CN1680551A - Gene of regulating epithelial cell channel of small intestine and its preparation and use - Google Patents
Gene of regulating epithelial cell channel of small intestine and its preparation and use Download PDFInfo
- Publication number
- CN1680551A CN1680551A CNA2004100407851A CN200410040785A CN1680551A CN 1680551 A CN1680551 A CN 1680551A CN A2004100407851 A CNA2004100407851 A CN A2004100407851A CN 200410040785 A CN200410040785 A CN 200410040785A CN 1680551 A CN1680551 A CN 1680551A
- Authority
- CN
- China
- Prior art keywords
- gene
- coli
- modulin
- pcag
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
A method of preparing PCAG of epithelial cell duct on intestinum tenue. First, use Escherichia coli to express it. Second, use yeast and the other eukaryotic system to express it. Escherichia coli PCGA is banking selected.
Description
Technical field
The present invention relates to medical technical field, specifically intestinal epithelial cell duct regulatory gene PCAG (name certainly) and preparation and application.
Background technology
Since oneth century, life science circle thinks that always small intestine epithelium is closely to arrange natural, absolute barriers immutable and regulation and control, (intercellular tight junction, TJ), thereby, Regular Insulin, high molecular weight protein, polypeptide class bio-pharmaceuticals such as tethelin, Interferon, rabbit, interleukin-, erythropoietin all with the pharmaceutical dosage form production and the use of injection, bring many miseries and inconvenience to patient.
Over past ten years, on bacteriopathology, the relevant synthetic study that cooperates subject obtains some relevant breakthroughs.There is the full gene sequencing of the microbial genome (as intestinal bacteria) of direct relation to finish to some and people in recent years, changes and the perfect idea of scientist bacterium one host's interphase interaction.The molecule bacteriological study develops in depth from molecular level:
Cause bacterium one host cell interaction aspect to obtain some new progresses, the most important thing is: can realize the change of small bowel permeability and this great discovery of regulation and control by cytoskeleton and intercellular substance signal transmission.
Biological study is in the past few decades found, human body is followed the body condition difference of auxology, physiology, pathology aspect, (kinetics .IEB) can take place and change the small intestine epithelium barrier in intestinal epithelial barrier, and TJ is very fast with the variation change of IEB environment.ZOT (Zonula Occludens Toxin) gene and the expressing protein thereof found by Univ Maryland-Coll Park USA in 1991 have confirmed reversiblely to open the intestinal epithelial cell duct about 20 to 40 minutes, thereby realize the oral absorption of macromolecular drug.But, do not adopted so far by pharmaceutical sector because this functional protein is found to have slightly to cause the diarrhoea side effect.
Diabetes have become the worldwide public health problem of serious threat human health.Whole world diabetic subject sum is about 1.35 hundred million now, and China diabetic subject is existing 4,000 ten thousand, with a diabetics be the medium maintenance dose of example with Regular Insulin such as every days 30 μ, each month just need be paid 259.50 yuan.Oneself's skin and flesh is injected at least once a day, and skin and flesh is injected to patient and brought misery, and quite one deck patient represents, as long as can keep the euglycemia level, if can be with oral replacement injection, and then the patient avoids the misery that long-term skin and flesh injection is brought.
Summary of the invention
Order of the present invention provides a kind of by the discovery to bodily fuctions's gene PCAG, realizes the application of gene PCAG on albumen, the polypeptide drug novel pharmaceutical technology from the drug administration by injection to the oral administration, and the preparation method of this gene.
The present invention serves as the research thinking with the regulation and control small bowel permeability theory of propositions such as professor Alessio of Univ Maryland-Coll Park USA, small bowel permeability test inside and outside they have used the animal body that the functional protein of different sources carries out, find that ZOT/PCAG etc. is one roughly the same on the basis of merit heterology functional protein, forward its gene structure and screening to from protein function, carried out a large amount of further investigations, we find except that Alessio etc. from the isolating ZOT gene in vibrio cholerae source, in human intestinal intestinal bacteria system and T4 phage system, also have this type of heterology congenerous albumen and gene thereof to exist.And prepared COSMID (coemid) the full gene pool of human intestinal bacillus coli gene group, the antibody serum that uses these type of regulation and control small bowel permeability proteinoids (ZOT) is from protein level, reach gene level from albumen information synthesized dna probe, locate and filter out complete small bowel permeability adjusting function gene, I name it is the PCAG gene, has realized high molecular weight protein, polypeptide drugs are made into by injection the key breakthrough of Macrosol.
1. the gene PCAG DNA nucleotide sequence of intestinal epithelial cell duct modulin is as follows:
atgcaagagagacacacggaacaggactatcgtgccctgctgattgctgatacgcccatt
attgatgttcgcgcccctatcgagtttgagcacggcgcaatgcccgccgctatcaatctg
ccgttaatgaataacgatgaacgcgccgccgttggcacctgctataaacagcaaggctca
gacgcagcgctggcgctgggacataaactggtggcgggtgaaattcgtcagcagcgcatg
gacgcctggcgggcagcgtgcctgcaaaatccgcaaggtattctctgctgcgcccgtggc
ggtcagcgctcacatattgtgcaaagctggttgcatgcagcggggattgattatccgctg
gtggaaggcggttataaggcactgcgccagaccgcgattcaggcgactattgaactggca
caaaaaccgatagtgctgattggcggttgtaccggcagcggtaaaacgctgttagtgcag
caacagccgaacggtgttgatctggaagggttggcgcgtcatcgcggttcggcgtttggt
cgcacgttacaaccacaacttagccaggcgagttttgaaaacctgctggctgccgaaatg
ctaaaaaccgacgcccgtcagaatttgcgcctgtgggtgctggaagacgaaagccggatg
atcggttcgaatcacctgccggaatgcctgcgcgagcgaatgactcaggcggcgattgcg
gtggtagaagatccgtttgagatccgtcttgagcgcctgaacgaagagtatttcttgcgt
atgcatcatgattttacccacgcgtacggcgacgaacagggctggcaggagtattgcgaa
tacctgcatcacggactttcggcgattaagcgtcggctggggctacagcgctataacgaa
ctggctgcaaggctggatgcagcactgacaacgcaactcaccaccggcagcaccgacggt
catctggcctggctggtgccgttacttgaagaatattacgacccgatgtatcgctatcag
cttgagaaaaaagcggaaaaagttgtctttcgcggtgagtgggcggaagtggcggaatgg
gttaaggcgcggtaa
The preparation method of the gene PCAG of above-described intestinal epithelial cell duct modulin comprises: 1) use this gene protein of intestinal bacteria Escherichia coli system expression; 2) use yeast and other eukaryotic cell systems to express this gene protein, that is:
1) with pathogenic colon bacillus E.coli.CT-58 and non-virulent intestinal bacteria E.coli.MG1655, E.coli.0157, E.coli.CR63, E.coli.Be, the adequate proteins of these several bacterial expressions of E.coli.XL-1 runs polyacrylamide gel electrophoresis, change nitrocellulose filter, after doing immuning hybridization with the antibody of small bowel permeability modulin, several bacteriums occur a positive clearly band is all arranged, separate, this band albumen of purifying, trypsin treatment, small segment is carried out the order-checking of C terminal amino acid, with the nucleic acid probe information of this result as screening bacillus coli gene storehouse;
2) make carrier with Cosmid, make up the full genomic gene storehouse of non-virulent intestinal bacteria E.coli.MG1655, by the synthetic picodna dna probe of above small bowel permeability modulin information, the P32 labelled with radioisotope, from gene pool, angle out a positive colony dna sequencing result, obtain a small bowel permeability regulatory protein gene of 530bp length, it is 5 ' years old, 3 ' two ends amino acids coding orders, actual to record amino-acid sequence identical with the two ends of the small segment of small bowel permeability modulin in probe source, obtained the small bowel permeability regulatory protein gene of Escherichia coli source thus, further be BLAST (dna homolog detection) with this gene order with the gene nucleic acid database sequence of international NCBI, sequence between the 6205-6702 on the gene segment of gained and the E.coli. genome is in full accord, and the location screens the small bowel permeability modulin complete genome PCAG of Escherichia coli source thus.
3. the application of intestinal epithelial cell duct regulatory gene PCAG:
The present invention is from harmless relatively non-virulent K-12 Colibacter, cloned in the regulatory factor family of intestinal epithelial cell duct another with merit allos, new gene PCAG with great practical value.Be other congenerous heterologous protein with the ZOT different sources.Utilize the proteic regulation and control small bowel of PCAG permeability function and make high molecular weight protein, polypeptide drugs into oral pharmaceutical by injection, realized the important breakthrough that protein and peptide drugs such as Regular Insulin, immunoglobulin (Ig), tethelin, Interferon, rabbit, interleukin-, erythropoietin are made oral pharmaceutical.
The concrete application method of this intestines wall permeability modulin: the intestinal epithelial cell duct regulation protein of protein and peptide drugs such as Regular Insulin, immunoglobulin (Ig), tethelin, Interferon, rabbit, interleukin-, erythropoietin and PCAG genetic expression is mixed and made into oral medicine (can be made into the stomach juice-resistant capsule).When described protein and peptide drugs is mixed with the gene PCAG of intestinal epithelial cell duct modulin, the two consumption is that protein and peptide drugs is for referencial use with the product injection measurement, and intestines wall permeability modulin 0.1~0.4nmol (Satisfied rubs)/per kilogram of body weight.With Regular Insulin is example: Regular Insulin 1.2~2.4 Humulin U (international unit), intestines wall permeability modulin 0.1~0.4nmol (Satisfied rubs) (regulating) by body weight.
The inside and outside test-results of ZOT/PCAG class regulation and control small bowel permeability functional protein animal body: experimental animal: New Zealand white rabbit, rat.
Medicine: 1) Regular Insulin (molecular weight: 5.7Kda), 2) immunoglobulin (Ig) (molecular weight: 140~160Kda)
Test method:
External: Ussing Chambers intestines wall permeability electrophysiological detection system.
In the body: the administration of rabbit oesophagus intubate, the blood drawing of jugular vein intubate detects.
Experimental result:
1) Regular Insulin: external small intestine (jejunum, rotation intestines) wall permeability increases by 72%.Small intestine (jejunum, rotation intestines) wall absorbed dose increases by 10 times in the body.
Hyperglycemic rat: Regular Insulin mixes oral (dose: Regular Insulin 1.2~2.4 Humulin U, intestines wall permeability modulin 0.1~0.4nmol regulates by body weight) with intestines wall permeability modulin, makes glucose level drop to level behind the injection of insulin.
The hyperglycemic rat chronic toxicity test: Regular Insulin mixes oral (dose and last same) with intestines wall permeability modulin, the hyperglycemic rat survival time is similar to the injection of insulin group.
2) immunoglobulin (Ig): external small intestine (jejunum, rotation intestines) wall permeability increases by 52%.Jejunum wall absorbed dose increases by 2 Bei , rotation intestines wall absorbed doses and increases by 6 times in the body.
From this animal test results as seen, ZOT/PCAG class regulation and control small bowel permeability functional protein can make macro-molecular protein medicines such as Regular Insulin and immunoglobulin (Ig) through intestinal absorption, and need not inject.
The present invention both can create considerable economic value, brought glad tidings for again the injection patient, was subjected to liking of patient deeply, use extensively in market, whole world diabetic subject's prediction has 10% to use the insulin administration oral liquid, and every annual medical charges profit of patient is estimated 100 yuan, then makes profits every year 1000000000 yuan.
Embodiment
Embodiment 1: obtain intestinal epithelial cell duct regulatory gene PCAG by following method:
1. with pathogenic colon bacillus E.coli.CT-58-and non-virulent intestinal bacteria E.coli.MG1655, E.coli.0157, E.coli.CR63, E.coli.Be, the adequate proteins of these several bacterial expressions of E.coli.XL-1 runs polyacrylamide gel electrophoresis, change nitrocellulose filter, after doing immuning hybridization with the antibody of small bowel permeability modulin, several bacteriums occur a positive clearly band is all arranged, separate, this protein ingredient of purifying, protease treatment, small segment is carried out the order-checking of C terminal amino acid, with the detecting probe information of this result as screening bacillus coli gene storehouse;
2. make carrier with Cosmid (coemid), make up the full genomic gene storehouse of non-virulent intestinal bacteria E.coli.MG1655, by the amino acid arrangement architecture information of above small bowel permeability modulin, synthetic picodna dna probe, P
32Labelled with radioisotope, from gene pool, angle out a positive colony dna sequencing result, obtain a small bowel permeability regulatory protein gene of 530bp length, it is 5 ' years old, 3 ' two ends amino acids coding orders, actual to record amino-acid sequence identical with the two ends of the small segment of small bowel permeability modulin in probe source, obtained the small bowel permeability regulatory protein gene of Escherichia coli source thus, further be BLAST (dna homolog detection) with this gene order with the nucleic acid database sequence of international NCBI, sequence between the 6205-6702 on the gene segment of gained and the E.coli. genome is in full accord, the location screens the small bowel permeability modulin complete genome of Escherichia coli source thus, and this unnamed gene is PCAG.Its gene structure is as follows: PCAG gene complete nucleotide order:
atgcaagagagacacacggaacaggactatcgtgccctgctgattgctgatacgcccatt
attgatgttcgcgcccctatcgagtttgagcacggcgcaatgcccgccgctatcaatctg
ccgttaatgaataacgatgaacgcgccgccgttggcacctgctataaacagcaaggctca
gacgcagcgctggcgctgggacataaactggtggcgggtgaaattcgtcagcagcgcatg
gacgcctggcgggcagcgtgcctgcaaaatccgcaaggtattctctgctgcgcccgtggc
ggtcagcgctcacatattgtgcaaagctggttgcatgcagcggggattgattatccgctg
gtggaaggcggttataaggcactgcgccagaccgcgattcaggcgactattgaactggca
caaaaaccgatagtgctgattggcggttgtaccggcagcggtaaaacgctgttagtgcag
caacagccgaacggtgttgatctggaagggttggcgcgtcatcgcggttcggcgtttggt
cgcacgttacaaccacaacttagccaggcgagttttgaaaacctgctggctgccgaaatg
ctaaaaaccgacgcccgtcagaatttgcgcctgtgggtgctggaagacgaaagccggatg
atcggttcgaatcacctgccggaatgcctgcgcgagcgaatgactcaggcggcgattgcg
gtggtagaagatccgtttgagatccgtcttgagcgcctgaacgaagagtatttcttgcgt
atgcatcatgattttacccacgcgtacggcgacgaacagggctggcaggagtattgcgaa
tacctgcatcacggactttcggcgattaagcgtcggctggggctacagcgctataacgaa
ctggctgcaaggctggatgcagcactgacaacgcaactcaccaccggcagcaccgacggt
catctggcctggctggtgccgttacttgaagaatattacgacccgatgtatcgctatcag
cttgagaaaaaagcggaaaaagttgtctttcgcggtgagtgggcggaagtggcggaatgg
gttaaggcgcggtaa
Embodiment 2: in the application of experimental animal:
The inside and outside effect test of ZOT/PCAG class regulation and control small bowel permeability functional protein animal body:
Experimental animal: New Zealand white rabbit, rat.
Medicine: 1) Regular Insulin (molecular weight: 5.7Kda), 2) immunoglobulin (Ig) (molecular weight: 140~160Kda)
Test method:
External: Ussing Chambers intestines wall permeability electrophysiological detection system.
In the body: the administration of rabbit oesophagus intubate, the blood drawing of jugular vein intubate detects.
Experimental result:
1) Regular Insulin: external small intestine (jejunum, rotation intestines) wall permeability increases by 72%.Small intestine (jejunum, rotation intestines) wall absorbed dose increases by 10 times in the body.
Hyperglycemic rat: Regular Insulin mixes oral (dose: Regular Insulin 1.2-2.4 Humulin U (international unit) with intestines wall permeability modulin, intestines wall permeability modulin 0.1-0.4nmol Satisfied rubs, regulate by body weight), make glucose level drop to level behind the injection of insulin.
The hyperglycemic rat chronic toxicity test: Regular Insulin mixes oral with intestines wall permeability modulin, dose: Regular Insulin 1.2~2.4 Humulin U, intestines wall permeability modulin 0.1~0.4nmol (regulating by body weight), the hyperglycemic rat survival time is similar to the injection of insulin group.
2) immunoglobulin (Ig): external small intestine (jejunum, rotation intestines) wall permeability increases by 52%, and jejunum wall absorbed dose increases by 2 Bei , rotation intestines wall absorbed doses and increases by 6 times in the body.
From this animal test results as seen, ZOT/PCAG class regulation and control small bowel permeability functional protein can make macro-molecular protein medicines such as Regular Insulin and immunoglobulin (Ig) through intestinal absorption, and need not inject.
Claims (4)
1. the gene PCAG of an intestinal epithelial cell duct modulin is characterized in that PCAG gene DNA nucleotide sequence is as follows:
atgcaagagagacacacggaacaggactatcgtgccctgctgattgctgatacgcccatt
attgatgttcgcgcccctatcgagtttgagcacggcgcaatgcccgccgctatcaatctg
ccgttaatgaataacgatgaacgcgccgccgttggcacctgctataaacagcaaggctca
gacgcagcgctggcgctgggacataaactggtggcgggtgaaattcgtcagcagcgcatg
gacgcctggcgggcagcgtgcctgcaaaatccgcaaggtattctctgctgcgcccgtggc
ggtcagcgctcacatattgtgcaaagctggttgcatgcagcggggattgattatccgctg
gtggaaggcggttataaggcactgcgccagaccgcgattcaggcgactattgaactggca
caaaaaccgatagtgctgattggcggttgtaccggcagcggtaaaacgctgttagtgcag
caacagccgaacggtgttgatctggaagggttggcgcgtcatcgcggttcggcgtttggt
cgcacgttacaaccacaacttagccaggcgagttttgaaaacctgctggctgccgaaatg
ctaaaaaccgacgcccgtcagaatttgcgcctgtgggtgctggaagacgaaagccggatg
atcggttcgaatcacctgccggaatgcctgcgcgagcgaatgactcaggcggcgattgcg
gtggtagaagatccgtttgagatccgtcttgagcgcctgaacgaagagtatttcttgcgt
atgcatcatgattttacccacgcgtacggcgacgaacagggctggcaggagtattgcgaa
tacctgcatcacggactttcggcgattaagcgtcggctggggctacagcgctataacgaa
ctggctgcaaggctggatgcagcactgacaacgcaactcaccaccggcagcaccgacggt
catctggcctggctggtgccgttacttgaagaatattacgacccgatgtatcgctatcag
cttgagaaaaaagcggaaaaagttgtctttcgcggtgagtgggcggaagtggcggaatgg
gttaaggcgcggtaa
2. the preparation method of the gene PCAG of intestinal epithelial cell as claimed in claim 1 duct modulin is characterized in that concrete grammar comprises: 1) use this gene protein of intestinal bacteria Escherichia coli system expression; 2) use yeast and other eukaryotic cell systems to express this gene protein, that is:
1) with pathogenic colon bacillus E.coli.CT-58 and non-virulent intestinal bacteria E.coli.MG1655, E.coli.0157, E.coli.CR63, E.coli.Be, the adequate proteins of these several bacterial expressions of E.coli.XL-1 runs polyacrylamide gel electrophoresis, change nitrocellulose filter, after doing immuning hybridization with the antibody of small bowel permeability modulin, several bacteriums occur a positive clearly band is all arranged, separate, this band albumen of purifying, trypsin treatment, small segment is carried out the order-checking of C terminal amino acid, with the nucleic acid probe information of this result as screening bacillus coli gene storehouse;
2) make carrier with Cosmid, make up the full genomic gene storehouse of non-virulent intestinal bacteria E.coli.MG1655, by the synthetic picodna dna probe of above small bowel permeability modulin information, P
32Labelled with radioisotope, from gene pool, angle out a positive colony dna sequencing result, obtain a small bowel permeability regulatory protein gene of 530bp length, it is 5 ' years old, 3 ' two ends amino acids coding orders, actual to record amino-acid sequence identical with the two ends of the small segment of small bowel permeability modulin in probe source, obtained the small bowel permeability regulatory protein gene of Escherichia coli source thus, further be BLAST (dna homolog detection) with this gene order with the gene nucleic acid database sequence of international NCBI, sequence between the 6205-6702 on the gene segment of gained and the E.coli. genome is in full accord, and the location screens the small bowel permeability modulin complete genome PCAG of Escherichia coli source thus.
3. as the application of the gene PCAG of claim 1,2 described intestinal epithelial cell duct modulins, it is characterized in that the intestinal epithelial cell duct regulation protein of protein and peptide drugs such as Regular Insulin, immunoglobulin (Ig), tethelin, Interferon, rabbit, interleukin-, erythropoietin and PCAG genetic expression is mixed and made into oral medicine.
4. the application of the gene PCAG of intestinal epithelial cell according to claim 3 duct modulin, when it is characterized in that described protein and peptide drugs mixed with the gene PCAG of intestinal epithelial cell duct modulin, the two consumption is that protein and peptide drugs is for referencial use with the product injection measurement, and intestines wall permeability modulin 0.1~0.4nmol (Satisfied rubs)/per kilogram of body weight.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2004100407851A CN1680551A (en) | 2004-10-08 | 2004-10-08 | Gene of regulating epithelial cell channel of small intestine and its preparation and use |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2004100407851A CN1680551A (en) | 2004-10-08 | 2004-10-08 | Gene of regulating epithelial cell channel of small intestine and its preparation and use |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1680551A true CN1680551A (en) | 2005-10-12 |
Family
ID=35067309
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2004100407851A Pending CN1680551A (en) | 2004-10-08 | 2004-10-08 | Gene of regulating epithelial cell channel of small intestine and its preparation and use |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1680551A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102212504A (en) * | 2011-05-05 | 2011-10-12 | 吉林农业大学 | Rabbit intestinal epithelial cell line and preparation method thereof |
-
2004
- 2004-10-08 CN CNA2004100407851A patent/CN1680551A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102212504A (en) * | 2011-05-05 | 2011-10-12 | 吉林农业大学 | Rabbit intestinal epithelial cell line and preparation method thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1245215C (en) | Recombination high efficiency composite interferon used as hepatitis B surface antigen and e antigen inhibitor | |
CN1699408A (en) | Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof | |
Gonzalez-Avila et al. | Colistin resistance in Aeromonas spp. | |
CN1158304C (en) | Antibacterial frog skin peptide derivative | |
CN101041692A (en) | Scorpion analgesic antibacterial active peptide and preparation method thereof | |
Hoang et al. | Interleukin 34 serves as a novel molecular adjuvant against nocardia seriolae infection in largemouth bass (Micropterus salmoides) | |
CN101418039B (en) | Novel antibacterial peptide and preparation method and use thereof | |
Yan et al. | Antagonization of ghrelin suppresses muscle protein deposition by altering gut microbiota and serum amino acid composition in a pig model | |
Liu et al. | Antimicrobial and immunoregulatory activities of TS40, a derived peptide of a TFPI-2 homologue from black rockfish (Sebastes schlegelii) | |
CN1680551A (en) | Gene of regulating epithelial cell channel of small intestine and its preparation and use | |
KR102122903B1 (en) | Nanovesicles derived from Blautia bacteria and Use thereof | |
CN1062565C (en) | Recombination human alpha type composite interferon, prepn. method and use therefor | |
Zhao et al. | De novo chemoattractants form supramolecular hydrogels for immunomodulating neutrophils in vivo | |
CN107266553A (en) | The efficient mutant fusion protein of human interleukin II and its application | |
Liang et al. | Genome-Wide Identification of Trachinotus ovatus Antimicrobial Peptides and Their Immune Response against Two Pathogen Challenges | |
CN1171900C (en) | Novel, ubiquitous potassium-channel proteins and genes for the same | |
Ishii et al. | Bacterial polysaccharides inhibit sucrose-induced hyperglycemia in silkworms | |
CN1583169A (en) | Use of human lysozyme in preparation of medicine for hemorrhoid | |
CN106432459B (en) | Antibacterial peptide of hypsizigus marmoreus, gene thereof and application thereof in pharmacy | |
CN1868483A (en) | Injection for treating eperythrozoonosis of domestic animal and its prepn. method | |
CN1948493A (en) | Hepatitis B virus vaccine synergistic protein and its gene | |
CN1746185A (en) | Analog of Exendin 4 | |
CN115192605B9 (en) | Application of dimercaptosuccinic acid modified cobaltosic oxide nano-particles | |
Hao et al. | Attenuated Streptococcus agalactiae WC1535∆ Sia perturbs the gut microbiota of Oreochromis niloticus, massively colonizes the intestine, and induces intestinal mucosal immunity after intraperitoneal inoculation | |
CN1299684C (en) | Antibacterial for aquatic animal, preparing method and method of feeding medicine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |