CN1661098A

CN1661098A - Chop for diagnosing absence type gene of alpha thalassemia

Info

Publication number: CN1661098A
Application number: CN 200410091906
Authority: CN
Inventors: 李泽松; 张文
Original assignee: SHENZHEN YISHENGTANG BIOLOGICAL PRODUCTS Co Ltd
Current assignee: SHENZHEN YISHENGTANG BIOLOGICAL PRODUCTS Co Ltd
Priority date: 2004-12-29
Filing date: 2004-12-29
Publication date: 2005-08-31

Abstract

A DNA chip for detecting the depletion alpha-Mediterranean anemia gene features that the specific probe fixed to substrate is hybridized with the specific PCR product to detect said gene.

Description

Absence type gene of alpha thalassemia diagnosing chip

Technical field

The present invention relates to a kind of DNA chip that medical science detects people's α-Zhu Danbai genetically deficient that can be used for.

The invention still further relates to this chip production method.

The invention still further relates to the pulsating amplification method of target dna.

Background technology

α-Di Zhonghaipinxue is to cause owing to α-Zhu Danbai genetically deficient causes its synthesis rate to change, and has the heterogeneity of height on genetics, and there are higher sickness rate (Lau YL, 1997 in China south; XM Xu, 2004).The poor molecular defect in α-ground is mainly the large fragment deletion of gene.Cause the poor deletion mutantion in α-ground that broad variety is arranged, in Chinese, have 7 kinds of absence type sudden changes, promptly-- ^SEA,-α ^3.7,-α ^4.2,-α ^2.7,-- ^THAI,-- ^FILWith-- ^HW, wherein with South East Asia (-- ^SEA), a left side lacks (α ^3.7) and the right (α that lacks ^4.2) the most common.Mensuration red corpuscle commonly used clinically has the method for related parameter to poor examination diagnosis (Lau YL, 1997 of carrying out, α-ground; XM Xu, 2004).But last making a definite diagnosis diagnosed and the type judgement still needs to use gene diagnosis.In view of South East Asia, a left side lack and right lack account for Chinese's absence type α-ground poor more than 96% (XM Xu, 2004).Therefore the main task of the poor gene diagnosis in α-ground just is to detect fast this three kinds of disappearances.Traditional Southern hybrid method is the poor reliable diagnostic method in absence type α-ground, but its shortcoming apparent (Waye, 1993).Round pcr has been applied to the poor gene diagnosis in α-ground (Chong SS, 2000).

The DNA chip technology since last century, the nineties occurred (Schena M, 1995), because of its have high-throughput, parallelism, fast, characteristics such as sensitivity, obtained great development.Obtained widespread use at aspects such as heredopathia, pathogenic microorganism detections.

Summary of the invention

At modal three kinds of absence type α-Di Zhonghaipinxues among the Chinese (-- ^SEA,-α ^3.7,-α ^4.2) the detection problem, the invention provides a kind of DNA chip detecting method of quick, stable, highly sensitive, good reproducibility.

Technical scheme of the present invention comprises the pcr amplification to human gene group DNA's testing sample, it is characterized in that adopting 7 (4 couples) primer P1, P2, and P3, P4, P5, P6, P7 forms quadruple PCR, and normal allele and disappearance allelotrope increase respectively.And four primers wherein (P2, P4, P6,5 ' end P7) is fluorescence (Cy-3 or Cy5) or biotin labeling.

P1：5’-CCCTCGCCAAGTCCACCCC-3’

P2：5’-CAAAGCACTCTAGGGTCCAGC-3’

P3：5’-TTTACCCATGTGGTGCCTCC-3’

P4：5’-CCGTTGGATCTTCTCATTTCCCC-3’

P5：5’-AGCGATCTGGGCTCTGTGTTC-3’

P6：5’-CCCACGTTGTGTTCATGGCTG-3’

P7：5’-GACCAGGAAGGGCCGGTGC-3’

Technical scheme of the present invention comprises detection normal allele and the allelic specific probe of disappearance, it is characterized in that:

The specific probe that detects normal α 2 genes is:

5’-CCCCCGCCCCGCGTGCACCCCCAGGGGAGGCCGAGCCCGCCGCCCGGCCCCGCG

CAGGCCCCGCCCGGGA-3’

Detection South East Asia absence type (-- ^SEA) specific probe be:

5’-TGACGCTGTCTGCTTAAGGCCCAGGGAAACCCAGGTGCAAACTCACACTCATCAC

CCAGGCAGCCACAGC-3’

Detect rightward deletion type (α ^3.7) specific probe be:

5’-GCAGCTGGATAGGGTAGGAAAAGGCAGGGGCGGGAGGAGGGGATGGAGGAGGG

AAAGTGGAGCCACCGCG-3’

Detect lefrward deletion type (α ^4.2) specific probe be:

5’-GCCCATGCCTGTAAACCCACCTACTCCGGAGGCTGAGGCAGGAGAATCATTTTAA

CCAAGGAGGCAGAGG-3’

Technical scheme of the present invention comprises the DNA chip production method, it is characterized in that the matrix that is used for the chip preparation comprises slide, silicon chip and film etc.Slide can be through modifications such as aldehyde radical, amino or poly-lysines.Probe prints to stromal surface with point sample instrument after the sampling liquid dilution, constitute micro-array chip.

Technical scheme of the present invention comprises that pcr amplification product and chip hybridize, and hybridization signal is detected and analyzes, and has judged whether that further missing gene exists.

Embodiment

Embodiment one:

Pcr amplification

In 0.2 or 0.5mlEppendoef pipe of sterilization, in the reaction system of 25 μ l, add respectively: the mixing stock solution 5 μ l of isocyatic 7 PCR primers, isocyatic four kinds of deoxynucleotide dATP, dUTP, the mixing stock solution 8 μ l of dCTP and dGTP, reaction buffer is 10 μ l, its component is 20mmol/L Tris-HCl pH8.9,50mmol/L KCl, 1.5mmol/L MgCl ₂Paraffin 30 μ l.Add human gene group DNA 1 μ l, the PCR reaction circulates with enzyme 1 μ l, of short duration centrifugal laggard performing PCR.The PCR loop parameter is 95 ℃ of 5min; 97 ℃ of 45s, 61 ℃ of 75s, 72 ℃ of 150s, 35 circulations; 72 ℃ of 5min.

The chip preparation

Probe is diluted to 0.1 μ g/ μ l-1.51 μ g/ μ l through sampling liquid, prints to stromal surface with point sample instrument, constitutes micro-array chip (seeing accompanying drawing 1).

Chip hybridization

After PCR product and hybridization solution diluted mixing by a certain percentage, add 5-20 μ l mixed solution, behind 42 ℃ of hybridization 30-180min, slide is washed secondary, dry with washing lotion to the hybridization hole.

Hybridization signal detects

Detect DNA chip hybridization signal with the fluorescent scanning instrument.Result such as Fig. 1.

Claims

1. DNA chip of diagnosing the absence type α-Di Zhonghaipinxue, by being fixed on the specific probe on the matrix such as slide, silicon chip, thereby with specific PCR product hybridization to the common disappearance allelotrope of Chinese (-- ^SEA,-α ^3.7,-α ^4.2) detect.

2. the matrix according to the described DNA chip of claim 1 comprises slide, silicon chip and film etc.

3. the probe according to the described DNA chip of claim 1 is:

The specific probe that detects normal α 2 genes is:

5’-CCCCCGCCCCGCGTGCACCCCCAGGGGAGGCCGAGCCCGCCGCCCGGCCCC

GCGCAGGCCCCGCCCGGGA-3’

Detection South East Asia absence type (-- ^SEA) specific probe be:

5’-TGACGCTGTCTGCTTAAGGCCCAGGGAAACCCAGGTGCAAACTCACACTCA

TCACCCAGGCAGCCACAGC-3’

Detect rightward deletion type (α ^3.7) specific probe be:

5’-GCAGCTGGATAGGGTAGGAAAAGGCAGGGGCGGGAGGAGGGGATGGAGGA

GGGAAAGTGGAGCCACCGCG-3’

Detect lefrward deletion type (α ^4.2) specific probe be:

5’-GCCCATGCCTGTAAACCCACCTACTCCGGAGGCTGAGGCAGGAGAATCATTT

TAACCAAGGAGGCAGAGG-3’

4. be the single tube multiplex PCR according to the described PCR of claim 1, it is characterized in that the specific fragment of DNA increases by PCR in the testing sample, the PCR product contains the dna sequence dna with specific probe hybridization; 7 preferred primer sequences that it adopted are: