CN1648253A - Molecule label linked with rice anti-rice blast gene - Google Patents

Molecule label linked with rice anti-rice blast gene Download PDF

Info

Publication number
CN1648253A
CN1648253A CN 200510037641 CN200510037641A CN1648253A CN 1648253 A CN1648253 A CN 1648253A CN 200510037641 CN200510037641 CN 200510037641 CN 200510037641 A CN200510037641 A CN 200510037641A CN 1648253 A CN1648253 A CN 1648253A
Authority
CN
China
Prior art keywords
rice
ssr
rice blast
disease
resistant gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200510037641
Other languages
Chinese (zh)
Inventor
张红生
王建飞
黄骥
王州飞
李培富
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN 200510037641 priority Critical patent/CN1648253A/en
Publication of CN1648253A publication Critical patent/CN1648253A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to molecular label linked with rice blast resisting gene and specially for the screening of rice blast resisting gene. Single plant DNA's of black hull japonica rice, Suyu glutinous rice and their F1 and F2 separated colony are extracted in SDS process; 350 pairs of SSR molecular labels are adopted in polymorphism screening of the amplified products of two parents and their F1; and the individuals of F2 anti-infective pond and F2 colony are screened for rice blast resisting gene linked label. It is found that the SSR labels RM144H240+260, RM7654H120, RM7212H120 and RM5923H150 in the long arm end of 11-th chromosome are linked with rice blast resisting gene Pi-hkl(t); and the SSR labels RM277H70, RM511H80+90, and RM2972H90 in the 12-th chromosome are linked with rice blast resisting gene Pi-hk2(t). The present invention can target the rice blast resisting gene accurately and raise the rice blast resisting selectively breeding efficiency greatly.

Description

The molecule marker chain with rice blast resistant gene
One, technical field
The invention discloses and rice blast resistant gene Pi-hk1 (t), the chain molecule marker of Pi-hk2 (t), be used to improve the molecular breeding of paddy rice, be exclusively used in the screening of rice blast resistant gene rice blast resistance.
Two, technical background
Paddy rice is the vital food crop that 21 century global human growth is depended on for existence.Rice disease has been robbed the rice yield of considerable part, and wherein rice blast harm loss accounts for more than 70%, and this harm is never only in developing country, and all there is generation Rice Production country, the world.In the popular time of rice blast, the production loss that causes, generally at 10-20%, serious reaches more than 50%, local field piece even No kernels or seeds are gathered, as in a year of scarcity, and cause rice quality descend [Ling Zhongzhuan. the rice anti-rice blast breeding. Fujian science tech publishing house, 1990].Area takes place about 4,000,000 hectares in China's rice blast every year, the serious time is about 8,000,000 hectares, annual because of rice blast harm loss paddy 2～1,000,000,000 kilogram [Sun Guochang. paddy rice and Pyricularia oryzae (Magnaporthe grisea) colony does and the structural research of germ population genetic mutually. doctor's Diplomarbeit, 2002].
Countries in the world facts have proved that through many decades cultivating and planting disease-resistant variety is the measure of most economical effectively preventing rice blast.But, often the popularizing planting several years is just lost resistance to many disease-resistant varieties, its major cause is because the disease-resistant variety of establishing in large scale is single and the kind disease-resistant gene is single relatively, makes that the toxicity microspecies in the rice blast fungus population become dominant races gradually, causes disease popular.Therefore the seed selection permanent disease-resistant kind consistent target of pursuing of person that becomes the breeding work.Studies show that durable resistance is relevant closely with disease-resistant polygene.Many germplasms with permanent disease-resistant all have a plurality of disease-resistant genes as Moroberekan, Tetep, IR64, LAC23, PKT, IR64 etc.The durable resistance kind is to tackle dominant races complicated and changeable in the rice blast fungus population with different disease-resistant gene polymerizations (pyramid), and the main disease-resistant gene of imitating that is overcome becomes little effect resistant gene to toxicity microspecies still lingering section resistance, other certain (or some) disease-resistant gene then shows as disease-resistant to new microspecies and becomes major gene [Tabien R E, et al.Mapping QTLs for field resistance to rice blast pathogenand evaluating of their individual and combined utility in improved varieties.Theor Appl Genet, 2002,105:313-324].
Method according to traditional breeding method, seed selection blast resisting kind need be inoculated a large amount of not homophylic rice blast fungi isolates and identify resistance, the strain system (strain) that keeps resistance of wide spectrum, so workload is big, and identify that extraneous factor such as being subject to seasonal restrictions, qualification result is subjected to envrionment conditions influences.The more important thing is that this phenotypic evaluation is difficult to the polymerization disease-resistant gene.Because different disease-resistant genes has different anti-spectrum (one or more rather than whole microspecies are had resistance), and anti-spectrum covers mutually; There are different pathogenic spectrum (one or more rather than whole disease-resistant genes are had toxicity) in different microspecies even mutually homophylic different strains, and the spectrum of causing a disease covers mutually.Therefore be difficult to utilize not homophylic bacterial strain to differentiate disease-resistant gene and polymerization disease-resistant gene, popular opportunity that provides of genotoxic potential microspecies in the complicated and diversified rice blast fungus population just is provided for this.
Dna molecular marker provides efficiently for screening disease-resistant polygene kind, method efficiently, and exempted large-scale offspring's resistance and identified and accelerate the seed selection process.Therefore all pay much attention to the molecular marker screening of carrying out blast resistant gene both at home and abroad, be used for marker assisted selection, the polymerization blast resistant gene is to cultivate wide spectrum, high anti-, persistent disease-resistant variety.Utilize nearly more than 40 of the localized blast resistant genes of dna molecular marker (comprising some multiple allelomorphoss and QTLs) at present, these genes are present in several chromosomal specific regions with gene a small bundle of straw, etc. for silkworms to spin cocoons on form mostly, and these characteristics are that molecular marker assisted selection has been created convenient condition.The chain molecule marker (the used molecule marker in especially early stage location) of some blast resistant genes is to utilize the RFLP mark mostly.First utilizes molecule marker RFLP to locate blast resistant gene Pi-2 (t) and Pi-4 (t) [Yu Z H as Yu et al (1991), et al. Tagging genes for blast resistance in rice via linkage to RFLP markers.Theor ApplGenet, 1991,81:471-476].Because this class mark needs complicated operations program, the biochemical reagents of costliness and a large amount of sample DNAs, inconvenience is used for the procedure of breeding.It is then more convenient feasible that the molecule marker of PCR-based is used for molecular marker assisted selection, and therefore more domestic and international laboratories begin to develop this quasi-linkage mark of disease-resistant gene, comprise AFLP, SSR, STS, RGA, EST, SNP, CAPS etc.As Fjellstrom etc. SSR linked marker RM208, the RM224 of Pi-b, Pi-ta is used for assisted selection [Fjellstrom R et al.Development of DNA markers suitable for marker assisted selection of three Pi genes conferringresistance to multiple Pyricularia grisea pathotypes.Crop science, 2004,44 (5): 1790-1798]; As Wu etc. the SSR mark of the blast resisting main effect QTL s of Moroberekan is used for back cross breeding [Wu J L, Sinha P K, Variar M et al.Association between molecular markers and blast resistance in anadvanced backcross population of rice.Theor Appl Genet, 2004,108:1024-1032]; Utilize chain molecule marker RM24 broad spectrum antidisease gene Pi-2 gene to be imported [Chen Zhiwei etc., the screening and the application of the closely linked SSR mark of blast resistant gene Pi-2 such as Zhenshan 97B.Molecular Plant Breeding, 2004,2 (3): 321-325].An important difficult point of molecular marker assisted selection is the polymorphism of molecule marker.No matter resist the still resistance polymerization of anti-mixing breed of resistance transformation of sense mixing breed, all need molecule marker between kind, to have polymorphism, therefore there is the limitation of kind in molecular marker assisted selection, especially the close interracial polymorphism frequency of genetic background is not high, this just need to the exploitation of disease-resistant gene dissimilar, a plurality of molecule markers use for disease-resistant gene transformation between different varietiess or polymeric assistant breeding.The polymorphism of the blast resistant gene Pi-ta that has cloned as bases such as Jia has been developed molecule marker [the Jia Y L et al.Development ofdominant rice blast Pi-ta resistance gene markers.Crop science of a plurality of PCR-based, 2002,42 (6): 2145-2149].Containing abundant blast resisting resource in China's local variety.Because Pyricularia oryzae is to the continuous adaptation of certain species structure and environment, the Pyricularia oryzae microspecies present tangible Characteristics of Geographical Distribution.According to the relation of gene pairs gene, in lacking hereditary alternative local variety, should also there be areal distribution in disease-resistant gene.Find in China's kind that some new blast resistant gene resources are just illustrating this point [Zhu Lihuang etc.Blast resistant gene with molecule marker the unknown in location.Chinese science (B collects), 1994,24 (10): 1048～1052].We analyze the disease-resistant gene composition of the japonica rice local variety Heikezijing of Taihu Lake basin wide spectrum, high blast resisting, find to carry at least 8 different Pi gene locuss, elder generation positions 2 resistant gene Pi-hk1 (t), Pi-hk2 (t) wherein, and is used for the evaluation of markers assisted selection.
Summary of the invention
Technical problem the objective of the invention is: filter out several and rice blast resistant gene Pi-hk1 (t), Pi-hk2 (t) close linkage and molecule marker not affected by environment, these molecule markers are used for the rice anti-rice blast assisted selection, can improve the efficiency of selection of resistance greatly.
Technical scheme embodiment of the present invention are as follows.
The molecule marker chain with rice blast resistant gene filters out by the following method:
The Taihu Lake basin japonica rice local variety Heikezijing (national germplasm resource bank all has preservation, can externally provide) of wide spectrum, high blast resisting is provided, hybridizes F with susceptible variety Suyunuo (national germplasm resource bank all has preservation, can externally provide) 1The seed selfing produces F 2Extract Heikezijing, Suyunuo and F thereof with the SDS method 1, F 2The individual plant DNA of segregating population.
Adopt 350 pairs of SSR molecule markers to above-mentioned 2 parents and F thereof 1Carry out the screening of pcr amplification product polymorphism, then successively to F 2Anti-sense pond, F 2The individual screening of each of colony blast resistant gene linked marker.The PCR response procedures is: behind 94 ℃ of pre-sex change 5min of DNA; 94 ℃ of sex change 45min, 55～65 ℃ (determining temperature) annealing 45min according to concrete primer, 72 ℃ are extended 1min, circulate 35 times; Last 72 ℃ are extended 7min.Increase on eppendorf Mastercycle gradient DNA cloning instrument, amplified production carries out isolation identification on 10% polyacrylamide gel, and silver dyes colour developing.
Find the SSR mark RM144H of long-armed end on the 11st karyomit(e) 240+260, RM7654 H 120, RM72 12H 120, RM5923H 150Deng chain with disease-resistant gene Pi-hk1 (t); SSR mark RM277H on the 12nd karyomit(e) 70, RM511H 80+90, RM2972H 90Chain Deng mark and disease-resistant gene Pi-hk2 (t).
Beneficial effect the present invention selects for use is the molecular marker screening that the paddy rice local variety Heikezijing of a high blast resisting of wide spectrum is carried out blast resistant gene.Compare with present traditional breeding technology, its advantage is:
(1) mark is stable, and is not affected by environment.This research identifies in the rice varieties Heikezijing and 7 of the chain SSR marks of 2 anti-pest gene Pi-hk1 (t), Pi-hk2 (t).Parent, the F of Heikezijing * Suyunuo combination 1With part F 2Segregating population, detected with these marks respectively in the different growing sampling in 2002, showed that the mark performance is stable, was not subjected to the influence of envrionment conditions.
(2) the assistant breeding select target is clear and definite, saves time and cost.According to traditional breeding technique, in improving the resistance breeding method, utilize donor parents and the receptor parent of the high anti-gene of wide spectrum to hybridize, repeatedly backcross usually or further disease-resistant gene polymerization is reestablished diplomatic relations.But at first to screen the toxic strain of receptor parent, and this bacterial strain is nontoxic to the donor parents disease-resistant gene, otherwise whether fubaritic disease-resistant gene imports receptor parent, even and import single disease-resistant gene, lack durable resistance on producing, therefore effect is little; In the process of the transformation of 2 disease-resistant genes or convergent cross, each disease-resistant gene must screen clear and definite avirulent strains and toxic strain respectively, and the avirulent strains of two disease-resistant genes and toxic strain can only can not cover mutually in complementation, otherwise whether fubaritic 2 disease-resistant genes all import or are aggregated among the offspring, therefore the screening of strain identification is a crucial step with utilizing, but need to spend plenty of time and energy, inoculating a large amount of bacterial strains could determine, and all wants in backcrossing antagonism to carry out the strain identification inoculation to identify every the wheel; The polymerization of especially a plurality of disease-resistant genes then is difficult to utilize inoculation Pyricularia oryzae method to screen.Therefore traditional breeding way identifies that workload is big, and identifies that extraneous factor such as being subject to seasonal restrictions, qualification result is subjected to envrionment conditions influences, and requires colony big, and blindness is also big, selects poor accuracy.What filter out by the present invention is used for assisted Selection with blast resistant gene close linkage and molecule marker not affected by environment, and target is decided disease-resistant gene exactly, improves the efficiency of selection of blast resisting breeding greatly.
Three, embodiment
Implementation procedure of the present invention is: the RIL of the Heikezijing/Lijiang xintuanheigu that utilized make up in 1996 to 1999 inoculate respectively 3 ZG1,1 ZC5,1 ZB15 microspecies with Japanese strain identification north 1, grind different Pyricularia oryzaes (all being public microspecies bacterial strain) such as 54-04, P-2b, identify 8 different blast resistant genes, we carry out chain molecular marker screening to 2 genes wherein.North 1 identification of strains disease-resistant gene Pi-hk1 (t), the ZB15 microspecies are identified disease-resistant gene Pi-hk2 (t).(Wang Jianfei, what is newly-built, Zhang Hongsheng etc.Taihu Lake basin japonica rice local variety Heikezijing is to the genetic analysis of rice blast resistance.Acta Genetica Sinica 2002,29 (9): 803-807)
Calendar year 2001 Heikezijing and the susceptible variety Suyunuo hybridize, the end of the year F 1Seed send Hainan Island to add generation, and selfing produces F 2Seed.2002 with F 2Segregating population is seeded in the seedling dish, seedling stage inoculation north 1 and ZB15 microspecies identify the individual plant resistance, find that typical susceptible individual in time numbers transplanting, be planted in the Agricultural University Of Nanjing solarium.Sampling is extracted F with the SDS method in tillering phase 2The individual plant DNA of segregating population.Ripe back results seed, spring in 2003 at F 3Family is inoculated north 1 and the ZB15 microspecies resistance of reflecting again respectively, to infer F 2Genotype.
Adopt 350 pairs of SSR molecule markers at first to above-mentioned 2 parents and F thereof 1Polymorphism screening is then respectively to 2 disease-resistant/susceptible pond, F 2Mass screening blast resistant gene linked marker.The SSR primer sequence derives from Http:// www.gramene.org/The website.It is synthetic to entrust Shanghai to give birth to the worker.The PCR reaction system is: template DNA (10ng/ul) 1ul; The SSR primer is to (4pmol/ul) 0.7ul; 10x damping fluid 1ul; DNTP (2.5mM) 0.2ul; MgCl 2(25mM) 0.6ul; Taq enzyme (5U/ul) 0.1ul; DdH 2O 6.4ul; Amount to 10ul.The PCR response procedures is: behind 94 ℃ of pre-sex change 5min of DNA; 94 ℃ of sex change 45min, 55 ℃ (determine temperature according to concrete primer, be generally 55 ℃) annealing 45min, 72 ℃ are extended 1min, circulate 35 times; Last 72 ℃ are extended 7min.Increase on eppendorf Mastercycle gradient DNA cloning instrument, amplified production carries out isolation identification on 10% polyacrylamide gel, and silver dyes colour developing, observes, writes down experimental result then on the visible light transmission instrument.
The SSR primer that has polymorphic amplified band between antagonism sense parent, enantiopathy/susceptible pond evaluation of further increasing respectively.The structure in disease-resistant/susceptible pond is mainly according to each F 3F is inferred in the anti-sense performance of family 2Genotype selects the typical case to isozygoty disease-resistant and the susceptible F that isozygotys 2Disease-resistant/susceptible the pond of individual composition.Each family is inoculated north 1 and ZB15 microspecies, every F respectively 3Family is identified about 20 seedlings to once repeating, and 3～5 repetitions are set, and forms 2 disease-resistant/susceptible ponds respectively.Disease-resistant parent's specific amplified band in disease-resistant pond, can repeat and in susceptible pond unexpressed primer, then from being used for (Heikezijing/Suyunuo) F 2Individual plant DNA increases.
Molecular marker screening is the result show: have the pcr amplification band of 76 pairs of SSR primers to there are differences between Heikezijing and Suyunuo.Discovery has 2 SSR mark RM144H 240+260(can amplify the dna fragmentation of 240bp and 260bp length of nucleotides with the RM144 primer at Heikezijing, and can amplify the dna fragmentation of 180bp length of nucleotides at Suyunuo), RM7654H 120(can amplify the dna fragmentation of 120bp length of nucleotides with the RM7654 primer at Heikezijing, and can amplify the dna fragmentation of 110bp length of nucleotides at Suyunuo) is chain to the blast resistant gene Pi-hk1 (t) in bacterial strain north 1 with paddy rice.Further 0 pair of Synthetic 2 is positioned at the SSR primer of this chromosomal region, finds mark RM7212H 120(can amplify the dna fragmentation of 120bp length of nucleotides with the RM7212 primer at Heikezijing, and can amplify the dna fragmentation of 140bp length of nucleotides at Suyunuo), RM5923H 150(can amplify the dna fragmentation of 150bp length of nucleotides with the RM5923 primer at Heikezijing, and can amplify the dna fragmentation of 170bp length of nucleotides at Suyunuo) there are differences between parents and is chain with Pi-hk1 (t).Utilize the MAPMAKER/EXP3.0 program to carry out chain detection, prove this 4 SSR mark: RM144H 240+260, RM7654H 120, RM7212H 120, RM5923H 150Chain with blast resistant gene Pi-hk1 (t).
Utilize above-mentioned 76 pairs of SSR primers equally, in the anti-sense of another Heikezijing/Suyunuo pond (to the ZB15 microspecies) pcr amplification selection markers.Discovery has 1 the SSR mark RM277H that is positioned on the 12nd karyomit(e) 70(can amplify the dna fragmentation of 70bp length of nucleotides with the RM277 primer at Heikezijing, and can amplify the dna fragmentation of 80bp length of nucleotides at Suyunuo) is chain with rice blast resistant gene Pi-hk2 (t).Near further synthetic 10 pairs of SSR primers that are positioned at this chromosomal region have 2 to be marked at and to there are differences and chain with Pi-hk2 (t) RM511H between parents 80+90(can amplify the dna fragmentation of 80bp and 90bp length of nucleotides with the RM511 primer at Heikezijing, and can amplify the dna fragmentation of 120bp and 130bp length of nucleotides at Suyunuo), RM2972H 90(can amplify the dna fragmentation of 90bp length of nucleotides with the RM2972 primer at Heikezijing, and can amplify the dna fragmentation of 80bp length of nucleotides at Suyunuo).They carry out chain detection to utilize the MAPMAKER/EXP3.0 program, prove this 3 SSR mark: RM277H 70, RM511H 80+90, RM2972H 90With a blast resistant gene Pi-hk2 (t) close linkage.Therefore can carry out the rice anti-rice blast breeding effectively with these molecular marker assisted selection.
The 7 pairs of SSR primer sequences, annealing temperature, chromosomal marker position, as follows:
RM144：tgccctggcgcaaatttgatcc?gctagaggagatcagatggtagtgcatg?55℃?Chr.11?117.3cM
RM7654：ctcatggttgtgtcgtggtc?gtgcagtgccagtggtacg 55℃?Chr.11?115.1cM
RM7212：tcagctcagctcagcatcag?actcatcaatcgtgtgctgc 55℃?Chr.11?117.0cM
RM5923：atagttcggggggtaattcg?gtcgatcgagatagttgggg 55℃ Chr.11 117.3cM
RM277：cggtcaaatcatcacctgac?caaggcttgcaagggaag 55℃ Chr.12 62.2cM
RM511：cttcgatccggtgacgac?aacgaaagcgaagctgtctc 55℃ Chr.12 59.8cM
RM2972：gagccaatatgttgtcttga?gttcagatcatgatgcctac 55℃ Chr.12 65.3cM

Claims (2)

1, with rice blast resistant gene Pi-hk1 (t), the chain molecule marker of Pi-hk2 (t), filter out by the following method:
(1) utilizes Taihu Lake basin japonica rice local variety Heikezijing, hybridize F with the susceptible variety Suyunuo 1The seed selfing produces F 2
(2) extract Heikezijing * Suyunuo F with the SDS method 2The individual plant DNA of segregating population;
(3) adopt the SSR molecule marker to carry out the screening of rice anti-rice blast mark;
(4) filter out 7 SSR marks altogether, wherein 4 SSR mark RM144H 240+260, RM7654H 120, RM7212H 120, RM5923H 150Chain with disease-resistant gene Pi-hk1 (t); 3 SSR mark RM277H 70, RM511H 80+90, RM2972H 90Chain with disease-resistant gene Pi-hk2 (t).
2, the molecule marker of and rice blast resistant gene according to claim 1, the screening method that the SSR molecule marker of employing carries out the rice anti-rice blast mark is:
With 7 couples of SSR primer RM144, RM7654, RM7212, RM5923, RM277, RM511, RM2972, Heikezijing and Suyunuo parent's dna polymorphism is carried out initial analysis;
The PCR reaction system is: template DNA 10ng/ul 1ul; The SSR primer is to 4pmol/ul 0.7ul; 10 * damping fluid 1ul; DNTP 2.5mM 0.2ul; MgCl 225mM 0.6ul; Taq enzyme 5U/ul 0.1ul; DdH 2O 6.4ul; Reaction total amount 10ul;
The PCR response procedures is: behind 94 ℃ of pre-sex change 5min of DNA; 94 ℃ of sex change 45min, 55 ℃, annealing 45min, 72 ℃ are extended 1min, circulate 35 times; Last 72 ℃ are extended 7min;
Increase on the DNA cloning instrument, amplified production carries out isolation identification on 10% polyacrylamide gel, and silver dyes colour developing, observes, writes down experimental result then on the visible light transmission instrument.
CN 200510037641 2005-01-07 2005-01-07 Molecule label linked with rice anti-rice blast gene Pending CN1648253A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 200510037641 CN1648253A (en) 2005-01-07 2005-01-07 Molecule label linked with rice anti-rice blast gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 200510037641 CN1648253A (en) 2005-01-07 2005-01-07 Molecule label linked with rice anti-rice blast gene

Publications (1)

Publication Number Publication Date
CN1648253A true CN1648253A (en) 2005-08-03

Family

ID=34876154

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200510037641 Pending CN1648253A (en) 2005-01-07 2005-01-07 Molecule label linked with rice anti-rice blast gene

Country Status (1)

Country Link
CN (1) CN1648253A (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100410390C (en) * 2006-01-26 2008-08-13 中国水稻研究所 Molecule identification and transfer technology for broad-spectrum rice-blast resistant gene of paddy rice
CN102154470A (en) * 2011-01-17 2011-08-17 南京农业大学 Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy
CN102162011A (en) * 2011-05-09 2011-08-24 南京农业大学 Molecule marking method of rice blast-resisting gene
CN102703443A (en) * 2012-05-23 2012-10-03 华南农业大学 Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof
CN105063030A (en) * 2015-08-04 2015-11-18 苏州市种子管理站 ISSR-SCAR marker for identifying Suyunuo and screening method thereof
CN105713983A (en) * 2016-04-21 2016-06-29 南京农业大学 Molecular marker closely interlocked with neck blast resistance gene of paddy rice Jiangnan lateness and application thereof
CN105779622A (en) * 2016-04-21 2016-07-20 南京农业大学 Molecular marker closely linked with race-specific rice-blast-resistant gene of paddy rice and application of molecular marker

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100410390C (en) * 2006-01-26 2008-08-13 中国水稻研究所 Molecule identification and transfer technology for broad-spectrum rice-blast resistant gene of paddy rice
CN102154470A (en) * 2011-01-17 2011-08-17 南京农业大学 Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy
CN102154470B (en) * 2011-01-17 2013-04-10 南京农业大学 Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy
CN102162011A (en) * 2011-05-09 2011-08-24 南京农业大学 Molecule marking method of rice blast-resisting gene
CN102703443A (en) * 2012-05-23 2012-10-03 华南农业大学 Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof
CN102703443B (en) * 2012-05-23 2014-09-24 华南农业大学 Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof
CN105063030A (en) * 2015-08-04 2015-11-18 苏州市种子管理站 ISSR-SCAR marker for identifying Suyunuo and screening method thereof
CN105713983A (en) * 2016-04-21 2016-06-29 南京农业大学 Molecular marker closely interlocked with neck blast resistance gene of paddy rice Jiangnan lateness and application thereof
CN105779622A (en) * 2016-04-21 2016-07-20 南京农业大学 Molecular marker closely linked with race-specific rice-blast-resistant gene of paddy rice and application of molecular marker
CN105713983B (en) * 2016-04-21 2019-03-05 南京农业大学 A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage

Similar Documents

Publication Publication Date Title
CN1648253A (en) Molecule label linked with rice anti-rice blast gene
CN101294161B (en) Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof
CN103866026A (en) Rice cold-resistant major gene identification method and special primer thereof
CN101914531A (en) Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof
CN113005213B (en) SNP molecular marker related to wheat stem basal rot resistance and application thereof
CN107022634A (en) A kind of molecule labelling method for differentiating rice ear sprouting period gene qHD7.4
CN110468229B (en) Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t)
CN110358861B (en) Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t)
CN116064903B (en) Co-segregation molecular marker of rice broad-spectrum rice blast resistance gene Pi69 (t) and special primer thereof
CN110878300A (en) DNA marker closely linked with wheat 7DL chromosome gibberellic disease resistant gene and application thereof
CN112889664B (en) Method for cultivating broad-spectrum and durable resistant rice breeding material by polymerizing complementary rice blast resistant genes
CN112126711B (en) Molecular marker of maize 4 th chromosome rough dwarf disease resistance major QTL and application thereof
CN101368181A (en) Numerator mark concatenated with rice purple pericladium gene PSH1 (t), acquiring method and application thereof
He et al. Nicotiana suaveolens accessions with different ploidy levels exhibit different reproductive isolation mechanisms in interspecific crosses with Nicotiana tabacum
CN112575101B (en) Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof
US11814638B2 (en) Marker associated with smut resistance in plant belonging to genus Saccharum and use thereof
WO2012017679A1 (en) Stalk-length-related marker of plant of the genus saccharum and the use thereof
CN111254212A (en) Rice blast resistance gene Pi68(t) close linkage molecular marker and application thereof
WO2012017682A2 (en) Leaf-blade-length-related marker of plant of the genus saccharum and the use thereof
CN109777885B (en) Rice hard-stalk high-yield gene molecular marker and application thereof
CN108130381A (en) From extra large 1 molecular labeling related with resistance to verticillium wilt of sea island cotton and its application
CN111073990B (en) Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof
Wang et al. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat
WO2012073495A2 (en) Sugarcane-stalk-number-related marker and the use thereof
WO2012073494A2 (en) Sugarcane-stalk-diameter-related marker and the use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication