CN1687128A - Nucleus factor-kB p50 subunit combination peptide, preparation and application thereof - Google Patents

Abstract

The present invention relates to nuclear factor-K Bp50 subunit conjugated peptide, its preparation and application, in more concrete, it is a small polypeptide which can be specifically conjugated with nuclear factor-k Bp50 subunit and can be used for inhibiting its activity. Its amino acid sequence can be referred to sequence table.

Description

Nf-kB p50 subunit binding peptide and preparation thereof and application

Technical field

The present invention relates to field of medicaments, particularly relate to a kind of treatment with nuclear Factor-Kappa B (NF-κ B) p50 subunit antagonist peptide, more specifically, relate to and a kind ofly can and suppress its active small-molecular peptides with nuclear Factor-Kappa B p50 subunit specific combination.The invention still further relates to the preparation and the application of this nuclear Factor-Kappa B p50 subunit antagonist peptide.

Background technology

NF-κ B is a kind of transcription factor that is prevalent in nearly all cell cytosol, be the convergent point of multiple signal transduction pathway, have the function of the multiple participation immunne response of regulation and control, inflammatory reaction, virus replication, apoptosis and propagation and the related gene expression that grows.The protein dimer that NF-κ B system is made of two kinds of Rel family proteins.Difference according to aspects such as structure, function and synthesis modes, the Rel protein family can be divided into two classes: a class is precursor protein p105 and p100, its C art end contains ankyrin repeat (ankin repeat motif), can become sophisticated p50 and p52 by the proteolysis process cracking of ATP dependence.Such hypoproteinosis transactivation domain does not have the function that independent activated gene is transcribed; Another kind of is RelA (p65), Rel (c-Rel), v-Rel and RelB, and its C-terminal contains one or more trans-activation domains (transactivationdomain), has the function that independent activated gene is transcribed ^[1]

When cell is in quiescent condition, main and κ B arrestin (the I κ B of NF-κ B _s) in conjunction with forming tripolymer, be present in the tenuigenin in the non-activity mode.When cell is subjected to that multiple outer signals such as proinflammatory cytokine, virus, intracellular toxin, ultraviolet ray, oxygenant and radioactive rays stimulates and when starting the cell second messenger system, I κ B _sPhosphorylation and degraded take place under the effect of I kappa b kinase (IKK), and NF-κ B loses I κ B _sStrictness control and be activated, and displacement enters in the nucleus, its subunit forms ring texture and combines the expression of efficiently inducing pro-inflammatory cytokine (as TNF, GM-CSF, IL-1 β, IL-6, IL-11, IL-17 etc.), chemokine (as IL-8, RANTES, MIP-1 α, MCP-2 etc.), adhesion molecule (as ICAM-1, VCAM-1, ELAM-1 etc.), immunity receptor (as IL-2R) and participating in the plurality of enzymes (as NO synthetic enzyme, cyclooxygenase etc.) of inflammatory response cascade amplification with privileged site in the target gene promoters ^[2]NF-κ B institute some albumen of inductive can further reverse and activate NF-κ B, cause the expansion and the continuity of inflammatory reaction.Based on above-mentioned cognition, many scholars think that the transcriptional activity that suppresses NF-κ B will open up new approach for the treatment of inflammatory relative disease.In addition, NF-κ B also plays a significant role in apoptosis and propagation, it can suppress the apoptosis of cell by the expression of anti-apoptotic genes expressions such as direct upregulation of apoptosis supressor (c-IAP1, c-IAP2 and IXAP), TNF receptor associated factor (TRAF1 and TRAF2), zinc finger protein A20, super manganese oxide dismutase, Bcl-2 homologue A1/Bfl-1 and IEX-IL ^[3]In oncotherapy, chemotherapy and radiation can make the NF-kB activation, causes tumour cell to chemotherapy resistance and insensitive to radioactive rays.Therefore, suppress the transcriptional activity of NF-κ B, the anti-apoptosis capacity of reduction tumour cell be can yet be regarded as and improved the good plan of cancer drug therapy effect ^[4]

Because activating in the generation of numerous disease and evolution, the powerful transcriptional control function of NF-κ B, the transition of NF-κ B playing the part of important effect: as chronic inflammatory diseases such as rheumatic arthritis, asthma, chronic glomerulonephritis, helicobacter pylori related gastritis, inflammatory bowel diseases ^[5,6,7,8], acute inflammation diseases such as Sepsis, septic shock, acute glomerulonephritis ^[9], Alzheimer ' s disease ^[10], atherosclerosis ^[11], systemic erythema is from body immunological diseases such as lupus ^[12]All excessive or continuous activation is closely related with the generation of cancer in NF-κ B with development.In addition, NF-κ B has also participated in transcribing and duplicating in cells infected such as rhinovirus, influenza virus, Epstein-Barr virus, cytomegalovirus, adenovirus, HTL virus and HIV virus, plays an important role in the infection of these viruses and pathogenic course ^[13]

In view of generation and the developing latent effect of NF-κ B in above-mentioned disease, be target spot with the associated protein in NF-κ B and the signal transduction pathway thereof, the medicine of research and development NF-κ B relative disease has become the research focus in this area.At present external relevant be that the antagonism therapeutic strategy of target spot mainly comprises the following aspects with NF-κ B ^{[14,15,16,17]}: (1) uses traditional anti-inflammatory drug---and hormonal medicaments such as glucocorticosteroid are the activity of part antagonism NF-κ B directly or indirectly; (2) anti-oxidant treatment: as antioxidant---acetylcysteine, acetylsalicylic acid sodium salicylate and tetramethyleneimine two thiocarbamate (Pyrrolidinedithiocarbamate, PDTC) etc. as the inhibitor of NF-κ B, wherein PDTC has been subjected to numerous investigators' favor as the inhibitor of NF-κ B; (3) formation and the activity of inhibition I κ K: the antisense nucleic acid as target I κ K α, the formation of I κ K α be can stop, thereby phosphorylation and the degradation process of I κ B alleviated or alleviate, finally reach the purpose that suppresses the NF-kB activity; (NF-κ B essential modifier is the adjusting albumen of I κ K albumen composition NEMO) to the essential adjusting of NF-κ B albumen, and the function of keeping I κ is played an important role.May etc. have designed the anti-inflammatory polypeptide at NEMO, this polypeptide comprise NEMO in conjunction with the territory (NEMO binding domain, NBD), it can combine with NEMO, stops being connected of NEMO and I κ K β, thereby suppresses activity and the follow-up effect thereof of I κ K; (4) degraded of minimizing I κ B: thus the epoxomicin of some proteasome inhibitor such as MG101, MG115, MG132, PS-341, lactacystin and discovery recently all can pass through the activity of the degraded antagonism NF-κ B of inhibition I κ B, and some serpin such as TLCK (N alpha-p-tosyll-L-lysinechloromethyl ketone), TPCK (N-tosyl-L-phenylalanine chloromethyl ketone) and SLPI also have similar function; (5) generation of promotion I κ B: use the adenovirus expression carrier of I κ B α, make I κ B α dominant negative mutant overexpression, can obviously suppress nuclear displacement and the follow-up effect thereof of NF-κ B.(6) suppress the synthetic of NF-κ B: can combine with gene and the mRNA of coding NF-κ B as antisense oligodeoxyribonucleotide at p50 and p65, and then the transcribing of blocking gene, translation process, finally suppress the formation of NF-κ B.Design can be carried out cutting damage to the mRNA of coding NF-κ B, in the formation of mRNA level blocking-up NF-κ B at the ribozyme of NF-κ B family high conserved region.

Above-mentioned is that the therapeutic strategy of target spot has shown curative effect in various degree with NF-κ B in experimentation on animals and cell in vitro culture systems.But all there is the not good enough problem of specificity in above-mentioned measure.In fact, obtain best result of treatment and reduce system toxicity as much as possible, then should note the specificity of NF-κ B target treatment.As glucocorticosteroid is the potent inhibitor of NF-κ B, but whole body has the side effect of upsetting internal secretion and substance metabolism when using ^[18]And more having specificity to the retarding effect of NF-kB activity, antioxidant can not say ^[19], experimentation on animals shows that PDTC has very strong toxic side effect.Proteasome, it also has other many important function except degradable I κ B, so arrestin enzyme corpusculum activity will cause the potential serious side effects ^[5]Although there is the scholar to think that I κ K, I κ B are specific to the adjusting of NF-κ B, but research does not so far still have enough evidences and shows that I κ K, I κ B do not possess regulating effect to other protein molecular, and the measure of sure target I κ K, I κ B that therefore just can not be definite is exactly specific to the intervention of NF-kB activity.The synthesis strategy that suppresses NF-κ B is specific for NF-κ B, but in some acute inflammatory reaction diseases, the activation of NF-κ B (rather than synthetic) process (the NF-κ B → activation of non-activity goes into examine → to combine with DNA → the promotor gene expression in the tenuigenin) is even more important, and the synthesis strategy that therefore suppresses NF-κ B is not optimal selection.Being not difficult to find out that from the whole activated channel of NF-κ B NF-κ B is specific with combining of DNA cis element, also is that NF-κ B starts the only way which must be passed that target gene is transcribed.Have only NF-κ B is implemented direct intervening measure with combining of DNA cis element, just can reach specificity truly.The upstream pathway of NF-kB activation intervened then be difficult to reach this purpose.

The heterodimer that is formed by p50 and p65 two subunits is typical case's representative of NF-κ B, is most important a kind of in the NF-κ B form of ownership, almost is present in all cells in the body, and its content is far above other dimer.The N-terminal of this heterodimer can constitute 1 loop domain, is combined with the DNA base specific by its mediation.The crystalline diffraction analysis shows that p50/p65 heterodimer and immunoglobulin kappa chain genetic enhancer κ B sequence-specific bonded mode are: 5 of the Arg-54 of p50 subunit, Arg-56, Tyr-57, Glu-60, His-64 and Lys-241 amino-acid residue and κ B sequence 5 ' end '-G _-5G _-4G _-3A _-2C _-1-3 ' base series specific combination; The Arg-33 of p65 subunit, Arg-35, Arg-36, Glu-39 and Arg-187, with 5 of κ B sequence 3 ' end '-T _{+ 1}T _{+ 2}C _{+ 3}C _{+ 4}-3 ' 4 base pair specific combination.In addition, by the loop domain that the aminoterminal and the dimerization structural domain of NF-kB p50/p65 heterodimer constitutes jointly, also can non-ly discern DNA ribose phosphoric acid skeleton specifically ^[20]Promptly this loop domain that is made of jointly p50 and p65 N-terminal has formed the DNA binding domains of NF-κ B, mediates itself and the combining of cis-acting elements, and it should be noted that this specificity combination that is combined into.NF-κ B activation target gene at first needs the cis-acting elements in the DNA binding domains identification target gene promoters zone, and combination with it, and the back is down auxiliary the p65 trans-activation domain, the expression of activation target gene.In the cohesive process of NF-κ B (p50/p65 heterodimer) and its cis-acting elements κ B motif, the p50 subunit plays a major role therein.Therefore,, then certainly will be able to reach the effect of antagonism NF-κ B transcriptional activity, finally reach the purpose that suppresses NF-κ B regulate target gene expression and treat the acute or chronic inflammation relative disease if obtain can antagonism p50 subunit and its cis-acting elements bonded polypeptide for we ^[20]

Foundation, maturation of a kind of strong instrument of studying protein interaction that emerges along with the later stage eighties 20th century---yeast-two hybrid technique and developing finally becomes possibility to the screening operation of NF-κ B antagonism polypeptide.Yeast two-hybrid system has very high sensitivity, can detect faint and of short duration protein-protein interaction, and protein interactions betides in the yeast cell born of the same parents and/or in the nuclear in this system.Compare with prokaryotic cell prokaryocyte, the eucaryon yeast cell to proteinic translation and processing more near mammalian cell, with it is that engineering bacteria research protein interactions is with better physiological status near mammalian cell, promptly keep the natural folded state of protein, make protein-protein interaction more near the true horizon in the mammalian cell.Therefore, the interaction of using between this systematic study protein has obtained using more and more widely, and to the screening of target protein interaction protein or polypeptide in the born of the same parents, this system is more first-selected especially ^[21]NF-κ B is a nuclear factor, is present in the cytoplasm, but brings into play the transcriptional control function in nucleus.Therefore, we select yeast two-hybrid system for use, are bait protein with NF-κ B p50 conserved domain, screen NF-κ B interaction polypeptide from the random peptide library of one 16 peptide, and identify the function of these polypeptide.We have screened and have obtained 9 kinds of NF-κ B p50 subunit binding peptides at present, and listed here is wherein a kind of p50 binding peptide with antagonism NF-κ B transcriptional activity.

Summary of the invention

The purpose of this invention is to provide can with single-minded combination of nuclear Factor-Kappa B p50 subunit, and can suppress the nuclear Factor-Kappa B antagonism peptide of nuclear Factor-Kappa B activity and institute's regulate gene expression thereof.

Another object of the present invention provides the medical use of this nuclear Factor-Kappa B antagonism peptide.

Nuclear Factor-Kappa B p50 subunit antagonist peptide of the present invention, its aminoacid sequence is as follows:

Asn?Thr?Trp?Gly?Met?Leu?Ser?Leu?Arg?Ile?Ile?Val?Arg?Leu?Val?Arg?Arg?Asn?Ser?Tyr?Tyr?Gly?ThrGln?Asp?Asn?Ser?His?Leu?Ala?Arg?Val?His?Phe?Leu?Leu

The present invention also comprises, the application of nuclear Factor-Kappa B p50 subunit antagonist peptide of the present invention in the medicine of preparation antinuclear factor-κ B.The medicine of described antinuclear factor-κ B is the medicine or the anti-tumor drug of treatment immune correlated disease.Wherein said inflammatory relative disease be Sepsis, septic shock, rheumatic arthritis, asthma, acute and chronic glomerulonephritis, systemic erythema from lupus etc., wherein said tumour is liver cancer, cancer of the stomach, esophagus cancer, breast tumor, bladder cancer, tumor of prostate etc.

The present invention also comprises, contains the pharmaceutical composition of nuclear Factor-Kappa B p50 subunit antagonist peptide of the present invention.Can contain the medicine acceptable carrier in the composition.Composition can exist by pharmaceutical dosage forms in any form, injection preferably, freeze drying injection most preferably, this pharmaceutical dosage forms pharmaceutical composition, can prepare according to the technology of pharmaceutics routine techniques, comprise that with active constituents of medicine polypeptide of the present invention mixes with pharmaceutical carrier, make needed formulation according to the technology of pharmaceutics routine techniques.

Have above-mentioned aminoacid sequence structure polypeptide can with single-minded combination of nuclear Factor-Kappa B p50 subunit, and the combining of blocking-up nuclear Factor-Kappa B and its cis-acting elements, thereby suppress the biologic activity of nuclear Factor-Kappa B, promptly nuclear Factor-Kappa B is regulated and control the activity of various expression of target gene.This kind structural polypeptide both can be with the polypeptide form Individual existence, also can be warm with other albumen and polypeptide, or methylated, modification such as acetylize and amination; or carry out indivedual amino acid whose sudden changes or substitute; or insert the privileged site of protein surface, as the bulge loop district, or be connected with other material.No matter with what form exist, the material that contains this structural polypeptide may show with nuclear Factor-Kappa B p50 subunit and combine, and suppresses the active effect of nuclear Factor-Kappa B.

The present invention obtains and the novel polypeptide that combines of nuclear Factor-Kappa B p50 subunit by the yeast-two hybrid technique screening, and having confirmed that this polypeptide has the bioactive function of the nuclear Factor-Kappa B of inhibition, this medicine for design and development novel anti nuclear Factor-Kappa B is significant.

Result of study shows, the polypeptide that the present invention screens not only can competitive blocking-up nuclear Factor-Kappa B and the combining of its cis-acting elements, also can suppress the target gene expression that nuclear Factor-Kappa B is regulated and control, thereby can become new antinuclear factor-κ B medicine or prodrug, nuclear Factor-Kappa B antagonism peptide of the present invention is with a wide range of applications and vast market prospect in the medicine of making antinuclear factor-κ B.

In addition, nuclear Factor-Kappa B p50 subunit binding peptide of the present invention also has the potential using value as biotechnological formulation, as being used for the affinity purification of nuclear Factor-Kappa B as part, being used for detection of nuclear Factor-Kappa B or the like as probe.

According to nuclear Factor-Kappa B p50 subunit binding peptide aminoacid sequence, the multiple method of obtaining the material of aminoacid sequence of the present invention can be arranged, as solid phase synthesis process, synthetic method in the solution, gene recombination method, and other chemical process is synthetic.Above preparation method can adopt the ordinary method that polypeptide is synthetic and prepare, and as the method in the textbook, preferred manufacturing procedure is listed in the specific embodiments of the invention.

The material that contains this aminoacid sequence can have various application modes, mainly comprise the activity that suppresses nuclear Factor-Kappa B in vitro and in vivo, realize that with various administering modes to suppress the nuclear Factor-Kappa B activity be the disease treatment of purpose, and the detection of nuclear Factor-Kappa B or purifying etc.

The material that contains aminoacid sequence of the present invention also comprises in the application of biomedical aspect:

1, passes through the mode of synthetic or gene recombination, to contain peptide section and other albumen or the peptide fusion of this sequence or carry out chemically modified, being used for to suppress the nuclear Factor-Kappa B activity is the treatment of various inflammatory relative diseases, autoimmune disease, tumour and other relative disease of purpose.

2, with after itself and the agarose coupling, be used for the affine separation of nuclear Factor-Kappa B.

3, with after itself and the indicating label coupling, be used for the evaluation of nuclear Factor-Kappa B.

Description of drawings

Figure 1A is GST fusogenic peptide escherichia coli expression result.M is albumen Marker; GST is pET-42a (+) empty carrier expression product; 1 is GST-binding peptide fusion protein expression products.

Figure 1B is the result of GST fusogenic peptide GST affinitive layer purification.M is albumen Marker; 1,2,3,4,5,6 be respectively GST (pET-42a (+) expression product) purifying before, GST cross post after product, GST purified product, GST-binding peptide purifying before, the GST-binding peptide crosses post after product, GST-binding peptide purified product.

Fig. 2 is the detected result of GST-binding peptide fusion rotein and nuclear Factor-Kappa B p50 subunit bonded biosensor

Fig. 3 detects the specificity bonded result of GST-binding peptide fusion rotein and nuclear Factor-Kappa B p50 subunit for ELISA.GST is pET-42a (+) empty carrier expression product; The GST-binding peptide is a GST-binding peptide fusion protein expression products.

Fig. 4 suppresses the result of experiment curve for the ELISA method detects GST-binding peptide fusion rotein to nuclear Factor-Kappa B p50 subunit and the competition of nuclear Factor-Kappa B cis-acting elements bonded

Fig. 5 detects GST-binding peptide fusion rotein and nuclear Factor-Kappa B p50 subunit interaction result figure for the Pull-down experiment.M, 1,2,3,4,5,6 is respectively the elutriant after elutriant, GST-binding peptide expression product, GST-binding peptide expression product after low molecular weight protein (LMWP) Marker, GST (pET-42a (+) empty carrier) expression product, GST expression product are crossed post liquid, GST and p50 combines crossed post liquid, GST-binding peptide and p50 combines.

Fig. 6 detects the retarding effect that GST-binding peptide fusion rotein is expressed the reactive luciferase reporter gene of nuclear Factor-Kappa B for the luciferase reporter gene experiment.A, B, C, D, E, F, G, H are respectively U937, U937+LPS, U937+LPS+p4-kB-Luc, U937+LPS+p4-kB-Luc+0.5 μ g/mLGST-binding peptide, U937+LPS+p4-kB-Luc+1 μ g/mL GST-binding peptide, U937+LPS+p4-kB-Luc+2 μ g/mL GST-binding peptide, U937+LPS+p4-kB-Luc+4 μ g/mL GST-binding peptide, U937+LPS+p4-kB-Luc+8 μ g/mL GST-binding peptide.

Embodiment

Amalgamation and expression and the purifying of embodiment 1, nuclear Factor-Kappa B p50 subunit binding peptide and GST

According to gene order in conjunction with polypeptide, keeping under the constant situation of polypeptide protein gene coded sequence, according to the intestinal bacteria preference codon, design and synthesize the upstream gene sequence respectively and contain BamH I, the downstream gene sequence contains the complementary DNA fragment of Sal I sticky end, dna sequence dna is as follows, and the synthetic of dna sequence dna synthesized by the limited engineering corporation of last marine life.

FP：

5’-GATCAACACTTGGGGTATGCTGAGCCTGCGTATCATCGTTCGCCTGGTTCGTCGTAACTCCTACTACCGTCGTAACTCCTACTACGGCACCCAGGACAACAGCCACCTGGCACGCGTTCACTTCCTGCTG-3’

RP：

5’-TCGACAGCAGGAAGTGAACGCGTGCCAGGTGGCTGTTGTCCTGGGTGCCGTAGTAGGAGTTACGACGGTAGTAGGAGTTACGACGAACCAGGCGAACGATGATACGCAGGCTCAGCATACCCCAAGTGTT-3’

With aseptic double-distilled water above-mentioned dna sequence dna is dissolved, final concentration is 20 μ M, after get 20 μ l FP and 20 μ l RP in an aseptic EP pipe, thorough mixing, after mixture is put into 94 ℃ of water-bath sex change, room temperature is placed and to be allowed the water-bath naturally cooling, the polypeptide gene sequence can slowly be annealed form double-stranded.With the T4 ligase enzyme polypeptide gene sequence is inserted in the pET 42a carrier of BamH I/Sal I double digestion again, and transformed the E.coli DH-5 α competent cell of CaCl2 method preparation.Several single bacterium colonies of picking carry out enzyme and cut evaluation, and order-checking.To identify that correct recombinant plasmid pET42a/ binding peptide transforms the E.col.BL-21 competent cell of CaCl2 method preparation, single bacterium colony of the fresh conversion of picking is inoculated in 10ml and contains in the LB substratum of 50 μ g/ml sulphuric acid kanamycins, and 37 ℃ of shaking culture are spent the night.Transfer and contain in the LB substratum of 50 μ g/ml sulphuric acid kanamycins in 200ml in 1: 100 ratio bacterium bacterium liquid that will spend the night, 37 ℃ of shaking culture are to OD600 ≈ 0.5～0.6, add IPTG to final concentration be 0.1-0.5mmol/L, move to 30 ℃ and continue to cultivate 4h.Centrifugal collection thalline, thalline can carry out purifying or frozen in-70 ℃.The thalline of the abduction delivering volume by original bacteria liquid 1/10 is resuspended among the PBS, ultrasonication cell behind the back adding 50mmol/L PMSF 15 μ l (6 * 10sec * 40hz), add final concentration again and be 1% Triton X-100,20min gently vibrates, in 4 ℃, 12000r/m is centrifugal, and 15min gets supernatant, add DTT to final concentration be 1mmol/L.Use the affine resin of PBS liquid balance glutathione agarose 4B of 10 times of column volumes simultaneously, after get an amount of above-mentioned supernatant liquor upper prop, make GST-binding peptide fusion rotein and resin-bonded, use the foreign protein of the non-specific combination of PBS liquid flush away of 10 times of column volumes again.Use 10mmol/L reduced glutathion wash-out target protein at last, and logical SDS-PAGE identifies its purity, purifying protein through distilled water fully dialyse remove reduced glutathion after freeze-drying in-20 ℃ of preservations.The SDS-PAGE electrophoresis result shows that the warm albumen of GST-binding peptide is solubility expression, and expression amount is about 24% (Figure 1A) of total protein concentration.Warm purity of protein reaches (Figure 1B) more than 82% behind the GST affinity purification

Embodiment 2, biosensor (Biosensor) detect GST-binding peptide fusion rotein and nuclear Factor-Kappa B p50 subunit Combination

With the Sensor Chip CM 5 bio-sensing sheet Iasys Plus system microjet chuck of packing into, with 60 μ l PBS/T (pH7.4PBS, 0.05% polysorbas20) flushing 3 times, balance 10min treats that baseline walks put down back collection baseline data 5min; EDC and NHS by 1: 1 mixed, are got 40 μ l mixed solutions flushing sample pool 2 times, after in sample pool, add 40 μ l mixed solutions again, keep 7min to activate the vane surface; Gather baseline value 1min 3 times with 50 μ l PBS/T flushing sample pool; With the acetate buffer of 40 μ l 10mM pH5.5 flushing sample pool 3 times, after add 40 μ l acetate buffers again, gather baseline value 1min; The total amount that adding 40 μ l dilute with acetate buffer in sample pool is about the p50 standard protein of 0.5 μ g then; Wash 3 times with PBS/T behind the reaction 20min, and gather baseline value 1min; Tris-Hcl damping fluid with 40 μ l 1M pH8.0 washes sample pool 3 times, and keeps 3min to seal unreacted NHS; With 40 μ l 10mM HCl flushing 3 times, remove the covalently bound p50 standard protein of generation useless residual on the vane; With 50 μ l PBS/T flushing 3 times, gather baseline value 1min, after treating, 4 ℃ of placements carry out association reaction.

With protein binding damping fluid (50mM Tris-HCl, pH7.2,100mM NaCl, 10mM MgCl2,10uM ZncL2,1mM DTT, 0.1% (v/v) NP40) GST-binding peptide fusion rotein is diluted to 1 μ g/mL, get 50 μ l fusion rotein diluents and add sample pool, 25 ℃ of temperature, association reaction 5～10min; Question response is complete, washes sample pool 3 times with 50 μ l protein binding damping fluids, and with the wash-out non-specific binding, the question response curve is walked to put down the back and gathered response curve value 1min; Wash sample pool 3 times with 40 μ L10mM HCl, the regeneration vane; Wash sample pool 3 times with 50 μ l protein binding damping fluids again, gather baseline data 1min, the association reaction of a beginning new round.

Biosensor result shows that p50 antagonism Toplink height of the present invention is affine to be combined with p50, sees Fig. 2.

Embodiment 3, ELISA method detect GST-binding peptide fusion rotein and combine with the specificity of nuclear Factor-Kappa B p50 subunit

It is inferior by hole count to wash the dull and stereotyped bag of ELISA with deionized water, is inverted lithographic plate, and ties plate at a cleaning filter paper arsis, removes remaining moisture content; With PBS damping fluid dilution p50 albumen, concentration is 10 μ g/ml; The bag of p50 albumen to 96 hole elisa plate that adds 100 μ l dilution is by in the hole, and incubated at room 3～4h or 4 ℃ of night incubation are noted water evaporates; With 300 μ l PBS hole flushings 3 times, remove unconjugated p50 albumen; The skim milk powder aqueous solution of preparation 5%, every hole adds 200 μ l, and incubated at room 1h or 4 ℃ of night incubation sealing bags are by the hole; (50mM Tris-HCl, pH7.2,100mM NaCl, 10mM MgCl2,10uM ZncL2,1mM DTT, 0.1% (v/v) NP40) washes plate 5 times with the protein binding damping fluid; The sample detection hole adds GST-binding peptide (dilution of protein binding damping fluid) 100 μ l/ hole, totally 20 holes of 0.5 μ mol/L.Negative control hole adds GST purifying protein (dilution of protein binding damping fluid) 100 μ l/ hole, totally 20 holes of 0.5 μ mol/L.In sample detection hole and negative control hole, add final concentration respectively and be respectively the p50 albumen of 0 μ g/ml, 20 μ g/ml, 100 μ g/ml, 400 μ g/ml, 5 multiple holes of each concentration row, combine with the p50 protein competition ground p50 binding peptide of this p50 albumen by not wrapping quilt and bag quilt and to verify that the proteic specificity of GST-binding peptide and p50 combines, room temperature is in conjunction with 1h; PBST (PBS+0.1%TWEEN-20) washes monoclonal antibody (being diluted in PBS at 1: 1000) the 100 μ l/ holes that add anti-GST behind the plate 3 times, incubated at room 1h; PBST washes sheep anti-mouse igg (being diluted among the PBS by description of product requirement) the 100 μ l/ holes that add the HRP mark behind the plate 3 times, incubated at room 1h; PBST washes and adds the colour developing liquid 100 μ l/ holes colour developing 5～10min that keeps in Dark Place behind the plate 3 times, adds 1mol/LH ₂SO4 _O50 μ l/ hole termination reactions are measured OD immediately ₄₅₀

The result shows that GST-binding peptide fusion rotein of the present invention can combine with p50 specifically, and along with the increase of p50 add-on, Fig. 3 is seen in the minimizing that combines of polypeptide and coating protein.

It is suitable to nuclear Factor-Kappa B p50 subunit and nuclear Factor-Kappa B that embodiment 4, ELISA method detect GST-binding peptide fusion rotein The competition of formula functional element bonded suppresses experiment

In bag by 96 hole elisa plates of nuclear Factor-Kappa B cis-acting elements (available from the Mercury of U.S. Clontech company ^TMTransfactor p50 kits) adds 150 μ l/ hole transcription factor confining liquids, incubated at room 15min in; Add the test sample of 50 μ l/ holes after abandoning the transcription factor confining liquid with the dilution of transcription factor confining liquid, sample is respectively the sample that p50 standard protein that the p50 standard protein that contains 10ng/ μ l adds series concentration GST fusogenic peptide simultaneously as positive control, the p50 standard protein that contains 10ng/ μ l and contain 10ng/ μ l adds same train concentration GST purifying protein simultaneously, incubated at room 1h, blank is for adding 50 μ l transcription factor confining liquids; Add transcription factor confining liquid 150 μ l/ holes washing 3 times, each 4min removes washings; Add with the p50 antibody 100 μ l/ holes of transcription factor confining liquid with dilution in 1: 500, incubated at room 1h; Add transcription factor confining liquid 150 μ l/ holes washing 3 times, each 4min removes washings; Add with the goat anti-rabbit igg-HRP two anti-100 μ l/ holes of transcription factor confining liquid with dilution in 1: 1000, incubated at room 30min; Add transcription factor damping fluid 250 μ l/ holes washing 4 times, each 4min removes washings; Add tmb substrate, incubated at room 10min, treat that liquid becomes basket after, with the stop buffer termination reaction in 100 μ l/ holes; Detect the OD value in 450nm and 630nm dual wavelength.The p50 binding peptide to p50 and its cis-acting elements bonded inhibition percentage ratio calculation formula is: (the same concentration GST fusogenic peptide of same concentration GST purifying protein OD-OD)/p50 standard protein positive control OD.

The result shows, but GST-binding peptide fusion rotein specificity inhibition p50 of the present invention combines with its cis-acting elements, and this retarding effect has dose-effect relationship, both restraining effect increased along with the rising of peptide concentration, GST does not then influence combining of p50 and its cis-acting elements, as shown in Figure 4.

Embodiment 5, Pull-down experiment detects GST-binding peptide fusion rotein and nuclear Factor-Kappa B p50 subunit interacts

GST pull-down assay test kit process specifications by PIERCE company carries out.Earlier 1ml glutathione agarose 4B affinity chromatography resin is adorned post in the needle tubing of disposable syringe, with PBS natural filtration washing 4～6 times (5mL/ time) and the balance resin of precooling; Add supernatant liquor 5ml then through the intestinal bacteria ultrasonication of IPTG abduction delivering GST-binding peptide fusion rotein, GST-binding peptide fusion rotein is solidificated on the glutathione agarose 4B affinity chromatography resin, with 10 times (5mL/ time) of PBS natural filtration washing of precooling.The unconjugated foreign protein of flush away; Add 2mL protein binding damping fluid (142.5mmol/LKCl, 5mmol/L MgCl ₂0.2% (v/v) Nonidet-40,10mmol/L N-2-hydroxyethyl piperazine-N '-2-ethanesulfonic acid, pH:7.2,1mmol/L EDTA) incubate 30min in advance on ice after, add rough p50 albumen 5ml at last through the recombinant expressed acquisition of protokaryon, natural filtration is also caught target protein, use the PBS filtration washing 10 times of precooling again, the unconjugated albumen of flush away adds 1mL elutriant (10mmol/L reduced glutathion at last, 50mmol/L Tris-HCl, pH:8.0), behind the incubated at room 30min, filter.Collecting last filtration product row SDS-PAGE analyzes.Use pET-42a (+) empty carrier to express the GST albumen that obtains simultaneously and do negative control.

Embodiment 6, nuclear Factor-Kappa B p50 subunit antagonist peptide are tested the inhibition of the reactive reporter gene expression of nuclear Factor-Kappa B.

1640 culture medium culturing U937 cells, transfection is adjusted into 0.5～2.5 * 10 with cell density the day before yesterday ⁵Individual/mL, incubated overnight; Get 1mL incubated overnight cell or with 0.5 * 10 ⁵Individual cells/well cell concentration adds 24 well culture plates; Get 3 μ L GeneJuice transfection reagents and add in 100 μ L serum-frees, 1640 substratum, the vortex mixing, room temperature is placed 5min; Get 1 μ g p4kB-Luc plasmid and add in the GeneJuice/1640 substratum mixture, blow and beat mixing gently, room temperature is placed 5-15min; Said mixture is dropwise added in the perfect medium, and light shaking makes the abundant mixing of mixture and cell; 37 ℃, the 5%CO2 incubator is cultivated; Behind the transfection 5h, change with perfect medium and to wash cell 3 times with PBS after liquid is cultivated 1h, at last cell is resuspended in serum-free 1640 substratum of 100 μ L; With PBS the GST-binding peptide is diluted to 6 different concns (final concentration behind the adding substratum is respectively 0,0.5,1,2,4,8 μ g/mL), volume is the fusion rotein liquid of 50 μ L, with PBS 2 μ LChariot transfection reagents are diluted to 50 μ L simultaneously, the GST-binding peptide of different concns is mixed with the Chariot transfection reagent, blow and beat mixing gently, room temperature is placed 30min.100 μ L GST-binding peptide/Chariot transfection reagent mixed solutions are dropwise added in the resuspended U937 cell culture fluid of above-mentioned 100 μ L serum-frees, 1640 substratum, and light shaking makes the abundant mixing of mixture and cell; 37 ℃, the 5%CO2 incubator is cultivated 1h; Remove transfection liquid, change substratum into perfect medium, the LPS that adds final concentration simultaneously and be 1 μ g/mL stimulates, and draws the centrifugal 5min of cell 500g after cultivating 2h, and the PBS washed cell once eliminates the PBS supernatant; Add 1 * CCLR cell lysis buffer solution with 100 μ l/ holes; Vortex EP manages 10-15s, and 4 ℃, the centrifugal 2min of 12000rpm gets supernatant ,-70 ℃ of activity of preserving or directly detecting luciferase; After in 96 hole check-out consoles, adding 100 μ L/ hole luciferase detection reagent, add behind the 100 μ L/ porocyte lysates reading at once again, and printing or record data.

The result shows, GST-binding peptide fusion rotein of the present invention is inhibited to the expression of the reactive luciferase reporter gene of nuclear Factor-Kappa B, and this restraining effect has dose-effect relationship, both restraining effect increased along with the rising of protein concentration, contrast GST albumen does not then have this restraining effect, as shown in Figure 5.Explanation thus, the p50 binding peptide that we screen acquisition has the function that suppresses the nuclear Factor-Kappa B transcriptional activity, has both had the function that suppresses genetic expressions such as nuclear Factor-Kappa B regulation and control inflammatory mediator.

Reference

1.Siebenlist?U，Franzoso?G，Brown?K?et?al.Structure，regulation?and?function?of?NF-κB.AnnuRev?Cell?Biol，1994；10：405-455.

2.Baldwin?AS.The?NF-κB?and?IκB?proteins：new?discoveries?and?insights.Annu?Rev?Immunol.1996；14：649-681.

3.Wang?CY，Mayo?MW，Korneluk?RG?et?al.NF-κB?anti-apoptosis：induction?of?TRAF1?andTRAF2?and?c-IAP1?and?c-IAP2?to?suppress?caspase-8?activation.Science，1998；281：1680-1683.

4.Wang?CY，Cusack?J，Liu?R?et?al.Control?of?inducible?chemoresistance：enhanced?anti-tumortherapy?through?increased?apoptosis?by?inhibition?of?NF-κB.Nat?Med，1999；5：412-417.

5.Yamamoto?Y，Gaynor?RB.Therapeutic?potential?of?inhibition?of?the?NF-κB?pathway?in?thetreatment?of?inflammation?and?cancer.J?Clin?Invest，2001，107(2)：135-142.

6.Baldwin?AS.Series?Introduction：The?transcription?factor?NF-kappaB?and?human?disease.JClin?Invest.2001；107(1)：3-10.

7.Tomita?N，Morishita?R，Lan?HY，et?al.In?vivo?administration?of?a?nuclear?transcriptionfactor-kappaB?decoy?suppresses?experimental?crescentic?glomerulonephritis.J?Am?SocNephrol，2000；11(7)：1244-1251.

8.Barnes?P?J?and?Karin?M.Nuclear?factor-kappaB：a?pivotal?transcription?factor?in?chronicinflammatory?diseases.N?Engl?J?Med.1997，336(15)：1066-1071.

9.Remick?D?G.Applied?molecular?biology?of?sepsis.J?Crit?Care.1995，10(4)：198-212.

10.Behl?C，et?al.Mechanism?of?amyloid?beta?protein?induced?neuronal?cell?death：currentconcepts?and?future?perspectives.J?Neural?Transm?Suppl.1997，49：125-134.

11.Brand?K，et?al.Dysregulation?of?monocytic?nuclear?factor-kappa?B?by?oxidized?low-densitylipoprotein.Arterioscler?Thromb?Vasc?Biol.1997，17(10)：1901-1909.

12.Kaltschmidt?C，et?al.Transcription?factor?NF-kappa?B?is?activated?in?microglia?duringexperimental?autoimmune?encephalomyelitis.J?Neuroimmunol.1994，55(1)：99-106.

13.Mosialos?G.The?role?of?Rel/NF-kappa?B?proteins?in?viral?oncogenesis?and?the?regulation?ofviral?transcription.Semin?Cancer?Biol.1997，8(2)：121-129.

14.May?MJ，D?Acquisto?F，Madge?LA，et?al.Selective?inhibition?of?NF-κB?activation?by?apeptide?that?blocks?the?interaction?of?NEMO?with?the?IκB?kinase?complex.Science，2000，289(5485)：1550-1554.

15.Hess?DC，Howard?E，Cheng?C，et?al.Hypertonic?mannitol?loading?of?NF-kappaB?transcriptionfactor?decoys?in?human?brain?microvascular?endothelial?cells?blocks?upregulation?ofICAM-1.Stroke，2000；31(5)：1179-1186.

16.Zandi?E，Chen?Y，Karin?M，et?al.?Direct?phosphorylation?of?IkappaB?by?IKKalpha?and?IKKbeta：discrimination?between?free?and?NF-kappaB-bound?substrate.Science，1998；281：1360-1363.

17.Yamamoto?Y，Gaynor?RB.Therapeutic?potential?of?inhibition?of?the?NF-κB?pathway?in?thetreatment?of?inflammation?and?cancer.J?Clin?Invest，2001，107(2)：135-142.

18.Barnes?P?J，et?al.Anti-inflammatory?actions?of?steroids：molecular?mechanisms.TrendsPharmacol?Sci.1993，14(12)：436-441.

19.Schreck?R，et?al.Reactive?oxygen?intermediates?as?apparently?widely?used?messengers?in?theactivation?of?the?NF-kappa?B?transcription?factor?and?HIV-1.EMBO?J.1?991，10(8)：2247-2258.

20.Chen?FE，Huang?DB，Chen?YQ?et?al.Crystal?structure?of?p50/p65?heterodimer?of?transcriptionfactor?NF-κB?bound?to?DNA.Nature，1998；391(22)：410-413.

21.Fields?S，Song?O.A?novel?genetic?system?to?detect?protein-proteininteractions.Natue，1989；340(6230)：245-246.

＜110〉No.3 Hospital Attached to No.3 Military Medical Univ., P.L.A.

＜120〉nf-kB p50 subunit binding peptide and preparation thereof and application

<160>1

<210>1

<211>36

<212>PRT

＜213〉artificial sequence

<220>

<400>1

Asn?Thr?Trp?Gly?Met?Leu?Ser?Leu?Arg?Ile?Ile?Val?Arg?Leu?Val

1 5 10 15

Arg?Arg?Asn?Ser?Tyr?Tyr?Gly?Thr?Gln?Asp?Asn?Ser?His?Leu?Ala

20 25 30

Arg?Val?His?Phe?Leu?Leu

35

Claims (10)

1. one kind combines with nuclear Factor-Kappa B p50 subunit specifically, and the active polypeptide of antagonism nuclear Factor-Kappa B specifically, and its aminoacid sequence is as follows:

Asn?Thr?Trp?Gly?Met?Leu?Ser?Leu?Arg?Ile?Ile?Val?Arg?Leu?Val?Arg?Arg?Asn?Ser?Tyr

Tyr?Gly?Thr?Gln?Asp?Asn?Ser?His?Leu?Ala?Arg?Val?His?Phe?Leu?Leu

2. the application of the polypeptide of claim 1 in the medicine of preparation antinuclear factor-κ B.

3. the application of claim 2, the medicine of described antinuclear factor-κ B are the medicine or the anti-tumor drugs of treatment inflammatory immune correlated disease.

4. the application of claim 3, wherein said inflammatory relative disease be Sepsis, septic shock, rheumatic arthritis, asthma, acute and chronic glomerulonephritis, systemic erythema from lupus, wherein said tumour is liver cancer, cancer of the stomach, esophagus cancer, breast tumor, bladder cancer, tumor of prostate.

5. the pharmaceutical composition that contains the polypeptide of claim 1.

6. the pharmaceutical composition of claim 5 wherein contains the medicine acceptable carrier.

7. the pharmaceutical composition of claim 5, pharmaceutical dosage forms in any form exists.

8. the pharmaceutical composition of claim 5 is injections.

9. the pharmaceutical composition of claim 5 is freeze drying injections.

10. the preparation method of the polypeptide of claim 1 is characterized in that, described method is selected from synthetic method, gene recombination method or chemical synthesis process in conventional solid phase synthesis process, the solution.

Images