium, (Plant J 2000, method 22:543-551) imports it in onion epidermis and cultivate again to utilize Yang etc. then.Utilize fluorescent microscope (Zeiss) to consider and detect the GFP fluorescent signal under the mating plate at FITC, result's GFP signal in control cells (only importing the onion epidermis cell of pCAMBIA-1302 carrier) is uniformly distributed in nucleus and the tenuigenin, and the GFP signal mainly is present in the nucleus in the cell that imports the OsRad21-4::GFP fusion expression vector, shows that OsRAD21-4 is a nucleoprotein.

Sequence table

<160>2

<210>1

<211>2133

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa L.ssp.japonica)

<400>1

cagcgcctcc?acttctcact?cgctcatcca?ttccctccct?cctcacgatc?gaggatgttc 60

tactcgcacc?agctcctcgc?gcggaaggct?ccgctcggcc?agatatggat?ggcggcgacg 120

cttcactcga?agatcaaccg?gaagcggctt?gacaagctcg?acatcatcaa?aatctgtgag 180

gagattttga?acccgtcggt?acccatggca?ctaaggctct?ccggaattct?catgggtggt 240

gtggcgatcg?tgtacgagag?gaaggtgaag?gctctgtatg?atgatgtgtc?tcggtttctg 300

attgagatca?acgaggcatg?gcgggtcaag?ccagtcgcag?accccaccgt?acttcccaag 360

ggcaaaaccc?aagccaagta?tgaagcagta?acactgccag?agaatatcat?ggatatggat 420

gtggagcagc?ccatgctttt?ctcagaggct?gatactacaa?ggttccgggg?aatgcgtttg 480

gaggatttgg?atgaccaata?cattaatgtc?aacctagacg?atgatgactt?ctcgcgcgct 540

gagaatcatc?accaagctga?tgcagaaaat?atcaccctgg?ctgataattt?cgggtctggg 600

cttggagaga?ctgatgtgtt?caatcgtttt?gagagattcg?acataacaga?tgatgatgca 660

actttcaatg?tcactcctga?tggacaccca?caggttccaa?gtaatctggt?tccttctcca 720

cctaggcagg?aagactctcc?tcagcaacaa?gaaaaccatc?atgctgcctc?atcccctctt 780

cacgaagaag?ctcaacaagg?gggggcatct?gtaaaaaatg?agcaagagca?gcagaagatg 840

aagggtcagc?aacctgctaa?atcatcaaag?agaaaaaaac?gtaggaaaga?tgatgaggtg 900

atgatggata?acgaccagat?aatgatccca?ggaaatgtat?atcaaacatg?gctgaaggat 960

ccatcaagcc?tcattaccaa?aaggcacaga?atcaacagta?aagttaatct?tattcggtca 1020

atcaagataa?gagacctcat?ggacttgccc?ctcgtttctc?taatatcttc?cttggagaag 1080

tcacccttag?aattttatta?tcctaaggaa?cttatgcagc?tttggaagga?atgtactgaa 1140

gtcaagtccc?caaaagctcc?atcttcagga?gggcagcagt?catcatcacc?agaacaacag 1200

caaagaaact?tgcctcctca?ggcatttcca?acccagcctc?aggttgataa?tgacagggaa 1260

atgggatttc?acccagtgga?ctttgcagat?gacatcgaaa?aactccgagg?aaacactagt 1320

ggggaatatg?gaagagatta?tgatgctttt?cacagtgatc?atagtgttac?tcctggaagt 1380

cctgggctaa?gtcgcaggtc?tgcttcaagc?tctggtggct?ctggacgggg?atttacgcag 1440

ttggatccag?aagtacagtt?gccatccgga?aggtccaaga?ggcagcattc?atctggaaaa 1500

agctttggga?acctcgatcc?agttgaagaa?gaattcccat?tcgagcaaga?acttagagat 1560

ttcaagatga?gaaggctttc?agatgttggg?ccaactccag?acctgctgga?agaaatcgaa 1620

cctactcaaa?ccccatatga?aaagaaatcc?aatcctatcg?accaggtcac?acaatcaatc 1680

cactcgtacc?tcaagctaca?ctttgacacc?ccaggggcct?cacagtctga?atcattaagt 1740

cagctagcac?atgggatgac?tacagcaaag?gctgcccgac?tcttctatca?agcatgcgtt 1800

ttagcaactc?atgattttat?caaggttaac?cagctggaac?catacggaga?catcttgatc 1860

tcgaggggac?caaagatgtg?acatcctaaa?tgtttaatag?ttggacaatt?ttctgctgtt 1920

gtggttcttg?cacatctcgt?gttatgtatg?gtgtttaagt?ttgcacatga?agtttagaaa 1980

aacttcgaag?gaaggcttgt?aggtacgttg?tattggggca?tgtatttaac?actagttttg 2040

tgtaggaaag?aaattttgta?agtatgctga?atggcttgat?agctggtgca?aggttaaagt 2100

taaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa?aaa 2133

<210>2

<211>608

<212>PRT

＜213〉Oryza paddy rice (Oryza sativa L.ssp.japonica)

<400>2

Met?Phe?Tyr?Ser?His?Gln?Leu?Leu?Ala?Arg?Lys?Ala?Pro?Leu?Gly?Gln

1 5 10 15

Ile?Trp?Met?Ala?Ala?Thr?Leu?His?Ser?Lys?Ile?Asn?Arg?Lys?Arg?Leu

20 25 30

Asp?Lys?Leu?Asp?Ile?Ile?Lys?Ile?Cys?Glu?Glu?Ile?Leu?Asn?Pro?Ser

35 40 45

Val?Pro?Met?Ala?Leu?Arg?Leu?Ser?Gly?Ile?Leu?Met?Gly?Gly?Val?Ala

50 55 60

Ile?Val?Tyr?Glu?Arg?Lys?Val?Lys?Ala?Leu?Tyr?Asp?Asp?Val?Ser?Arg

65 70 75 80

Phe?Leu?Ile?Glu?Ile?Asn?Glu?Ala?Trp?Arg?Val?Lys?Pro?Val?Ala?Asp

85 90 95

Pro?Thr?Val?Leu?Pro?Lys?Gly?Lys?Thr?Gln?Ala?Lys?Tyr?Glu?Ala?Val

100 105 110

Thr?Leu?Pro?Glu?Asn?Ile?Met?Asp?Met?Asp?Val?Glu?Gln?Pro?Met?Leu

115 120 125

Phe?Ser?Glu?Ala?Asp?Thr?Thr?Arg?Phe?Arg?Gly?Met?Arg?Leu?Glu?Asp

130 135 140

Leu?Asp?Asp?Gln?Tyr?Ile?Asn?Val?Asn?Leu?Asp?Asp?Asp?Asp?Phe?Ser

145 150 155 160

Arg?Ala?Glu?Asn?His?His?Gln?Ala?Asp?Ala?Glu?Asn?Ile?Thr?Leu?Ala

165 170 175

Asp?Asn?Phe?Gly?Ser?Gly?Leu?Gly?Glu?Thr?Asp?Val?Phe?Asn?Arg?Phe

180 185 190

Glu?Arg?Phe?Asp?Ile?Thr?Asp?Asp?Asp?Ala?Thr?Phe?Asn?Val?Thr?Pro

195 200 205

Asp?Gly?His?Pro?Gln?Val?Pro?Ser?Asn?Leu?Val?Pro?Ser?Pro?Pro?Arg

210 215 220

Gln?Glu?Asp?Ser?Pro?Gln?Gln?Gln?Glu?Asn?His?His?Ala?Ala?Ser?Ser

225 230 235 240

Pro?Leu?His?Glu?Glu?Ala?Gln?Gln?Gly?Gly?Ala?Ser?Val?Lys?Asn?Glu

245 250 255

Gln?Glu?Gln?Gln?Lys?Met?Lys?Gly?Gln?Gln?Pro?Ala?Lys?Ser?Ser?Lys

260 265 270

Arg?Lys?Lys?Arg?Arg?Lys?Asp?Asp?Glu?Val?Met?Met?Asp?Asn?Asp?Gln

275 280 285

Ile?Met?Ile?Pro?Gly?Asn?Val?Tyr?Gln?Thr?Trp?Leu?Lys?Asp?Pro?Ser

290 295 300

Ser?Leu?Ile?Thr?Lys?Arg?His?Arg?Ile?Asn?Ser?Lys?Val?Asn?Leu?Ile

305 310 315 320

Arg?Ser?Ile?Lys?Ile?Arg?Asp?Leu?Met?Asp?Leu?Pro?Leu?Val?Ser?Leu

325 330 335

Ile?Ser?Ser?Leu?Glu?Lys?Ser?Pro?Leu?Glu?Phe?Tyr?Tyr?Pro?Lys?Glu

340 345 350

Leu?Met?Gln?Leu?Trp?Lys?Glu?Cys?Thr?Glu?Val?Lys?Ser?Pro?Lys?Ala

355 360 365

Pro?Ser?Ser?Gly?Gly?Gln?Gln?Ser?Ser?Ser?Pro?Glu?Gln?Gln?Gln?Arg

370 375 380

Asn?Leu?Pro?Pro?Gln?Ala?Phe?Pro?Thr?Gln?Pro?Gln?Val?Asp?Asn?Asp

385 390 395 400

Arg?Glu?Met?Gly?Phe?His?Pro?Val?Asp?Phe?Ala?Asp?Asp?Ile?Glu?Lys

405 410 415

Leu?Arg?Gly?Asn?Thr?Ser?Gly?Glu?Tyr?Gly?Arg?Asp?Tyr?Asp?Ala?Phe

420 425 430

His?Ser?Asp?His?Ser?Val?Thr?Pro?Gly?Ser?Pro?Gly?Leu?Ser?Arg?Arg

435 440 445

Ser?Ala?Ser?Ser?Ser?Gly?Gly?Ser?Gly?Arg?Gly?Phe?Thr?Gln?Leu?Asp

450 455 460

Pro?Glu?Val?Gln?Leu?Pro?Ser?Gly?Arg?Ser?Lys?Arg?Gln?His?Ser?Ser

465 470 475 480

Gly?Lys?Ser?Phe?Gly?Asn?Leu?Asp?Pro?Val?Glu?Glu?Glu?Phe?Pro?Phe

485 490 495

Glu?Gln?Glu?Leu?Arg?Asp?Phe?Lys?Met?Arg?Arg?Leu?Ser?Asp?Val?Gly

500 505 510

Pro?Thr?Pro?Asp?Leu?Leu?Glu?Glu?Ile?Glu?Pro?Thr?Gln?Thr?Pro?Tyr

515 520 525

Glu?Lys?Lys?Ser?Asn?Pro?Ile?Asp?Gln?Val?Thr?Gln?Ser?Ile?His?Ser

530 535 540

Tyr?Leu?Lys?Leu?His?Phe?Asp?Thr?Pro?Gly?Ala?Ser?Gln?Ser?Glu?Ser

545 550 555 560

Leu?Ser?Gln?Leu?Ala?His?Gly?Met?Thr?Thr?Ala?Lys?Ala?Ala?Arg?Leu

565 570 575

Phe?Tyr?Gln?Ala?Cys?Val?Leu?Ala?Thr?His?Asp?Phe?Ile?Lys?Val?Asn

580 585 590

Gln?Leu?Glu?Pro?Tyr?Gly?Asp?Ile?Leu?Ile?Ser?Arg?Gly?Pro?Lys?Met

595 600 605

Claims (8)

1, plant meiotic gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

2, plant meiotic gene according to claim 1 is characterized in that: described plant meiotic gene has SEQ ID № in the sequence table: 1 dna sequence dna.

3, the proteins encoded of the described plant meiotic gene of claim 1 is characterized in that: be one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

2) with SEQ ID № in the sequence table: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and the protein with regulation and control plant reduction division function.

4, albumen according to claim 3 is characterized in that: described albumen has the SEQ ID № in the sequence table: 2 amino acid residue sequences.

5, the expression vector that contains the described plant meiotic gene of claim 1.

6, the transgenic cell line that contains the described plant meiotic gene of claim 1.

7, the host bacterium that contains the described plant meiotic gene of claim 1.

8, the application of the described plant meiotic gene of claim 1 in the new variety that cultivate plants.

Images