CN1679943A - Compound medicine for improving effect of ACEI hypotensor - Google Patents
Compound medicine for improving effect of ACEI hypotensor Download PDFInfo
- Publication number
- CN1679943A CN1679943A CN 200510008999 CN200510008999A CN1679943A CN 1679943 A CN1679943 A CN 1679943A CN 200510008999 CN200510008999 CN 200510008999 CN 200510008999 A CN200510008999 A CN 200510008999A CN 1679943 A CN1679943 A CN 1679943A
- Authority
- CN
- China
- Prior art keywords
- acei
- compound
- vitamin
- drug effect
- improves
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
A compound medicine for improving the curative effect of ACEI-type antihypertenssive medicines is prepared from the ACEI-type antihypertenssive medicine and the synergist chosen from folic acid, tetrahydrofolic acid, folic acid compound, VB12, VB12 compound, VB16 and VB16 compound.
Description
The application is for dividing an application, and the application number of original application is 02125863.5, and the applying date is on July 31st, 2002.
Technical field
The present invention relates to a kind of compound medicines that improves the depressor drug effect, be used in particular for improving the pharmaceutical composition of ACEI hypotensor drug effect by measurement function gene polymorphism sites genotype.
Background technology
Hypertension is one of China and global modal chronic disease, is 11% in China's prevalence, existing at present patient more than 100,000,000, the about 3,000,000 New Development patients of annual increase.Hypertension is to cause life-threatening cardiovascular diseases such as myocardial infarction, apoplexy, and the main cause of kidney disease etc.Angiotensin-convertion enzyme inhibitor (ACEI) hypotensor is the most frequently used class medicine of clinic control hypertension.It mainly brings into play the pharmacological action of blood pressure lowering by the activity that suppresses ACE enzyme in the renin angiotensin aldosterone system.
The antihypertensive effect of existing each hypotensor is unsatisfactory, and the effective percentage of single drug is about 60-70%, and individual difference is big.This mainly is owing to lack the indication mechanism of measurable curative effect of medication, so the doctor has no way of selecting medicine, compatibility and dosage according to individual variation when medication, reduce efficient and the safety of clinical application, treatment relatively, increased the risk that toxic and side effects and financial burden take place.
Principle of the present invention is as follows:
One, the antihypertensive drugs regulating and controlling effect of the mechanism of blood pressure regulating and ACEI:
Renin angiotensin aldosterone system (RAAS) as topmost biology of path, all has important effect in blood pressure regulating and hypertension incidence.Tonin (ACE) is a kind ofly on this path to regulate and control activating enzymes blood pressure, that have crucial biological significance.One of main effect of angiotensin converting enzyme (ACE) shows the Kallidin I of can degrading, and suppresses the effect of nitric oxide (NO) synzyme indirectly, changes the dependent vasorelaxation action of endotheliocyte.Kallidin I combines with the bradykinin b 2 receptor of G-protein coupling, activates phospholipase (PLC) and phospholipase A2 (PLA2) in the vascular endothelial cell, induces prostacyclin (PGI2) and nitric oxide (NO).The normal blood vessels endotheliocyte is by secretion endothelium derivation contraction factor (EDCF) and endothelium derivation relaxing factor (EDRF has proved the nitric oxide that endothelium generates), dynamic adjustments blood vessel wall equalization of strain.Under the pathologic condition, Kallidin I produces chain pathologic effect because ACE too much degrades, and the endothelium nitric oxide is generated reduce, and vascular smooth muscle cell tensity is unbalance, the dependent vasodilation functional lesion of endotheliocyte, and peripheral vascular resistance raises.
The successful development of angiotensin-convertion enzyme inhibitor (ACEI) is one of milestone that modern age, cardiovascular drugs made progress.The ACEI hypotensor mainly combines with tonin by ACEI, suppresses the activity of ACE, reaches the generation that (1) suppresses Angiotensin II (AngII) with this, reduces the secretion of aldosterone; (2) degraded of restriction Kallidin I, and then activate nitric oxide synthetase, protection vascular endothelial cell and dependency diastolic function thereof reduce the blood vessel wall tension force that sympathetic nerve causes; Cause the comprehensive function blood vessel dilating, realize antihypertensive effect.
Clinically being widely used in that treatment is light, the benazepril of moderate essential hypertension is one of representative of ACEI class medicine, is the long-acting ACE inhibitor of a kind of non-sulfydryl, and only need once oral every day, and common dose is 5-80mg.(Moser?M，Abraham?PA，Bennett?WM，et?al.，The?effects?of?benazepril，a?new?angiotensin-converting?enzyme?inhibitor，in?mildto?moderate?essential?hypertension：a?multicenter?study.Clin?Pharmacol?Ther?1991，49(3)：322-9)。The clinical medicine commonly used of other ACEI classes also comprises: captopril (captopril), enalapril (enalapril), cilazapril (cilazapril), benazepril (benazepril), perindopril (perindopril), ramipril (ramipril), fosinopril (fosinopril) etc.
Two, the MS gene A sp919Gly polymorphism on the human homocysteine metabolic pathway found of the present invention is to the predicting function of ACEI class antihypertensive drug drug effect:
Methionine synthetase (MS) is on the metabolic pathway of homocysteine, guarantees the important reaction enzymes of methionine cyclic metabolism.Homocysteine (Homocysteine) is a kind of aminoacid that contains sulfydryl, is important intermediate product in methionine and the cysteine metabolic process.Homocysteine has two kinds of outlets from methionine behind a series of demethylating reactions: (1) enters the methionine metabolic cycles.Through methionine synthetase (MS) catalysis, the homocysteine that 50% metabolism generates is through the generation methionine that methylates; Vitamin B12 is as cofactor, 5, and the 10-methyl tetrahydrofolate is participated in this process that methylates as donor, last under the effect of methionine synthase synthetic methionine again.(2) condensation forms cysteine.Through vitamin B6 (with the form of 5-phosphoric acid-pyridoxol) participating in activation cystathionie-beta-synthetase (CBS), in addition about 50% homocysteine is condensed into cystathionie with serine under the catalysis of CBS, and final metabolism is the cysteine of small-molecular weight more.
The MS gene is the important candidate gene on the homocysteine metabolic pathway.Found that there is the single nucleotide polymorphism that changes protein function in the MS gene.Wherein have the A/G polymorphism on MS gene the 2756th bit base, it makes the 919th amino acids of gene outcome become Gly by Asp.MS gene A sp919Gly site mutation makes the active reduction of MS.Reports such as Geisel, methionine synthetase (MS) gene A sp919Gly (D919G) polymorphism with the rising significant correlation of the metabolite cystathionie level of homocysteine, points out this polymorphism may hinder the process that methylates of homocysteine.Other has report MS gene A sp919Gly polymorphism and other gene pleiomorphisms to interact, and causes the rising of blood plasma homocysteine level.Research shows that also h and E two aspect factors also can influence the level of homocysteine in plasma.For example found certainly that blood plasma folate level and homocysteine level and cardiovascular and cerebrovascular disease are the negative response relation; But it is still disputable with the relation of gene mutation site.
The relation of MS gene pleiomorphism and ACEI class blood pressure lowering mechanism does not still have the research report.Influence the feature that homocysteine methylates, reaches the hyperhomocysteinemiainjury that causes thus according to aforementioned MS gene mutation, the relation of the inhibitory action mechanism of MS gene mutation and hypertensin enzymeinhibitor (ACEI) may be the biological effect that produces by the homocysteine in plasma concentration change, but does not study report at present.Known at present, hyperhomocysteinemiainjury is the independent risk factor of cardiovascular and cerebrovascular disease morbidities such as hypertension, coronary heart disease.The rising of Plasma Homocysteine can cause blood vessel injury, induces the endothelial function disorder, stimulated vascular smooth muscle cell propagation.Animal experiment prompting oxidation mechanism is the morbific key of homocysteine, because homocysteine can be suppressed by catalase the toxic action that endothelial cells cultured produced.When hyperhomocysteinemiainjury, the activity that suppresses nitric oxide synthetase by a series of active oxygen intermediate products (superoxide anion free radical, hydrogen peroxide, hydroxyl etc.) that produce indirectly, suppress the synthetic of NO and promoted its degraded, nitric oxide production burst size is descended, thereby cause vascular function unusual, obviously impaired by the endothelium-dependent relaxation vasodilation function of NO mediation.And ACE inhibitor is by reducing the degraded of Kallidin I, and then activation nitric oxide synthetase, improve vascular endothelial function, homocysteine concentration may make this function of ACEI weaken or form antagonism, therefore MS is as one of key enzyme of regulating homocysteine concentration, can react body homocysteine metaboilic level from MS gene A sp919Gly polymorphism, can infer and to form related with the effect of the comprehensive blood pressure lowering of ACEI class.But related factors still remains to be inquired into to the mechanism of vascular endothelial function influence.
Smoking is the risk factor of cardiovascular disease such as the hypertension of generally acknowledging, coronary heart disease, and it is also relevant with the rising of blood pressure to drink.Cigarette can cause disorders of lipid metabolism, endothelial function imbalance, and ethanol can cause that vascular smooth muscle shrinks, and influences endothelial function.And found that in Australian crowd MS gene A SP919GLY polymorphism and smoking interact, the danger of coronary heart disease is risen.So the smoking and one of the key factor that to consider when also being understanding ACEI class hypotensive effect feature of drinking.
Before the present invention relates to discover generation, though present research prompting MS gene and hypertensive generation and hypertensive Drug therapy have substantial connection, also do not report at present about MS gene A SP919GLY polymorphism and with environmental factors reciprocal action and hypertensive relation; The MS gene and under the environmental factors reciprocal action with ACEI class efficacy of antihypertensive treatment relation, also all be to await further research topic.
What the present invention relates to discovers:
(1) MS gene A SP919GLY polymorphism has a dependency with hypertensive; Showing as the systolic pressure of Gly allele carrier in the smoking population and diastole is pressed with and increases trend; It is homozygous that the diastolic pressure of Gly allele carrier of drinking among the crowd is significantly higher than Asp/Asp; This significance still exists after controlling other Confounding Factor.Point out this gene mutation may with smoking, the interaction of drinking, strengthened smoking, drunk the damage of endothelium, increase the danger that hypertension takes place; And when estimating pressure reduction effect, pay attention to.
(2) under the Asp919Gly of known MS gene polymorphism situation, the hypertensive patient is after the treatment of ACEI class medicine, taking medicine back the 8th, 11,14,16 day, the systolic pressure of the wild homozygous individuality of Asp/Asp, diastolic pressure fall, all be significantly higher than saltant Gly allele carrier, prompting MS gene A sp919Gly polymorphism is relevant with the hypotensive effect of ACEI class; The MS gene genotype, as one of indication mechanism of prediction ACEI class antihypertensive drug: (2.1) can indicate and be qualitative and predict the drug effect of ACEI hypotensor quantitatively; (2.2) and metabolism (enzyme) activity/functional status that can instruct MS gene pleiomorphism correspondence, the function target spot as new drug instructs the research and development of compound antihypertensive drug; (2.3) and can indicate compound antihypertensive drug in conjunction with development, the more individual dose,optimum of choose reasonable ACEI class medicine and the compatibility of suitable combination drug.
Three, with MS gene A sp919Gly polymorphism prediction ACEI class antihypertensive drug drug effect and the principle that instructs the compound antihypertensive drug research and development on the homocysteine metabolism path:
Imitate closely-related feature according to people MS gene A sp919Gly polymorphism and ACEI hypotensor among the present invention, for MS gene A sp919Gly polymorphism, take the benazepril antihypertensive effect at the wild homozygous individuality of Asp/Asp and be better than Asp/Gly or Gly/Gly saltant individuality.So different activities state of the interior homocysteine methyl metabolism of MS gene pleiomorphism antimer.Can be the blood pressure lowering mechanism that influences of MS functional gene correspondence, function target spot as the medicinal mechanism of new drug, design the blanket compound antihypertensive drug of one group of better effects if, its principle is to utilize ACEI class medicine and blood plasma homocysteine to exist reciprocal action on the change endothelial function.ACEI class medicine can bring high blood pressure down by improving endothelial function; The associating compatibility promotes homocysteine metabolic folic acid donor and vitamin cofactors such as methylate, to help reducing Plasma Homocysteine, promote the NO synthase activity, promote endotheliocyte to discharge NO and vasodilative effect thereof, the protection endothelial function; For any MS gene A sp919Gly polymorphism, all will improve the antihypertensive effect of ACEI class medicine forming in varying degrees to working in coordination with or replenishing on the ACEI class mechanism of drug action.Form one group of alternative good efficient combination drug of ACEI class.
Imitate closely-related feature according to people MS gene A sp919Gly polymorphism and ACEI hypotensor among the present invention, and aforementioned ultimate principle, when the MS genotype has Gly allele, MS enzyme function is suppressed, hindered methylating of cysteine, cause that homocysteine in plasma concentration increases, thereby cause endothelial function disturbance.Infer that in view of the above the individuality that carries for Gly allele by the most adaptive 5 and combination, can be strengthened homocysteine metabolic folic acid donor and vitamin cofactors such as methylate more targetedly.
Therefore, no matter to general crowd or special MS gene A sp919Gly polymorphism crowd, vitamin B12, methyl donor tetrahydrofolic acid and vitamin B6 and the coupling of ACEI hypotensor, the blood pressure lowering drug effect that all can promote the ACEI hypotensor.Measure the said gene type of MS,, more reasonable compound antihypertensive drug compatibility, selection and the dose application that can instruct makes it more to be applicable to individuality.
Vitamin B12, methyl donor tetrahydrofolic acid and vitamin B6 one by one or the associating compatibility can be made into one group and use for any MS genotype is individual, comprehensively improve the blood pressure lowering drug effect of ACEI class medicine.Existing a large amount of clinical observation and studies show that has lacked above-mentioned some important vitamin and may cause the homocysteine level in the body; Folic acid, vitamin B12, vitamin B6 can be separately or synergy, all can reduce the homocysteine level that nearly all reason causes, increase the reasonable absorption of being rich in above-mentioned nutritional labeling (folic acid and vitamin) food at present, in conjunction with taking separately or Cernevit-12, be widely used in the treatment of clinical hyperhomocysteinemiainjury.May be because of there be genetic defect in some individuality or because of gene pleiomorphism, show as the low or difference of metabolic efficiency of homocysteine, therefore need picked-up than the ordinary person more folic acid of multiple dose and vitamin (comprising B6 and B12) etc., make Plasma Homocysteine be controlled at normal range.About the dose compatibility of drug combination, accumulated quite abundant clinical experience commonly used and result of study, can be applicable in the compatibility of combination drug.
In addition, take the existing clinical research of folic acid for a long time and point out the long-term protection that may form,, enlarged the scope of medicinal application, improved its value making this class compound medicines have the more efficacy of antihypertensive treatment of lasting stability to target organs such as inner skin cell functions.At present, still there is not the hypertensive ACEI class of above-mentioned treatment combination drug.
Summary of the invention
The technical problem that solves
For improving the individual selection of clinical application, improve curative effect of medication, reduce the generation of toxic and side effects, the invention provides a kind of test kit, method, software and compound medicines of the ACEI of prediction hypotensor drug effect, predict and improve the drug effect of ACEI hypotensor by measuring the receptor gene polymorphism loci gene type.
Technical scheme
For achieving the above object, take following technical scheme:
A kind of test kit of predicting ACEI hypotensor drug effect, by measuring MS gene A sp919Gly polymorphic site prediction depressor drug effect, its composition comprises: primer (Primer); Restricted enzyme HaeIII (to the MS gene),, restricted enzyme II, hot resistant DNA polymerase (Taq) and deoxidation triphosphoric acid mononucleotide (dNTP).
The sequence of the primer of described MS gene (Primer) is:
Forward primer: 5 ' GAACTAGAAGACAGAAATTCTCTA3 '
Downstream primer: 5 ' CATGGAAGAATATCAGATATTAGA3 '
This primer is artificial design and adopts oligonucleotide synthesizer synthetic.The G/C ratio is reasonable, and the annealing temperature of positive anti-chain is approaching, the high specificity of this enzyme restriction enzyme site in the amplified fragments.
A kind of method of predicting ACEI hypotensor drug effect, this method is by measuring experimenter's MS gene A sp919Gly polymorphic site, prediction ACEI hypotensor drug effect.
Comprise the steps: in the described mensuration MS gene A rg16Gly polymorphic site genotype
(1) genomic DNA of extraction host cell;
(2) use polymerase chain reaction (PCR) amplification MS functional gene;
(3) digestion with restriction enzyme;
(4) electrophoresis detection MS gene A sp919Gly polymorphic site genotype;
In the described prediction drug effect, by detecting gene type prediction ACEI hypotensor drug effect: when the MS genotype was the Asp/Asp genotype, its efficacy of antihypertensive treatment was Gly/Asp or Gly/Gly with higher and work as the MS genotype, and its efficacy of antihypertensive treatment is relatively poor.
A kind of software of predicting ACEI hypotensor drug effect, on the basis of measuring MS functional gene polymorphism loci gene type, realize following steps by the computer language procedure computing:
(1) obtains MS functional gene shape parameter and basic physiological parameter: age, body weight, sex, height, basic SBP and basic DBP;
(2) carry out following computing:
Y
0(Δ SBP)=(2.5*MS wild type)+(0.23* age-0.14* body weight-0.01* height-1.19* sex+0.33* baseline SBP)-21.1
Z
0(Δ DBP)=(2.4*MS wild type)+(0.13* age-0.08* body weight-0.03* height-1.65* sex+0.38* baseline DBP)-13.1;
(3) according to operation result quantitative forecast ACEI hypotensor drug effect.
A kind of compound medicines that improves ACEI hypotensor drug effect, measuring the curative effect of improving the ACEI hypotensor on the genotypic basis of MS gene polymorphism sites, this compound medicines comprises main component ACEI class Altace Ramipril and drug effect enhancing ingredients, and wherein the drug effect enhancing ingredients is one or more in folic acid, tetrahydrofolic acid, folic acid compound formulation, vitamin B12, vitamin B12 compound formulation, vitamin B6 and the vitamin B6 compound formulation.
Described ACEI hypotensor is one or more in captopril (captopril), enalapril (enalapril), cilazapril (cilazapril), benazepril (benazepril), perindopril (perindopril), ramipril (ramipril), fosinopril (fosinopril), the lisinopril (lisinopril).
Beneficial effect
The invention provides a kind of test kit, methodology and the cover software that utilize functional gene prediction ACEI class curative effect of antihypertensive drug, can be used as the indication mechanism of ACEI hypotensor drug effect, by measuring MS functional gene Asp919Gly polymorphic site genotype, prediction ACEI hypotensor curative effect; Also can be with genotype as parameter in conjunction with basic physiological parameter and special parameter by calculating the drug effect of predicting the ACEI hypotensor quantitatively, improve precision of prediction; Be convenient to the doctor and when medication, select, improved the efficient and the safety of clinical application and treatment, reduced the risk that toxic and side effects and financial burden take place according to individual variation.The present invention can also instruct new drug development to form one group of compound new drug of ACEI class by measuring genotype, and is special in the not good patient of present therapeutic effect, and better choice is provided.In a word, use the invention achievement of this class functional gene polymorphism, select medicine, prediction medication curative effect and instruct new drug development to have the using value of industry and service instructing the clinical of antihypertensive drug from now on more economically effectively.
The specific embodiment
Embodiment 1: use test kit prediction ACEI hypotensor drug effect
A kind of test kit of predicting ACEI hypotensor drug effect, this test kit comprises:
A liquid: PCR buffer (PCR buffer), composition is KCL, Tris-HCl and MgCl
2
B liquid: deoxidation triphosphoric acid mononucleotide (dNTP);
C liquid: primer (Primer), synthetic by oligonucleotide synthesizer;
D liquid: hot resistant DNA polymerase (Taq); Storage temperature is-20 ℃;
E liquid: restricted enzyme HaeIII; Storage temperature is-20 ℃;
F liquid: restricted enzyme buffer 2, composition are Tris-HCl, NaCl, MgCl
2, dithiothreitol, DTT.
The sequence of the primer in this test kit is:
Forward primer: 5 ' GAACTAGAAGACAGAAATTCTCTA3 '
Downstream primer: 5 ' CATGGAAGAATATCAAGATATTAGA3 '
Use the step of this test kit prediction ACEI hypotensor drug effect as follows:
(1) amplifying target genes fragment: add genomic DNA 20ng, A liquid 1ul, B liquid 1.6ul, C liquid 0.2ul, D liquid 0.05ul in the 10 μ l PCR reaction systems; Carry out the PCR reaction by following condition:
95℃??10min，
72℃??7min。
PCR product size: 189bp
(2) digestion with restriction enzyme:, put 37 ℃ of calorstat insulations more than 4 hours by reactant being mixed as lower volume:
PCR product 10ul
F liquid 1.5ul
E liquid 0.3ul
Distilled water adds to 15ul (1 * digestion volume)
(3) electrophoresis detection MS Asp919Gly pleomorphism site genotype:
The enzyme action afterproduct is with 3.5% agarose gel electrophoresis, use the TAE electrophoretic buffer, DNA Marker uses 50bp or 100bp DNA ladder (available from Shanghai biotechnology Services Co., Ltd), and consumption is the 1ug/ hole, voltage is 250V, and electrophoresis time is 20～50 minutes.Gel behind the electrophoresis is through ethidium bromide staining, observed result under uv analyzer.
M is DNA marker, with the reference as testing result of the present invention of its 100bp and the segmental position of 200bp.189bp that the present invention relates to and 159bp two fragments appear at above-mentioned two with reference between the band.Electrophoresis result only shows the segmental homozygous wildtype Asp/Asp of being of 189bp, as 1,2,4,6,9; Electrophoresis result show 189bp and 159bp two segmental be heterozygote Asp/Gly, as 5,7,8; Electrophoresis result only shows the segmental homozygous mutation type Gly/Gly of being of 159 bp, as 3.
(4) prediction drug effect:
When genotype was the Asp91/Asp919 homozygous wildtype, the blood pressure lowering amplitude of ACEI hypotensor drug effect was bigger;
When genotype was Asp919Gly919 heterozygote or Gly919/Gly919 homozygous mutation, the blood pressure lowering amplitude of ACEI hypotensor drug effect was lower.
Embodiment 2: measure MS gene A sp919Gly pleomorphism site on the homocysteine path and predict the drug effect of ACEI hypotensor captopril
(1) the Asp919Gly polymorphic site genotype of mensuration MS gene:
(1) genomic DNA of extraction host cell:
(a) add the 30ml erythrocyte cracked liquid in the whole blood, slowly shake up, room temperature left standstill 10 minutes, during, shake for several times, thoroughly splitting erythrocyte;
(b) leave the heart/minutes 10 minutes in 4 ℃, 2000, remove supernatant, the leukocyte that will precipitate is broken up on the rotation oscillator, adds protease 40ul, RNA enzyme 50ul, shakes up, and adds write cell lysis buffer and puts 15ml, and 37 ℃ of water-baths of mixing were taken out after 20 minutes, put in the cold water;
(c) add cold albumen precipitation liquid 4ml, be placed on-20 ℃ of refrigerators 5 minutes behind the mixing, take out in 4 ℃, 3000 rev/mins centrifugal 10 minutes.Supernatant poured into slowly shake in the 50ml centrifuge tube that has added the 15ml isopropyl alcohol for several times, separate out to the DNA floccule;
(d) the DNA floccule of separating out is moved to another 1.5ml and has packed on the 75% alcoholic acid filter paper, make evaporate dried.
(e) add DNA hydrating fluid 1.5ml, put shaking table, shaken over night, standby;
(f) mensuration of DNA concentration adopts ultraviolet spectrophotometry, and the OD value of measuring respectively under two wavelength of 260nm and 280nm is a DNA concentration with OD260nm * 50 income values.And with OD260nm/OD280nm ratio estimation DNA purity;
(2) use PCR-RFLP method amplification MS functional gene:
With PCR instrument amplification MS functional gene, contain genomic DNA 20ng, 1.5mmol/LMgCl in the 10ul PCR reaction system
2, 200 μ mol/L dNTP, 50mmol/L KCl, 10mmol/L Tris-HCl (pH9.0), 0.5U/ μ l Taq archaeal dna polymerase, reaction buffer, each primer 0.2 μ mol/L (0.1～0.4 μ mol/L all can), the sequence of primer is:
Forward primer: 5 ' GAACTAGAAGACAGAAATTCTCTA3 '
Downstream primer: 5 ' CATGGAAGAATATCAAGATATTAGA3 '
The PCR reaction condition:
95℃????5～10min，
72℃????7～10min。
PCR product size: 189bp
(3) digestion with restriction enzyme
Following 1 * the digestion of enzyme action process volume (15ul)
PCR product 10ul
BufferII??????????1.5ul
HaeIII????????????2～4U
It is 15ul that distilled water adds to cumulative volume.
(4) electrophoresis detection MS gene A rg16Gly polymorphic site genotype: method and result are with embodiment 1.
(2), prediction drug effect: method is with embodiment 1.
Above method verifies that by two groups of clinical observations the result is as follows:
1, the relation of MS gene A sp919Gly polymorphism and hypertension incidence risk:
In hypertension case and normal control, discovery has significant dependency (OR=1.46 between Asp919Gly gene pleiomorphism and the hypertension state in specific crowd, P=0.033), show as Gly allele carrier in smoking population (systolic pressure and diastole be pressed with and increase trend, and reach significance level (seeing Table 1);
The relation of table 1. Arg919Gly polymorphism and hypertension state after the smoking state layering
| Genotype | Case n (%) | Contrast n (%) | Do not adjust OR (95%CI) | The P value | Adjust OR (95%CI) | The P value |
| The non-smoking group of smoking group Asp/Asp Gly/Gly+Asp/Gly Asp/Asp Gly/Gly+Asp/Gly | ?419(76.9) ?126(23.1) ? ?1171(82.7) ?245(17.3) | 284(83.0) 58(17.0) ? 579(82.0) 127(18.0) | ????1 ????1.46(1.0，2.1) ? ????1 ????0.95(0.8，1.2) | ? ??0.033 ? ? ??0.692 | ????1 ????1.47(1.0，2.1) ? ????1 ????0.94(0.7，1.2) | ? ??0.034 ? ? ??0.629 |
Annotate: factor such as adjust sex, age, drink.
The diastolic pressure of Gly allele carrier is significantly higher than the Asp/Asp genotype in the crowd of drinking, control other Confounding Factor after this significance still have (P=0.003) (seeing Table 2);
Table 2.The relation of Arg919Gly polymorphism and hypertension state after the state layering of drinking
| Genotype | ????N ????(％) | ?????SBP ????(mmHg) | Do not adjust the P value | Adjust the P value | ??????DBP ?????(mmHg) | Do not adjust the P value | Adjust the P value |
| The non-group ASP/Asp Gly/Gly+Asp/Gly that drinks of the group of drinking ASP/Asp Gly/Gly+Asp/Gly | ?611(81.5) ?139(18.5) ? ?1761(81.6) ?397(18.4) | ??144.7±25.2 ??145.7±22.5 ? ??147.8±25.0 ??149.5±25.2 | ? ??0.654 ? ? ??0.248 | ? ?0.206 ? ? ?0.315 | ??91.6±14.4 ??95.0±14.5 ? ??91.2±14.0 ??90.7±13.4 | ? ??0.01 ? ? ??0.525 | ? ?0.003 ? ? ?0.467 |
Annotate: adjust factors such as sex, age, smoking.
2, MS gene and hypertension therapeutic effect relationship:
The the 8th, 11,14,16 day diastolic pressure (DBP) antihypertensive effect is significantly higher than Asp919Gly919 genotype or Gly919/Gly919 (P＜0.05) in the Asp919/Asp919 homozygous individual after the hypertensive patient takes benazepril, the hypotensive effect relevant (seeing Table 3) of prompting MS gene A sp919Gly polymorphism and benazepril.
The relation of the efficacy of antihypertensive treatment of table 3 benazepril and MS gene A SP919GLY polymorphic site
| Genotype | ????N | Effective percentage (%) | Do not adjust OR (95%CI) | Do not adjust the P value | Do not adjust OR (95%CI) | Do not adjust the P value |
| The 16th day ASP/Asp Gly/Gly+Asp/Gly of the 8th day ASP/Asp Gly/Gly+Asp/Gly the 14th day ASP/Asp Gly/Gly+Asp/Gly of the 11st day ASP/Asp Gly/Gly+Asp/Gly of the 5th day ASP/Asp Gly/Gly+Asp/Gly | ????699 ????156 ????688 ????152 ????671 ????153 ????597 ????141 ????644 ????145 | ??58.1 ??57.7 ??72.7 ??65.1 ??69.9 ??62.1 ??72.2 ??66 ??57.5 ??41.4 | ????1 ????0.98(0.7-1.4) ????1 ????0.70(0.5-1.0) ????1 ????0.71(0.5-1.0) ????1 ????0.75(0.5-1.1) ????1 ????0.52(0.4-0.8) | ??0.929 ? ??0.064 ? ??0.062 ? ??0.143 ? ??0.001 | ????1 ????0.92(0.6-1.3) ????1 ????0.63(0.4-0.9) ????1 ????0.64(0.4-0.9) ????1 ????0.64(0.4-1.0) ????1 ????0.52(0.4-0.8) | ????0.659 ? ????0.023 ? ????0.024 ? ????0.048 ? ????0.001 |
Annotate: adjusted factors such as sex, age, BMI.
Embodiment 3: measure MS gene A sp919Gly pleomorphism site on the homocysteine path and predict the drug effect of ACEI hypotensor captopril
Method is observed the result similar to benazepril with embodiment 2 in the zoopery of ACEI class medicine captopril (captopril).
Embodiment 4: measure MS gene A sp919Gly pleomorphism site on the homocysteine path, and the drug effect of prediction ACEI hypotensor fosinopril
Method is observed the result similar to benazepril with embodiment 2 in the zoopery of ACEI class medicine fosinopril (fosinopril).
Embodiment 5, a kind of software of predicting ACEI hypotensor drug effect
On the basis of measuring MS functional gene polymorphism loci gene type, realize following steps by the computer language procedure computing:
(1) obtains MS functional gene shape parameter and basic physiological parameter: age, body weight, sex, height, basic SBP and basic DBP;
(2) carry out following computing:
Y
0(Δ SBP)=(2.5*MS wild type)+(0.23* age-0.14* body weight-0.01* height-1.19* sex+0.33* baseline SBP)-21.1
Z
0(Δ DBP)=(2.4*MS wild type)+(0.13* age-0.08* body weight-0.03* height-1.65* sex+0.38* baseline DBP)-13.1
(3) according to operation result quantitative forecast ACEI hypotensor drug effect.
The value mode of the genotype parameter value in the above step (1) is as follows: by the genotype value of the MS gene polymorphism sites of measuring, when undergoing mutation (Asp/Gly or Gly/Gly type), MS saltant parameter gets 1; When being homozygous wildtype (Asp/Asp type), MS saltant parameter gets 0.The value mode of the basic physiological parameter value in the above step (1) is as follows: parameter treating excess syndrome border age at age numerical value, unit are year; Body weight parameter treating excess syndrome border body weight value, unit is a kilogram (kg); The sex parameter gets 1 for the man, for the woman gets 2; Height parameter treating excess syndrome border height values, unit is a rice (m); Basis SBP parameter is basic systolic blood pressure value, and unit is a millimetres of mercury; Basis DBP parameter is basic diastolic blood pressure value, and unit is a millimetres of mercury.
The Y that calculates through step (2)
0Value is the variable quantity of diastolic pressure (millimetres of mercury), can predict the drug effect of ACEI hypotensor quantitatively by these two values.
Embodiment 6, a kind of software of predicting ACEI hypotensor drug effect
On the basis of measuring MS functional gene polymorphism loci gene type, realize following steps by the computer language procedure computing:
Step has been obtained in step (1) after genotype parameter and the basic physiological parameter with embodiment 5, obtains special parameter again: smoking at present, previously smoking, drink at present, previously drink; After in step (2), carrying out computing, Y0 and Z0 value are carried out following correction calculation:
Y
0(Δ SBP)=(2.5*MS wild type)+(0.22* age-0.14* body weight-0.01* height-1.62* sex+0.33* baseline SBP)-21.2
Z
0(Δ DBP)=(2.5*MS wild type)+(0.13* age-0.08* body weight-0.04* height-1.24* sex+0.39* baseline DBP)-122;
The value mode of the special parameter value in the above step (1) is as follows: at present the smoking parameter is according to the present smoking situation value of experimenter, gets 1 when being, gets 0 for not the time; Previously the value of smoking parameter is with aforementioned, gets 1 when being, gets 0 for not the time; The parameter of drinking at present is according to experimenter's the situation of drinking at present value, gets 1 when being, gets 0 for not the time; The parameter of previously drinking is according to the past of experimenter situation value of drinking, and gets 1 when being, gets 0 for not the time; The value mode of all the other parameters is with embodiment 5.
With above parameter substitution step (2), the Y that draws as calculated
1Value is variable quantity of systolic pressure (millimetres of mercury) and Z
1Value is the variable quantity of diastolic pressure (millimetres of mercury),
Y
1(Δ SBP)=Y
0+ (the present smoking of 0.29*-0.82* previously smoking-0.12* drink at present-2.54* previously drinks)
Z
1(Δ DBP)=Z
0+ (the present smoking of+1.44*+0.27* previously smoking+0.05* drink at present-1.96* previously drinks)
Can predict the drug effect of ACEI hypotensor quantitatively by this value, and by simple query mode obtain existing smoking, previously smoking, drink, characteristic parameters such as education, occupation, what calculate predicts depreciation down than the more accurate blood pressure of embodiment 5.
Embodiment 7, a kind of software of predicting ACEI hypotensor drug effect
On the basis of measuring MS functional gene polymorphism loci gene type, realize following steps by the computer language procedure computing:
Step has been obtained in step (1) after genotype parameter and basic physiological parameter and smoking, the parameter of drinking with embodiment 6, obtains special parameter QTc again; Carry out following correction calculation:
Y
1(Δ SBP)=(2.7*MS saltant)+(0.23* age-0.14* body weight-0.007* height-2.02* sex+0.33* baseline SBP)+(the present smoking of 0.14*-1.43* previously smoking-0.15* drink at present-2.67* previously drinks)-15.5
Z
1(Δ DBP)=(2.8*MS saltant)+(0.13* age-0.07* body weight-0.07* height-1.72* sex+0.38* baseline DBP)+(the present smoking of+1.42*+0.02* previously smoking-1.21* drink at present-1.10* previously drinks)-6.64
The value mode of the special parameter value in the above step (1) is as follows: special parameter QTc is the heart rate Q-Tc interval, QTc=QT/RR, and wherein QT is a time value between electrocardial vector Q-T, RR is a time value between R-R.The value mode of all the other parameters together
Embodiment 6.
With above parameter substitution step (2), the Y that draws as calculated
2Value is the variable quantity of systolic pressure (millimetres of mercury), Z
2Value is the variable quantity of diastolic pressure (millimetres of mercury),
Y
2(ΔSBP)＝Y
1+(-6.47*QTC)
Z
2(ΔDBP)＝Z
1+(-1.10*QTC)
Can predict the drug effect of ACEI hypotensor quantitatively by these two values, and can obtain special parameter QTc by electrocardiogram objective measurement result, available as calculated than the more accurate blood pressure drops predictive value of embodiment 6.
Embodiment 8: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: benazepril+folic acid or tetrahydrofolic acid or folic acid compound formulation
This compound medicines manufactures and designs on the genotypic basis of mensuration homocysteine metabolism path MS pleomorphism site, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
The zoopery of two kidneys, one folder type hypertension and spontaneous type Hypertensive Rats shows, the compound medicine of benazepril+folic acid or tetrahydrofolic acid or folic acid compound formulation, and hypotensive effect is greater than benazepril medicine group.
Embodiment 9: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: benazepril+folic acid or tetrahydrofolic acid+vitamin B12
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, benazepril+folic acid or tetrahydrofolic acid+vitamin B12 compound medicine, and hypotensive effect is greater than benazepril medicine group.
Embodiment 10: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: benazepril+folic acid or tetrahydrofolic acid+vitamin B6
This compound medicines manufactures and designs on the genotypic basis of mensuration homocysteine metabolism path MS pleomorphism site, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
The zoopery of two kidneys, one folder type hypertension and spontaneous type Hypertensive Rats shows, benazepril+folic acid or tetrahydrofolic acid+vitamin B6 compound medicine, and hypotensive effect is greater than benazepril medicine group.
Embodiment 11: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: benazepril+vitamin B12
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, the compound medicine of benazepril+vitamin B12, and hypotensive effect is greater than benazepril medicine group.
Embodiment 12: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: benazepril+vitamin B6
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, the compound medicine of benazepril+vitamin B6, and hypotensive effect is greater than benazepril medicine group.
Embodiment 13: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: fosinopril+folic acid or tetrahydrofolic acid or folic acid compound formulation
This compound medicines manufactures and designs on the genotypic basis of mensuration homocysteine metabolism path MS pleomorphism site, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
The zoopery of two kidneys, one folder type hypertension and spontaneous type Hypertensive Rats shows, the compound medicine of fosinopril+folic acid or tetrahydrofolic acid or folic acid compound formulation, and hypotensive effect is greater than fosinopril medicine group.
Embodiment 14: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: fosinopril+folic acid or tetrahydrofolic acid+vitamin B12
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, fosinopril+folic acid or tetrahydrofolic acid+vitamin B12 compound medicine, and hypotensive effect is greater than fosinopril medicine group.
Embodiment 15: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: fosinopril+folic acid or tetrahydrofolic acid+vitamin B6
This compound medicines manufactures and designs on the genotypic basis of mensuration homocysteine metabolism path MS pleomorphism site, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
The zoopery of two kidneys, one folder type hypertension and spontaneous type Hypertensive Rats shows, fosinopril+folic acid or tetrahydrofolic acid+vitamin B6 compound medicine, and hypotensive effect is greater than fosinopril medicine group.
Embodiment 16: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: fosinopril+vitamin B12
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, the compound medicine of fosinopril+vitamin B12, and hypotensive effect is greater than fosinopril medicine group.
Embodiment 17: a kind of the present invention uses described ACEI class blood pressure lowering compound medicines: fosinopril+vitamin B6
This compound medicines manufactures and designs on genotypic basis, improves the curative effect of ACEI hypotensor.For the individuality of general use ACEI class medicine, this compound medicine can be in varying degrees from improving the pharmacological action of the collaborative or supplementary AC EI of Plasma Homocysteine.Can select the combination drug of different compatibilities or dosage according to individual metabolic characteristics.Especially for Gly genotype carrier, the antihypertensive effect that improves ACEI class medicine should be more obvious.
Two kidneys, one folder type Hypertensive Rats and the hypertensive zoopery of spontaneous type show, the compound medicine of fosinopril+vitamin B6, and hypotensive effect is greater than fosinopril medicine group.
Claims (12)
1. compound medicines that improves ACEI hypotensor drug effect, it is characterized in that on the genotypic basis of mensuration MS gene polymorphism sites, improving the curative effect of ACEI hypotensor, this compound medicines comprises main component ACEI class Altace Ramipril and drug effect enhancing ingredients, and wherein the drug effect enhancing ingredients is one or more in folic acid, tetrahydrofolic acid, folic acid compound formulation, vitamin B12, vitamin B12 compound formulation, vitamin B6 and the vitamin B6 compound formulation.
2. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described ACEI hypotensor is one or more in captopril (captopril), enalapril (enalapril), cilazapril (cilazapril), benazepril (benazepril), perindopril (perindopril), ramipril (ramipril), fosinopril (fosinopril), the lisinopril (lisinopril).
3. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is benazepril and folic acid or tetrahydrofolic acid or folic acid compound formulation.
4. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is benazepril, folic acid or tetrahydrofolic acid and vitamin B12.
5. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is benazepril, folic acid or tetrahydrofolic acid and vitamin B6.
6. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is benazepril and vitamin B12.
7. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is benazepril and vitamin B6.
8. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is fosinopril and folic acid or tetrahydrofolic acid or folic acid compound formulation.
9. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is fosinopril, folic acid or tetrahydrofolic acid and vitamin B12.
10. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is fosinopril, folic acid or tetrahydrofolic acid and vitamin B6.
11. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is fosinopril and vitamin B12.
12. the compound medicines that improves ACEI hypotensor drug effect as claimed in claim 1 is characterized in that: described polypharmaceutic composition is fosinopril and vitamin B6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510008999 CN1679943A (en) | 2002-07-31 | 2002-07-31 | Compound medicine for improving effect of ACEI hypotensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510008999 CN1679943A (en) | 2002-07-31 | 2002-07-31 | Compound medicine for improving effect of ACEI hypotensor |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN021258635A Division CN1217008C (en) | 2002-07-31 | 2002-07-31 | Reagent box, method software and composite medicine for predicting effect of ACEI hypotensors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1679943A true CN1679943A (en) | 2005-10-12 |
Family
ID=35066936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510008999 Pending CN1679943A (en) | 2002-07-31 | 2002-07-31 | Compound medicine for improving effect of ACEI hypotensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1679943A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101176788B (en) * | 2006-11-11 | 2011-06-15 | 深圳奥萨医药有限公司 | Pharmaceutical composition for ACE restrainer/uretica/folic acid, and uses thereof |
| CN103690954A (en) * | 2013-12-25 | 2014-04-02 | 四川大学华西医院 | Cardiovascular protection medicinal composition and use thereof |
| CN107007812A (en) * | 2017-04-05 | 2017-08-04 | 江苏大学 | A kind of method for extending captopril hypotensive efficacy time |
-
2002
- 2002-07-31 CN CN 200510008999 patent/CN1679943A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101176788B (en) * | 2006-11-11 | 2011-06-15 | 深圳奥萨医药有限公司 | Pharmaceutical composition for ACE restrainer/uretica/folic acid, and uses thereof |
| CN103690954A (en) * | 2013-12-25 | 2014-04-02 | 四川大学华西医院 | Cardiovascular protection medicinal composition and use thereof |
| CN103690954B (en) * | 2013-12-25 | 2016-08-17 | 四川大学华西医院 | A kind of cardiovascular protection medicinal composition and application thereof |
| CN107007812A (en) * | 2017-04-05 | 2017-08-04 | 江苏大学 | A kind of method for extending captopril hypotensive efficacy time |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109868314B (en) | Kit for detecting cardiovascular disease drug gene and detection method | |
| CN1330556A (en) | Combination therepy of angiotensin-converting enzyme inhibor and aldosterone antagonist for reducing morbidity and mortality from cardiovascular disease | |
| CN1604968A (en) | Methods to treat diabetes and related conditions based on polymorphisms in the TCF-1 gene | |
| CA2362533A1 (en) | Gene sequence variations with utility in determining the treatment of disease | |
| CN1279606A (en) | Use of inhibitors of the renin-angiotensin system for the treatment of hypoxia or impaired metabolic function | |
| CN109082464B (en) | Primer group and kit for detecting hypertension drug metabolism related genes | |
| Kui et al. | The relationship between polymorphisms at 17 gene sites and hypertension among the Aboriginal Tibetan people | |
| CN1217008C (en) | Reagent box, method software and composite medicine for predicting effect of ACEI hypotensors | |
| CN1679943A (en) | Compound medicine for improving effect of ACEI hypotensor | |
| CN1898394A (en) | Method of detecting predisposition to high altitude pulmonary edema | |
| CN101029336A (en) | Reagent kit for predicting serotonin re-uptake inhibitor medicine effect | |
| CN1858240A (en) | Method for predicting angiotonin II receptor agonist hypotensor function and use | |
| CN1891822A (en) | PH gene with specific mononucleotide pleimorphism, and its detecting method and use | |
| CN1639190A (en) | Transmembrane NFAT inhibitory peptide | |
| CN107435076A (en) | A kind of hypertension medication genetic test Solid phase PCR kit | |
| CN1827776A (en) | Method for predicting calcium antagonist medicine effect and application thereof | |
| CN101063166A (en) | Reagent case for predicting action effect of angiotensin conversion enzyme inhibitor medicament | |
| CN1781554A (en) | Compound medicine for predicting ACEI pressure reducing medicine effect | |
| CN101029337A (en) | Use and method for predicting serotonin re-uptake inhibitor medicine effect by polymorphic site | |
| CN1282338A (en) | A DNA molecule encoding mutant prepro-neuropeptide Y, a mutant signal peptide, and uses thereof | |
| CN1685062A (en) | Methods to predict cholesterol elevations during immunosuppressant therapy | |
| CN1940086A (en) | Method for determining patient's brain ictus genetic susceptibility | |
| CN101063165A (en) | Method for predicting action effect of angiotensin conversion enzyme inhibitor medicament | |
| CN1925851A (en) | Dichloroacetate combined with inotrope for heart protection | |
| CN1151168C (en) | Antisense thio-oligonucleic acid of target protein kinase C-alpha and its medicine composition and application in treating cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |