CN1304418C - Nuclear factor-K B P65 subunit antagonistic peptide and its use - Google Patents

Abstract

The present invention relates to a nuclear factor, namely kBp65 ylidene antagonist peptide and an application thereof, particularly to a group of nuclear factors, namely kB (NF-kB0p65) ylidene antagonist peptides. In more concrete, the present invention relates to a group of small molecular peptides capable of especially combining the nuclear factor, namely the kBp65 ylidene, and a preparation and an application of the nuclear factors, namely kBp65 ylidene antagonist peptides.

Description

Nuclear Factor-Kappa B p65 subunit antagonist peptide and application thereof

Technical field

The present invention relates to field of medicaments, particularly relate to one group of treatment, more specifically, relate to one group and can and suppress its active small-molecular peptides with nuclear Factor-Kappa B p65 subunit specific combination with nuclear Factor-Kappa B (NF-κ B) p65 subunit antagonist peptide.The invention still further relates to the preparation and the application of these nuclear Factor-Kappa B p65 subunit antagonist peptide.

Background technology

NF-κ B is a kind of transcription factor that is prevalent in nearly all cell cytosol, be the convergent point of multiple signal transduction pathway, have the function of the multiple participation immunne response of regulation and control, inflammatory reaction, virus replication, apoptosis and propagation and the related gene expression that grows.The protein dimer that NF-κ B system is made of two kinds of Rel family proteins.Difference according to aspects such as structure, function and synthesis modes, the Rel protein family can be divided into two classes: a class is precursor protein p105 and p100, its C-terminal contains ankyrin repeat (ankin repeat motif), can become sophisticated p50 and p52 by the proteolysis process cracking of ATP dependence.Such hypoproteinosis transactivation domain does not have the function that independent activated gene is transcribed; Another kind of is RelA (p65), Rel (c-Rel), v-Rel and RelB, and its C-terminal contains one or more trans-activation domains (transactivationdomain), has the function that independent activated gene is transcribed ^[1]

When cell is in quiescent condition, main and κ B arrestin (the I κ B of NF-κ B _s) in conjunction with forming tripolymer, be present in the tenuigenin in the non-activity mode.When cell is subjected to that multiple outer signals such as proinflammatory cytokine, virus, intracellular toxin, ultraviolet ray, oxygenant and radioactive rays stimulates and when starting the cell second messenger system, I κ B _sPhosphorylation and degraded take place under the effect of I kappa b kinase (IKK), and NF-κ B loses I κ B _sStrictness control and be activated, and displacement enters in the nucleus, its subunit forms ring texture and combines the expression of efficiently inducing pro-inflammatory cytokine (as TNF, GM-CSF, IL-1 β, IL-6, IL-1l, IL-17 etc.), chemokine (as IL-8, RANTES, MIP-1 α, MCP-2 etc.), adhesion molecule (as ICAM-1, VCAM-1, ELAM-1 etc.), immunity receptor (as IL-2R) and participating in the plurality of enzymes (as NO synthetic enzyme, cyclooxygenase etc.) of inflammatory response cascade amplification with privileged site in the target gene promoters ^[2]NF-κ B institute some albumen of inductive can further reverse and activate NF-κ B, cause the expansion and the continuity of inflammatory reaction.Based on above-mentioned cognition, many scholars think that the transcriptional activity that suppresses NF-κ B will open up new approach for the treatment of inflammatory relative disease.In addition, NF-κ B also plays a significant role in apoptosis and propagation, it can suppress the apoptosis of cell by the expression of anti-apoptotic genes expressions such as direct upregulation of apoptosis supressor (c-IAPl, c-IAP2 and IXAP), TNF receptor associated factor (TRAFl and TRAF2), zinc finger protein A20, super manganese oxide dismutase, Bcl-2 homologue A1/Bfl-1 and lEX-IL ^[3]In oncotherapy, chemotherapy and radiation can make the NF-kB activation, causes tumour cell to chemotherapy resistance and insensitive to radioactive rays.Therefore, suppress the transcriptional activity of NF-κ B, the anti-apoptosis capacity of reduction tumour cell be can yet be regarded as and improved the good plan of cancer drug therapy effect ^[4]

Because the powerful transcriptional control function of NF-κ B, the overactivity of NF-κ B is being played the part of important effect in the generation of numerous disease and evolution: as chronic inflammatory diseases such as rheumatic arthritis, asthma, chronic glomerulonephritis, helicobacter pylori related gastritis, inflammatory bowel diseases ^[5,6,7,8], acute inflammation diseases such as Sepsis, septic shock, acute glomerulonephritis ^[9], Alzheimer ' s disease ^[10], atherosclerosis ^[11], systemic erythema is from body immunological diseases such as lupus ^[12]All excessive or continuous activation is closely related with the generation of cancer and development with NF-κ B.In addition, NF-κ B has also participated in transcribing and duplicating in cells infected such as rhinovirus, influenza virus, Epstein-Barr virus, cytomegalovirus, adenovirus, HTL virus and HIV virus, plays an important role in the infection of these viruses and pathogenic course ^[13]

In view of generation and the developing latent effect of NF-κ B in above-mentioned disease, be target spot with the associated protein in NF-κ B and the signal transduction pathway thereof, the medicine of research and development NF-κ B relative disease has become the research focus in this area.At present external relevant be that the antagonism therapeutic strategy of target spot mainly comprises the following aspects with NF-κ B ^{[14,15,16,17]}: (1) uses traditional anti-inflammatory drug---and hormonal medicaments such as glucocorticosteroid are the activity of part antagonism NF-κ B directly or indirectly; (2) anti-oxidant treatment: as antioxidant---acetylcysteine, acetylsalicylic acid sodium salicylate and tetramethyleneimine two thiocarbamate (Pyrrolidinedithiocarbamate, PDTC) etc. as the inhibitor of NF-κ B, wherein PDTC has been subjected to numerous investigators' favor as the inhibitor of NF-κ B; (3) formation and the activity of inhibition I κ K: the antisense nucleic acid as target I κ K α, the formation of I κ K α be can stop, thereby phosphorylation and the degradation process of I κ B alleviated or alleviate, finally reach the purpose that suppresses the NF-kB activity; (NF-κ B essential modifier NEMO) is the adjusting albumen of I κ K albumen composition to the essential adjusting of NF-κ B albumen, and the function of keeping I κ K is played an important role.May etc. have designed the anti-inflammatory polypeptide at NEMO, this polypeptide comprise NEMO in conjunction with the territory (NEMO binding domain, NBD), it can combine with NEMO, stops being connected of NEMO and I κ K β, thereby suppresses activity and the follow-up effect thereof of I κ K; (4) degraded of minimizing I κ B: thus the epoxomicin of some proteasome inhibitor such as MG101, MG115, MG132, PS-341, lactacystin and discovery recently all can pass through the activity of the degraded antagonism NF-κ B of inhibition I κ B, and some serpin such as TLCK (N alpha-p-tosyll-L-lysinechloromethyl ketone), TPCK (N-tosyl-L-phenylalanine chloromethyl ketone) and SLPI also have similar function; (5) generation of promotion I κ B: use the adenovirus expression carrier of I κ B α, make I κ B α phenotype inactivation mutant overexpression, can obviously suppress nuclear displacement and the follow-up effect thereof of NF-κ B.(6) suppress the synthetic of NF-κ B: can combine with gene and the mRNA of coding NF-κ B as antisense oligodeoxyribonucleotide at p50 and p65, and then the transcribing of blocking gene, translation process, finally suppress the formation of NF-κ B.Design can be carried out cutting damage to the mRNA of coding NF-κ B, in the formation of mRNA level blocking-up NF-κ B at the ribozyme of NF-κ B family high conserved region.

Above-mentioned is that the therapeutic strategy of target spot has shown curative effect in various degree with NF-κ B in experimentation on animals and cell in vitro culture systems.But all there is the not good enough problem of specificity in above-mentioned measure.In fact, obtain best result of treatment and reduce system toxicity as much as possible, then should note the specificity of NF-κ B target treatment.As glucocorticosteroid is the potent inhibitor of NF-κ B, but whole body has the side effect of upsetting internal secretion and substance metabolism when using ^[18]And more having specificity to the retarding effect of NF-kB activity, antioxidant can not say ^[19], experimentation on animals shows that PDTC has very strong toxic side effect.Proteasome, it also has other many important function except degradable I κ B, so arrestin enzyme corpusculum activity will cause the potential serious side effects ^[5]Although there is the scholar to think that I κ K, I κ B are specific to the adjusting of NF-κ B, but research does not so far still have enough evidences and shows that I κ K, I κ B do not possess regulating effect to other protein molecular, and the measure of sure target I κ K, I κ B that therefore just can not be definite is exactly specific to the intervention of NF-kB activity.The synthesis strategy that suppresses NF-κ B is specific for NF-κ B, but in some acute inflammatory reaction diseases, the activation of NF-κ B (rather than synthetic) process (the NF-κ B → activation of non-activity goes into examine → to combine with DNA → the promotor gene expression in the tenuigenin) is even more important, and the synthesis strategy that therefore suppresses NF-κ B is not optimal selection.Being not difficult to find out that from the whole activated channel of NF-κ B NF-κ B is specific with combining of DNA cis element, also is that NF-κ B starts the only way which must be passed that target gene is transcribed.Have only NF-κ B is implemented direct intervening measure with combining of DNA cis element, just can reach specificity truly.The upstream pathway of NF-kB activation intervened then be difficult to reach this purpose.

The heterodimer that is formed by p50 and p65 two subunits is typical case's representative of NF-κ B, is most important a kind of in the NF-κ B form of ownership, almost is present in all cells in the body, and its content is far above other dimer.The N-terminal of this heterodimer can constitute 1 loop domain, is combined with the DNA base specific by its mediation.The crystalline diffraction analysis shows that p50/p65 heterodimer and immunoglobulin kappa chain genetic enhancer κ B sequence-specific bonded mode are: 5 of the Arg-54 of p50 subunit, Arg-56, Tyr-57, Glu-60, His-64 and Lys-241 amino-acid residue and κ B sequence 5 ' end '-G _-5G _-4G _-3A _-2C _-1-3 ' base series specific combination; The Arg-33 of p65 subunit, Arg-35, Arg-36, Glu-39 and Arg-187, with 5 of κ B sequence 3 ' end '-T _{+ 1}T _{+ 2}C _{+ 3}C _{+ 4}-3 ' 4 base pair specific combination.In addition, by the loop domain that the aminoterminal and the dimerization structural domain of NF-kB P 50/p65 heterodimer constitutes jointly, also can non-ly discern DNA ribose phosphoric acid skeleton specifically ^[20]Promptly this loop domain that is made of jointly p50 and p65N end has formed the DNA binding domains of NF-κ B, mediates itself and the combining of cis-acting elements, and it should be noted that this specificity combination that is combined into.NF-κ B activation target gene at first needs the cis-acting elements in the DNA binding domains identification target gene promoters zone, and combination with it, and the back is down auxiliary the p65 trans-activation domain, the expression of activation target gene.If we can block combining of NF-κ B p65 subunit and its cis-acting elements, the NF-κ B heterodimer of the p65 of containing subunit then capable of blocking and combining of its cis-acting elements finally reach the purpose that suppresses NF-κ B regulate target gene expression.

Foundation, maturation of a kind of strong instrument of studying protein interaction that emerges along with the later stage eighties 20th century---yeast-two hybrid technique and developing finally becomes possibility to the screening operation of NF-κ B antagonism polypeptide.Yeast two-hybrid system has very high sensitivity, can detect faint and of short duration protein-protein interaction, and protein interactions betides in the yeast cell born of the same parents and/or in the nuclear in this system.Compare with prokaryotic cell prokaryocyte, the eucaryon yeast cell to proteinic translation and processing more near mammalian cell, with it is that engineering bacteria research protein interactions is with better physiological status near mammalian cell, promptly keep the natural folded state of protein, make protein-protein interaction more near the true horizon in the mammalian cell.Therefore, the interaction of using between this systematic study protein has obtained using more and more widely, and to the screening of target protein interaction protein or polypeptide in the born of the same parents, this system is more first-selected especially ^[21]NF-κ B is a nuclear factor, is present in the cytoplasm, but brings into play the transcriptional control function in nucleus.Therefore, we select yeast two-hybrid system for use, are bait protein with NF-κ B p65DNA in conjunction with the territory, screen NF-κ B interaction polypeptide from the random peptide library of one 16 peptide, and identify the function of these polypeptide.We have screened and have obtained two groups of NF-κ B p65 subunit antagonist peptides with concensus sequence at present, listed here is one group of NF-κ B antagonism peptide with concensus sequence wherein.

Summary of the invention

The purpose of this invention is to provide can with single-minded combination of nuclear Factor-Kappa B p65 subunit, and can suppress the nuclear Factor-Kappa B antagonism peptide of nuclear Factor-Kappa B activity and institute's regulate gene expression thereof.

Another object of the present invention provides the purposes of these nuclear Factor-Kappa B antagonism peptides.

Nuclear Factor-Kappa B p65 subunit antagonist peptide of the present invention: have following formula

X1-X2-Met-X4-Glu-Val-X7-X8-X9-Val-X11-X12-X13-X14-Phe-X16

In the formula,

X1 represents any amino-acid residue;

X2 represents any amino-acid residue;

X4 represents any amino-acid residue or disappearance;

X7 represents any amino-acid residue or disappearance;

X8 represents any amino-acid residue or disappearance;

X9 represents any amino-acid residue or disappearance;

X11 represents any amino-acid residue or disappearance;

X12 represents any amino-acid residue or disappearance;

X13 represents any amino-acid residue or disappearance;

X14 represents any amino-acid residue or disappearance;

X16 represents any amino-acid residue;

Preferably:

X2 represents nonpolar amino acid;

X4 represents nonpolar amino acid;

X7 represents Threonine;

X8 represents nonpolar amino acid;

X16 represents leucine or Threonine;

Other are with last identical.

More preferably:

X2 represents Xie Ansuan or L-Ala;

X4 represents Xie Ansuan or Isoleucine;

X8 represents Xie Ansuan or tryptophane;

Other are with last identical.

Particularly preferably be:

X1 represents Val;

X2 represents Val;

X4 represents Ile;

The X7 disappearance;

The X8 disappearance;

The X9 disappearance;

The X11 disappearance;

The X12 disappearance;

The X13 disappearance;

The X14 disappearance;

X16 represents Leu;

Its aminoacid sequence is Val Val Met Ile Glu Val Val Phe Leu.

Or:

X1 represents Leu;

X2 represents Ala;

X4 represents Val;

X7 represents Thr;

X8 represents Val;

The X9 disappearance;

X11 represents Leu;

X12 represents Ser;

X13 represents Trp;

X14 represents Gly;

X16 represents Thr;

Its aminoacid sequence is Leu Ala Met Val Glu Val Thr Val-Val Leu Ser Trp Gly Phe Thr.

Or:

X1 represents Pro;

X2 represents Ala;

X4 represents Val;

X7 represents Thr;

X8 represents Val;

The X9 disappearance;

X11 represents Leu;

X12 represents Ser;

X13 represents Trp;

X14 represents Gly;

X16 represents Thr;

Its aminoacid sequence is Pro Ala Met Val Glu Val Thr Val-Val Leu Ser Trp Gly Phe Thr.

Or:

X1 represents Thr;

X2 represents Gln;

The X4 disappearance;

X7 represents Thr;

X8 represents Trp;

X9 represents Arg;

X11 represents Glu;

X12 represents Cys;

X13 represents Cys;

X14 represents Leu;

X16 represents Leu;

Its aminoacid sequence is Thr Gln Met-Glu Val Thr Trp Arg Val Glu Cys Cys Leu Phe Leu.

Wherein "-" represented amino acid lacks.

More than particularly preferred 4 polypeptide structures as follows:

PT1：Val?Val?Met?Ile?Glu?Val———Val————Phe?Leu

PT2：Leu?Ala?Met?Val?Glu?Val?Thr?Val-Val?Leu?Ser?Trp?Gly?Phe?Thr

PT3：Pro?Ala?Met?Val?Glu?Val?Thr?Val-Val?Leu?Ser?Trp?Gly?Phe?Thr

PT4：Thr?Gln?Met-Glu?Val?Thr?Trp?Arg?Val?Glu?Cys?Cys?Leu?Phe?Leu

The present invention also comprises, the application of nuclear Factor-Kappa B p65 subunit antagonist peptide of the present invention in the medicine of preparation antinuclear factor-κ B.The medicine of described antinuclear factor-κ B is the medicine or the anti-tumor drug of treatment immune correlated disease.

The present invention also comprises, contains the pharmaceutical composition of nuclear Factor-Kappa B p65 subunit antagonist peptide of the present invention.

Have the said structure pattern polypeptide can with single-minded combination of nuclear Factor-Kappa B p65 subunit, and the combining of blocking-up nuclear Factor-Kappa B and its cis-acting elements, thereby suppress the biologic activity of nuclear Factor-Kappa B, promptly nuclear Factor-Kappa B is regulated and control the activity of various expression of target gene.This type of structural pattern both can the polypeptide form Individual existence, also can be warm, or insert the privileged site of protein surface with other albumen and polypeptide, as the bulge loop district, or be connected with other material.No matter with what form exist, the material that contains this structural pattern may show with nuclear Factor-Kappa B p65 subunit and combine, and suppresses the active effect of nuclear Factor-Kappa B.

The present invention passes through one group of structural analysis that combines polypeptide with nuclear Factor-Kappa B p65 subunit, determined and nuclear Factor-Kappa B p65 subunit bonded amino acid sequence patterns or title structural pattern that this medicine for design and development novel anti nuclear Factor-Kappa B is significant.

Result of study shows, the polypeptide that the present invention screens not only can competitive blocking-up nuclear Factor-Kappa B and the combining of its cis-acting elements, also can suppress the target gene expression that nuclear Factor-Kappa B is regulated and control, thereby can become new antinuclear factor-κ B medicine or prodrug, polypeptide of the present invention can be used for the treatment of various inflammation or immunity relative disease and tumour.It can be prepared into pharmaceutical composition as active constituents of medicine, said composition can add some medicine acceptable carriers as required, can adopt the technology of pharmaceutics routine techniques to prepare said composition, composition of the present invention can be oral, also can parenteral administration, preferred compositions is that the injection form of unitary dose is as lyophilized injectable powder.Nuclear Factor-Kappa B antagonism peptide of the present invention is with a wide range of applications and vast market prospect in the medicine of making antinuclear factor-κ B.

In addition, nuclear Factor-Kappa B p65 subunit binding peptide of the present invention also has the potential using value as biotechnological formulation, as being used for the affinity purification of nuclear Factor-Kappa B as part, being used for detection of nuclear Factor-Kappa B or the like as probe.

According to the multiple existence form of nuclear Factor-Kappa B p65 subunit binding peptide sequence pattern, the multiple method that contains this sequence pattern material of obtaining can be arranged, as solid phase synthesis process, synthetic method in the solution, gene recombination method, and other chemical process is synthetic.Above preparation method can adopt the ordinary method that polypeptide is synthetic and prepare, and as the method in the textbook, preferred manufacturing procedure is listed in the specific embodiments of the invention.

The material that contains this sequence pattern can have various application modes, mainly comprise the activity that suppresses nuclear Factor-Kappa B in vitro and in vivo, realize that with various administering modes to suppress the nuclear Factor-Kappa B activity be the disease treatment of purpose, and the detection of nuclear Factor-Kappa B or purifying etc.

The material that contains sequence pattern row of the present invention also comprises in the application of biomedical aspect:

1, by the mode of synthetic or gene recombination, will contain peptide section and other albumen or the peptide fusion of this sequence pattern, being used for to suppress the nuclear Factor-Kappa B activity is the treatment of various inflammatory relative diseases, autoimmune disease, tumour and other relative disease of purpose.

2, with after itself and the agarose coupling, be used for the affine separation of nuclear Factor-Kappa B.

3, with after itself and the indicating label coupling, be used for the evaluation of nuclear Factor-Kappa B.

Description of drawings

Figure 1A is GST fusogenic peptide escherichia coli expression result.M is albumen Marker; GST is pET-42a (+) empty carrier expression product; 1～No. 4 corresponding with PT 1～PT 4GST fusogenic peptide respectively.

Figure 1B is the result of GST fusogenic peptide GST affinitive layer purification.M is albumen Marker; GST is pET-42a (+) empty carrier expression product; 1～4:PT1～PT4GST fusogenic peptide.

Fig. 2 A is the detected result of PT1/GST fusogenic peptide and nuclear Factor-Kappa B p65 subunit bonded biosensor

Fig. 2 B is the detected result of PT2/GST fusogenic peptide and nuclear Factor-Kappa B p65 subunit bonded biosensor

Fig. 2 C is the detected result of PT3/GST fusogenic peptide and nuclear Factor-Kappa B p65 subunit bonded biosensor

Fig. 2 D is the detected result of PT4/GST fusogenic peptide and nuclear Factor-Kappa B p65 subunit bonded biosensor

Fig. 3 detects the specificity bonded result of GST fusogenic peptide and nuclear Factor-Kappa B p65 subunit for ELISA.GST is pET-42a (+) empty carrier expression product; 1～No. 4 corresponding with PT1～PT4GST fusogenic peptide respectively.

Fig. 4 suppresses the result of experiment curve for the ELISA method detects the GST fusogenic peptide to nuclear Factor-Kappa B p65 subunit and the competition of nuclear Factor-Kappa B cis-acting elements bonded

Fig. 5 A is that luciferase reporter gene experiment detection PT1 wears the retarding effect that the film peptide is expressed the reactive luciferase reporter gene of nuclear Factor-Kappa B.A, B, C, D, E, F, G, H, I is respectively U937, U937+LPS, U937+LPS+p4-kB-Luc, U937+LPS+p4-kB-Luc+5 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+10 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+20 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+40 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+80 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+160 μ g/mL wears film antagonism peptide.

Fig. 5 B is that luciferase reporter gene experiment detection PT2 wears the retarding effect that the film peptide is expressed the reactive luciferase reporter gene of nuclear Factor-Kappa B.A, B, C, D, E, F, G, H, I is respectively U937, U937+LPS, U937+LPS+p4-kB-Luc, U937+LPS+p4-kB-Luc+5 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+10 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+20 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+40 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+80 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+160 μ g/mL wears film antagonism peptide.

Fig. 5 C is that luciferase reporter gene experiment detection PT3 wears the retarding effect that the film peptide is expressed the reactive luciferase reporter gene of nuclear Factor-Kappa B.A, B, C, D, E, F, G, H, I is respectively U937, U937+LPS, U937+LPS+p4-kB-Luc, U937+LPS+p4-kB-Luc+5 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+10 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+20 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+40 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+80 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+160 μ g/mL wears film antagonism peptide.

Fig. 5 D is that luciferase reporter gene experiment detection PT4 wears the retarding effect that the film peptide is expressed the reactive luciferase reporter gene of nuclear Factor-Kappa B.A, B, C, D, E, F, G, H, I is respectively U937, U937+LPS, U937+LPS+p4-kB-Luc, U937+LPS+p4-kB-Luc+5 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+10 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+20 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+40 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+80 μ g/mL wears film antagonism peptide, U937+LPS+p4-kB-Luc+160 μ g/mL wears film antagonism peptide.

Embodiment

The GST amalgamation and expression and the purifying of embodiment 1, nuclear Factor-Kappa B p65 subunit antagonist peptide

Gene order according to PT1, PT2, PT3, PT4 polypeptide, according to the intestinal bacteria preference codon, design and synthesize upstream sequence respectively and contain BamHI under the constant situation of polypeptide protein encoding sequence keeping, downstream sequence contains the complementary DNA fragment of SalI sticky end, and dna sequence dna is as follows:

PT1-FP：5’-GATCGTTGTAATGATCGAAGTAGTTTTCCTGTAG-3’，

PT1-RP：5’-TCGACTACAGGAAAACTACTTCGATCATTACAAC-3’

PT2-FP：

5’-GATCCTGGCGATGGTTGAAGTAACTGTTGTTCTGTCTTGGGGTTTCACTTAG-3’

PT2-RP：5’-

TCGACTAAGTGAAACCCCAAGACAGAACAACAGTTACTTCAACCATCGCCAG-3’

PT3-FP：

5′-GATCCCGGCGATGGTTGAAGTAACTGTTGTTCTGTCTTGGGGTTTCACTTAG-3′

PT3-RP：

5′-TCGACTAAGTGAAACCCCAAGACAGAACAACAGTTACTTCAACCATCGCCGG-3′

PT4-FP：

5′-GATCCAGACTCAGATGGAAGTTACTTGGCGTGTTGAATGTTGCCTGTTCCTGTA

G-3′

PT4-RP：

5′-TCGACTACAGGAACAGGCAACATTCAACACGCCAAGTAACTTCCATCTGAGTCTG-3′

With aseptic double-distilled water above-mentioned dna sequence dna is dissolved, final concentration is 20 μ M, after get 4 0.5ml EP pipe and be labeled as PT1, PT2, PT3 and PT4, respectively at adding 20 μ l PT1-FP and 20 μ l PT1-RP among the PT1 EP, in PT2 EP, add 20 μ l PT2-FP and 20 μ l PT2-RP, in PT3EP, add 20 μ l PT3-FP and 20 μ l PT3-RP, in PT4EP, add 20 μ l PT4-FP and 20 μ l PT4-RP, thorough mixing, after mixture is put into 94 ℃ of water-bath sex change, room temperature is placed and to be allowed the water-bath naturally cooling, the polypeptide gene sequence can slowly be annealed form double-stranded.After with the T4 ligase enzyme 4 polypeptide gene sequences are inserted in the pET 42a carrier of BamH I/Sal I double digestion respectively, and transform the E.coliDH-5a competent cell of CaCl2 method preparation.Several single bacterium colonies of each picking carry out enzyme and cut evaluation, and order-checking.To identify that respectively correct recombinant plasmid pET42a/PT1, pET42a/PT2, pET42a/PT3, pET42a/PT4 transform the E.coli.BL-21 competent cell of CaCl2 method preparation, single bacterium colony of the fresh conversion of picking, be inoculated in 10ml and contain in the LB substratum of 50 μ g/ml sulphuric acid kanamycins, 37 ℃ of shaking culture are spent the night.Transfer and contain in the LB substratum of 50 μ g/ml sulphuric acid kanamycins in 200ml in 1: 100 ratio bacterium bacterium liquid that will spend the night, 37 ℃ of shaking culture are to OD600 ≈ 0.5～0.6, add IPTG to final concentration be 0.1-0.5mmol/L, move to 30 ℃ and continue to cultivate 4h.Centrifugal collection thalline, thalline can carry out purifying or frozen in-70 ℃.The thalline of the abduction delivering volume by original bacteria liquid 1/10 is resuspended among the PBS, ultrasonication cell behind the back adding 50mmol/L PMSF 15 μ l (6 * 10sec * 40hz), back adding final concentration is 1% Triton X-100,20min gently vibrates, in 4 ℃, 12000r/m is centrifugal, and 15min gets supernatant, add DTT to final concentration be 1mmol/L.Use the affine resin of PBS liquid balance Glutathione Sepharose4B of 10 times of column volumes simultaneously, after get an amount of above-mentioned supernatant liquor upper prop, make GST fusogenic peptide albumen and resin-bonded, use the foreign protein of the non-specific combination of PBS liquid flush away of 10 times of column volumes again.Use 10mmol/L reduced glutathion wash-out target protein at last, and logical SDS-PAGE identifies its purity, purifying protein through distilled water fully dialyse remove reduced glutathion after freeze-drying in-20 ℃ of preservations.The SDS-PAGE electrophoresis result shows that 4 warm polypeptide of GST are solubility expression, and expression amount is about 20% (Figure 1A) of total protein concentration.Warm purity of protein reaches (Figure 1B) more than 85% behind the GST affinity purification

Embodiment 2, biosensor (Biosensor) detection GST fusogenic peptide combine with nuclear Factor-Kappa B p65 subunit

With the Sensor Chip CM 5 bio-sensing sheet Iasys Plus system microjet chuck of packing into, with 60 μ l PBS/T (pH 7.4PBS, 0.05% polysorbas20) flushing 3 times, balance 10min treats that baseline walks put down back collection baseline data 5min; EDC and NHS by 1: 1 mixed, are got 40 μ l mixed solutions flushing sample pool 2 times, after in sample pool, add 40 μ l mixed solutions again, keep 7min to activate the vane surface; Gather baseline value 1min 3 times with 50 μ l PBS/T flushing sample pool; With the acetate buffer of 40 μ l 10mM pH5.5 flushing sample pool 3 times, after add 40 μ l acetate buffers again, gather baseline value 1min; The total amount that adding 40 μ l dilute with acetate buffer in sample pool is about the p65 standard protein of 0.5 μ g then; Wash 3 times with PBS/T behind the reaction 20min, and gather baseline value 1min; Tris-Hcl damping fluid with 40 μ l 1M pH 8.0 washes sample pool 3 times, and keeps 3min to seal unreacted NHS; With 40 μ l 10mM HCl flushing 3 times, remove the covalently bound p65 standard protein of generation useless residual on the vane; With 50 μ l PBS/T flushing 3 times, gather baseline value 1min, after treating, 4 ℃ of placements carry out association reaction.

With protein binding damping fluid (50mM Tris-HCl, pH7.2,100mM NaCl, 10mM MgCl2,10uM ZncL2,1mM DTT, 0.1% (v/v) NP40) GST-binding peptide fusion rotein is diluted to 10 μ g/L, get 50 μ l fusion rotein diluents and add sample pool, 25 ℃ of temperature, association reaction 5～10min; Question response is complete, washes sample pool 3 times with 50 μ l protein binding damping fluids, and with the wash-out non-specific binding, the question response curve is walked to put down the back and gathered response curve value 1min, washes sample pool 3 times with 40 μ L10mM HCl, the regeneration vane; Wash sample pool 3 times with 50 μ l protein binding damping fluids again, gather baseline data 1min, the association reaction of a beginning new round.

Biosensor result shows that the equal energy height of 4 p65 antagonism polypeptides of the present invention is affine to be combined with p65, and wherein PT3 polypeptide and p65 bonded avidity are the strongest, see Fig. 2 A～2D.

Embodiment 3, ELISA method detect the GST fusogenic peptide and combine with the specificity of nuclear Factor-Kappa B p65 subunit

It is inferior by hole count to wash the dull and stereotyped bag of ELISA with deionized water, is inverted lithographic plate, and ties plate at a cleaning filter paper arsis, removes remaining moisture content; With PBS damping fluid dilution p65 albumen, concentration is 10 μ g/ml; The bag of p65 albumen to 96 hole elisa plate that adds 100 μ l dilution is by in the hole, and incubated at room 3～4h or 4 ℃ of night incubation are noted water evaporates; With 300 μ l PBS hole flushings 3 times, remove unconjugated p65 albumen; The skim milk powder aqueous solution of preparation 5%, every hole adds 200 μ l, and incubated at room 1h or 4 ℃ of night incubation sealing bags are by the hole; (50mM Tris-HCl, pH7.2,100mM NaCl, 10mM MgCl2,10uM ZncL2,1mM DTT, 0.1% (v/v) NP40) washes plate 5 times with the protein binding damping fluid; GST fusogenic peptide (dilution of protein binding damping fluid) the 100 μ l/ holes that add 0.5 μ mol/L are (except that the control wells of not wrapping quilt, setting adds p65 albumen that the GST fusogenic peptide adds series concentration simultaneously in contrast, combines with the proteic specificity of p65 to detect the GST fusogenic peptide.), room temperature is in conjunction with 1h; PBST (PBS+0.1%TWEEN-20) washes monoclonal antibody (being diluted in PBS at 1: 1000) the 100 μ l/ holes that add anti-GST behind the plate 3 times, incubated at room 1h; PBST washes sheep anti-mouse igg (being diluted among the PBS by description of product requirement) the 100 μ l/ holes that add the HRP mark behind the plate 3 times, incubated at room 1h; PBST washes and adds the colour developing liquid 100 μ l/ holes colour developing 5～10min that keeps in Dark Place behind the plate 3 times, adds 1mol/L H ₂SO ₄50 μ l/ hole termination reactions are measured OD immediately ₄₅₀

The result shows that small peptide PT1 of the present invention, PT2, PT3 and PT4 all can combine with P65 specifically, and along with the increase of p65 add-on, Fig. 3 is seen in the minimizing that combines of polypeptide and coating protein.

Embodiment 4, ELISA method detect the GST fusogenic peptide nuclear Factor-Kappa B p65 subunit and the competition of nuclear Factor-Kappa B cis-acting elements bonded are suppressed experiment

In bag by 96 hole elisa plates of nuclear Factor-Kappa B cis-acting elements (available from the Mercury of U.S. Clontech company ^TMTransfactor p65kits) adds 150 μ l/ hole transcription factor confining liquids, incubated at room 15min in; Add the test sample of 50 μ l/ holes after abandoning the transcription factor confining liquid with the dilution of transcription factor confining liquid, sample is respectively the sample that p65 standard protein that the p65 standard protein that contains 10ng/ μ l adds series concentration GST fusogenic peptide simultaneously as positive control, the p65 standard protein that contains 10ng/ μ l and contain 10ng/ μ l adds same train concentration GST purifying protein simultaneously, incubated at room 1h, blank is for adding 50 μ l transcription factor confining liquids; Add transcription factor confining liquid 150 μ l/ holes washing 3 times, each 4min removes washings; Add with the p65 antibody 100 μ l/ holes of transcription factor confining liquid with dilution in 1: 500, incubated at room 1h; Add transcription factor confining liquid 150 μ l/ holes washing 3 times, each 4min removes washings; Add with the goat anti-rabbit igg-HRP two anti-100 μ l/ holes of transcription factor confining liquid with dilution in 1: 1000, incubated at room 30min; Add transcription factor damping fluid 250 μ l/ holes washing 4 times, each 4min removes washings; Add tmb substrate, incubated at room 10min, treat that liquid becomes basket after, with the stop buffer termination reaction in 100 μ l/ holes; Detect the OD value in 450nm and 630nm dual wavelength.The P65 binding peptide to p65 and its cis-acting elements bonded inhibition percentage ratio calculation formula is: (the same concentration GST fusogenic peptide of same concentration GST purifying protein OD-OD)/p65 standard protein positive control OD.

The result shows, but the equal specificity inhibition of small peptide PT1 of the present invention, PT2, PT3 and PT4 P65 combines with its cis-acting elements, and this retarding effect has dose-effect relationship, and both restraining effect increased along with the rising of peptide concentration, and GST does not then influence combining of P65 and its cis-acting elements.The retarding effect of PT3 is better than other 3 in 4 polypeptide, as shown in Figure 4.

The organic synthesis of embodiment 5, polypeptide

Because nuclear Factor-Kappa B antagonism peptide only enters the transcriptional activity and the inflammation Expression of Related Genes that could effectively suppress nuclear Factor-Kappa B in the cell, we will wear film peptide (Arg-Gln-Ile-Lys-Ile-Trp-Phe-Gln-Asn-Arg-Arg-Met-Lys-Trp-Lys-Lys) and PT1, PT2, PT3 and PT4 fusion respectively for this reason, and synthetic these 4 fusion polypeptide of the method that adopts organic synthesis (synthetic) by Shenzhen writing brush space biotechnology company limited, technical process is as follows: 1) claim 1g (0.01mmol) Rink resin to place reactor, with DMF swelling 30min, elimination DMF; 2) add 5mL 20% piperidines-DMF solution in resin, reaction 10min removes the Fmoc protecting group, then the elimination deprotecting regent; 3) (1min), wash 1 time with DMF 5mL * 3 again to replace washing resin 3 times with DMF and methyl alcohol; 4) with Fmoc-AA-OH (0.4mmol), HBTU (0.4mmol), HOBT (0.4mmol) and N-methylmorpholine (0.6mmol) are dissolved in an amount of DMF, add in the resin jolting reaction 1h in 35～40 ℃ of constant temperature shaking tables; 5) filtering reaction solution, washing is with 3), (1min) wash 5mL * 2, drains to use ether again; Get 2～3 grainy resins, detect with ninhydrin method whether free amino group is arranged; If the result is negative; Enter next circulation; Otherwise repeat 4)～6); 7) cyclical operation 2)～6), hold to N-terminal sequence adding Fmoc-AA-OH and condensation reagent from C-by the aminoacid sequence of the fusion polypeptide of wearing film peptide and PT1, PT2, PT3 and PT4 respectively successively, finish up to the peptide chain assembling; 8) remove Fmoc at last, operation is with 2); 9) with DMF, methyl alcohol, glacial acetic acid, DMF and anhydrous diethyl ether thorough washing resin, kept dry; 10) will synthesize good polypeptide through G10 post desalination and HPLC purifying, lyophilize is preserved.Its purity is respectively 82.3%, 79.6%, 85.3%, 88.8%, and it is dissolved among the DMSO, and concentration is 20mmol/L.

Embodiment 6, nuclear Factor-Kappa B p65 subunit antagonist peptide are tested the inhibition of the reactive reporter gene expression of nuclear Factor-Kappa B.

1640 culture medium culturing U937 cells, transfection is adjusted into 0.5～2.5 * 10 with cell density the day before yesterday ⁵Individual/mL, incubated overnight; Get 3mL incubated overnight cell or with 1-2 * 10 ⁵Individual cells/well cell concentration adds 6 well culture plates; Get 3 μ L GeneJuice transfection reagents and add in 100 μ L serum-frees, 1640 substratum, the vortex mixing, room temperature is placed 5min; Get 1 μ gp4-kB-Luc plasmid and add in the GeneJuice/1640 substratum mixture, blow and beat mixing gently, room temperature is placed 5-15min; Said mixture is dropwise added in the perfect medium, and light shaking makes the abundant mixing of mixture and cell; 37 ℃, the 5%CO2 incubator is cultivated; Behind the transfection 5h, the LPS that adds final concentration and be 1 μ g/mL stimulates, and what add series concentration (0,1,5,10,20,40,80,160 μ g/mL) simultaneously wears film antagonism peptide, draws the centrifugal 5min of cell 500g behind the 2h, the PBS washed cell once eliminates the PBS supernatant; Add 1 * CCLR cell lysis buffer solution with 100 μ l/ holes; Vortex EP manages 10-15s, and 4 ℃, the centrifugal 2min of 12000rpm gets supernatant ,-70 ℃ of activity of preserving or directly detecting luciferase; After in 96 hole check-out consoles, adding 100 μ L/ hole luciferase detection reagent, add behind the 100 μ L/ porocyte lysates reading at once again, and printing or record data.

The result shows, the fusion polypeptide that small peptide of the present invention is worn film peptide Arg-Gln-Ile-Lys-Ile-Trp-Phe-Gln-Asn-Arg-Arg-Met-Lys-Trp-Lys-Lys and PT1, PT2, PT3 and PT4 all has the effect that suppresses nuclear Factor-Kappa 3 reactive luciferase reporter genes expression, and this retarding effect has dose-effect relationship, both restraining effect increased along with the rising of peptide concentration, and this retarding effect of wearing film PT3 antagonism peptide is the strongest, shown in Fig. 5 A-D.Explanation thus, the p65 antagonism peptide that we screen acquisition has the function that suppresses the nuclear Factor-Kappa B transcriptional activity, has both also had anti-inflammatory properties.

Reference

1.Siebenlist?U，Franzoso?G，Brown?K?et?al.Structure，regulation?and?function?of?NF-κB.Annu?Rev?CellBiol，1994；10：405-455.

2.Baldwin?AS.The?NF-κB?and?IκB?proteins：new?discoveries?and?insights.Annu?Rev?Immunol.1996；14：649-681.

3.Wang?CY，Mayo?MW，Korneluk?RG?et?al.NF-κB?anti-apoptosis：induction?of?TRAF1?and?TRAF2?andc-IAP1?and?c-IAP2?to?suppress?caspase-8?activation.Science，1998；281：1680-1683.

4.Wang?CY.Cusack?J，Liu?R?et?al.Control?of?inducible?chemoresistance：enhanced?anti-tumor?therapythrough?increased?apoptosis?by?inhibition?of?NF-κB.Nat?Med，1999；5：412-417.

5.Yamamoto?Y，Gaynor?RB.Therapeutic?potential?of?inhibition?of?the?NF-κB?pathway?in?the?treatment?ofinflammation?and?cancer.J?Clin?Invest，2001，107(2)：135-142.

6.Baldwin?AS.Series?Introduction：The?transcription?factor?NF-kappaB?and?human?disease.J?Clin?Invest.2001；107(1)：3-10.

7.Tomita?N，Morishita?R，Lan?HY，et?al.In?vivo?administration?of?a?nuclear?transcription?factor-kappaB?decoysuppresses?experimental?crescentic?glomerulonephritis.J?Am?Soc?Nephrol，2000；11(7)：1244-1251.

8.Barnes?P?J?and?Karin?M.Nuclear?factor-kappaB：a?pivotal?transcription?factor?in?chronic?inflammatorydiseases.N?Engl?J?Med.1997，336(15)：1066-1071.

9.Remick?D?G.Applied?molecular?biology?of?sepsis.J?Crit?Care.1995，10(4)：198-212.

10.Behl?C，et?al.Mechanism?of?amyloid?beta?protein?induced?neuronal?cell?death：current?concepts?and?futureperspectives.J?Neural?Transm?Suppl.1997，49：125-134.

11.Brand?K，et?al.Dysregulation?of?monocytic?nuclear?factor-kappa?B?by?oxidized?low-density?lipoprotein.Arterioscler?Thromb?Vasc?Biol.1997，17(10)：1901-1909.

12.Kaltschmidt?C，et?al.Transcription?factor?NF-kappa?B?is?activated?in?microglia?during?experimentalautoimmune?encephalomyelitis.J?Neuroimmunol.1994，55(1)：99-106.

13.Mosialos?G.The?role?of?Rel/NF-kappa?B?proteins?in?vjral?oncogenesis?and?the?regulation?of?viraltranscription.Semin?Cancer?Biol.1997，8(2)：121-129.

14.May?MJ，D’Acquisto?F，Madge?LA，et?al.Selective?inhibition?of?NF-κB?activation?by?a?peptide?that?blocksthe?interaction?of?NEMO?with?the?IκB?kinase?complex.Science，2000，289(5485)：1550-1554.

15.Hess?DC，Howard?E，Cheng?C，et?al.Hypertonic?mannitol?loading?of?NF-kappaB?transcription?factor?decoysin?human?brain?microvascular?endothelial?cells?blocks?upregulation?of?ICAM-1.Stroke，2000；31(5)：1179-1186.

16.Zandi?E，Chen?Y，Karin?M，et?al.Direct?phosphorylation?of?IkappaB?by?IKKalpha?and?IKKbeta：discrimination?between?free?and?NF-kappaB-bound?substrate.Science，1998；281：1360-1363.

17.Yamamoto?Y，Gaynor?RB.Therapeutic?potential?of?inhibition?of?the?NF-κB?pathway?in?the?treatment?ofinflammation?and?cancer.J?Clin?Invest，2001，107(2)：135-142.

18.Barnes?P?J，et?al.Anti-inflammatory?actions?of?steroids：molecular?m?echanisms.Trends?Pharmacol?Sci.1993，14(12)：436-441.

19.Schreck?R，et?al.Reactive?oxygen?intermediates?as?apparently?widely?used?messengers?in?the?activation?ofthe?NF-kappa?B?transcription?factor?and?HIV-1.EMBO?J.1991，10(8)：2247-2258.

20.Chen?FE，Huang?DB，Chen?YQ?et?al.Crystal?structure?of?p50/p65?heterodimer?of?transcription?factor?NF-κBbound?to?DNA.Nature，1998；391(22)：410-413.

21.Fields?S，Song?O.A?novel?genetic?system?to?detect?protein-proteininteractions.Nature，1989；340(6230)：245-246.

Sequence table

＜110〉Xu Xiang beam Warburg Pincus

＜120〉nuclear Factor-Kappa B p65 subunit antagonist peptide and application thereof

<160>8

<210>1

<211>9

<212>PRT

＜213〉artificial sequence

<220>

<400>1

Val?Val?Met?Ile?Glu?Val?Val?Phe?Leu

1 5 9

<210>2

<211>15

<212>PRT

＜213〉artificial sequence

<220>

<400>2

Leu?Ala?Met?Val?Glu?Val?Thr?Val?Val?Leu?Ser?Trp?Gly?Phe?Thr

1 5 10 15

<210>3

<211>15

<212>PRT

＜213〉artificial sequence

<220>

<400>3

Pro?Ala?Met?Val?Glu?Val?Thr?Val?Val?Leu?Ser?Trp?Gly?Phe?Thr

1 5 10 15

<210>4

<211>15

<212>PRT

＜213〉artificial sequence

<220>

<400>4

Thr?Gln?Met?Glu?Val?Thr?Trp?Arg?Val?Glu?Cys?Cys?Leu?Phe?Leu

1 5 10 15

<210>5

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<400>5

gttgtaatga?tcgaagtagt?tttcctgtag?30

<210>6

<211>48

<212>DNA

＜213〉artificial sequence

<220>

<400>6

ctggcgatgg?ttgaagtaac?tgttgttctg?tcttggggtt?tcacttag?48

<210>7

<211>48

<212>DNA

＜213〉artificial sequence

<220>

<400>7

ccggcgatgg?ttgaagtaac?tgttgttctg?tcttggggtt?tcacttag?48

<210>8

<211>51

<212>DNA

＜213〉artificial sequence

<220>

<400>8

cagactcaga?tggaagttac?ttggcgtgtt?gaatgttgcc?tgttcctgta?g?51

Claims (2)

1. nuclear Factor-Kappa B p65 subunit antagonist peptide, its aminoacid sequence is:

Leu Ala Met Val Glu Val Thr Val Val Leu Ser Trp Gly Phe Thr, or,

Pro?Ala?Met?Val?Glu?Val?Thr?Val?Val?Leu?Ser?Trp?Gly?Phe?Thr。

2. the pharmaceutical composition that contains the antagonism peptide of claim 1.

Images