CN1654646A - High efficiency production method for recombinant silkworm antibacterial peptide CM4 - Google Patents
High efficiency production method for recombinant silkworm antibacterial peptide CM4 Download PDFInfo
- Publication number
- CN1654646A CN1654646A CN 200510037601 CN200510037601A CN1654646A CN 1654646 A CN1654646 A CN 1654646A CN 200510037601 CN200510037601 CN 200510037601 CN 200510037601 A CN200510037601 A CN 200510037601A CN 1654646 A CN1654646 A CN 1654646A
- Authority
- CN
- China
- Prior art keywords
- expression
- antibacterial peptide
- recombinant silkworm
- recombinant
- product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to the expression and purification of recombinant protein in the field of gene engineering, and is especially the high efficiency production process of recombinant silkworm antibiotic peptide. Technologically, the high efficiency production process of recombinant silkworm antibiotic peptide includes the following steps: 1) constituting ABP-CM4 eukaryotic expression vector by means of DNA technology; 2) transforming host cell Pichia yeast with ABP-CM4 eukaryotic expression vector to constitute expression engineering bacteria; 3) fermentation culturing the engineering bacteria and performing methanol inducing expression; and 4) purifying expression product through chromatography with molecular sieve column to obtain recombinant silkworm antibiotic peptide CM4 product. The present invention has high expression efficiency, simple separation and purification and other advantages, and is suitable for industrial production.
Description
Technical field
The present invention relates to the expression and the purifying of genetically engineered field recombinant protein, especially relate to the high-efficiency method for producing of recombinant silkworm antibacterial peptide CM 4.
Background technology
Antibacterial peptide is the molecule effector of innate immunity, and they contain 15-45 amino-acid residue usually, and net charge is for just.The halfcystine linear peptides that do not contain of Cecropins type is found the earliest, derives from insect.Have now found that antibacterial peptide, albumen have more than 800, derive from animal, plant field.The main action target spot of antibacterial peptide is the film of bacterium, and the process of killing and wounding must be faster than the speed of bacterial growth.It is found that many traditional microbiotic, particularly penicillin, generation that can the inducible resistance bacterial strain.In order to solve the problem of antibiotic resistance, develop new microbiotic or the antibacterial peptide particularly important that just seems.Antibacterial peptide has good antibiotic selectivity and unique antibiotic pattern, and can not induce the generation Resistant strain, is degraded easily, is difficult for enrichment in microbe, therefore, is believed to become alternative antibiotic choice drug.
Silkworm antibacterial peptide CM 4 is extracted from the fortunatus hemolymph by people such as Zhang Shuanquan, similar to the member of Cecropins family, it also has amphipathic α-Luo Xuanjiegou zone, belong to Cecropins family, contain 35 amino-acid residues, molecular weight is about 3.5KD, and very strong sterilizing ability is arranged, and bacterium, pathogenic bacteria, fungi and virus are all had effect.
At present, many antibacterial peptides are being developed patent medicine, but the natural output of antibacterial peptide is very low, and prices are rather stiff for synthetic peptide, and this becomes a bottleneck of exploitation patent medicine, produce antibacterial peptide by genetic engineering technique and have broad application prospects.
Have report once to adopt the formal representation silkworm antibacterial peptide CM 4 of escherichia expression system with fusion rotein, the result is not very good.In recent years, be that the research of genetically engineered recipient bacterium is subjected to people day by day and payes attention to the yeast.Especially methyl alcohol nutritious yeast expression system, this system has become one of very successful exogenous protein expression system, have many advantages: (1) utilizes alcohol oxidase (the alochol oxidaseI AOXI) promotor that is subjected to methanol induction, can strictly control expression of exogenous gene, the high expression level no matter born of the same parents are interior, born of the same parents all can realize foreign gene outward; (2) the pichia spp growth is quick, and culture condition is simple, is fit to high-density culture, and wet cell weight can reach 450g in the every liter of nutrient solution in fermentation back, helps improving target protein output; (3) pichia spp is as a kind of eucaryotic organism, and the albumen processing after can translating is so that foreign protein obtains correct advantages such as folding and modification.Also there is report to express antibacterial peptide (transformation of yellow Yadong antibacterial peptide AD gene and the expression South China Science ﹠ Engineering University journal in pichia spp both at home and abroad with Bichi yeast system, 2002,30 (2), 13-16), but pichia yeast expression system secreting, expressing silkworm antibacterial peptide CM 4 does not still have report at present.
Summary of the invention
The invention provides a kind of high-efficiency method for producing that adopts eukaryotic expression system express recombinant silkworm antibacterial peptide CM 4.
Technical scheme of the present invention is: a kind of high-efficiency method for producing of recombinant silkworm antibacterial peptide CM 4 may further comprise the steps:
(1) use recombinant DNA technology, make up the ABP-CM4 carrier for expression of eukaryon, vector construction is seen Fig. 1;
(2) ABP-CM4 carrier for expression of eukaryon transformed host cell Pichia yeast, the construction expression engineering bacteria;
(3) fermentation culture engineering bacteria carries out methanol induction and expresses;
(4) expression product gets the recombinant silkworm antibacterial peptide CM 4 product through the molecular sieve column chromatography purifying.
Optimized technical scheme recommendation step of the present invention (3) is specially: express the about 20h to OD600 of engineering bacteria and reach 2-6 with BMGY, 28 ℃～30 ℃ fermentation culture; Centrifugal, be about 1.0,20 ℃～30 ℃ to OD600 and cultivate about 72h with BMMY is resuspended, adding 100% methyl alcohol to methyl alcohol concentration expressed in percentage by volume every 24h is 0.5-3%, preferably 0.5%.
Step (4) is specially: express the supernatant freeze-drying, be dissolved in aqua sterilisa, boil, low-temperature centrifugation is removed precipitation,
Molecular sieve column chromatography: separating medium is sephadex G50, uses 0.05M, 5 column volumes of PH5.1 Ammonium Acetate damping fluid balance, last sample; 0.05M PH5.1 Ammonium Acetate buffer solution elution is collected the albumen elution peak, gets product.
The further optimized technical scheme of the present invention is to add the acid hydrolysis casein in step (3) culture expression process.
Using gene engineering technique of the present invention has efficiently expressed recombinant antibacterial peptide CM4 in eukaryotic host cell, CM4 has germicidal action to multiple fungi through this recombinant antibacterial peptide of experimental verification, and expression efficiency height of the present invention, separation and purification is simple, easy to operate, easily amplify, good stability is suitable for large-scale industrial production.Therefore, the present invention has important value to developing new and effective anti-infectives, has broad application prospects at pharmaceutical industry.
Description of drawings
Fig. 1 is the expression vector establishment synoptic diagram;
Fig. 2 is the synoptic diagram of the relation of acid hydrolysis casein concentration and product expression amount;
Fig. 3 is the synoptic diagram of the relation of methanol concentration and product expression amount;
Fig. 4 is the synoptic diagram of the relation of induction time and product expression amount;
Fig. 5 is chromatography and anti-microbial activity analysis chart;
Fig. 6 is the Tricine-SDS-PAGE electrophoretic analysis of purified product; Wherein swimming lane N is a natural antibacterial peptide; Swimming lane M is small molecules Marker; Swimming lane R is a purified product of the present invention;
Fig. 7 is that the acidity of purified product is surveyed the electrophoretic analysis of living; Wherein 4 is inhibition zone;
Fig. 8 is the bacteriostatic action of purified product to aspergillus niger; The wherein negative contrast of C, 1,2,3 is inhibition zone;
Fig. 9 is the bacteriostatic action of purified product to viride; The wherein negative contrast of C, 1,2,3 is inhibition zone;
Embodiment
The present invention is further described below in conjunction with drawings and Examples.
Embodiment 1:
(1) construction of expression vector: according to the preference codon and the antibacterial peptide CM 4 aminoacid sequence of pichia spp gene translation, the multiple clone site of pPIC9, synthetic two primers of design are as follows:
ABP-F?5′agatggaagattttcaagaagatcgagaaggtcggtcaaaacatcagagacggtatcgt3′
ABP-R?5′aatagtagcagcttgaccgacgacagcgacagctggaccagccttgacgataccgtctc3′
Restriction enzyme site is Xho I and Xba I, and expression plasmid is pPICZaA, and vector construction is seen Fig. 1;
(2) make up genetic engineering bacterium: transform the host bacterium with above-mentioned expression vector, host strain is yeast GS115;
(3) abduction delivering: express the about 20h to OD600 of engineering bacteria and reach 2-6 with BMGY, 28 ℃～30 ℃ fermentation culture; Centrifugal, be about 1.0,20 ℃～30 ℃ cultivations with BMMY is resuspended to OD600, adding 100% methyl alcohol to methyl alcohol concentration expressed in percentage by volume every 24h is 0.5-3%; Analyze the different final concentrations of methyl alcohol as shown in Figure 3 to the influence expressed.
(4) purifying: express the supernatant freeze-drying, be dissolved in the aqua sterilisa; Boil 10～30min, 4 ℃, the centrifugal 5min of 10000rpm;
Adopt sieve chromatography (separating medium is sephadex G50), use 0.05M, (1.5 * 40cm), flow velocity is 1ml/min to 5 column volumes of PH5.1 Ammonium Acetate damping fluid balance; Sample on the above-mentioned sample; 0.05M, PH5.1 Ammonium Acetate buffer solution elution (0.5ml/min), collecting has bacteriostatic activity albumen elutriant.
Embodiment 2: substantially the same manner as Example 1, difference is, in the abduction delivering process, adds 1-3% (W/V) acid hydrolysis casein and suppress degraded in BMMY.The relation of analysis acid hydrolysis casein addition and expression product as shown in Figure 2.
Adopt sieve chromatography (separating medium is sephadex G50), use 0.05M, (1.5 * 40cm), flow velocity is 0.5ml/min to 5 column volumes of PH5.1 Ammonium Acetate damping fluid balance; Sample on the above-mentioned sample; 0.05M, PH5.1 Ammonium Acetate buffer solution elution (0.15ml/min), chromatography and anti-microbial activity are analyzed shown in Figure 5, and collecting has bacteriostatic activity albumen elutriant.
Embodiment 3: the method identical with embodiment 2, the relation of analyzing methanol induction incubation time and expression product as shown in Figure 4.
Embodiment 4:Tricine-SDS-PAGE detects
The separation gel (urea) for preparing 15% concentration, the middle glue of 10% concentration and the concentrated glue of 4% concentration; Final purification of samples concentrates 10 times, with 2 * sample-loading buffer (4%SDS, 12% glycerine, 50mMTris, 2% mercaptoethanol, 0.01% tetrabromophenol sulfonphthalein, 6N HCl transfers PH to 6.8) mix, go up the sample electrophoresis behind the boiling water bath 5min, stationary liquid (50% methyl alcohol, 10% acetic acid) fixing 30min, the Kao Masi light blue G-250 1h that dyes decolours with destainer again.As shown in Figure 6, the sample after the separation and purification is through the Tricine-SDS-PAGE check and analysis, and every liter of fermented liquid can obtain purity greater than 96% sample 15mg.
Embodiment 5: acid electrophoresis is identified
Preparation 15% continuous glue (activity), sample mix with sample-loading buffer directly goes up sample, and 100V runs 5h; Glue is with among the sterilising liq LB and 30min, contains the solid LB of 1%E.coliK12D31 at glue upper berth one deck, puts 37 ℃ and spends the night, and as shown in Figure 7, inhibition zone 4 occurs.
Embodiment 6: the responsive fungi screening of purified product
Aspergillus niger (Aspergillus niger), flavus (Aspergillus flavus), Aspergillus parasiticus (Aspergillus parasiticus), viride (Trichodermaviride), beading sickle spore (Fusarium moniliforme), cotton rot (Fusariumoxyporium), pink sickle spore (Fusarium roseum), Candida albicans (Candidaalbicans) etc. are inoculated on the potato culture (PDA), 28 ℃, 5 days.Use aseptic water washing, 100ul spore suspension (10
4/ ml) coat potato culture, and in the last hole of beating 5mm, hole c adds not inductive supernatant for contrast, all the other each holes add purified product, cultivate 3 days, and with Fig. 8, shown in Figure 9 basic identical, inhibition zone 1,2,3 occurs for 28 ℃.Show that above-mentioned bacterial strains is all to the recombinant silkworm antibacterial peptide CM 4 sensitivity.
Claims (4)
1, a kind of high-efficiency method for producing of recombinant silkworm antibacterial peptide CM 4 may further comprise the steps:
(1) use recombinant DNA technology, make up the ABP-CM4 carrier for expression of eukaryon, vector construction is seen Fig. 1;
(2) ABP-CM4 carrier for expression of eukaryon transformed host cell Pichia yeast, the construction expression engineering bacteria;
(3) fermentation culture engineering bacteria carries out methanol induction and expresses;
(4) expression product gets the recombinant silkworm antibacterial peptide CM 4 product through the molecular sieve column chromatography purifying.
2, the high-efficiency method for producing of recombinant silkworm antibacterial peptide CM 4 according to claim 1 is characterized in that: step (3) is specially
Express the about 20h to OD600 of engineering bacteria and reach 2-6 with BMGY, 28 ℃～30 ℃ fermentation culture; Centrifugal, be about 1.0,20 ℃～30 ℃ to OD600 and cultivated about 72 hours with BMMY is resuspended, adding 100% methyl alcohol to methyl alcohol concentration expressed in percentage by volume every 24h is 0.5%.
3, the high-efficiency method for producing of recombinant silkworm antibacterial peptide CM 4 according to claim 2 is characterized in that: step (4) is specially
Express the supernatant freeze-drying, be dissolved in aqua sterilisa, boil, low-temperature centrifugation is removed precipitation,
Molecular sieve column chromatography: separating medium is sephadex G50, uses 0.05M, 5 column volumes of PH5.1 Ammonium Acetate damping fluid balance, last sample; 0.05M PH5.1 Ammonium Acetate buffer solution elution is collected the albumen elution peak, gets product.
4, according to the high-efficiency method for producing of the described recombinant silkworm antibacterial peptide CM 4 of one of claim 1 to 3, it is characterized in that: step is also added the acid hydrolysis casein in (3).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100376010A CN1294261C (en) | 2005-01-04 | 2005-01-04 | High efficiency production method for recombinant silkworm antibacterial peptide CM4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100376010A CN1294261C (en) | 2005-01-04 | 2005-01-04 | High efficiency production method for recombinant silkworm antibacterial peptide CM4 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1654646A true CN1654646A (en) | 2005-08-17 |
| CN1294261C CN1294261C (en) | 2007-01-10 |
Family
ID=34894373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100376010A Expired - Fee Related CN1294261C (en) | 2005-01-04 | 2005-01-04 | High efficiency production method for recombinant silkworm antibacterial peptide CM4 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1294261C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1966709B (en) * | 2006-11-09 | 2010-06-02 | 新疆大学 | Process for preparing recombinant Sinkiang domestic silkworm antibiotic peptide, Sinkiang domestic silkworm antibiotic peptide therefrom, and use thereof |
| CN102191251A (en) * | 2011-03-25 | 2011-09-21 | 盐城星海饲料有限公司 | Method for expressing Cecropin CM4 gene in sf9 insect cells |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1158382C (en) * | 2001-02-28 | 2004-07-21 | 华南农业大学 | Preparation and application of antibiotic peptide pichia yeast |
-
2005
- 2005-01-04 CN CNB2005100376010A patent/CN1294261C/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1966709B (en) * | 2006-11-09 | 2010-06-02 | 新疆大学 | Process for preparing recombinant Sinkiang domestic silkworm antibiotic peptide, Sinkiang domestic silkworm antibiotic peptide therefrom, and use thereof |
| CN102191251A (en) * | 2011-03-25 | 2011-09-21 | 盐城星海饲料有限公司 | Method for expressing Cecropin CM4 gene in sf9 insect cells |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1294261C (en) | 2007-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146135A (en) | Recombinant human-like collagen and production method thereof | |
| CN102439154A (en) | A polynucleotide and polypeptide sequence and methods thereof | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| US10906947B2 (en) | Compositions and methods for producing high secreted yields of recombinant proteins | |
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN100357441C (en) | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor | |
| CN101270359A (en) | Method for preparing recombined human amyloid A beta 42 and application thereof | |
| CN1294261C (en) | High efficiency production method for recombinant silkworm antibacterial peptide CM4 | |
| CN111004317A (en) | Canine recombinant interferon α 7, and preparation method and application thereof | |
| CN103966253A (en) | Method for efficiently preparing recombinant human interluekin-33 protein | |
| CN112625141A (en) | Protein standard substance of tomato spotted wilt virus and application thereof | |
| CN103848912A (en) | Recombinant protein of bay scallop peptidoglycan recognition protein as well as preparation and application thereof | |
| CN101182475B (en) | Pichia yeast highly-effective expression of elastase as well as construction method and uses thereof | |
| CN101033465A (en) | Pea albumin subunit PA1b recombination albumen and its preparing method and application | |
| CN102010867A (en) | Yeast expression method for recombining major protein AccMRJP1 of apis cerana royal jelly and product application | |
| CN113121672B (en) | Soluble prokaryotic expression and purification method of cat interferon gamma and application | |
| CN110904115B (en) | Canine recombinant interferon alpha 7, preparation method and application thereof, expression vector containing canine recombinant interferon alpha 7 and host cell | |
| CN102212547A (en) | Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor | |
| CN102485890A (en) | Expression of recombined human protein disulphide isomerase (hPDI491) with Pichia pastoris in secretion manner | |
| CN102220345B (en) | Recombinant canine alpha-interferon optimized gene, strain and efficient expression | |
| CN101649340A (en) | Method for preparing human interleukin-18 | |
| CN105695500A (en) | Expression and purification method of chicken growth hormone recombinant protein in Pichia pastoris | |
| CN105154497A (en) | Method for preparing chicken interleukin 2 by aid of recombinant Escherichia coli | |
| CN104099354A (en) | Coding sequence and coding protein of recombinant ULP1 kinase, plasmids containing coding sequence, and preparation method of recombinant ULP1 kinase | |
| JP2007228937A (en) | Method for purifying killer protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |