CN1273595C - Meiosis gene of paddy, coded protein and application - Google Patents

Abstract

The present invention discloses a rice meiosis gene OsSPO11-1, a coded protein thereof and an application thereof. The rice meiosis gene OsSPO11-1 is one of the following nucleotide sequences: 1) a DNA sequence of SEQ ID No: 1 in a sequence list; 2) polynucleotide for coding an SEQ ID No. 2 protein sequence in the sequence; 3) a DNA sequence which has more than 90% of homology with the DNA sequence limited by SEQ ID No: 1 in the sequence list and codes the same functional protein. The coded protein OsSPO11-1 of the rice meiosis gene OsSPO11-1 is a protein with an SEQ ID No. 2 amino acid residue sequence in the sequence list, or a protein which is used for substituting, deleting or adding one or a plurality of amino acid residues of the SEQ ID No. 2 amino acid residue sequence, has the same activity with the SEQ ID No. 2 amino acid residue sequence and is derived from SEQ ID No. 2. The gene of the present invention can be widely used for regulating and controlling the reproduction characteristic of a plant, improving plant quality, controlling the reproduction of foreign invasion living things, etc., and has important application value.

Description

A kind of paddy rice meiotic gene and proteins encoded and application

Technical field

The present invention relates to a kind of meiotic gene and proteins encoded and application in the biological technical field, particularly a kind of paddy rice meiotic gene OsSPO11-1 and proteins encoded and application.

Background technology

Reduction division is that eukaryote forms normal gamogenesis cell, finishes the key link that species are multiplied, and is the basis that crop forms economic yield.On cytology, reduction division mainly is made up of homologous chromosomes joint conference, homologous recombination and three successive processes of chromosome segregation, relates to complicated gene regulatory network.In recent years, utilize unicellular eukaryote-yeast in the world, some important meiotic genes have been cloned, as SPO11, DMC1, ZIP1 etc., wherein the single gene mutation of most of genes can cause corresponding reduction division process exception, produce lethal spore (royal cell etc., Science Bulletin 2002,46:838-842; Merino et al., PNAS 97:10477-10482; Celerin et al., EMBO 2000,19:2739-2750; Watanabe et al., Nature 1999,400:461-464), show that on molecular level meiotic gene is the key gene of the biological reproductive characteristic of regulation and control.

SPO11 is a gene specific expressed in meiotic cell of cloning from yeast at first, its encoded protein is key protein (the Atcheson et al. of catalysis reduction division homologous chromosomes reorganization, Proc Natl AcadUSA 1987,84:8035-8039; Keeney et al., Cell 88:375-384); The reduction division homologous chromosomes of SPO11 single-gene mutant can not joint conference and normal separation, and the reduction division failure finally produces lethal spore.In yeast rad50 mutant, because the dna double splitting of chain that produces can not be repaired normally, Spo11 is found the 5 ' end (Keeney S et al., Cell 1997.88:375-384) that is attached to the fracture chain.Though also there is not direct biochemical evidence to confirm that Spo11 has participated in the shearing of dna double chain directly at present, but compare and the structural analysis discovery by sequence, Spo11 is homologous protein (the BergeratA et al. of topological enzyme among the Sulfolobus shibatae (TopVIA) subunit, Nature 1997,386:414-417).TopVIA is the proteic new family of TopoII, has to TopoII albumen similar biochemical characteristic is arranged.The Tyr that participates in the avtive spot of transesterification reaction in Spo11 and TopoII all be guard (Keeney S et al., Cell 1997,88:375-384; Bergerat A et al., Nature 1997,386:414-417).After the dna double splitting of chain produced, under the effect of restriction endonuclease, 5 ' end of fracture chain was sheared, thereby (Bishop DK etc., Cell 1992,69:439-456) for 3 ' end of generation different lengths.3 ' is terminal at Dmc1 subsequently, under the assistance of Rad51 and other associated protein, intrudes into homologous chromosomes, finishes reparation (Hong EL et al., J Biol Chem 2001, the 276:41906-1912 of dna double splitting of chain; Shinohara A, Cell, 1992,69:457-470).

At present, the homologous gene of SPO11 is also respectively from the people, mouse, and nematode, (Cervantes MD et al., Mol Cell, 2000,5:883-888 are separated in fruit bat and the Arabidopis thaliana; McKim and Hayashi-Hagihara, Science 1998,279:876-878; Derburg et al., 1998; Keeney S et al., Genomics1999,61:170-182; Hartung F et al., Nucleic Acids Res 2000,28:1548-54; GrelonM et al., EMBO J 2001,20:589-600).Discover that although these homogenic sequence homologies are lower, 5 structural domains that play a crucial role are all guarded in its function.AtSPO11 is the homologous gene of yeast meiotic gene SPO11.But different with zooblast is, the homologous gene that three SPO11 are arranged in the Arabidopis thaliana, be respectively AtSPO11-1, AtSPO11-2 and AtSPO11-3, and its expression is neither reduction division special, also expresses (Hartung F et al., Nucleic Acids Res in vegetative organ, 2000,28:1548-1554).In Arabidopis thaliana AtSPO11-1 deletion mutant, the formation of meiosis prophase I synaptonemal complex is influenced, and I in anaphase, and chromosomal separation is at random, produce a large amount of sterile gametophytes (EMBO J, 2001,20:589-600).Therefore, AtSPO11-1 may be the key gene that participates in the chromosomal DNA double-strand break in Arabidopis thaliana reduction division.The phenotype of AtSPO11-3 deletion mutant and brassinolide synthetic with to experience the defective mutant similar, the dwarfing and the cell that all show as the mutant plant can not carry out features such as elongation growth, therefore the adjusting (Yin Y et al., 2002) of AtSpo11-3 possibility participation oil rape lactone signal conduction is relevant.But to the function of AtSPO11-2, that understands now is also few.Therefore, the function of SPO11 homologous gene in plant reduction division also needs further research.

Summary of the invention

The purpose of this invention is to provide a kind of paddy rice meiotic gene OsSPO11-1 and proteins encoded thereof.

Paddy rice meiotic gene OsSPO11-1 is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences.

The dna sequence dna of sequence 1 comprises the 5 ' non-translational region of 97bp by 1714 based compositions in the sequence table, the 3 ' non-translational region of 600bp and the ORF of 906bp.ORF is from 5 ' end 208 bit bases-1114 bit base.

Paddy rice meiotic gene OsSPO11-1 proteins encoded OsSPO11-1, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.

SEQ ID № in the sequence table: 2 are made up of 302 amino-acid residues, and molecular weight is 34kDa, and iso-electric point is 8.06.Comprise 5 functional motif conservative in the Spo11 family protein, also comprise key amino acid residue relevant among the functional motif I with enzymic activity.

The clone and the expression vector that contain paddy rice meiotic gene OsSPO11-1 also belong to protection scope of the present invention.

Paddy rice meiotic gene OsSPO11-1 of the present invention is that first example derives from the monocotyledonous gene that relates to the reorganization of reduction division homologous chromosomes; The present invention all expresses in maiotic sexual cell and mitotic meristematic cell at cellularstructure level proof paddy rice meiotic gene OsSPO11-1, but expression amount is than higher in maiotic sexual cell, and expression amount is the highest in the early stage pollen mother cell of reduction division; The RNAi analytical proof OsSPO11-1 that carries out with this cDNA sequence participates in the initial of dna double splitting of chain in the control paddy rice reduction division homologous recombination process, and the gene function disappearance causes female male sterile.Though OsSPO11-1 encoded protein matter OsSpo11-1 is lower with the Argine Monohydrochloride sequence homology of other homologous genes encoding of known function, has only 10-20%, but 5 conservative functional motifs forming this proteinoid all exist in the aminoacid sequence of OsSpo11-1, and are arranged in the key amino acid residue Tyr (Tyr152 of OsSpo11-1) that Motif I participates in transesterification reaction and also guard.

Gene of the present invention can be used for and other controlling element, construct expression vector as constitutive promoter (as 35S promoter) or organ specific promoters, or be used to produce cenospecies to improve the output of crop by technical regulation plant reproductive characteristics (as male sterile, female sterile or female male sterile) such as transgenic technology, sense-rna or RNAi, or the fertility of controlling plant as required, as make willow sterile, reduce the pollution of seeds (hair of white) to the city; The reproduction of the quality of improvement plant (, improving crop contents of essential amino acids etc.), command economy plant (as tobacco) as producing the s.m.p melon and fruit, the reproduction that improves its economic worth or control exotic invasive biology reduces its invasion property etc.; Having important use is worth.

Embodiment

The separation of embodiment 1, rice Os SPO11-1cDNA

1) separation of RNA

With Trizol test kit (GIBICO-BRL biotech company, the U.S.) extract total RNA from the grain husk of paddy pollen parent cell meiophase is spent, the DNase (TaRaKa Bioisystech Co., Ltd (Dalian)) with no RNase removes DNA residual among the RNA subsequently.The RNA that removes behind the DNA is used for the synthetic first chain cDNA of reverse transcription.

2) the segmental separation of cDNA

With budding yeast Spo11 aminoacid sequence is probe, carries out the TBLAST search in NCBI paddy rice database, obtains a paddy rice EST (expressed sequence tags, expressed sequence tag) (AU075487).This EST has the incomplete ORF of 106 amino-acid residues of a coding.Aminoacid sequence of inferring and the sequence of budding yeast Spo11 have 30% consistence, comprise Spo11/TopVIA family protein total functional motif III and IV (Bergerat, et al, 1997), showing that this EST is the part of paddy rice SPO11 homologous gene cDNA, is OsSPO11-1 with its corresponding unnamed gene here.In order to obtain 3 ' and the 5 ' end sequence of OsSPO11-1cDNA, according to the synthetic Auele Specific Primer WP1 of est sequence (5 '-ACGACATTCACTTGGTGGACC-3 ')/WP2 (5 '-TCTTGACTTGGATGGGCTCC-3 ') and 5 ' RACE primer WP6 (5 '-AGCCCATCCAAGTCAAGA-3 ')/WP7 (5 '-GGTCCACCAAGTGAATGT CGT-3 '), by RACEs (rapid amplification ofcDNA ends-RACEs) (Forhman MA.et al.Proc Natl Acad Sci USA, 1988,85:8998-9002) further separate its 5 ' and 3 ' and hold.

The separation of 3 ' end: 5 μ gRNA and 10M oligo-dT adapter (CTGATCTAGAGGTACCGGATCTTTTTTTTTTTTTTTTT) primer are mixed, adding sterilized water makes volume of mixture reach 12 μ l, 70 ℃ of insulation 10min, go in the ice bath, add 4 μ l, 5 * the first chain damping fluids (first strand buffer), 1 μ l 10mMdNTPs, 2 μ l 0.1mM DTT behind 42 ℃ of preheating 2min, add 1 μ l SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ l, GIBCO-BRL biotech company, the U.S.), 42 ℃ of reaction 50min, the synthetic first chain cDNA, at last at 70 ℃ of heating 15min, inactivation reversed transcriptive enzyme.This cDNA is as pcr template.The volume 50 μ l of PCR mixture contain 10mM Tris-HCl, pH8.3,50mM KCl, 2mM MgCl for the first time ₂, 0.05%NonidetP-40,1 μ l cDNA, 10pmoles WP1,10pmoles adapter primer (CTGATCTAGAGGTACCGGATC), 200 μ M dNTPs and 2.5U Pfu DNA polymerase (5U/ μ l, Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Reaction conditions is: 94 ℃ of pre-sex change 1min; Subsequently at 94 ℃ of sex change 1min, 52-60 ℃ of annealing 1min, 72 ℃ are extended 2min 3sec, carry out 30 circulations altogether; At last at 72 ℃ of insulation 10min.For the second time PCR use 1 μ l for the first time the product of PCR to make template and WP2 and adapter primer right, other condition with the first time PCR identical.Obtain 3 ' end cDNA segment of OsSPO11-1cDNA for the second time behind the pcr amplification, behind the agarose electrophoresis purifying, according to a conventional method it is cloned into pGEM-T (Zhou MY et al., BioTechniques 19,34.) on the carrier, obtain recombinant plasmid W03, order-checking according to a conventional method, it is 678bp that W03 inserts segmental length.

5 ' terminal segment cloning of OsSPO11-1cDNA: 5 μ g RNA are mixed with 2.5pmoles WP6, adding sterilized water makes volume of mixture reach 12 μ l, 70 ℃ of insulation 10min, go in the ice bath rapidly, add 4 μ l, 5 * the first chain damping fluids (first strand buffer), 1 μ l 10mM dNTPs, 2 μ l 0.1mM DTT behind 42 ℃ of preheating 2min, add 1 μ l SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ l, GIBICO-BRL biotech company, the U.S.), 42 ℃ of reaction 50min, the synthetic first chain cDNA, at last at 70 ℃ of heating 15min, inactivation reversed transcriptive enzyme.With GlassMax cartridge (GIBICO-BRL biotech company, the U.S.) the purifying first chain cDNA, remove unnecessary primer.Press the guidance of GIBCO-BRL 5 ' RACE test kit (GIBICO-BRL biotech company, the U.S.), add poly G tail at 5 of the first chain cDNA ' end.The cDNA of tailing is as pcr template.The volume 50 μ l of PCR mixture contain 10mM Tris-HCl, pH8.3,50mM KCl, 2mM MgCl for the first time ₂, 0.05%Nonidet P-40, the cDNA of 1 μ l tailing, 10pmolesWP6,10pmoles UAP primer, 200uMdNTPs and 2.5U Pfu DNA polymerase (5U/ μ l, Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Reaction conditions is: 94 ℃ of pre-sex change 1min; Subsequently at 94 ℃ of sex change 1min, 52-60 ℃ of annealing 1min, 72 ℃ are extended 2min 3sec, carry out 30 circulations altogether; At last at 72 ℃ of insulation 10min.For the second time PCR use 1 μ l for the first time the product of PCR to make template and WP7 and UAP primer right, other condition with the first time PCR identical.Obtain 5 ' end cDNA segment of OsSPO11-1cDNA for the second time behind the pcr amplification, behind the agarose electrophoresis purifying, according to a conventional method it is cloned on the pGEM-T carrier, obtains recombinant plasmid W19, order-checking according to a conventional method, it is 883bp that recombinant plasmid W19 inserts segmental length.

Sequencing result shows, it is respectively 883 and 678bp that recombinant plasmid W19 and W03 insert segmental length, utilizes the overlap of they and EST, obtained the cDNA sequence of OsSPO11-1 total length by assembling.

3) analysis of the molecular structure of OsSPO11-1 gene and proteins encoded

OsSPO11-1cDNA total length 1714bp, open reading frame (ORF) is from 5 ' end, 208 bit base to 1114 bit bases.Its encoded polypeptides OsSpo11-1 forms (SEQ ID NO.2) by 302 amino acid, and molecular weight is 34kDa, and iso-electric point is 8.06.OsSPO11-1cDNA comprises an intron; OsSpo11-1S has lacked OsSpo11-1L N-and has held preceding 56 amino-acid residues, other sequence is consistent with the latter, and 246 amino acid residue sequences of this unanimity have comprised all 5 conservative functional motifs (Bergerat etal.1997) of Spo11/TopVIA albumen.Further find with the PROSITE software analysis, OsSpo11-1S has 3 N-glycosylation sites, (NKSR (20-23), NYSR (104-1-7), NISV (129-132)), 3 protein kinase C phosphorylation site (SER (9-11), TNR (123-125), SLR (155-157)), 2 Tyrosylprotein kinase II phosphorylation sites (SRQE (22-25), SNVE (60-63)).OsSpo11-1L also contains 3 identical N-glycosylation sites, but contains 5 protein kinase C phosphorylation sites (TSK (11-13), TER (16-18), SER (65-67), TNR (179-181), SLR (211-213)), 6 Tyrosylprotein kinase II phosphorylation site (SSSD (2-5), TSKDA (11-14), SYSD (43-46), SDQD (45-48), SRQE (78-81), SNVE (116-119)), also contain a Tyrosylprotein kinase phosphorylation site RVLEPKSY (37-44) in addition.Therefore, OsSpo11-1L may be regulated by different enzymes with OsSpo11-1S, thereby brings into play different biological functions, the reduction division of common adjusting and controlling rice and mitoticly normally carry out.

The expression analysis of embodiment 2, OsSPO11-1

Detect the expression of OsSPO11-1 in paddy rice grain husk flower, leaf, young shoot and root with RT-PCR.The RT-PCR primer is WP45F (5 '-TGCAGGTGAGAAGAGTAAATG-3 ') and WP45R (5 '-ATCAGAAATTGCCTGATCTG-3 ').TubA compares with the paddy rice microtubule protein gene, and used justice and antisense primer are respectively TCAGATGCCCAGT GACAGA and TTGGTGATCTCGGCAACAGA.

Total RNA according to the extraction of the method in embodiment 1 step 1) grain husk flower, leaf, young shoot and root carries out the synthetic of cDNA then.With 4 μ g RNA and 0.5 μ g oligo-(dT) ₁₅Primer mixes, and adds sterilized water and makes volume of mixture reach 12 μ l, 70 ℃ of insulation 10min, go in the ice bath, add 4 μ l, 5 * the first chain damping fluids (first strandbuffer), 1 μ l 10mM dNTPs, 2 μ l 0.1mM DTT behind 42 ℃ of preheating 2min, add 1 μ l SuperScriptII RNase H-reversed transcriptive enzyme (200U/ μ l, GIBICO-BRL biotech company, the U.S.), 42 ℃ of reaction 50min, the synthetic first chain cDNA, at last at 70 ℃ of heating 15min, inactivation reversed transcriptive enzyme.The first chain cDNA is as the template of PCR.The PCR reaction mixture of 50 μ l contains 1 μ l cDNA template, 10pmoles sense primer, 10pmoles antisense primer, the LATaq archaeal dna polymerase of 400 μ M dNTPs, 1 * GC PCR damping fluid and 2.5U (TaKaRa Bioisystech Co., Ltd (Dalian)).The PCR reaction conditions is 94 ℃ of pre-sex change 1min; 94 ℃ of 1min, 55-60 ℃ of 1min, 72 ℃ of 2min 30sec, 30 circulations; 72 ℃ of 10min.The PCR product detects through 1% agarose electrophoresis.Experimental result shows that OsSPO11-1 expression amount in the early stage grain husk of reduction division is spent is the highest, and expression amount is also higher in blade, and expression amount is lower in young shoot, and expression amount is minimum in root.

For the OsSPO11-1 full length cDNA sequence of verifying that we obtain by splicing, we above-mentioned be template with the first chain cDNA, with the product purification of WP45F and WP45R primer amplification and be connected on the pGEM-T carrier, obtained the identical clone of OsSPO11-1 full length cDNA sequence who obtains with splicing through order-checking.

In order accurately to locate OsSPO11-1 expression tissue and cell site in spending, the paddy rice grain husk flower of getting each developmental stage carries out following experiment.At room temperature,, dewater step by step subsequently, press the standard method waxdip, at last material is embedded among the paraffin (Sigma, St.Louis, the U.S.) to 100% ethanol with the fixing flower pesticide 16 hours of FAA (50% ethanol, 5% propionic acid and 3.7% formaldehyde) stationary liquid.Slice thickness is 10 millimeters.Section is attached on the slide glass of Methionin bag quilt (Sigma, St.Louis, the U.S.).

Dewaxing, rehydration and in situ hybridization press Meyerowitz (Meyerowitz, Plant Mol Biol Rep, 1988, method 5:242-250) is carried out.Make template with linearizing W19, with the justice and the antisense probe of T7 or the synthetic digoxigenin labeled of SP6RNA polysaccharase (Boehringermannheim, Indianapolis, IN, the U.S.).42 ℃ of hybridization 20 hours.The hybridization solution composition is: 50%formamide (formaldehyde), 5%dextran sulfte (T 500), 1%block reagent (Boehringer Mannheim, Indianapolis, IN, USA), 150mg/ml tRNA (Sigma, St.Louis, the U.S.), 300mM NaCl, 1mM EDTA and 10mM TrispH7.5.

Use DIG detection kit (Boehringer Mannheim, Indianapolis, IN, the U.S.) to detect hybridization signal.Experimental result shows that OsSPO11-1 just has very strong expression signal at pollen mother cell formation stage, and the preprophase of to reduction division, the expression amount of OsSPO11-1 reaches the highest.After, along with the carrying out of developmental stage, expression amount reduces gradually, to monokaryon late period, almost can't see its expression signal.At megasporocyte and ovary very strong expression signal is arranged also.In addition, grow the expression that also detects OsSPO11-1 in the vascular bundle cells of early stage tapetal cell and different floral organs.Simultaneously, during with just probe hybridization, various organizing all do not have hybridization signal.The OsSPO11-1 gene of preliminary explanation paddy rice has outside the function of yeast and the reorganization of animal SPO11 generegulation reduction division homologous chromosomes, may be also relevant with the adjusting of somatocyte development.

Embodiment 3, the RNAi expression vector adjusting and controlling rice fertility of utilizing OsSPO11-1 to make up

1) separation of RNA

With Trizol test kit (GIBICO-BRL, biotech company, the U.S.) extract total RNA from the grain husk of pollen mother cell meiosis is spent, (TaRaKa Biotechnology (Dalian) Co. Ltd) removes DNA residual among the RNA to the DNase of the no RNase of usefulness subsequently.The RNA that removes behind the DNA is used for the synthetic first chain cDNA of reverse transcription.

2) the first chain cDNA's is synthetic

5 μ g RNA and 10 μ M oligo-dTadapter (CTGATCTAGAGGTAC CGGATCTTTTTTTTTTTTTTTTT) primers are mixed, adding sterilized water makes volume of mixture reach 12 μ l, 70 ℃ of insulation 10min, go in the ice bath, add 4 μ l, 5 * the first chain damping fluids (first strand buffer), 1 μ l 10mM dNTPs, 2 μ l 0.1mM DTT behind 42 ℃ of preheating 2min, add 1 μ l SuperScript II RNase H-reversed transcriptive enzyme (200U/ μ l, GIBCO-BRL biotech company, the U.S.), 42 ℃ of reaction 50min, the synthetic first chain cDNA, at last at 70 ℃ of heating 15min, inactivation reversed transcriptive enzyme.

3) the segmental acquisition of purpose cDNA

According to the OsSPO11-1 full length cDNA sequence of Seq No.1, synthetic primer WP164F:5-tag ctc tag aggaat gcc atg cgg aat tg-3 (containing the XbaI point of contact)/WP164R:5-aag tgg tac cag ccc tta ctttgc tgc caa g-3 (containing the KpnI point of contact) and WP165F:5-tag cga gct cgg aat gcc atg cgg aattg-3 (containing the SacI point of contact)/WP165R:5-aag tgt cga cag ccc tta ctt tgc tgc caa g-3 (containing the SalI point of contact).According to a conventional method with present embodiment step 2) in the synthetic first chain cDNA be that template is carried out pcr amplification.

To be connected with product forward after enzyme is cut accordingly of primer WP164F and WP164R amplification RNAi carrier p1300MGM (by pCAMBIA1300, CAMBIA, Australia); And the product of WP165F and WP165R amplification is reversely connected on the identical carrier after corresponding enzyme is cut, and is separated by a linker between the two, and promotor is 35S.Above-mentioned PCR reaction mixture is 50 μ l, contains 1 * PCR damping fluid, 1 μ l OsSPO11-1D plasmid (50ng), the 10pmoles sense primer, the 10pmoles antisense primer, 200uM dNTPs, 2.5 Taq of unit archaeal dna polymerase (5U/ μ l, Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), mixture is at 94 ℃ of pre-sex change 1min, subsequently at 94 ℃ of 1min, and 55-60 ℃ of 1min and 72 ℃ of 2min30sec, 30 circulations are extended 10min at 72 ℃ at last.

4) structure of RNAi expression vector

Cut the cDNA fragment that is increased by WP164F and WP164R with restriction enzyme XbaI and KpnI at 37 ℃ of enzymes, its forward is connected on the RNAi carrier p1300MGM that same enzyme is cut, promotor is 35S; Cut the cDNA fragment that increases by WP165F and WP165R at 37 ℃ of enzymes with restriction enzyme SacI and SalI, it is reversely connected on the RNAi carrier p1300MGM that same enzyme is cut, the cDNA fragment intermediate phase that is connected with forward is every the long linker of a 700bp, and a shared promotor.

5) acquisition of genetic transformation and transgenic plant

With the RNAi expression vector (p1300MGMS1) that builds,, obtain the callus of conversion through card Na mycin resistance screening by agrobacterium-mediated transformation rice transformation callus.Further cultivate according to a conventional method and obtain regeneration plant.Carry out PCR and northern blot hybridization according to ordinary method, further detect the plant that obtains changeing OsSPO11-1RNAi.

6) detection of transfer-gen plant

Use I ₂-KI and TTC chromoscopy pollen activity in conjunction with the detection and the analysis of setting percentage, prove that RNAi can cause plant male sterile.

Sequence table

<160>2

<210>1

<211>1714

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>1

gcggatgaca?ttgcttgtat?ttgcaggtga?gaagagtaaa?tgaaaatttt?gtcctagggg 60

cacaagcata?tatcctgttc?tacaacaggt?atcgtagttc?attttgacaa?tatgtgtgcc 120

tttatgtgag?tttgaaaatc?tgaacttcat?tttcaggaaa?gaagaggcca?aatcattcga 180

tgaggtttta?gcttttgctg?ctacagctat?gtcttcatct?gatgccgtgc?ctacatcaac 240

ttcaaaagat?tacactgaaa?gaacattatc?acctgaagta?tcgtctgctg?ctctgtcatg 300

ttggattgat?gctgcacggg?tccttgagcc?caagagttac?tcagaccagg?atatcctaga 360

aaaatatatc?atttgtatgg?accgtgacag?ttcagatgta?tctgagagga?taaggaatgc 420

catgcggaat?tgtaatgagt?ccagacagga?gtatcatttt?aatctcccta?caacggatgg 480

acctttttat?gatgacaact?tggggcagta?ctgtcttctt?cggggagcta?gatttcgaac 540

cattagtaca?agcagtaatg?tagaagcgaa?gagagatagg?gctgttagaa?tgcacttcct 600

tctttctgaa?atcttaaaac?tcctacagct?gaaaaaagtg?attgacgttg?gagctattgg 660

ctatctggag?aaatttaagt?ttgggaatta?ttccaggagt?gctcttttac?ggcgaattaa 720

tgatgcatgt?atgctcttgg?ggactaacag?attatccctt?aatatctcag?ttatgtcaag 780

aggatctatc?attgggccag?tgctgttcaa?agttggagaa?gatgtgatga?ttgatgcaag 840

cttaagggct?gtacagattc?cacacgacat?tcacttggtg?gaccatatta?agttgaaaaa 900

accagtcagc?tttgttcttg?ttgttgaaaa?actatcaata?tttaacatgc?ttgtcaatct 960

taactttcat?gtcacacaca?attgcataat?catcactgga?tgtggaaaac?ctgatatggc 1020

aacaagaggt?gcagttttta?aacttaatta?ttgcttgcca?gtcaaagttt?atatccttgc 1080

tgatcttgac?ttggatgggc?tccagatata?cttataaact?tggcagcaaa?gtaagggctt 1140

ttgagaactt?tgtgttgcat?ctagagatct?tatatggctg?ggtgctagac?cagaagattc 1200

tctactttta?caagaaccca?atgaatttac?cagagtgcag?cagaaatctc?ttactgatct 1260

tcgtgattct?cttcccaata?tttcggacag?agatcgtcta?aacactgtgt?tggactggaa 1320

ctttacattg?aatctgcatg?acattcttga?ttatgagaat?attgtagagt?atttgactaa 1380

tcgaatggca?gagtttgaag?atccttgatg?gagaaagatc?tgacctcagc?tgtttgccca 1440

taagtgaagc?tgaagatggg?ttgccaaacg?tgtgtcgcca?tttatgccac?ttgtatattt 1500

tgcacgattg?catcttgttt?actgcaatag?gcgatactgt?gccagtgtgc?caccatctgg 1560

atgatatccc?ctactgactg?tagttctcat?tctgggtaat?tctaattctg?gtttttaaga 1620

gtatgctgta?acgtaggagc?aatacctctt?tgctgataag?agtttaacag?atcaggcaat 1680

ttctgattac?ttaaaaaaaa?aaaaaaaaaa?aaaa 1714

<210>2

<211>302

<212>PRT

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>2

Met?Ser?Ser?Ser?Asp?Ala?Val?Pro?Thr?Ser?Thr?Ser?Lys?Asp?Tyr?Thr

1 5 10 15

Glu?Arg?Thr?Leu?Ser?Pro?Glu?Val?Ser?Ser?Ala?Ala?Leu?Ser?Cys?Trp

20 25 30

Ile?Asp?Ala?Ala?Arg?Val?Leu?Glu?Pro?Lys?Ser?Tyr?Ser?Asp?Gln?Asp

35 40 45

Ile?Leu?Glu?Lys?Tyr?Ile?Ile?Cys?Met?Asp?Arg?Asp?Ser?Ser?Asp?Val

50 55 60

Ser?Glu?Arg?Ile?Arg?Asn?Ala?Met?Arg?Asn?Cys?Asn?Glu?Ser?Arg?Gln

65 70 75 80

Glu?Tyr?His?Phe?Asn?Leu?Pro?Thr?Thr?Asp?Gly?Pro?Phe?Tyr?Asp?Asp

85 90 95

Asn?Leu?Gly?Gln?Tyr?Cys?Leu?Leu?Arg?Gly?Ala?Arg?Phe?Arg?Thr?Ile

100 105 110

Ser?Thr?Ser?Ser?Asn?Val?Glu?Ala?Lys?Arg?Asp?Arg?Ala?Val?Arg?Met

115 120 125

His?Phe?Leu?Leu?Ser?Glu?Ile?Leu?Lys?Leu?Leu?Gln?Leu?Lys?Lys?Val

130 135 140

Ile?Asp?Val?Gly?Ala?Ile?Gly?Tyr?Leu?Glu?Lys?Phe?Lys?Phe?Gly?Asn

145 150 155 160

Tyr?Ser?Arg?Ser?Ala?Leu?Leu?Arg?Arg?Ile?Asn?Asp?Ala?Cys?Met?Leu

165 170 175

Leu?Gly?Thr?Asn?Arg?Leu?Ser?Leu?Asn?Ile?Ser?Val?Met?Ser?Arg?Gly

180 185 190

Ser?Ile?Ile?Gly?Pro?Val?Leu?Phe?Lys?Val?Gly?Glu?Asp?Val?Met?Ile

195 200 205

Asp?Ala?Ser?Leu?Arg?Ala?Val?Gln?Ile?Pro?His?Asp?Ile?His?Leu?Val

210 215 220

Asp?His?Ile?Lys?Leu?Lys?Lys?Pro?Val?Ser?Phe?Val?Leu?Val?Val?Glu

225 230 235 240

Lys?Leu?Ser?Ile?Phe?Asn?Met?Leu?Val?Asn?Leu?Asn?Phe?His?Val?Thr

245 250 255

His?Asn?Cys?Ile?Ile?Ile?Thr?Gly?Cys?Gly?Lys?Pro?Asp?Met?Ala?Thr

260 265 270

Arg?Gly?Ala?Val?Phe?Lys?Leu?Asn?Tyr?Cys?Leu?Pro?Val?Lys?Val?Tyr

275 280 285

Ile?Leu?Ala?Asp?Leu?Asp?Leu?Asp?Gly?Leu?Gln?Ile?Tyr?Leu

290 295 300

Claims (11)

1, a kind of paddy rice meiotic gene OsSPO11-1 is one of following nucleotide sequences:

1) SEQ ID № in the sequence table: 1 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences.

2, gene according to claim 1 is characterized in that: described paddy rice meiotic gene OsSPO11-1 is SEQ ID № in the sequence table: 1 dna sequence dna.

3, paddy rice meiotic gene OsSPO11-1 proteins encoded OsSPO11-1, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.

4, OsSPO11-1 according to claim 3 is characterized in that: described OsSPO11-1 is SEQ ID № in the sequence table: 2.

5, the transgenic cell line that contains the described gene of claim 1.

6, contain the described expression carrier of claim 1.

7, expression vector according to claim 6 is characterized in that: described carrier is the RNAi expression vector.

8, the described gene of claim 1 is in the developmental application of regulation and control plant anther.

9, the application of the described gene of claim 1 in regulation and control plant reproductive characteristic.

10, application according to claim 9 is characterized in that: described plant is the exotic invasive biology.

11, the application of the described gene of claim 1 in the improvement plant quality.