CN1644693A - Protein having tpo activity - Google Patents

Abstract

The present invention relates to thrombopoietin (TPO) polypeptides having the biological activity of specifically stimulating or increasing platelet production comprising the amino acid sequence 1-332 of SEQ ID NO: 6 or a derivative thereof, DNA molecules encoding TPO polypeptides, processes for production of the polypeptides, antibodies specifically immunoreactive with the polypeptides, pharmaceutical compositions comprising the polypeptides, and methods for using the polypeptides in treatment of platelet disorders such as thrombocytopenia.

Description

Protein with TPO activity

The application is to be February 14 nineteen ninety-five the applying date, and application number is dividing an application of application for a patent for invention 97102405.7, that denomination of invention is identical with the present invention.

The application is the partial continuous application of the U.S. Patent application (application number the unknown) submitted on unsettled now January 31 nineteen ninety-five, back one application is the U.S. Patent application No.08/361 that submits to 22 days unsettled now December in 1994,811 partial continuous application, back one application is the U.S. Patent application No.08/320 that submits to 11 days unsettled now October in 1994,300 partial continuous application, back one application is the U.S. Patent application No.08/278 that submits to 20 days unsettled now July in 1994,083 partial continuous application, back one application is the U.S. Patent application No.08/221 that submitted on April 1st, now resigned, 020 partial continuous application, back one application is the U.S. Patent application No.08/212 that submitted on March 14th, now resigned, 164 partial continuous application.

Invention field

The present invention relates to have with ad hoc fashion stimulates or platelet increasing generates or strengthen the active new protein of megalokaryocyte progenitor cell hyperplasia and differentiation, the said protein DNA sequence of encoding and preparation method thereof in vivo.

Background of invention

Megalokaryocyte is the syncyte that cell space is big, be rich in endochylema, and it can produce thrombocyte, is mainly seen in the marrow.Megalokaryocyte originates from the pluripotential hemopoietic stem cell in the marrow.The primary multipotential stem cell is divided into the megalokaryocyte progenitor cell in certain program, the latter is fixed to megakaryocytic series.Megalokaryocyte progenitor cell hyperplasia and be divided into megakaryoblast.Megalokaryocyte further carries out polyploid and tenuigenin maturation, at last its seedless kytoplasm fragment (being thrombocyte) is discharged in the circulation.A sophisticated megalokaryocyte on average forms 2,000-4,000 thrombocyte.Although hematoblastic formation mechanism it be unclear that on some details, but it is believed that, megalokaryocyte is positioned at albumin (albuminal) surface of bone marrow sious chamber endothelium typically, and its produces prolongs and the endochylema treating processes of sinusoid, takes this megalokaryocyte and carries out hematoblastic fragmentation.

Also there are many doubtful points in the hematoblastic mechanism of relevant generation, although think and might be present in marrow venous sinus cortex by megalokaryocyte, kytoplasm passes cortex, produces rope sample projection on the vein inwall, takes this, and thrombocyte is released.

It is believed that, have a kind of specific function in generation that produces for megalokaryocyte hematopoiesis thrombocyte and the regulation and control.In healthy human and animal, though known to after for example healthy animal is used antiplatelet antibody, platelet count reduces rapidly, begins then to rise to temporarily to be higher than usually, returns back to normal level at last, so effective hematoblastic quantity is maintained at certain level.Equally, known in clinical platelet count reduce (thrombocytopenia) or platelet count and increase (thrombocytosis) even see red corpuscle and blood cell count when being in normal level.

Carry one in passing, the thrombocyte most important function is to form thrombus in hemostatic mechanism.If hemostatic mechanism then will cause bleeding tendency because platelet count reduces and can not normally play a role.

Proved that there are specific regulation mechanism in relevant megalokaryocyte generation and thrombocyte in generating.Thrombocyte is being kept effectively quantity in healthy human body and in the normal animal.Yet known when antiplatelet antibody is applied to animal, platelet count only reduces rapidly in a short time, and bottom out afterwards and the temporary transient normal level that surpasses finally return back to normal level.In clinical field, also recognize, platelet count reduce (thrombocytopenia) or platelet count increase (thrombocytosis) in addition see red corpuscle and the normal situation of leukocyte count under.But, still do not have the report that successfully separates and identify the particular adjustments factor that relates to thrombocyte and produce (for example, resemble in the red corpuscle forming process erythropoietin) so far.

The thrombocyte most important function is to form blood clot in hemostatic mechanism.When the normal function of hemostatic mechanism goes to pot because of thrombopenia, then bleeding tendency can take place.In the radiation and chemotherapy field of cancer, being reduced by the state's platelet due to the bone marrow depression is lethal complication; Give this class patient platelet transfusion to prevent bleeding tendency.The thrombocyte infusion also is applied to the patient after the bone marrow transplantation or the patient of aplastic anemia.

The thrombocyte that is used for this class thrombocyte infusion can be prepared by the blood of healthy blood donor by the thrombocyte method of removing, but it is short to be used for hematoblastic transformation period of this class of infusion, and might produce bacterial contamination.Having polluted lymphocyte in the thrombocyte that the thrombocyte infusion also may be used because of infusion exists and makes the patient contact harmful virus (as human immunodeficiency virus HIV or various hepatitis virus), induces major histocompatibility antigen (HLA) to platelet transfusion that specific antibody is arranged or cause the danger of graft versus host disease (GVHD).

Therefore, if can form at thrombocytopenic patient's body internal stimulus inherent thrombocyte, and reduce the dependency of thrombocyte infusion simultaneously, this will be very useful.In addition,, just can make this class treatment safer, might increase the intensity of treatment and further improve desired anticancer effect if can correct or prevent to carry out the cancer patients's of radiotherapy or chemotherapy thrombopenia.

For all the foregoing reasons, people are to separating and identifying to relate to and regulate megalokaryocyte and thrombopoietic specificity regulatory factor has carried out a large amount of research.According to results of in vitro studies, the regulatory factor that the control megalokaryocyte generates roughly is divided into following two kinds of factors (referring to Williams etal., J.Cell.Physiol., vol.110, p 101-104,1982).Megakaryocyte colony stimulating factor (Meg-CSF) is in semisolid medium moderate stimulation CFU-MK hyperplasia and breaks up to form the regulatory factor of megakaryocyte colony.The regulatory factor that another kind is called megalokaryocyte synergistic factor (Meg-Pot), megakaryocyte stimulating factor, thrombopoietic-stimulating factor etc. mainly acts on prematurity or sophisticated megalokaryocyte, takes this to strengthen its differentiation with ripe.In some cases, Meg-Pot can be detected with Meg-CSF.In addition, because platelet count increases in the time will being applied to other intact animal by serum of testing the collection of inductive thrombopenia animal or blood plasma, so show to exist a kind ofly can promote the thrombopoietic promotion factor in vivo, be called thrombopoietin (TPO).

In recent years, checked that the cytokine stimulating megakaryocyte that some its genes have been cloned generates and thrombopoietic ability.People IL-3 stimulates the formation (Bruno etal., Exp.Hamatol., vol.16, p371-377,1988) of people's megakaryocyte colony, and the platelet count of the monkey that raises at least (Donahue et al., Science, vol.241, p1820,1988).Yet,, generate and thrombopoietic specificity regulatory factor so it is different from the control megalokaryocyte because IL-3 works to the hyperplasia and the differentiation of all hematopoietic cells.People IL-6 does not show the Meg-CSF activity, but it acts on immature megalokaryocyte, and promotes it to be divided into sophisticated megalokaryocyte (Williams et al., Exp.Hamatol., vol.18, p.69,1990).Use IL-6 in the body and can induced platelet generate, promote the ripe of Primates bone marrow megakaryocyte and be transferred and promoted, but also produce some side effects to Hyperploidy more, as lose weight, induce acute phase protein (Asano et al., Blood, vol.75, p1602-1605,1990; Stahl et al., Blood, vol.78, p1467-1475,1991).People IL-11 does not have the Meg-CSF activity, but the Meg-Pot activity is arranged, and promotes the thrombocyte of mouse to generate (Neben et al., Blood, vol.81, p901-908,1993).In addition, people LIF improves platelet count (Mayer et al., Blood, the vol.81 of Primates significantly, p3226-3233,1993), but its external to Megakaryocytic effect very faint (Burstein et al., J.Cell.Physiol., vol.153, p305-312,1992).

Although hope is applied to these cytokines as the thrombocyte synergistic factor clinical, its function is not special to megakaryocytic series, and they can cause side effect.Therefore, need clinically to develop and a kind ofly not only megalokaryocyte-platelet system had been had specificity but also can cause that the thrombocyte of less side effect increases the factor.

Meg-CSF, Meg-Pot or TPO activity have been found in serum, blood plasma or the urine of thrombocytopenic patient or animal or in some human cell line's who is cultivated culture supernatants, to exist.Yet, still do not know that whether these activity cause because of the common existence that has single kind factor or several factors, do not know whether these factors are different with known cytokine yet at present.

People such as Hoffman find that aplastic anemia and no megalokaryocyte thrombopenic purpura patient's serum contains the Meg-CSF activity, and it increases formation (the Hoffman et al. of megakaryocyte colony significantly, N.Eng.J.Med., vol.305, p533-538,1981).After this, people such as Mazur report that again the Meg-CSF activity that is present in the Patients with Aplastic Anemia serum is different from IL-3 and GM-CSF (Mazur et al., Blood, vol.76, p290-297,1990).Similarly the Meg-CSF activity has seen (Mazur et al., Exp.Hematol., vol.12, p624-628,1984 in the cancer patients that accepts cytotoxicity chemotherapy widely and bone marrow transplantation patient's the serum; De Alarcon and Schinieder, Prog.Clin.Bio.Res., vol.215, p335-340,1986).According to people such as Hoffman, by purifying in low megalokaryocyte thrombopenia patient's the serum Meg-CSF, its apparent molecular weight is 46,000 (Hoffman et al., J.Clin.Invest., vol.75, p1174-1182,1985), but discover that further said material is not to have (Hoffman Blood with the purity level that can carry out accurate amino acid sequencing, vol.74, p1196-1212,1989).From thrombopenia patient's blood plasma or idiopathic thrombocytopenic purpura (ITP) patient's urine partial purification have the active material of TPO sample, it can strengthen ⁷⁵The Se-Sethotope mixes in the new thrombocyte that forms of mouse, and the apparent molecular weight of the blood plasma source factor of being measured is 40,000 (Grossi et al., Hematologica, vol.72, p291-295,1987; Vannucchi et al., Leukemia, vol.2, p236-240,1988).

Meg-CSF activity and TPO sample activity also detect (Kawakita et al., Br.J.Haemtol., vol.48, p609-615,1981 in aplastic anemia and severe ITP patient's urine sample; Kawakita et al., Blood, vol.556-560,1983).People such as Kawakita further report, urinate Meg-CSF activity seen in the extract the aplastic anemia patient, show that through gel-filtration its apparent molecular weight is 45 under the disassociation condition, 000 (vol 62 for Kawakita et al., Br.J.Haematol., p715-722,1986).People such as Erikson-Miller have also reported purifying Meg-CSF from similar urine sample, but do not provide information (the Erikson-Miller et al. of relevant its structure, " Blook Cell Growth Factors:their Present and future use inhematology and oncology " ed.by Murphy, AlphaMed Press, Dayton, Ohio, p204-220,1992).People such as Turner from bone marrow transplantation patient's urine purifying the active megakaryocyte stimulating factor of tool Meg-CSF (MSF) and clone its gene (Turner et al., Blood, vol.78, p1106-279a, 1991, (abstr., supple.1)).The molecular weight of this MSF is 28,000-35,000.This factor with so far in thrombopenia patient's serum and plasma sample the consistence of detected Meg-CSF and thrombocyte thereof increase activity and still await illustrating.

People also from the culture supernatants of the clone (HEK cell) in human embryo kidney (HEK) source purifying tool TPO sample activity, molecular weight be 32,000 material, and its biology and biochemical characteristic done to detect widely, but its structure it be unclear that (McDonald et al., J.Lab.Clin.Med., vol.106, p162-174,1985; McDonald, Int.J.Cell Cloning, vol.7, p139-155,1989).On the contrary, according to other researchist, the main activity of the stripped enhancing megakaryocytic maturation process that in the conditioned medium of HEK cell, produces, be because known cytokine, be (Withy et al., J.Cell.Physiol., the vol.15 that IL-6 and EPO cause, p362-372,1992).

People such as Evatt have reported the factor of relevant animal-origin, and they are finding and can promote in rabbit in antiplatelet sera injection institute inductive thrombopenia rabbit plasma ⁷⁵The Se-Sethotope mixes the TPO sample activity (Evatt et al., J.Lab.Clin.Med., vol.83, p364-371,1974) in the thrombocyte of new formation.In addition, a large amount of similar results of study (for example, Odell et al., Proc.Soc.Biol.Med., vol.108, P428-431,1961 from the sixties to the seventies, have been reported; Evatt and Levin, J.Clin.Invest., vol.48, p1615-1626,1969; Harker, Am.J.Physiol., vol.218, p1376-1380,1970; Shreiner and Levin, J.Clin.Invest., vol.49, p1709-1713,1970; Penington, Br.Med.J.vol.1, p606-608,1970).People such as Evatt and Hill and Levin from the thrombopenia rabbit plasma partial purification TPO sample activity (Evatt et al., Blood, vol.54, p377-388,1979; Hill and Levin, Exp.Hematol., vol.14, p752-759,1986).After this, proceeded purifying work to this factor, monitor it and show that in external promotion megalokaryocyte differentiation and ripe active (being the Meg-Pot activity) when detecting with gel-filtration, this active apparent molecular weight is 40,000-46,000 (Keller et al., Exp.Hematol., vol.16, p262-267,1988; Hill et al., Exp.Hematol., vol.20, p354-360,1992).Since the IL-6 activity in the blood plasma that brings out severe acute thrombopenia rabbit through using antiplatelet sera, detect less than, thereby show that this TPO sample activity is a kind of factor (Hill et al., Blood, the vol.80 that results from outside the IL-6, p346-351,1992).

Tayrien and Rosenberg also from the culture supernatants of thrombopenia rabbit plasma and HEK cell purifying a kind of apparent molecular weight be 15,000 the factor, it can the Megakaryocytic clone of stimulation in rats produce platelet factor 4, but they did not provide information (the Tayrien and Rosenberg.J.Biol.Chem. of relevant its structure, vol.262, p3262-3268,1987).

In addition, Nakeff is finding Meg-CSF activity (Nakeff, " Experimental Hematology Today " ed.by Baum and Ledney in using the thrombopenia mice serum that antiplatelet sera brings out, Springer-Verlag, NY, p111-123,1977).On the other hand, thrombocytopenic rabbit anteserum can promote megakaryocytic maturation (keller et al., Exp.Hematol., vol.16, p262-267,1988; Hill et al., Exp.Hematol., vol.17, p903-907,1989), and the metamorphosis of stimulating megakaryocyte is thrombocyte (Leven and Yee, Blood, vol.69, p1046-1052,1989), but the Meg-CSF activity that can survey is not arranged.

Meg-CSF activity (Miura et al. has been provided in the thrombocytopenic rabbit plasma that is provided through inferior lethality integral radiation people such as Miura, Blood, vol.63, p1060-1066,1984), this explanation induces Meg-CSF active relevant with the megalokaryocyte minimizing in vivo, and irrelevant with thrombopenia, because do not change this activity (Miura et al. behind platelet transfusion, Exp.Hematol., vol.16, p139-144,1988).Mazur and South are detecting the Meg-CSF activity in inferior lethality radiating dog serum, and report that it is 175,000 (Mazur and South, Exp.Hematol., vol.13, p1164-1172,1985) that this factor records apparent molecular weight through gel-filtration.In addition, other researchist (as Straneva et al., Exp.Hematol., vol.15, p657-663,1987) has also reported the factor in serum, blood plasma and urine source.

Therefore, as mentioned above, found in the biological sample of taking from thrombopenia patient and animal that stimulating megakaryocyte generates and thrombopoietic condition activity, but because its content in natural origin (as blood and urine) is very little, so also fail to finish separation, biochemistry and biological assay and feature description to these factors.

Summary of the invention

The objective of the invention is to separate TPO protein and identify it from natural origin, this TPO protein has the body internal stimulus or platelet increasing generates and/or the hyperplasia of promotion megalokaryocyte progenitor cell and the activity (hereinafter being called " TPO activity ") of differentiation; Purpose of the present invention also will be separated the proteinic gene of this TPO of coding, and provides with recombinant DNA technology homogeneous and the said method of protein of mass production.The frequency of utilization that successfully achieves the above object and to substitute existing thrombocyte infusion or reduce the thrombocyte infusion; Said new protein also will be used for the treatment of and diagnose thrombopathia.

Therefore, the present invention relates to:

(i) purifying and separated coding have the dna sequence dna of TPO active protein, and it is selected from following sequence:

(a) dna sequence dna or its complementary strand shown in the SEQ ID NO 194,195 and 196; With

(b) dna sequence dna or its fragment of defined dna sequence dna hybridization under stringent condition and (a); With

(c) if the degeneracy that does not have a genetic code just will be with (a) and the dna sequence dna of defined dna sequence dna hybridization (b).

(ii) production has the method for TPO active protein, and it comprises the following steps:

Under the appropriate nutrition condition, cultivate can express the protokaryon or the eukaryotic host cell of said proteinic mode with said dna sequence dna conversion or transfection;

Separate target protein matter product by the said dna sequence dna gained of expression,

(iii) in protokaryon or eukaryotic host cell, pass through to express the protein of said dna sequence dna gained.

The invention further relates to contain effective measurer have the TPO activity said proteinic pharmaceutical composition and the treatment thrombopathia (especially thrombopenia) method, comprise to the patient that above-mentioned disorder is arranged and use said protein.

Brief description of the drawings

Fig. 1 represents to derive from the SephacrylS-200HR gel permeation chromatography of the Phenyl Sepharose 6 FF/LS F2 of XRP.

Fig. 2 represents the Capcell PakC1 reversed phase chromatography of YMC-pack CN-AP TPO active fraction, and said fraction derives from the lower molecular weight TPO sample (Sephacryl S-200HRF3) of XRP.

The SDS-PAGE that Fig. 3 represents to derive from the Capcell PakC1 TPO active fraction (FA) of XRP lower molecular weight TPO sample analyzes.

Fig. 4 represents the peptide mapping of TPO on the C18 reversed-phase HPLC with the isolating rat of SDS-PAGE.Shown in peptide fragment be to get through three kinds of thorough hydrolysis of proteolytic enzyme.

Fig. 5 represents to derive from the rat CFU-MK mensuration system TPO activity of XRP.

Fig. 6 represents the structure of expression vector pEF18S.

Fig. 7 is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pEF18S-A2X is introduced in the COS1 cell.

Fig. 8 is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pEF18S-HL34 is introduced in the COS1 cell.

Fig. 9 is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHT1-231 is introduced in the COS1 cell.

Figure 10 a is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHTF1 is introduced in the COS1 cell.

Figure 10 b is illustrated in the M-07e mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHTF1 is introduced in the COS1 cell.

Figure 11 represents λ HGT1 clone's restriction map and the structure of pHGT1 and pEFHGTE.

(E：EcoRI，H：HindIII，S：SalI)

Figure 12 a is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pEFHGTE is introduced in the COS1 cell.

Figure 12 b is illustrated in the M-07e mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pEFHGTE is introduced in the COS1 cell.

Figure 13 a is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHT1-211#1, pHT1-191#1 or pHT1-171#2 are introduced in the COS1 cell.

Figure 13 b is illustrated in the rat CFU-MK mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHT1-163#2 is by in the primer COS1 cell.

Figure 14 is illustrated in the M-07e mensuration system, the TPO activity in the culture supernatants of COS1 cell, and wherein pHT1-211#1, pHT1-191#1, pHT1-171#2 or pHT1-163#2 are introduced in the COS1 cell.

Figure 15 represents to be used for from the color atlas of the reverse-phase chromatography (Vydac C4 post) of the culture supernatants purifying people TPO of Chinese hamster ovary celI, and Chinese hamster ovary celI wherein has been imported into pDEF202-hTPO-P1, so that TPO can be expressed.

Figure 16 shows that Chinese hamster ovary celI wherein has been imported into pDEF202-hTPO-P1, so that TPO can be expressed with the picture of SDS-PAGE separation by the people TPO of the culture supernatants purifying of Chinese hamster ovary celI.

Figure 17 is the color atlas that is used for from the reverse-phase chromatography of E.coli purifying people TPO, and E.coli wherein has been imported into pCFM536/h6T (1-163), to enable to express TPO.

Figure 18 separates from the picture of the people TPO varient h6T (1-163) of E.coli separation and purifying with SDS-PAGE, and E.coli wherein has been imported into pCFM536/h6T (1-163), to enable to express TPO.

Figure 19 is illustrated in the wash-out pattern that purifying on the Superdex 75pg post derives from the hTPO163 of culture supernatants, and as initiator, it is by people TPO expression plasmid pDEF202-hTPO163 transfection is prepared to Chinese hamster ovary celI.Detect protein content in the 220nm place.

Figure 20 is illustrated in from culture supernatants purifying hTPO163 after the SDS-PAGE of the standard hTPO163 of Superdex 75pg post wash-out analysis, as initiator, it is by preparing people TPO expression plasmid pDEF202-hTPO163 transfection to Chinese hamster ovary celI, hTPO163 dyes with silver on gel.

Figure 21 represents the structure of expression vector pSMT201.

Figure 22 is illustrated in the TPO activity that detects through the M-07e assay method in the culture supernatants of COS7 cell, has been imported into β GL-TPO, N3/TPO or 09/TPO in the COS7 cell wherein, expresses it then.

Figure 23 is illustrated in the TPO activity that detects through the M-07e assay method in the culture supernatants of COS7 cell, and COS7 cell wherein has been imported into and has expressed insertion or the disappearance derivative of people TPO.

Figure 24 represents that the platelet count of mouse behind vein and subcutaneous injection TPO raises.

After Figure 25 represented subcutaneous injection TPO, the platelet count of mouse was dose-dependently and raises.

Figure 26 is illustrated in 5-FU and handles mouse to bring out after the thrombopenia, and TPO can raise by the induced platelet number.

Figure 27 represents to handle after mouse brings out thrombopenia with the pyrimidine hydrochloride Nitrosourea, and TPO can raise by the induced platelet number.

Figure 28 represents that TPO can induce the platelet count in the mouse of thrombopenia after the bone marrow transplantation to raise.

Figure 29 is illustrated in after the minimizing of roentgen radiation x mouse hyperamization platelet, and TPO can raise by the induced platelet number.

Figure 30 is illustrated in to use by the TPO of brachymemma (amino acid/11-163 among the SEQ ID NO:6) back platelet count and is the dose-dependently rising.

After Figure 31 is illustrated in and uses the minimizing of hydrochloric acid Nidran induced platelet, use the TPO (amino acid/11-163 among the SEQ ID NO:6) of brachymemma can cause that platelet count raises again.

Figure 32 represents to improve the Mpl-X concentration that adds in people's megalokaryocyte culture system will increase the blocking-up that megalokaryocyte is grown.

TPO derivative [the Met that Figure 33 has described to express in E.coli ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹³³] TPO (1-163), [Met ^-2, Lys ^-1, Ala ¹, Val ³, Pro ¹⁴⁸] TPO (1-163) and [Met ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹¹⁵] the TPO activity of TPO (1-163), this activity is detected by the M-07e assay method.

TPO derivative [the Met that Figure 34 has described to express in E.coli ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹²⁹] TPO (1-163), [Met ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹⁴³] TPO (1-163), [Met ^-2, Lys ^-1, Ala ¹, Val ³, Leu ⁸²] TPO (1-163), [Met ^-2, Lys ^-1, Ala ¹, Val ³, Leu ¹⁴⁶] TPO (1-163) and [Met ^-2, Lys ^-1, Ala ¹, Val ³, Arg ⁵⁹] the TPO activity of TPO (1-163), this activity is detected by the M-07e assay method.

The detailed description of invention

Exactly the invention provides biological activity with differential stimulus or platelet increasing generation and 1-332 thrombopoietin (TPO) the polypeptide or derivatives thereof that contains SEQ ID NO:6 aminoacid sequence.Illustrational polypeptide comprises the those polypeptides of being made up of following amino acid sequences: the 1-163 of SEQ ID NO:6 aminoacid sequence; The 1-232 of SEQ ID NO:6 aminoacid sequence; The 1-151 of SEQ ID NO:6 aminoacid sequence; SEQ ID NO:2,4 and 6 mature amino acid sequence; Comprise the those polypeptides that lacks 1-6-terminal amino acid.The other illustrational polypeptide of the present invention comprises [Thr ³³, Thr ³³³, Ser ³³⁴, Ile ³³⁵, Gly ³³⁶, Tyr ³³⁷, Pro ³³⁸, Tyr ³³⁹, Asp ³⁴⁰, Val ³⁴¹, Pro ³⁴², Asp ³⁴³, Tyr ³⁴⁴, Ala ³⁴⁵, Gly ³⁴⁶, Val ³⁴⁷, His ³⁴⁸, His ³⁴⁹, His ³⁵⁰, His ³⁵¹, His ³⁵², His ³⁵³] TPO, [Asn ²⁵, Lys ²³¹, Thr ³³³, Ser ³³⁴, Ile ³³⁵, Gly ³³⁶, Tyr ³³⁷, Pro ³³⁸, Tyr ³³⁹, Asp ³⁴⁰, Val ³⁴¹, Pro ³⁴², Asp ³⁴³, Tyr ⁴⁴, Ala ³⁴⁵, Gly ³⁴⁶, Val ³⁴⁷, His ³⁴⁸, His ³⁴⁹, His ³⁵⁰, His ³⁵¹, His ³⁵², His ³⁵³] TPO, [Asn ²⁵] TPO and [Thr ³³] TPO.

Other polypeptide of the present invention also comprises the derivative of TPO polypeptide

[Δ His ³³] TPO (1-163), [Δ Arg ¹¹⁷] TPO (1-163), [Δ Gly ¹¹⁶] TPO (1-163); [His ³³, Thr ^{33 '}, Pro ³⁴] TPO (1-163), [His ³³, Ala ^{33 '}, Pro ³⁴] TPO (1-163), [His ³³, Gly ^{33 '}, Pro ³⁴, Ser ³⁸] TPO (1-163), [Gly ¹¹⁶, Asn ^{116 '}, Arg ¹¹⁷] TPO (1-163), [Gly ¹¹⁶, Ala ^{116 '}, Arg ¹¹⁷] TPO (1-163), [Gly ¹¹⁶, Gly ^{116 '}, Arg ¹¹⁷] TPO (1-163), [Ala ¹, Val ³, Arg ¹²⁹] TPO (1-163), [Ala ¹, Val ³, Arg ¹³³] TPO (1-163), [Ala ¹, Val ³, Arg ¹⁴³] TPO (1-163), [Ala ¹, Val ³, Leu ⁸²] TPO (1-163), [Ala ¹, Val ³, Leu ¹⁴⁶] TPO (1-163), [Ala ¹, Val ³, Pro ¹⁴⁸] TPO (1-163), [Ala ¹, Val ³, Arg ⁵⁹] TPO (1-163) and [Ala ¹, Val ³, Arg ¹¹⁵] TPO (1-163).

TPO polypeptide of the present invention comprises that also those link to each other with polymkeric substance (preferably polyoxyethylene glycol) covalency.TPO polypeptide of the present invention further can comprise amino acid [Met ^-2-Lys ^-1], [Met ^-1] or [Gly ^-1].DNA provided by the invention comprises the DNA of such encode above-mentioned TPO polypeptide and derivative, and with suitable the providing of the dna form of cDNA, genomic dna and production.

The present invention also provides the method for producing above-mentioned TPO polypeptide, and its step is included in the polypeptide of expressing among the suitable host by dna encoding of the present invention, separates said TPO polypeptide.At the TPO polypeptide of being expressed is Met ^-2-Lys ^-1Under the polypeptide situation, said method further can comprise from said isolating TPO polypeptide cracking Met ^-2-Lys ^-1Step.

The present invention also provides the method for producing as the TPO polypeptide of glutathione-S-transferase (GST) fusion polypeptide.The DNA of coding N-terminal gst polypeptide, zymoplasm identification polypeptide and TPO polypeptide is imported suitable host, separates fusion polypeptide, and through Thrombin treatment to remove the GST part.Gained TPO polypeptide has [Gly ^-1] structure.

The present invention provides protokaryon or the eukaryotic host cell with dna sequence dna conversion of the present invention or transfection in addition, and its transfection or conversion are to carry out in the mode that can express the bioactive polypeptide with differential stimulus or platelet increasing generation in said host cell.

Pharmaceutical composition of the present invention comprises TPO polypeptide or the derivative and the pharmaceutical carrier of significant quantity, is easy for treating thrombopathia, especially treats thrombocytopenia, as the thrombocytopenia of bringing out because of chemotherapy, radiotherapy or bone marrow transplantation.The invention provides corresponding methods of treatment.

At last, the invention provides the antibody that specific immune response is arranged with above-mentioned TPO polypeptide and derivative thereof.This antibody-like is used for the analysis and the quantitative analysis method of TPO polypeptide of the present invention.

According to the present invention, provide coding to have the active proteinic new dna sequence dna of TPO (hereinafter referred to as " dna sequence dna of the present invention ").Dna sequence dna of the present invention comprises the dna sequence dna of aminoacid sequence shown in the SEQ ID NO:2,4 or 6 in the appended sequence table of coding.

Dna sequence dna of the present invention also comprises amino acid whose part modification shown in the coding aforementioned SEQ ID NO:2,4 or 6 (replace, lack, insert or increase) varient, and prerequisite is that this class modification does not damage the TPO activity.In other words, the dna sequence dna of coding TPO derivative is also included among the present invention.

In other words, dna sequence dna of the present invention comprises that its aminoacid sequence of coding is essentially the dna sequence dna of the protein molecule of aminoacid sequence shown in the SEQ ID NO:2,4 or 6.Used in addition word " aminoacid sequence is essentially aminoacid sequence shown in the SEQ ID NO:2,4 or 6 " means said aminoacid sequence and comprises that those are by SEQ ID NO:2,4 or 6 represented, and those are by the SEQ ID NO:2,4 or 6 represented that is wherein modified (as replacement, disappearance, insertion, increase etc.) by part, and the latter's prerequisite is that said modification does not damage the TPO activity.

Further, dna sequence dna of the present invention comprises that in essence coding has the dna sequence dna of TPO active protein.

Word " dna sequence dna of encoding amino acid sequence " comprises all dna sequences that can have degeneracy in nucleotide sequence.

Dna sequence dna of the present invention also comprises following sequence:

(a) SEQ ID NO:7,194,195 and 196 represented dna sequence dna or its complementary strands,

(b) under stringent condition with dna sequence dna or its fragment of (a) defined dna sequence dna hybridization, or

(c) if the degeneracy that does not have a genetic code just will be with (a) and the dna sequence dna of defined dna sequence dna hybridization (b).

In other words, dna sequence dna of the present invention also comprises following sequence:

(a) be incorporated in the following carrier and coding has the dna sequence dna of the aminoacid sequence of TPO active protein: the carrier pHGT1 (preserving number is FEMR BP-4616) that the carrier pHT1-231 (preserving number is FERM BP-4564) that the carrier pEF18S-A2 α that E.coli DH5 bacterial strain carries (preserving number is FERMBP-4565), E.coli DH5 bacterial strain carry, the carrier pHTF1 (preserving number is FERM BP-4617) that E.coli DH5 bacterial strain carries and E.coli DH5 bacterial strain carry; Or

(b) under stringent condition, has the dna sequence dna of the active aminoacid sequence of TPO with (a) defined dna sequence dna or the hybridization of its fragment and coding.

" strictness " described herein hybridization conditions be meant with sex change and/or unique sequence Oligonucleolide primers (probe) illustrate that applied condition among the embodiment that DNA of the present invention is carried out pcr amplification (also can be referring to for example Molecular Cloning, Chapter 11 and 12, Sambrook et al., Cold Spring Harbor Laboratory Press, 1989; CurrentProtocols in Molecular Biology, Unit 2.10, Ausubel et al., Eds., CurrentProtocols, USA, 1993).

Dna sequence dna of the present invention also comprises the active protein DNA sequence of coding tool TPO, comprises the nucleotide sequence of the 1-163 position of the aminoacid sequence that coding SEQ ID NO:6 represents.

This class dna sequence dna can also add limited enzymatic hydrolysis site and/or other dna sequence dna in initial, termination and mid-way, so that make up the carrier that is easy to express.When using the nonmammalian host, can in the host, mix preferred codon for genetic expression.

An example of dna sequence dna of the present invention is: by from Mammals (comprising the people) cell preparation mRNA, screen the cDNA molecule of required cDNA gained then with conventional route from the cDNA library of currently known methods preparation.The source of mRNA comprises clone McA-RH8994, HTC cell, H4-II-E cell, rat liver, kidney, brain and small intestine, the people liver etc. in rat hepatocytes source in this case.

The another one example of dna sequence dna of the present invention is a kind of genomic dna molecule, it by with conventional route from getting with screening the genomic library of currently known methods by Mammals (comprising the people) cell preparation.The source of genomic dna comprises the chromosomal DNA prepared product that derives from people, rat, mouse etc. in this case.

The dna sequence dna of preparation coding TPO derivative can be modified above-mentioned cDNA sequence by utilizing known site-directed mutagenesis, takes this part and modifies corresponding aminoacid sequence, thereby made by the cDNA sequence that above-mentioned coding has a TPO active protein.

Derived the proteinic aminoacid sequence or the dna sequence dna of tool TPO activity of the present invention, thereby coding is easy to make with chemical synthesis through the dna sequence dna of the aminoacid sequence of part modification.

Dna sequence dna of the present invention is to utilize various recombinant DNA technology scale operation to have the proteinic useful matter of TPO activity.

Equally, dna sequence dna of the present invention also is used as the label probe of the gene that separates coding TPO associated protein, and cDNA and the genomic dna of the TPO of other mammal species of conduct coding.It also can be used for people and other kind gene therapy in mammalian animal.In addition, dna sequence dna of the present invention also is used to develop the transgene mammal (Palmiter et al., Science, vol.222, p809-814,1983) that can be used as the eucaryon host of scale operation TPO.

The method of protein that the present invention also provides the carrier integrated by the dna sequence dna of aforementioned coding tool TPO active protein, had the TPO activity with said carrier transformed host cells and production, said method comprises cultivates said host cell, the active protein of tool TPO that separation and purifying are expressed.

The example that is used for the host cell of above-mentioned situation comprises prokaryotic cell prokaryocyte, and as E.coli etc., eukaryotic cell is as yeast, insect, mammalian cell etc.The example of illustrational mammalian cell comprises COS cell, Chinese hamster ovary (CHO) cell, C-127 cell, children's hamster kidney in age (BHK) cell etc.Illustrational zymic example comprises bread yeast (yeast saccharomyces cerevisiae), methyl alcohol assimilation yeast (Pichia pastoris).The example of illustrational insect cell comprises the culturing cell of silkworm etc.

The relevant carrier that is used to transform above-mentioned host cell, pKC30 (Shimatake H.and M.Rosenberg, Nature, 292,128-132,1981), pTrc99A (Amann E.et al., Gene, 69,301-315,1988) etc. can be used for Transformed E .coli cell.PSV2-neo (Southern andBerg, J.Mol.Appl.Genet., 1,327-341,1982), pCAGGS (Niwa et al., Gene, 108,193-200,1991), pcDL-SR α 296 (Takebe.et al., Mol.Cell.Biol., 8,466-472,1988) etc. can be used for transformed mammalian cell.PG-1 (Schena M.and Yamamoto K.R., Science, 241,965-967,1988) etc. can be used for transformed yeast cell.The transfer vector such as the pAc373 (Luckow et al., Bio/Technology, 6,47-55,1988) that are used for construction of recombinant virus can the transformed silkworm cells.

In case of necessity, each above-mentioned carrier can contain system return contact, selective marker, promotor etc., and also contains RNA splicing site, polyadenylation signal etc. being used for eukaryotic carrier.

Relevant replication origin can be used in the carrier of transformed mammalian cell from for example sequence of SV40, adenovirus, bovine papilloma virus etc.Sequence from ColEI, the R factor, F-factor etc. can be used in the carrier of Transformed E .coli cell.Sequence from 2 μ m DNA, ARS1 etc. can be used in the carrier of transformed yeast cell.

About the promotor of genetic expression, those can be used for the carrier of transformed mammalian cell from for example promotor of retrovirus, polyomavirus, adenovirus, SV40 etc.From the promotor of phage, can be used for the carrier of Transformed E .coli cell as trp, Ipp, Lac or tac promotor.ADH, PHO5, GPD, PGK or MAF α promotor can be used for transforming the carrier of bread leaven matricyte, and AOX1 promotor etc. can be used for transforming the carrier of methyl alcohol assimilation yeast cell.The carrier that can be used for the transformed silkworm cell from the promotor of nucleopolyhedrosis virus.

The exemplary that is used for the selective marker of mammalian cell carrier comprises Xin Meisu (neo) resistant gene, thymidine kinase (TK) gene, Tetrahydrofolate dehydrogenase (DHFR) gene, E.coli xanthine-guanine phosphoribosyl transferase (Ecogpt) gene etc.The illustrative example that is used for the selective marker of E.coli cell carrier comprises kalamycin resistance gene, ampicillin resistance gene, tetracycline resistance gene etc., and the example that is used for the selective marker of yeast cell comprises genes such as Leu2, Trp1, Ura3.

The suitable combination of above-mentioned host-vector system is produced in utilization has the active protein of TPO, can from gained cell or substratum or filtrate, separate and the required polypeptide of purifying then by the transformant that transforms suitable host cells, cultivates gained with recombinant DNA through insert gene gained of the present invention in the appropriate site of above-mentioned carrier.Usually used mode and process can be used for aforesaid method in combination.

When expressing goal gene, can modify or replace the primary signal sequence to obtain with deriving from another kind of proteinic signal sequence by the homogeneity N-terminal of expression product.The N-terminal homogenizing can be undertaken by the amino-acid residue of modifying (substituting or increase) N-terminal or its neighbor positions.For example under situation about expressing as host cell with E.coli, the Lys residue can further replenish and add the met residue.

The present invention has the active new protein of TPO (hereinafter referred to as " protein of the present invention ") and comprises the protein that contains aminoacid sequence shown in the SEQ ID NO:2,4 or 6 separately.Aminoacid sequence is modified (replace, lack, insert or increase) by part TPO derivative is also included among the present invention, and prerequisite is that the TPO activity is not destroyed because of modification.

In other words, protein of the present invention comprises that its aminoacid sequence is the protein molecule of aminoacid sequence shown in the SEQ IDNO:2,4 or 6 basically.

The word of this paper " aminoacid sequence is the aminoacid sequence of (or expression) shown in the SEQ ID NO:2,4 or 6 basically " is meant that said aminoacid sequence comprises those sequences shown in the SEQ ID NO:2,4 or 6, and sequence shown in the SEQ ID NO:2,4 or 6 of wherein part modification (as alternative, disappearance, insertion or increase etc.), be that said modification does not destroy the TPO activity for this situation prerequisite of the latter.

Protein of the present invention comprises and contains aminoacid sequence 7-151 position shown in the SEQ ID NO:6 and have the active protein of TPO.Be included in equally in the protein of the present invention is that to have a TPO active and contain the protein of 1-163 amino acids sequence shown in the SEQ ID NO:6.

The example of other TPO derivative of the present invention comprises the derivative that its body internal stability and persistence are improved because of amino acid whose modification (substitute, lack, insert or increase), at least one potential glycosylation derivative of obtaining changing because of amino acid whose disappearance or increase wherein, or at least one Cys residue disappearance or wherein by other amino-acid residue (as Ala or Ser residue) alternate derivative.

Preferably, the present invention is proteinic is characterised in that it is from containing cDNA molecule, genomic dna molecule or separating and purifying through the recombinant vectors transformed host cells of the dna fragmentation that chemical synthesis obtains.

When doing the host with bacterium such as E.coli and can carry out cell inner expression effectively, can obtain the protein that initial methionine residue is added to N-terminal one side of the protein molecule with TPO activity, this protein is also included among the present invention.According to used host's difference, the protein of the tool TPO activity of being produced can or can not be by glycosylation, and this every kind situation all is included in the protein of the present invention.

Protein of the present invention also comprises naturally occurring TPO active protein, and they are from natural origin, as have in the active cell culture medium of TPO or in people's urine, serum and the blood plasma purifying and separating obtain.

The method of purifying TPO is also included among the present invention from above-mentioned natural origin.Finish this class purification process and can adopt one or the following step that is generally used for protein purification of combined utilization, as ion exchange chromatography, lectin affinity chromatography, triasine dyes affinity chromatography, hydrophobic interaction chromatography, gel permeation chromatography, reversed phase chromatography, heparin affinity chromatography, sulfation gel chromatography, hydroxyapatite chromatography, isoelectric focusing chromatography, metal chelate chromatography, preparative electrophoresis, isoelectric focusing gel electrophoresis etc.Utilization can infer the physicochemical property of the TPO that among the embodiment from this specification sheets and the purification process that is used in combination some technology is also included among the present invention.In addition, can also use antibody affinity chromatography, wherein use the antibody that to discern TPO.And, found that TPO is part (de Sauvage et al., the Nature 369:533-538 (1994) of Mpl; Bartley et al., Cell 77:1117-1 124 (1994); Kaushansky et al., Nature 369:565-568 (1994)), take this to utilize Mpl with resin link coupled affinity gel column purification TPO.Or rather, the example of said pillar is a Mpl-X post, it is by extracellular region (Mpl-X) coupling of resin and Mpl is made, and said MpL-X is (Bartley, ibid for et al. (1994)) that the recombinant DNA technology through do the host with Chinese hamster ovary celI is produced.

As disclosed herein, TPO polypeptide of the present invention further be characterised in that it can in conjunction with the Mpl acceptor and can be specifically in conjunction with outer (solubility) zone of its born of the same parents.

Comprise equally in the present invention be by with the protein coding chain complementary DNA part encoded protein matter of the people cDNA or the genomic dna sequence of TPO gene, be people such as Tramontano (Nucl.Acids.Res., vol.12, p5049-5059,1984) disclosed " complementary reverse protein ".

Comprise equally in the present invention be with detectable label as ¹²⁵Therefore the protein of the present invention of I mark or biotin function mark is provided for the possible reagent articles for use of detection and quantitative analysis TPO or TPO expression of receptor cell in solid sample (as tissue) and liquid sample (as blood, urine etc.).

Biotinylated protein matter of the present invention is used for itself and the combining of immobilized streptavidin, to remove megakaryoblast when the allogeneic bone marrow transplantation from marrow.It also is used for itself and the combining of immobilized streptavidin, to concentrate from body or allochthonous megalokaryocyte from body or allogeneic bone marrow transplantation the time.TPO and toxin such as ricin, diphtheria toxin etc. or with radioisotopic binding substances can be used for antineoplaston and the conditioning bone marrow transplantation.

The present invention also provides nucleic acid substances, and it is used for when usefulness comprises radioactivity or nonradioactive labeling's's (as vitamin H) detectable label mark, or is used for crossover process to detect people's TPO gene and/or its position of genes involved family on map.This class nucleic acid substances also is used for the genetic disorder at dna level confirmer TPO, and can be as confirming to adjoin gene and disorderly genetic marker thereof.

Comprise equally in the present invention be medicinal compositions, it contains protein of the present invention and practical and effective thinner, sanitas, solubilizing agent, emulsifying agent, assistant agent and/or the carrier for the treatment of significant quantity.Term used herein " treatment significant quantity " is meant that the approach to specific disease and application conditions provides the amount of useful effect.This based composition can liquid, the form of freeze-drying or drying agent is used, it contains and is selected from various damping fluids with different pH values and ionic strength (Tris-HCl for example, acetate and phosphoric acid salt) thinner, prevent to express additive such as the albumin and the gelatin of absorption, tensio-active agent such as polysorbas20, tween 80, Pluronic F68 or cholate, solubilizing agent such as glycerine or polyoxyethylene glycol, antioxidant such as xitix or pyrosulphite hydrogen sodium, sanitas such as thiomersal(ate), benzyl alcohol or metagin, and carrier or tonicity agents such as semi-lactosi or mannitol.The compound that is employed in addition comprises that protein of the present invention links to each other with polymkeric substance such as polyoxyethylene glycol covalency, protein and metal ion-chelant, protein mixes granular preparation, or on its surface, contain polymer compound such as poly(lactic acid), polyglycolic acid or hydrogel perhaps mix protein liposome, microemulsion, micelle, single or multiple lift vesicle, blood shadow or protoplastis.This based composition will work according to clearance rate in release rate and the body in the physical condition of TPO, solvability, stability, the body.Can determine selection according to the physicochemical property of used TPO active protein to composition.Comprise equally in the present invention be granular composition, wherein particle is with polymkeric substance such as poloxamer, poloxamine wraps quilt, TPO combines with the part of tissue specificity acceptor, part or antigenic antibody or tissue specificity acceptor.Other example of the present composition is to have the protectiveness coating and contain proteinase inhibitor or the granular form of penetration enhancers, is used for various approach dispensers, as parenteral, through lung, via intranasal application and oral administration.

Contain the proteinic pharmaceutical composition of the present invention can every day administration for several times, according to patient's situation, sex, route of administration etc. usually consumption be 0.05 μ g-1mg/kg body weight (TPO protein).

Different according to patient's symptom, sex and route of administration, containing the proteinic pharmaceutical composition of the present invention can per kilogram of body weight 25,000-500,000, the amount of 000 activeconstituents (by the relative reactivity that hereinafter the M-07e assay method that provides is detected) uses 1 every day to for several times, medication 1-7 days weekly.

The inventor confirms, about the C-terminal site of people TPO, both made when the 152 amino acids residues of sequential amino acid deletion to the shown in the SEQ ID NO:6 and still can keep its activity; For the N-terminal site, activity is still kept when amino-acid residue lacks to the 6th.

In view of the above, have the TPO activity, contain the 7-151 aminoacid sequence of SEQ ID NO:6 and modified the protein of (replace, disappearance, insert or increase) in other parts and also be preferably used as effective constituent of the present invention.Preferred TPO derivative has the 1-163 aminoacid sequence of SEQ ID NO:6.

Comprise that equally in the present invention composition is except containing protein of the present invention, also contain at least a other Hemopoietic factor, as EPO, G-CSF, GM-CSF, M-CSF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, LIF and SCF.

Protein of the present invention is united separately or with other Hemopoietic factor and is used for the treatment of various thrombocytopenic diseases.The example of other Hemopoietic factor comprises EPO, G-CSF, GM-CSF, M-CSF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, LIF and SCF.

Can treat many with protein of the present invention is the disease of feature with or thrombocyte shortening lifetime impaired because of hematoblastic generation (due to the hematoblastic destruction accumulation) caused thrombopathia (as thrombocytopenia).For example, it can be used for congenital Fanconi anaemia or after bone marrow transplantation because of the thrombocytopenia patient of the aplastic anemia due to chemotherapy, radiotherapy, osteomyelodysplasia syndromes, acute myelocytic leukemia, the aplastic crisis, to promote hematoblastic recovery.It can also be used for the treatment of because of the generation of TPO or the thrombocytopenia due to reducing.Thrombocytopenia due to thrombocyte or megalokaryocyte shortening lifetime comprises idiopathic thrombocytopenic purpura, hypoplastic anemia, acquired immune deficiency syndrome (AIDS) (AIDS), disseminated intravascular coagulation and thrombus thrombocytopenia.In addition, protein of the present invention also is used for hematoblasticly reinjecting from body, wherein TPO is used before the patient carries out surgical operation, increasing patient's self platelet count, and therefore and the thrombocyte that increases when operation as the thrombocyte of infusion.

Proteinic other purposes of the present invention is treatment because of the disease that the temporary transient disappearance of the thrombocyte due to chemistry or pharmacy medicine or the methods of treatment or infringement cause.TPO can be used in and promotes new " complete " hematoblastic release in this class patient body.

The invention further relates to has specific antibody to TPO.Protein of the present invention can be used as antigen, and corresponding antibody comprises monoclonal antibody, polyclonal antibody and the chimeric antibody with the ordinary method preparation, i.e. " recombinant antibodies ".For preparing the antibody of the anti-TPO of this class, people TPO itself can be used as antigen, and perhaps selectively, the partial peptide of people TPO can be used as antigen.When using, with regard to available specific antigenic region definition epi-position at the antigenic antibody of this class peptide.On the other hand, when the antibody used at antigen protein (TPO) itself, can be by the clear and definite antigenic region of epi-position of analyzing antibody.In this case, these antibody capables that have so clear and definite epi-position respectively are enough in the different TPO of various its characteristics of fractional separation, detection, quantitative analysis and purifying (as the kind of adding sugar chain, the length of peptide chain etc.).

Can synthesize the TPO peptide that contains through the aminoacid sequence of above-mentioned selection, and, link to each other by covalent linkage, with preparation immunoreactivity antigen as albumin, KLH (lockhole _ hemocyanin) etc. with it and suitable carrier proteins.In addition, produce multiple antigenic peptide (MAP) type peptide as antigen (Tam, Proc.Natl.Acad.Sci.USA.85:5409-5413,1988) according to the method for Tam.Then, with immune Mammals such as prepared antigen and adjuvant, birds etc., this is used to make it to produce antibody usually, as rabbit, mouse, rat, goat, sheep, chicken, hamster, horse, cavy etc.From immune animal reclaim antiserum(antisera) and cell, obtain polyclonal antibody thus.When peptide is used as antigen, with specific antigenic region definition epi-position.In this case, the antigenic region that has the various TPO of different molecular weight with screening of immunology engineering and evaluation.For example, can screen and identify peptide disappearance district.In addition, from cell clone antibody gene or its part of expressing required antibody, with the antibody molecule that obtains expressing with genetic engineering method.

Have the polyclonal antibody of specific multiple antibody to compare to multiple antigenic determinant (epi-position) with containing usually, monoclonal antibody only has specificity to the single antigenic determinat on the antigen.The specific antibody of TPO is used to improve the selectivity and the stability of complementary diagnosis of antigen-antibody reaction and analytical measuring method, and is used for separation and the purifying of TPO.In addition, this antibody-like can be used for neutralization or remove TPO from serum.Monoclonal antibody also is used for detecting and the quantitative analysis TPO of serum or whole blood for example.

Anti-people TPO antibody of the present invention can be used as the part in the affinity chromatography of purifying and separation of human TPO.For sessile antibody making it to be used for affinity chromatography, any ordinary method of fixing various enzymes can be used.For example, can use the method for carrier (Pharmacia Fine Chemicals Co.) of having utilized CNBr activatory Sepharose 4B etc.In order to utilize the anti-people TPO of fixed antibody purifying people TPO practically, the anti-people TPO antibody that is fixed is filled in the post, and crosses post with the liquid that contains people TPO.Through this operating process, a large amount of people TPO is adsorbed to the carrier surface in the post.As for the solvent that carries out wash-out, for example available is Gly-HCl damping fluid (pH2.5), NaCl solution, propionic acid, diox, 1, chaotropic salt, Guanidinium hydrochloride, urea element etc.Carry out wash-out with above-mentioned solvent, can go out to have highly purified people TPO by wash-out.

Antibody of the present invention can be measured by the immunochemistry quantitative analysis and be used to detect people TPO, the especially enzyme-linked immunoassay that is undertaken by the solid phase sandwich assay.

The advantage of monoclonal antibody is that they can be produced by the hybridoma that does not contain any other immunoglobulin molecules in the substratum.Monoclonal antibody can be by the culture supernatants of hybridoma or by preparing in the mouse ascites that is brought out through the peritoneal injection hybridoma.Be widely used for forming hybridoma by Kohler and the disclosed hybridoma technology of Milstein (Eur.J.Immunol.6:511-519,1976) at first, the latter has the high-level monoclonal antibody at specific antigens.

In order from the material that contains antibody of gained, to separate required antibody, can adopt a step or unite step (affinity chromatography such as a-protein affinity chromatography, the protein G affinity chromatography that the use multistep is generally used for protein purification, the Avid gel chromatography, anti-immunoglobulin fixed gel chromatography etc., and cation-exchange chromatography, anion-exchange chromatography, lectin affinity chromatography, dye adsorption chromatography, hydrophobic interaction chromatography, gel permeation chromatography, reversed phase chromatography, hydroxyapatite chromatography, fluoro phosphatic rock chromatography, metal chelate chromatography, iso-electric point chromatography etc.).In addition, can also use the antigen affinity purification, wherein, preparation with contain antigenic region or its part and maybe can discern the people TPO albumen of molecule of required antibody itself or gel carrier or the film that peptide links to each other through chemistry, on it, add the material that contains antibody, so that the required antibody of preparation is adsorbed to carrier or film surface, wash-out and reclaim adsorbed antibody under optimum conditions then.

The present invention also allows to use the endogenous dna sequence of coding TPO polypeptide to produce polypeptide product in large quantities.For example, utilize external and intravital homology regrouping process transformed host cell, express polypeptide expression to be provided or to strengthen.Preferred host cell comprises the people's cell (as liver, medullary cell etc.) that has wherein inserted promotor or enhancer sequence, used target area homologous flanking sequence during insertion with cellular genome, take this to finish or strengthen the TPO polypeptide expression (referring to as U.S.Letters Patent 5,272,071, PCT WO 90/14092, WO 91/06666 and WO 91/09955).

The present invention also provides the method for producing above-mentioned TPO polypeptide, is included in the polypeptide of expressing dna encoding of the present invention among the suitable host, separates said TPO polypeptide.When the TPO polypeptide of being expressed is Met ^-2-Lys ^-1During polypeptide, these class methods further comprise cracking Met from said isolating TPO polypeptide ^-2-Lys ^-1Step.

The present invention also provides production tool [Gly ^-1] method of TPO polypeptide of structure, comprise the coding for glutathion-DNA5 ' of S-transferring enzyme (GST) polypeptide is imported suitable host cells with the connector of TPO polypeptid coding sequence, GST wherein and TPO polypeptide are separated by the DNA of coding zymoplasm identification polypeptide, separate the GST-TPO expression product, with Thrombin treatment by polypeptide expressed to remove GST amino acid, gained TPO polypeptide has [Gly ^-1] structure.

The present invention will be described in detail belows.

(A) purification of rat TPO, analyze purifying rat TPO partial amino-acid series and analyze the biological property of the rat TPO of purifying

The most capable trial purifying of the present inventor has the active rat TPO protein that promotes rat CFU-MK hyperplasia and differentiation.In the research of this purifying, to the selection in purge process such as various natural supplies source and be used for the gel of chromatography and a large amount of tentative and failure property trials has been carried out in the selection of clastotype.Finally, the inventor successfully has the active protein of TPO from being purified into through X ray or gammairradiation inductive thrombocytopenia rat plasma, be purified the rat CFU-MK assay method of describing among the embodiment 1 and 2 of proteinic partial amino-acid series based on hereinafter with reference embodiment and mensuration, will utilize the TPO activity to serve as a mark.

The biological property of the rat TPO in blood plasma source also detects in embodiment 3.

List main points below from purification of rat TPO to the partial amino-acid series process of measuring protein purification.

(i) from about 1,100 prepare plasma sample through X ray or gammairradiation inductive thrombocytopenia rat, and carry out Sephadex G-25 chromatography, anion-exchange chromatography (Q-Sepharose FF) and lectin chromatography (WGA-Agarose) successively, thereby obtain the TPO active fraction of WGA-Agarose absorption.

(ii) next, the active fraction of the WGA-Agarose of gained like this absorption is carried out triasine dyes affinity chromatography (TSK AF-BLUE 650MH), hydrophobic interaction chromatography (Phenyl Sepharose 6FF/LS) and gel permeation chromatography (Sephacryl S-200HR) more successively.(F1 is the highest weight fraction because of this is divided into 4 peaks by Sephacryl S-200HR gel-filtration TPO activity, be F2, F3 and F4 subsequently), so concentrate TPO active fraction F2 and F3 respectively, obtain being respectively applied for high molecular TPO sample F 2 and lower molecular weight TPO sample F 3 in the subsequent purification step.

(iii) with lower molecular weight TPO sample F ₃Being prepared property reversed phase chromatography (YMC-PackPROTEIN-RP), reversed phase chromatography (YMC-Pack (N-AP) and another reversed phase chromatography (CapcellPack C1) successively.After the TPO of gained like this active fraction is used to sodium lauryl sulphate (SDS) polyacrylamide gel electrophoresis (SDS-PAGE) and extracts the TPO active substance from gel, under non-reduced condition, be about 17 from being equivalent to apparent molecular weight, 000-19, alleged occurrence TPO activity in 000 the band.

(iv) follow, all TPO active fraction are carried out SDS-PAGE under non-reduced condition, and transfer to pvdf membrane.Protein on the pvdf membrane becomes peptide fragment through the hydrolysis of thoroughness Restriction Enzyme, measures the proteinic partial amino-acid series of rat TPO then.Amino acid sequence information clone rat TPO gene according to two peptide fragment.

(v) so far, the high molecular TPO sample F 2 that will obtain through Sephacryl S-200HR is with the mode purifying same with lower molecular weight TPO sample F 3.When the TPO active fraction that obtains through final step reversed phase chromatography (Capcell Pack C1) is applied to SDS-PAGE, and when from gel, extracting the TPO active substance, under non-reduced condition, be about 17 from being equivalent to apparent molecular weight, 000-22, alleged occurrence TPO activity in 000 the band.

(B) the characterization rat produces cell, the preparation mRNA of TPO and makes up the rat cdna library

Because the rat TPO of above-mentioned purifying derives from blood plasma, so be necessary to screen the organ or the cell of originating as the mRNA that is used for the cDNA clone.Therefore, screen TPO activity in various organs and the cell culture supernatant liquid according to the biochemistry of rat plasma source TPO and biological characteristics.As a result, in the culture supernatants of the culture supernatants of clone McA-RH8994, the HTC in rat hepatocytes source and H4-11-E and rat primary hepatocyte, found the TPO activity (embodiment 4) that almost equates with the TPO in rat plasma source.

On the other hand, from expression vector pME18S and pEFBOS construction of expression vector pEF18S (embodiment 5).The structure of this carrier can provide and may be easy to utilize efficient expression vector clone cDNA, and said efficient expression vector has can be used in integrates the multiple clone site of inserting section.

Except that above-mentioned expression vector, main also in order to the pUC and the pBR construction cDNA library of the phage vector on plasmid vector and λ basis.

Cultivate the McA-RH8994 cell, homogenize, carry out CsCl density gradient centrifugation then, obtain total RNA (embodiment 6) by adding guanidine thiocyanate solution.

Also can use hot phenol method, preparation such as a kind of sour guanidinesalt phenol chloroform method RNA.

Using oligodeoxythymidylic acid fixed latex particle purifying poly (A) from total RNA ⁺Behind the RNA, make primer, add Restriction Enzyme NotI recognition sequence, through the synthetic article one cDNA chain of the effect of reversed transcriptive enzyme, again with RNase H and the synthetic second cDNA chain of E.coli dna polymerase i with oligodeoxythymidylic acid.In the double-stranded cDNA of gained, add the EcoRI connector, mammalian cell expression vector pEF18S (with NotI and EcoRI digestion) constructed among the cDNA of gained and the embodiment 5 is connected, then with the competent cell of the cDNA Transformed E .coli DH5 bacterial strain that connected with construction cDNA library (embodiment 7).

(C) with PCR preparation (clone) rat TPO cDNA fragment

Infer dna sequence dna from partial amino-acid series, the synthetic degenerated primer that is used for polymerase chain reaction (PCR) through the rat TPO of rat plasma purifying.The primer also can obtain with the aminoacid sequence beyond the position of primer according to this place.Can also use the height degenerated primer of not using inosine.In addition, can utilize the codon design that in rat, is in daily use to reduce the primer (vol 18, p2367-2411,1990 for Wada et al., Nucleic Acids Res.) of degeneracy.

When carrying out PCR as template from the intact part extraction plasmid DNA in above prepared cDNA library and with the DNA that extracts, detect the band of about 330bp, this is determined as the dna fragmentation (A1 fragment) (embodiment 8) of coding rat TPO part in amino acid sequence analysis subsequently.

(D) screen the sequence of rat TPO cDNA, rat TPO cDNA and prove the TPO activity with PCR

The cDNA library of above-mentioned preparation is divided into little storehouse, respectively contains about 10,000 clones, extracts plasmid DNA from per 100 little storehouses.When with each plasmid DNA storehouse as template and use when carrying out PCR according to the new synthetic primer of the segmental nucleotide sequence of A1, in 3 little storehouses, detect and be considered to the specific band of tool.One of them of 3 little storehouses is divided into Ya Ku again, contains about 900 clones respectively, plasmid DNA purification from 100 inferior storehouses, and carry out PCR in an identical manner.As a result, in 3 inferior storehouses, detect specific band.One of them of these storehouses is divided into Ya Ku again, respectively contains 40 clones, finally screens each clone through PCR in the same manner.As a result, be separated to the clone pEF18S-A2 α (embodiment 9 and 10) that seems coding rat TPO cDNA.

When analyzing this clone's nucleotide sequence, the result shows the proteinic partial amino-acid series of this clones coding by the rat plasma purifying, has therefore confirmed that this clone contains rat TPO cDNA (embodiment 10) most probably.

When by the clone pEF18S-A2 α plasmid DNA purification of above-mentioned gained and transfection COS1 cell, in the culture supernatants of transfected cell, found the TPO activity.As a result, confirmed that clone pEF18S-A2 α contains the cDNA (embodiment 11) of coding rat TPO.

(E) in various rat tissues, detect TPO mRNA

With the expression of TPO mRNA in the pcr analysis rat tissue, and specific expressed (embodiment 12) in rat brain, liver, small intestine and the kidney have been detected.

(F) make up the human cDNA library

Based on the result of embodiment 4 and 12, liver is selected as the initial tissue that carries out people TPO cDNA clone.Therefore, with the commercially available mRNA construction cDNA library that derives from normal people's liver.As the situation in rat library, make the synthetic cDNA of carrier with same method with pEF-18S, utilize Restriction Enzyme NotI and EcoRI to obtain directly clone's cDNA library.Import the prepared library of E.coli DH5 by the cDNA that carrier is connected and contain about 1,200,000 clone (embodiment 13).

(G) with PCR preparation (clone) people TPO cDNA fragment

Synthetic several of nucleotide sequence according to the clone pEF18S-A2 α of coding rat TPO cDNA are used for the primer of PCR.When with the synthetic cDNA of the commercially available mRNA that derives from normal people's liver, and when using above-mentioned primer and carrying out PCR as template, observe the band of about 620bp with cDNA.Prove when analyzing its nucleotide sequence that this clone contains the dna fragmentation with about 86% homology of rat TPOcDNA tool, prove that therefore this is the Gene Partial (embodiment 14) of coding people TPO most probably.

(H) screen the sequence of people TPO cDNA, people TPO cDNA and confirm the TPO activity with PCR

The increase human cDNA library of above-mentioned preparation is divided into little storehouse, respectively contains about 100,000 clones, and plasmid DNA is extracted in the little storehouse of each from 90 little storehouses.When making template with the plasmid molecule in each storehouse and using the new synthetic primer of nucleotide sequence according to the people TPO fragment of embodiment 14 gained to carry out PCR, in 3 little storehouses, detect possible band.One of these little storehouses are divided into Ya Ku, respectively contain 5,000 clones, plasmid DNA purification from each inferior storehouse in 90 inferior storehouses.When carrying out PCR with each storehouse plasmid DNA as template in the same manner, in 5 inferior storehouses, detect possible band.When one of these storehouses are subdivided into Ya Ku, when respectively containing 250 clones, the plasmid DNA purification performing PCR of going forward side by side detects possible band in 3 inferior storehouses from each inferior storehouse in 90 inferior storehouses.And, separate 90 colonies from one of these inferior storehouses, carry out PCR by the plasmid DNA of each colony purifying, finally obtain the clone (embodiment 15) of HL34 by name.

During the nucleotide sequence of the plasmid DNA in analyzing this clone, the result proves that this clone contains the cDNA (embodiment 16) that shows about 84% homology with rat TPO cDNA nucleotides sequence.

When this plasmid DNA of cloning of purifying and transfection COS1 cell, in the culture supernatants of transfected cell, found the TPO activity.As a result, confirmed that this plasmid clone contains the cDNA (embodiment 17) of coding people TPO.

Yet this cDNA seemingly clones the artifact of process, because do not find terminator codon in this clone, at its 3 ' end polyA tail sample sequence is arranged.Therefore, the structure coding does not contain the expression vector corresponding to the aminoacid sequence of polyA tail sample sequence.When the carrier of structure like this is expressed, in the culture supernatants of gained, found TPO activity (embodiment 18) in the COS1 cell.

Obtain the dna fragmentation of people TPO3 ' end region with PCR, so that analyze the structure of full-length cDNA.

Measure this segmental nucleotide sequence and show, the cDNA that the clone HL34 of it and embodiment 15 gained carries is overlapped.Expect that also total length people TPO cDNA can contain its open reading frame, and 353 the amino acid whose protein of encoding.Therefore, this shows that people TPO contains 353 aminoacid sequences (embodiment 19) that comprise 21 amino acid signal sequences.

Except above-mentioned cloning process, can also utilize plasmid vector, based on the carrier of lambda particles phage etc. based on pUC or pBR, do probe obtains people TPO cDNA through colony hybridization or plaque hybridization clone with rat TPO cDNA fragment.When design degeneracy probe, inosine can be used to reduce the degree of the letter opposite sex.A kind of during when can effectively using with ad hoc fashion or the active measuring method of high-sensitivity detection TPO, then might utilize the expression library of As used herein to come cloning by expression.

Yet because as described in the embodiment 15 hereinafter, in normal people's liver as if very low (content that calculates from the result of this embodiment 15 is 1: 3 * 10 to the content of people TPO coding RNA ⁶), so, carry out screening by hybridization with synthetic oligonucleotide or rat or people TPO cDNA fragment as probe and be difficult to prove effective, because pending colony or plaque number become very huge, and the sensitivity of hybrid method and specificity are not as good as the PCR method.In fact, the inventor with rat TPOcDNA fragment do probe in the cDNA library of the prepared normal people's liver of embodiment 13 2 * 10 ⁶The clone hybridizes, but fails to obtain people TPO cDNA clone.

(I) rebuild the cDNA that normal people's liver is originated

Because the clone HL34 of embodiment 15 gained may contain incomplete cDNA, so with the poly (A) in commercially available normal people's liver source ⁺The RNA preparation rebuilds the cDNA library, to obtain complete people TPO cDNA, imports the library (hTPO-F1) for preparing among the E.coli DH5 by the cDNA that carrier is connected and contains 1.0 * 10 ⁶Transformant (embodiment 20).(J) screening TPO cDNA clone, order-checking and expressing human TPO cDNA and confirmation TPO activity

According to the synthetic primer that is used for PCR of the nucleotide sequence (SEQ ID NO:196) of the people TPO global cDNA of prediction among the nucleotide sequence (SEQ ID NO:3) of the Partial cDNA of gained among the embodiment 14 and the embodiment 19.

The people's liver cDNA library (hTPO-F1) that makes up among the embodiment 20 is divided into 3 little storehouses (storehouse 1-3#).Use by the plasmid DNA of each little storehouse preparation and also carry out PCR with the synthetic primer as template.As a result, when using the plasmid DNA that is prepared by the little storehouse of 3#, having increased has the dna fragmentation of expection size.Then the little storehouse of 3# is divided into Ya Ku, contains 15,000 transformant respectively, utilize PCR to screen as mentioned above.As a result, in 6 of 90 little storehouses, find to have tool to expect the amplification of big or small DNA.When these positive little storehouses are divided into Ya Ku, contain 1,000 clone respectively, when extracting plasmid DNA in an identical manner and going forward side by side performing PCR, do not observe DNA cloning.Consider this be growth owing to purpose clone than the more weak plasmid DNA rate of recovery that causes of other clone low due to.Therefore, the little storehouse of primary 3# is coated in 100 LB flat boards with the inoculation volume of 4,100 colonies of growing on each LB flat board, xeroxed dull and stereotyped by each flat board of so inoculating preparation.When using the DNA that from the colony that flat board is grown, extracts to carry out PCR with above-mentioned same way as, in one of 100 inferior storehouses, observed expect the amplification of band.

Flat board by this storehouse, Asia prepares two replica filters, finishes colony hybridization with the probe (the EcoRI/BamHI fragment of plasmid pEF1 8S-HL34) of mark.As a result, observe and be considered to the male single signal, from original flat board, collect colony, and be inoculated into once more on the LB flat board.Prepare dna sample 50 colonies altogether on growing in flat board, the performing PCR of going forward side by side finally obtains the clone (embodiment 21) of pHTF1 by name.In screening cDNA when clone, main method such as hybridization, PCR and the cloning by expression that utilizes and unite these methods of use improving the effectiveness and the sensitivity of screening, or reduces labour intensity.When measuring the nucleotide sequence of the clone pHTF1 that so obtains, the result shows that clone pHTF1 has open reading frame, and is considered in full accord with the aminoacid sequence (SEQ ID NO:6) of the people TPO that is inferred by the aminoacid sequence of open reading frame encoded protein matter.This nucleotides sequence is listed on 3 positions different with a kind of sequence (SEQ ID NO:196) of being inferred, but these difference do not cause amino acid change.Confirmer TPO protein contains 353 amino-acid residues of 21 amino acid signal sequences of tool.When the clone pHTF1 by acquisition like this prepares plasmid DNA and transfection people COS1 cell, in culture supernatants, found TPO activity (embodiment 23).

(K) utilize plaque hybridization screening people TPO chromosomal DNA, order-checking and expressing human TPO chromosomal DNA, confirm the TPO activity

By T.Yamamoto (the Gene Research Center, Tohoku University) genomic library of being so kind as to give contains 30 with each flat board, the inoculum size of 000 phage particle is seeded on 18 NZYM flat boards, two replica filters of each preparation from 18 made flat boards.With pcr amplification people TPO cDNA fragment (the base figure place 178-1 among the SEQ ID NO:7,025), and purifying it.Utilization with ³²The purifying fragment of P mark is that probe carries out plaque hybridization.The result obtains 13 positive signal.From original flat board, collect plaque, and be seeded to once more on the NZYM flat board with each dull and stereotyped inoculum size that forms 1,000 plaque.From two replica filters of the dull and stereotyped preparation of each gained, under above-mentioned the same terms, carry out plaque hybridization.As a result, on all filter membranes of 13 groups, all detect positive signal.Reclaim single plaque with the preparation phage DNA from the flat board of each gained.Verify in the phage DNA sample for preparing by 13 clones whether have the cDNA coding region with PCR.As if 5/13 clone contain the complete amino acid coding region by the cDNA prediction.Therefore, select one of these clones (clone λ HGT1), and analyze with Southern trace (using above-mentioned probe).Because under the situation of HindIII digestion, observe the single band of about 10kb, so clone λ HGT1, the row agarose gel electrophoresis of going forward side by side with HindIII digestion.Excision and purifying 10kb band from gel, subclone is gone into cloning vector pUC13, finally obtains the clone (embodiment 24) of pHGT1 by name.

When measuring the nucleotide sequence of the clone pHGT1 that so obtains, find that chromosomal DNA that this clone carries contains the complete coding region of the protein of embodiment 19 indications, the nucleotide sequence of this coding region conforms to fully with the nucleotide sequence that is indicated (SEQ ID NO:196).

In addition, corresponding to the zone of the exon of coded amino acid 4 introns are arranged, this nucleotide sequence is different from the sequence (SEQ ID NO:7) of the global cDNA that 21 DCRP pHTF1 of embodiment carry.

During the nucleotide sequence of 4 clones of residue in measuring 5 chromosomal DNAs clones that select respectively by screening, find to have among 4 clones 2 consistent with clone pHGT1, other 2 clones except as in 3 ' non-coding region, have the different Nucleotide also and clone pHGT1 identical (embodiment 25) with clone pHTF1 is observed.

EcoRI fragment among the plasmid clone pHGT1 that so obtains is linked to each other with expression vector pEF18S, obtain people TPO expression plasmid pEFHGTE.When preparing plasmid DNA (pEFHGTE) and being transfected into the COS1 cell, in culture supernatants, found TPO activity (embodiment 26).

(L) the disappearance derivative of preparation people TPO, this derivative expression and the confirmation TPO activity in the COS1 cell

Embodiment 18 and 22 result show, even people TPO protein still can show its biological activity after removing 3 amino acid of its C-terminal.Therefore, carried out the experiment of disappearance derivative in order further to analyze the part of biologically active.Utilize the DNA of the plasmid clone pHT1-231 of embodiment 18 gained to make template and make primer to prepare a series of expression plasmid through PCR with the synthetic oligonucleotide.

The expression plasmid of gained contains the DNA of coding people TPO disappearance derivative, and this DNA lacks the proteinic C-terminal of TPO district, promptly lacks the aminoacid sequence of derivative coding 1-211,1-191,1-171 and 1-163 position.When each clone preparation plasmid DNA and transfection are to the COS1 cell, in each culture supernatants, detect TPO activity (embodiment 27).

Design the derivative of a series of disappearance C-terminal amino-acid residues to 151 and lack other derivative that N-terminal side amino-acid residue reaches 6,7 and 12 respectively, in the COS1 cell, express the back detection of active at it, has the active zone of TPO with further detailed analysis, when the amino-acid residue disappearance of 7 of the aminoacid deletion to the of N-terminal side or C-terminal side during, detect less than TPO activity (embodiment 28 and 29) to 151.

Can obtain having the proteinic derivative of TPO biological activity by modifying (lack, substitute, insert or increase) cDNA of coded protein.Be used to carry out method such as PCR, site-directed mutagenesis and the chemical synthesis of modification.

(M) expressing human TPO cDNA and purifying TPO in Chinese hamster ovary celI

Construction of expression vector pHTP1, it can be at the DNA (embodiment 30) that expresses the people TPO speculating acid sequence of coding shown in SEQ ID NO:6 in the zooblast.

TPO cDNA district among the pHTP1 is used to be structured in the carrier pDEF202-hTPO-P1 (embodiment 31) that expresses in the Chinese hamster ovary celI.

After selecting transfectional cell then, obtain the expression vector of carrier TPO cDNA wherein and be incorporated into transfectional cell (embodiment 32) in the Chinese hamster ovary celI karyomit(e) with above-mentioned carrier transfection CHO cell.

In embodiment 32, cultivated the Chinese hamster ovary celI system (CHO28-30 cell, anti-25nM MTX) that produces people TPO on a large scale, this clone is by people TPO expression plasmid pDEF202-hTPO-P1 transfection CHO cell preparation (embodiment 55).

Purifying people TPO (embodiment 56) from 100 liters of culture supernatants.

Can select different modes purifying people TPO (embodiment 57) from the culture supernatants of embodiment 55.

(N) expressing human TPO cDNA and confirmation are active in the X63.6.5.3. cell

Utilize TPO cDNA district coded among the prepared plasmid pBLTEN of embodiment 30 to make up the expression vector BMCGSneo-hTPO-P1 (embodiment 33) that is used for X 63.6.5.3. cell.

When transforming the X63.6.5.3. cell with above-mentioned carrier, the expression vector of coding people cDNA has been incorporated in its karyomit(e) in the transformant cell of gained.Cultivate this transformant, in culture supernatants, detect TPO activity (embodiment 34).

(O) great expression people TPO, purifying TPO, determining molecular weight and its biological property of description in the COS1 cell

The expression vector pHTP1 transfection of preparation among the embodiment 30 in the COS1 cell, is obtained the culture supernatants (embodiment 35) that a large amount of (about altogether 40 liters) contain expression product.

Purifying TPO from the COS1 cell non-serum culture supernatants of the prepared TPO that contains expression vector pHTP1 source of 7 liters of embodiment 35.Can access highly active TPO (embodiment 36) by hydrophobic interaction chromatography, cation exchange column chromatography, WGA column chromatography and reversed phase column chromatography step.

To carry out molecular weight detection and biological property analysis (embodiment 37 and 38) by partially purified TPO like this in the COS1 cell culture supernatant liquid.

(P) expressing human TPO in E.coli

Structure is used for expressing at E.coli the carrier pGEX-2T/hT (1-174) of the fused protein (being called " GST-TPO (1-174) ") of glutathione-S-transferase and people TPO (1-174 amino acids residue).In this case, the preferred codon with E.coli exchanges people's TPO cDNA nucleotide segment (half zone of about 5 ' side) (embodiment 39).

GST-TPO (1-174) expresses in E.coli, the cell of cracking gained, the contained GST-TPO (1-174) of dissolution precipitation part then.Next, after application review TPO refolding condition, purification condition (Triptide affinity chromatography, cationic exchange coloum etc.) and various steps, can carry out partial purification to the protein that contains designed TPO aminoacid sequence with zymoplasm digestion GST protein portion.Confirmed that in rat CFU-MK mensuration system this protein shows TPO activity (embodiment 40 and 41).

With the parent, be structured in and express the mutant human proteinic carrier pCFM536/h6T of TPO (1-163) among the E.coli, in the said mutein (being called " h6T (1-163) "), 1 Ser and 3 s' Ala is replaced by Ala and Val respectively, increases a Lys and a Met respectively at-1 and-2 simultaneously.The whole portion (being equivalent to the 1-163 amino-acid residue) of the people TPO cDNA nucleotide sequence that above-mentioned carrier carries exchanges (embodiment 42) with the preferred codon of E.coli.

H6T (1-163) expresses in E.coli.The cell of cracking gained, the contained h6T (1-163) of dissolution precipitation part, and this proteinic refolding condition of inspection then.Take this partial purification successfully and contained the protein of designed TPO aminoacid sequence.In rat CFU-MK mensuration system, confirmed this proteinic TPO activity (embodiment 43 and 44).

In addition, made up and be used for expressing the mutant human proteinic carrier pCFM536/hMKT of TPO (1-163) at E.coli, in the said mutant protein (being called " hMKT (1-163) ") ,-1 and-2 increased Lys and Met respectively.HMKT (1-163) expresses with embodiment 43 described same way as in E.coli, and marking protein is carried out SDS-PAGE, be transferred on the pvdf membrane, carry out the N-terminal amino acid sequence analysis then, confirm that then this protein contains designed aminoacid sequence (embodiment 52).

In addition, structure is used for expressing the mutant human proteinic carrier pCFM536/hMKT of TPO (1-332) at E.coli, in the said mutant protein (being called " hMKT (1-332) ") ,-1 at people TPO (1-332 amino acids) increases Lys and increases Met at-2 respectively.HMKT (1-332) in E.coli with embodiment 42 in identical mode express, and utilize that prepared anti-people TPO peptide antibody has confirmed above-mentioned expression of results (embodiment 66) through the Western trace among the embodiment 45 that hereinafter provides.

(Q) anti-TPO peptide antibody of preparation and anti-TPO peptide antibody post

Utilize synthetic peptide (three subregions that are equivalent to the rat TPO aminoacid sequence measured among the embodiment 10) the anti-TPO peptide antibody of preparation rabbit polyclonal.Confirmed that these antibody can discern rat and people TPO molecule.And the synthetic peptide that is equivalent to 6 subregions of SEQ ID NO:6 (or SEQ ID NO:7) the TPO aminoacid sequence of leting others have a look at is used to prepare the anti-TPO peptide antibody of rabbit polyclonal then.Confirmed gained antibody capable identification people TPO (embodiment 45).

Might utilize with some the pillar that TPO has the molecule (as anti-TPO antibody, TPO acceptor etc.) of binding affinity to fill is come purifying TPO through affinity column chromatography.Therefore, at first prepare anti-TPO antibody column (embodiment 46) by the anti-TPO peptide antibody of 45 gained in conjunction with the embodiments.

(R) utilize its biological property of people TPO, determining molecular weight and description of expressing in the anti-TPO peptide antibody column purification COS1 cell

Utilization obtains partially purified TPO with the culture supernatants of the COS1 cell of expression vector pHTP1 transfection as initiator, is used for anti-TPO antibody column then.Because found the TPO activity in being adsorbed fraction, so this fraction further carried out reversed phase column chromatography, with this protein of purifying and detect its molecular weight and biological property (embodiment 47).

(S) confirm the biological activity of the partial purification sample of the people TPO that the COS1 cell is expressed

Check the biological activity of TPO active fraction purified among the embodiment 36, determining whether it plays the function (embodiment 48) of platelet increasing number in vivo, said active fraction promptly is purified to the TPO sample of CapcellPak C1 300A post step by the culture supernatants with the COS1 cell of expression vector pHTP1 transfection.

Equally, check the biological activity of the rough TPO fraction that obtains through cationic exchange coloum by the prepared 33 liters of culture supernatants of the transfection COS1 cell that carries expression vector pHTP1, to confirm its increased platelets counts number (embodiment 49) in vivo.

(T) expressing human TPO chromosomal DNA and confirm its activity in Chinese hamster ovary celI

Structure is used at the chromosomal carrier pDEF202-ghTPO of Chinese hamster ovary celI expressing human TPO (embodiment 50).

When this carrier imports Chinese hamster ovary celI, obtain the chromosomal dna encoding expression vector of people TPO wherein and be incorporated into transformant in its karyomit(e).When cultivating this cell clone, in culture supernatants, detect TPO activity (embodiment 51).

(U) the mutant human TPO that in E.coli, expresses of partial purification and confirm its activity

Utilize Guanidinium hydrochloride and gsh that clone pCFM536/h6T (1-163) that derives from coding people TPO nucleotide sequence and the mutant human TPO that expresses in E.coli are carried out folding again, play rising platelet count (embodiment 53) in vivo with the h6T (1-163) that determines gained like this.

Utilize N-dodecanoyl sodium sarcosinate and copper sulfate to carry out again folding to clone pCFM536/h6T (1-163) that derives from coding people TPO nucleotide sequence and the mutant human TPO that in E.coli, expresses, carry out cation-exchange chromatography then, with the h6T (1-163) that determines gained like this increased platelets counts number (embodiment 54) in vivo.

In addition, also available other method is carried out folding and purifying (embodiment 60 and 61) to mutant human TPO h6T (1-163) again.

(V) at expressed in insect cells people TPO cDNA and identify the TPO activity

Preparation is used for the recombinant virus (embodiment 58) at expressed in insect cells people TPO, and expresses in insect cell Sf21, identifies TPO activity (embodiment 59) then in culture supernatants.

(W) expressing human TPO (1-163 amino acids) and this TPO of purifying in Chinese hamster ovary celI

Be structured in expressing human TPO protein expression carrier pDEF202-hTPO163 in the Chinese hamster ovary celI, said protein (being called " hTPO163 ") has the let others have a look at 1-163 amino acids of TPO aminoacid sequence of SEQ ID NO:7.With the expression vector transfection CHO cell, and the Chinese hamster ovary celI system of cultivating the production hTPO163 of gained like this on a large scale.Purifying hTPO163 from culture supernatants (embodiment 62-65).

(X) substituted derivatives of preparation people TPO

Arg-25 and Glu-231 among the preparation people TPO (are called " N3/TPO " and His-33 by Thr alternate derivative (being called " 09/TPO ") by Asn and Lys alternate derivative respectively.

The plasmid of every kind of derivative of encoding is transfected in the COS7 cell, cultivates then.In culture supernatants, detect TPO activity (embodiment 67).

By utilizing the E.coli expression system to prepare a amino acid among the h6T (1-163) by the derivative of other amino acid replacement.In every kind of derivative, all found TPO activity (embodiment 94).

(Y) insertion of preparation people TPO or disappearance derivative

Insert an amino acid to hTPO163 or therefrom lack an amino acid, with the plasmid transfection COS7 cell of coding gained derivative, in COS7 cell culture supernatant liquid, detect TPO activity (embodiment 68) then to prepare its insertion or disappearance derivative.

The present invention is used to detect the active method of TPO (external test system) and describes with " reference example " hereinafter.

(Z) preparation and the anti-people TPO of purifying antibody

Utilize people TPO peptide fragment to prepare polyclonal antibody (embodiment 69), be used for Western engram analysis (embodiment 70) then and make up anti-TPO antibody affinity column (embodiment 71).

(AA) activity in vivo of people TPO

The people TPO of purifying is applied to the mouse of having brought out thrombocytopenia, with respect to the change (embodiment 72-79) of control group monitoring platelet count.The effective application (embodiment 80-89) of pharmaceutical composition in the treatment thrombocytopenia also described.

(BB) relation of TPO activity and MLP receptors bind

In the measuring method that is provided, the TPO activity defines (embodiment 93) according to the specificity keying action of itself and Mpl acceptor.

Reference example

A. rat megalokaryocyte progenitor cell is measured (rat CFU-MK mensuration) system (liquid culture system)

Megalokaryocyte relies on process by energy initiatively and mix and store serotonin (Fedorko, Lab.Invest., vo1.36, p310-320,1977) in endochylema density particle.This phenomenon is observed in less monokaryon acetylcholinesterase, and said cell it is believed that and is positioned (Bricker and Zuckerman, Exp.Hematol., vol.12, p672,1984) between CFU-MK and the discernible megalokaryocyte.The serotonin amount of being mixed increases (Schick and Weinstein, J, Lab.Clin.Med., vol.98, p607-615,1981) along with the increase of megalokaryocyte volume.In addition, known above-mentioned phenomenon only comes across in the megalokaryocyte in the medullary cell (Schick and Weinstein, J, Lab.Clin.Med., vol.98, p607-615,1981) specifically.In the mensuration system of this paper, under the situation that testing sample exists, cultivate highly enriched rat CFU-MK cell (promptly hereinafter with the Gp II b/III a that describes ⁺And detect and to be incorporated in the megalokaryocyte CFU-MK fraction), ¹⁴The C-5 hydroxy-tryptamine ( ¹⁴C-creatine sulfuric acid hydroxyl color amine, ¹⁴C-5HT).

The advantage of this mensuration system be can reduce contaminated cell direct influence (for example, formation is by the Meg-CSF activity of the contamination of cells that some material stimulated outside the purpose factor, perhaps produce certain factor by the cell that pollutes, it and the purpose factor produce combined action) because GpII b/III is a ⁺CFU-MK per-cent in the CFU-MK fraction cell quite high ([measuring method] that vide infra) and the contamination of cells number seldom.In addition, the suitable culture condition can be kept one long relatively period, because the total cellular score of being inoculated in every hole seldom.Another advantage is can check the ripe megalokaryocyte of many comparatively large vols of being grown by CFU-MK when having active sample to exist between incubation period under phase microscope, therefore, provide possible quantitative judgement to said active existence and degree.Quantitatively the result who judges with according to quantitative assay ¹⁴The gained result that mixes of C-5 hydroxy-tryptamine conforms to very much.Therefore, can further improve the reliability of quantitative assay by the quantitative judgement of combined utilization.

Measuring method

Method (Exp.Hematol., vol.20, p855-861,1992) to people such as Miyazaki is carried out trickle modification, is used for highly enriched rat CFU-MK cell (the Gp II b/III a of this measuring method with preparation ⁺The CFU-MK fraction).

Briefly, from Wister rat (male, 8-12 week age), remove femur and shin bone to prepare described bone marrow cell suspension.(this solution contains the 13.6mM trisodium citrate to be used to prepare the suspension culture base of bone marrow cell suspension, 11.1mM glucose, 1mM adenosine, 1mM theophylline, 10mM HEPES (pH 7.25), (Path-O-Cyte 4 for 0.5% bovine serum albumin (hereinafter referred to as " BSA "); Seikagaku Kogyo Co. is Ltd.) with no Ca ²⁺No Mg ²⁺Hanks balanced salt solution (hereinafter will be called " HATCH solution ") on megalokaryocyte isolation medium (Levine and Fedoroko, Blood, vol.50, p713-725, the 1977) basis that Levine and Fedoroko reported, done trickle modification.With the bone marrow cell suspension of so preparation be layered on the discontinuous density gradient solution of Percoll (density: 1.050g/ml/1.063g/ml/1.082g/ml), this gradient solution is by making with the HATCH solution dilution, in 20 ℃ with 400 * g centrifugal 20 minutes.After centrifugal, reclaim the cell between 1.063g/ml and the 1.082g/ml density layer.After the washing, the cell that reclaims is suspended from the Dulbeceo substratum (hereinafter being called " IMDM " substratum) of the Iscove improvement that contains 10% foetal calf serum (hereinafter being called " FCS "), places 100mm tissue culturing plastic plate, at 5%CO ₂Cultivated 1 hour in 37 ℃ in the incubator.After the insulation, reclaim not adherent cell, in the plastics plate, cultivated 1 hour again at 37 ℃.Not adherent cell suspends in HATCH solution, in wherein having adsorbed the mouse thrombocyte Gp II b/III a of mouse monoclonal Chinese People's Anti-Japanese Military and Political College antibody P55 antibody (Miyazaki et al., Thromb.Res., vol.59, p941-953,1990) insulation is 1 hour in the 100mm cytology culture dish.After the insulation, to remove not adherent cell, blow and beat the remaining cell that separately is adsorbed on the fixed P55 antibody by volumetric pipette, and collect it with HATCH solution cleaning down.In general, obtain 3-4 * 10 by a rat ⁵Cell.So the cell fraction of gained contains highly enriched rat CFU-MK (" Gp IIb/III a hereinafter referred to as ⁺The CFU-MK fraction "), partly contain about 5-10%CFU-MK according to known this cell of detected result that has the colony mensuration system under the situation by rat IL-3 in saturation concentration.The hybridoma that can produce aforementioned P55 antibody is in preservation on February 14 in 1994, preserving number is FERM BP-4563 (National Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology, Ministry of IntetnationalTrade and Industry).

Next, with the Gp II b/III a that so obtains ⁺CFU-MK partly is suspended from the IMDM substratum that contains 10%FCS, and with 10 ⁴The ratio of cells/well is scattered in the 96 hole tissue culturing plates.Each Kong Zhongzai adds standard model (hereinafter will describe in detail) or testing sample, therefore adjusts final culture volume to 200 μ l/ hole.The flat board of so preparation is placed CO ₂In the incubator, in 37 ℃ of insulations 4 days.The 4th day of insulation adds 0.1 μ Ci (3.7kBq) finishing preceding 3 hours of cultivation in each hole ¹⁴The C-5-hydroxy-tryptamine continues last insulation in 37 ℃.After being incubated 3 hours, dull and stereotyped with 1, centrifugal 3 minutes of 000rpm removes the gained supernatant liquor through drawing.In every hole, add the 200 μ l PBS parts that contain 0.05%EDTA, centrifugal flat board, it is dull and stereotyped to remove the washing of gained supernatant liquor.The repeated washing step once.200 μ l 2%Triton X-100 are added in the cell mass ball of every hole gained, and dull and stereotyped about 5-10 minute of jolting is with thorough lysing cell on dull and stereotyped mixed instrument.The cell pyrolysis liquid of 150 μ l gained like this is transferred to hat solid scintillator (the Ready Cap that the merchant sells; Beckman), place baking oven to spend the night with dry lysate subsequently again in 50 ℃.Second day, Ready Cap is inserted in the vial, detect with liquid scintillation counter ¹⁴The radioactivity of C.

In this case, when the acetylcholine esterase active that detects according to the method (Blood, vol.67, p1512-1514,1986) of Ishibashi and Burstein in the aforementioned cell pyrolysis liquid, can access with ¹⁴The C-5-hydroxy-tryptamine mixes the almost completely identical result of mensuration.

Standard model:

Preparation is used for the blood plasma of the thrombocytopenia rat of preparation standard sample at first, in the following manner.

Give normal male Wister rat (7-8 age in week) twice of the above-mentioned P55 antibody of intravenous injection (about 24 hours at interval) with the dosage of 0.5mg/ animal, to bring out thrombocytopenia.After 24 hours, under the etherization condition,, added 1ml 3.8% (v/v) citric acid three sodium solution in the used 10ml syringe in the medication second time as antithrombotics through the aorta abdominalis blood sampling.So the blood sample of gathering is dispersed in the plastic centrifuge tube, with centrifugal 10 minutes of 1,200 * g to reclaim the blood plasma part.The blood plasma part of so collecting centrifugal 10 minutes again with 1,200 * g.Reclaim the blood plasma part of gained, careful operation prevents from wherein to contain cell, thrombocyte etc., merges it (blood plasma that obtains in this mode is called as " TRP " hereinafter).To dialyse completely to the IMDM substratum of enough volumes by Ca processing TRP (standard model C), WGA-Agarose post active fraction (standard model W) or Phenyl Sepharrose 6FF/LS post active fraction that TPO obtains according to embodiment 1 method, and as the bioassay standard thing.

In embodiment 1 described rat TPO purification process, standard model C is used in early days, but uses standard model W after mid-term instead, uses standard model P then instead.The specific activity of standard model C tentatively is decided to be 1, according to the relative reactivity of this definition base of calculation sample W and P.The dose response curve by the standard of comparison sample and the dose response curve of testing sample are determined the relative reactivity of each testing sample, and the relative reactivity of testing sample is defined as n, wherein n represent its specific activity standard model C high n doubly.

B. colony is measured system

In this mensuration system, under the situation that testing sample exists, in semisolid medium, cultivate medullary cell, and by calculating the CFU-MK hyperplasia and breaking up formed megakaryocyte colony number and detect the Meg-CSF activity.

Measuring method:

(a) utilize the situation of unsegregated rat bone marrow cell etc.

With the IMDM substratum of containing of 1ml final volume of unsegregated rat bone marrow cell, derive from the Gp II b/III a of the A of said determination system ⁺The cell of each separating step of CFU-MK or GpII b/III a ⁺(AGAR NOBLE DIFCO) adds in the 35mm tissue culturing plastic plate, after self-vulcanizing, at CO for the cell of CFU-MK fraction and 10%FCS, 2mM Gln, 1mM Sodium.alpha.-ketopropionate, 50 μ M 2 mercapto ethanols and 0.3% agar ₂In the incubator in 37 ℃ of cultivations.In general, be used under the isolating medullary cell situation, the cell count in each plate is adjusted into 2-4 * 10 ⁵Under the situation when Percoll density gradient or adherent cell exhaust, cell count is 2-5 * 10 ⁴Or at Gp II b/III a ⁺Under the situation of CFU-MK fraction, cell count is 0.5-2 * 10 ³Cultivate after 6-7 days, from plate, tell agar plate, and place on the slide glass (76mm * 52mm).For dry each agar plate, on gel, put the nylon mesh and the filter paper of one 50 sieve mesh successively.So exsiccant agar slide in 50 ℃ of heat settings 5 minutes, and soaked 2-4 hour in the acetylcholinesterase dye liquor according to method (Blood, vol.42, p413-421, the 1973) preparation of Jackson on hot-plate.After confirming that megalokaryocyte is fully dyeed, wash the agar slide with water, drying again with Harris hematoxylin solution secondary dyeing 30 seconds, washing, dry air.Megakaryocyte colony is defined as having tight accumulative acetylcholinesterase more than 3 or 3.

(b) utilize the situation of unsegregated bone marrow cells in mice

Each plate is used 2-4 * 10 ⁵Cell carries out colony in the mode identical with above-mentioned (a) and measures.

(c) utilize the situation of human bone marrow cell or human cord blood cell

Human bone marrow cell or cord blood cell can directly be used, or use with the CFU-MK fraction form of enrichment in the following manner.

At first, (Daiichi Kagaku Co. Ltd) goes up and centrifugal, reclaims the separation surface white corpuscle part of gained bone marrow fluid or bleeding of the umbilicus to be layered on Lymphoprep.Partly remove and the cell that has specific biotinylation monoclonal antibody to link to each other to people's surface antigen (CD2, CD11c and CD19) from the cell of above-mentioned recovery with the magnetic bead that avidin connects.The cell of being removed by paramagnetic particle method mainly is B cell, T cell, scavenger cell and part granulocyte.Last cell uses cell sorter (for example ELITE of COULTER production) to reclaim CD34 and the positive part of HLA-DR with the anti-CD34 antibody of FITC mark and the anti-HLA-DR antibody staining of PE mark then.The CFU-MK cell is concentrated (" CD34 hereinafter referred to as in this part ⁺DR ⁺The CFU-MK fraction ").Can measure with the colony that above-mentioned same way as when utilizing the rat bone marrow cell situation is carried out people's cell, what change to some extent is with 3-5 * 10 in every plate ³CD34 ⁺DR ⁺CFU-MK fraction cell and replace 10%FCS with the mixture of 12.5% people AB blood plasma and 12.5%FCS.The incubation time that forms megakaryocyte colony is 12-14 days.For detecting people's megalokaryocyte, utilization has specific mouse monoclonal antibody through alkaline phosphatase alkali-resistivity phosphatase antibody method megalokaryocyte to be carried out immunostaining (for example referring to Teramura et al. to megalokaryocyte surface antigen Gp II b/III a, Exp.Hematol., vol.16, p843-848,1988), to respectively containing Megakaryocytic colony count more than 3 or 3.

C. utilize the mensuration system (M-07e mensuration) of the clone of people megakaryoblast

The clone M-07e cell of people megakaryoblast is hyperplasia (Avanzi et al., J.Cell.Physiol., vol.145, p458-464,1990) in response to answering GM-CSF, IL-3, SCF, IL-2 etc.Because these cells also respond to TPO, so they are used for substituting the mensuration system that rat CFU-MK measures system.

Measuring method:

Be recovered in GM-CSF and have the M-07e cell of keeping down, thoroughly washing is suspended from the IMDM substratum that contains 10%FCS then.The M-07e cell suspension of gained is with every hole 10 ⁴The ratio of cell is scattered in the 96 hole tissue culturing plates, and every Kong Zhongzai adds standard model or testing sample, therefore adjusts final volume to 200 μ l/ hole.So the flat board of preparation places 5%CO ₂In the incubator, cultivated 3 days in 37 ℃.Cultivate after 3 days, every hole adds 1 μ Ci (37 KBq) before cultivation is finished 4 hours ³The H-thymidine.After cultivation was finished, usefulness cell harvesting instrument to glass fibre filter, detected cell harvesting with liquid scintillation counter ³H radioactivity (for example, the Beta Plate of Pharmacia production).

D. utilize the mensuration system (Ba/F3 mensuration) of mouse pro B lymphocyte system

The mouse pro B lymphocyte be Ba/F3 be considered to be in outgrowth clone when replying IL3, I4 etc. (Palacios et al., Cell, vol.41, p727-734).Yin Qiya strain BF-TE22 can not only reply IL3 and IL4, and replys TPO generation hyperplasia, so this cell can be used for the mensuration system of rat CFU-MK mensuration as an alternative, the clone auxiliary measuring of people megakaryoblast (M-07e mensuration) is as follows in other words.Briefly, be recovered in the BF-TE22 of growth in the Iscove improvement DMF substratum (IMDM:GIBCO) that contains 1ng/ml mouse IL-3, wash 3 times, be suspended from again in the IMDM substratum that contains 10%FCS with IMDM.Then, with cell suspension with 1 * 10 ⁴The density of cells/well is scattered in each hole of 96 hole tissue culturing plates, and every Kong Zhongzai adds standard TPO solution or testing sample, and the accent final volume is 200 μ l/ holes.The gained flat board is at 5%CO ₂Insulation is 2-3 days in the incubator.At the 2nd or the 3rd day, in each hole, add 1 μ Ci (37KBq) ³The H-thymidine continues to cultivate 4 hours.At last, usefulness cell harvesting instrument to glass fiber filter, detects cell harvesting with liquid scintillation counter ³The H radioactivity, in this mensuration system, nearly all cell of cultivating in lacking the active substratum of TPO is all dead, does not therefore have ³The H-thymidine mixes.Yet cultured cells shows TPO concentration dependent mode in containing the active substratum of TPO active hyperplasia and thymidine mix.In addition, this measurement result conforms to the CFU-MK measurement result with M-07e.

The following examples are further for example understood the present invention.

Embodiment 1-1

Antiplatelet antibody brings out purifying because of using

Rat TPO in the thrombocytopenia rat plasma

Preparation is because of using the blood plasma of the thrombocytopenia rat that antiplatelet antibody brings out

According to the described method of above-mentioned reference embodiment A rat megalokaryocyte progenitor cell (CFU-MK) mensuration system, prepare TRP from about 1,000 rat and originate as purifying.

From TRP purification of rat TPO

At first, with the content of TPO among the imagination TRP mostly be 1: 3 most * 10 ⁶For carrying out purifying according to the TRP with about 1,000 rat, the result obtains being slightly less than the partially purified rat TPO of 1pmole.Although generally speaking purifying TPO is very difficult, but attempt analyzing its partial amino-acid series, the result obtains three partial amino-acid series, and accuracy is very low.The consensus amino acid sequence of the serpin that produces in these sequences and the liver (SPI) or very close.By this result still can not be clear and definite whether TPO has the structure similar to serpin, this sequence derives from the contamination of cells except that TPO in other words.Utilize these not clear and definite sequences from the rat cdna library, to clone the TPO gene, but fail to obtain effective TPO encoding gene.Therefore, be because the purity of analyzed sample is low and to contain quantity not sufficient be that extensive studies has been carried out on the basis again to imagine this failure.In order to obtain the required whole sample that is purified of amino acid analysis, carry out purifying according to the described method of the following examples 1-2.Surprisingly, from the resulting estimate of embodiment 1-2, the TPO content among TRP or the XRP (will be described below) is few, is 1: 10 of total plasma proteins ⁸-10 ⁹, therefore, it is quite difficult that TPO is carried out complete purifying.

Embodiment 1-2

From shining purification of rat the rat plasma that causes thrombocytopenia through whole body X line or γ line

The TPO[preparation is through whole body X line or γ line irradiation the causing blood plasma of thrombocytopenia rat]

X line or the irradiation down of γ line with normal male Wister rat (7 to 8 age in week) whole body places sublethal dose (6 to 7Gy) make it to suffer from thrombocytopenia.Collected rat blood at the 14th day that shines and prepare blood plasma fraction (after this this paper be referred to as " XRP ") in the identical mode of preparation TRP method that preamble is mentioned.

In this case, will be used as the source of carrying out purifying by the XRP (about 8L) that about 1,100 rat of sum makes.

By XRP purification of rat TPO

Because total protein content reaches 493 in the plasma sample of 1,100 rat, 000mg therefore can not be with its primary treatment.Thereby, be divided into 11 parts in the purification step (1) to (4) that plasma sample is carried out below, every part corresponding to about 100 rats.In (7), sample is divided into 6 batches at the purification step that carries out subsequently (5), in purification step (8) and later step thereof, has used sample by about 1,100 rough purifying of the whole blood plasma of rat.Hereinafter describe sample and be (XW9) and (XB6) exemplary of each purification step under the situation.

In all purification steps, the TPO activity is to be used in the rat CFU-MK detection system of describing in the reference example to measure.Unless dated especially, all purification steps all carry out under 4 ℃, except carrying out reversed phase chromatography and the Superdex75pg gel-filtration when surfactant exists, at room temperature carry out at this moment.Protein determination is with coomassie dyestuff binding assay (a kind of reagent system of being produced by PIERCE, catalog number (Cat.No.) 23236X) or uses a kind of method (a kind of reagent system of being produced by PIERCE, catalog number (Cat.No.) 23225) of dicinchonine acid to carry out.

The summary of purifying is shown in table 1.

The purifying of table 1 rat plasma TPO

The relative gross activity activity of the total egg of step

White matter is active to be reclaimed

(mg) (％)

Total blood plasma 493000---

Blood plasma/G25 480,300 2 864,600 100 after Ca handles

＜ion-exchange〉Q-SepharoseFF 314,400 9 704,000 313

＜Sugar receptors〉WGA-Agarose 15,030 132 1,987,000 230

＜triasine dyes〉TSK-gel AF-Blue 650MH 4,236 905 3,834,000 443

＜hydrophobic Phenyl-Sepharose 6FF/LS 2,762 847 2,339,000 271

＜gel filters〉S-200HR F3 (lower molecular weight TPO) 51 20,000 1,020,000 118

S-200HR F2 (high molecular TPO) 262 7,838 2,055,000 238

Lower molecular weight TPO (deriving from S-200HR F3)

The relative gross activity activity of the total egg of step

White matter is active to be reclaimed

(mg) (％)

＜gel filters〉S-200HR F3 (lower molecular weight TPO) 50.3300 20,000 1,007,000 116

＜anti-phase YMC Protein-RP preparative column 2.8540 130,000 371,000 43

＜anti-phase YMC CN-AP 0.3730 800,000 298,400 35

＜anti-phase Cepcell pak C1 0.0396 4,890,000 193,600 22

＜electrophoresis〉15%SDS-PAGE 0.0017 149,000,000 250,300 29

(under non-reduced condition)

High molecular TPO (deriving from S-200HR F2)

The relative gross activity activity of the total egg of step

White matter is active to be reclaimed

(mg) (％)

＜gel filters〉S-200HRF2 (high molecular TPO) 257.0000 7,840 2,015,000 233

＜anti-phase YMC Protein-RP preparative column 11.4000 227,000 2,588,000 300

＜gel filters〉Superdex 75pg/CHAPS 1.1660 1,750,000 2,041,000 236

＜anti-phase YMC CN-AP 0.6200 700,000 434,000 50

＜anti-phase Capcell pak C1 0.0630 20,000,000 1,260,000 146

＜electrophoresis〉15%SDS-PAGE 0.0030 330,000,000 990,000 117

(under non-reduced condition)

(1) calcium chloride of rat plasma is handled, to handle sample part number be under the situation of XW9 for centrifugal and proteinase inhibitor

To be stored in-80 ℃, corresponding to the XRP (742ml of about 100 rats; Protein concn, 54.8mg/ml; Gross protein, 40,686mg) melt and divide to polypropylene tube (producing) by Nalgere.Adding calcium chloride powder to its final concentration in each pipe is 100mM.Behind the incubation that spends the night under 4 ℃, with the gained mixture with 8, centrifugal 60 minutes of 000rpm.With a kind of proteinase inhibitor p-APMSF ((right-the ADP base) Fumette hydrochloride, Wako PureChemical Industries, Lte. produce, catalog number (Cat.No.) 010-10393)) add to gained the active supernatant liquor (742ml of TPO arranged; Protein concn, 54.9mg/ml; Gross protein, 40,740mg) in, making its final concentration is 1mM.The sample that is obtained is used for following Sephadex G-25 post buffering exchange step.

By this way,, handle, thereby the calcium chloride/p-APMSF that has finished whole XRP handles by being divided into every part of 11 parts of equaling about 100 rat XPP by whole XRP that 1,100 rat obtains aly.11 duplicate samples of gained are handled respectively in SephadexG-25 post step subsequently.

(2) Sephadex G-25＜buffering exchange 〉

Sample part number is under the situation of XW9

Will be by calcium treatment step (1) supernatant liquor (742ml of gained afterwards; Protein concn, 54.9mg/ml; Gross protein, 40,740mg) flow velocity with 40-70ml/min adds to the SephadexG-25 post (by Pharmacia Biotech production, catalog number (Cat.No.) 17-0033-03; Diameter, 11.3cm; The height of bed, 47cm) on, this post has been used 20mM Tris-HCl before this, the pH8 balance.Carry out wash-out with same damping fluid.Will be before the albumen wash-out 1, the 300ml elutriant discards.When in elutriant, measuring UV and absorb, store distillate until electric dodar to 500 μ S/cm, thereby found Tris-HCl with 20mM, the TPO active protein cut of pH8 exchange (1,377ml; Protein concn, 27.56mg/ml; Gross protein, 37.882mg; Protein yields, 93%).The relative reactivity of TPO is 2.3 in the fraction.

It is that to have obtained total amount be 21 that all each duplicate samples are carried out result that Sephadex G-25 post handles, and the Sephadex G-25 post of 117ml contains the active fraction of TPO (gross protein, 480,300mg; Average relative reactivity, 2; Gross activity, 864,600).

(3) Q-Sepharose FF (powerful anion-exchange chromatography)

Sample part number is under the situation of XW9

The TPO active fraction that will in above-mentioned steps (2), obtain by Sepharose G-25 processing (1,377ml; Protein concn, 27.5mg/ml; Gross protein, 37,841mg; Relative reactivity, 2.3) add to Q-Sepharose FF post with the flow velocity of 40ml/min and (produce catalog number (Cat.No.) 17-0510-01 by PharmaciaBiotech; Diameter 5cm; Height of bed 27cm) on, and with 20mMTris-HCl (pH8) wash-out, the fraction F1 that crosses post is stored (3,949ml; Protein concn, 0.98mg/ml; Gross protein, 3,870mg; Relative reactivity, 0).

Next step damping fluid is changed into the 20mM Tris-HCl (pH8) that contains 175mM NaCl with wash-out contain the active fraction F2 of TPO (4,375ml; Protein concn, 5.36mg/ml).

At last, containing 1, the 20mM Tris-HCl elutriated fraction F3 of 000mM NaCl (1,221ml; Protein concn, 3.9mg/ml; Gross protein, 4,783mg; Relative reactivity, 3.8).Contain that gross protein is 23 among the active fraction F2 of TPO, 440mg, and be 61.9% by the protein yields of this step F 2.In addition, the relative reactivity of TPO increases to 6.8.

Whole each part Sephadex G-25 are contained the result that the TPO active fraction adds to Q-Sepharose FF obtained 35,842ml Q-Sepharose FF contains the active fraction F2 of TPO (gross protein, 314,384mg; Average relative reactivity, 9; Gross activity, 2,704,000).

(4) wheat germ agglutinin (WGA)-agarose＜Sugar receptors affinity chromatography 〉

Sample part number is under the situation of XW9

To handle the TPO active fraction F2 that contains that in above-mentioned steps (3), obtains by Q-Sepharose FF and be divided into three parts, adding to the WGA-Sepharose post with the flow velocity of 5ml/min (is produced by HonenCorp., be numbered 800273, diameter 5cm, height of bed 22.5cm) on.And with phosphate buffered saline buffer (DPBS) wash-outs such as Dulbecco ' s.With cross post fraction F1 (9,336ml; Protein concn, 2.30mg/ml; Gross protein, 21,407mg, relative reactivity 6.9) store.

Then, damping fluid changed into contain 0.2M N-acetyl-D-glycosamine (GlcNAc, produce by Nacalaitesque, numbering 005-20), the 20mM sodium phosphate buffer (pH 7.2) of 150mM NaCl and 0.02% sodiumazide, reservoir gets elutriant also with a ultra-filtration equipment (OmegaUltrosette, the demarcation molecular weight that dams is 8,000; Filtron produces) concentrate, thereby obtain the absorption of WGA-agarose contain the active fraction F2 of TPO (2,993ml; Protein concn, 0.376mg/ml).

The gross protein that contains among the active fraction F2 of TPO is 1,125mg, and be 4.8% by the protein yields of this step F 2.In addition, the relative reactivity of TPO increases to 101.The fraction F2 that so obtains is stored under-80 ℃.

The result that the active F2 fraction of whole each part Q-Sepharose FF TPO is added to the WGA-agarose is: having obtained total amount is 33, the active fraction F2 of WGA-agarose TPO (gross protein, 15, the 030mg of 094ml; Average relative reactivity, 132; Gross activity, 1,987,000).

(5) tsk gel AF-BLUE 650MH＜triasine dyes affinity chromatography 〉

At the sample lot number is under the situation of XB6

With part number for the active fraction of TPO of the WGA-agarose absorption of XW8 with in above-mentioned steps (4) from part of equaling the initial acquisition of 215 rat XRP number for the WGA-agarose absorption of XW9 contain TPO active fraction F2 mix the sample that the formation lot number is XB6 (5,947ml; Protein concn, 0.388mg/ml; Gross protein, 2,319mg; Relative reactivity, 150).

With 5, a 974ml part and the 1000ml of blended sample contains 0.85 mole NaCl (total amount is 296.76g) and mixes, generating the NaCl final concentration is 6 of 0.822M, 132ml solution, and resulting solution is added in advance with 20mM sodium phosphate buffer (pH 7.2) the equilibrated tsk gel AF-BLUE 650MH post (TOSOH CORP, the catalog number (Cat.No.) 08705 that contain 1M NaCl with the flow velocity of 7ml/min; Diameter 5cm; Height of bed 23cm) on.

After this process is finished, with containing the flow velocity elute protein of the 20mM sodium phosphate buffer (pH7.2) of 1M NaCl with 10ml/min.The gained elutriant stored and concentrated, thereby obtained the fraction F1 (543ml of post with a ultra-filtration equipment (Omega Ultrasette, demarcating the molecular weight that dams is 8,000); Protein concn, 2.05mg/ml; Gross protein, 1,112mg; Relative reactivity, 31).

Next step with elution buffer change into 2M NaSCN with the tsk gel AF-BLUE 650 MH absorption that obtains wash-out contain the active fraction F2 of TPO (1,427ml; Protein concn, 0.447mg/ml).

The gross protein that contains among the active fraction F2 of TPO is 638mg, is 27.5% by the protein yields of this step F 2.In addition, the relative reactivity of TPO increases to 1,500.

With the result that TPO active fraction F2 adds to tsk gel AF-BLUE 650 MH of containing of each batch WGA-agarose absorption is that to have obtained total amount be 10, and tsk gel AF-BLUE 650 MH of 655ml contain the active fraction F2 of TPO (gross protein, 4,236mg; Average relative reactivity, 905; Gross activity, 3,834,000).

(6) Phenyl Sepharose 6FF/LS＜hydrophobic interaction chromatography 〉

At sample is under the XB6 situation about criticizing

With 1,424ml tsk gel AF-BLUE 650 MH contain TPO active fraction F2 (1,424ml; Protein concn, 0.447mg/ml; Gross protein, 638mg; Relative reactivity, 1,500) a part is mixed with 1.5 mol sulfuric acid ammonium powder (total amount is 282.2g) among every 1000ml, and obtaining the ammonium sulfate final concentration is the solution 1 of 1.35M, 581ml.

The flow velocity of gained solution with 7ml/min added in advance with 50mM sodium phosphate buffer (pH 7.2) equilibrated Phenyl Sepharose 6FF (Low Sub) post (Phomacia Biotech, the catalog number (Cat.No.) 17-0965-05 that contain 1.5M ammonium sulfate; Diameter 5cm; Height of bed 10cm) on.After this operation is finished, carry out wash-out with the stream band of 10ml/min with the 36mM sodium phosphate buffer (pH 7.2) that contains 0.8M ammonium sulfate.Reservoir get elutriant (about 3,160ml) and with a ultra-filtration equipment (Omega Ultrasette, demarcation dam molecular weight 8,000) concentrate, thereby obtain fraction F1 (485ml; Protein concn, 0.194mg/ml; Gross protein, 94.2mg; Relative reactivity, 0).

Next step with elution buffer change into 20mM sodium phosphate buffer (pH 7.2) with obtain to contain the active fraction F2 of TPO (about 3,500ml).With a ultra-filtration equipment (Omega Ultrasette, demarcate dam molecular weight 8.000) fraction of wash-out is concentrated and takes out the sample that portion is measured.In this stage, the protein concn and the gross protein that contain the active fraction F2 of TPO are respectively 1.45mg/ml and 319mg, are 50.0% through the albumen productive rate of this step F 2.The relative reactivity of TPO is 1,230.

It is that to have obtained total amount be 1 that each batch tsk gel AF-BLUE 650 MH are contained result that the active F2 fraction of TPO adds to Phenyl Sepharose 6FF/LS, and the PhenylSepharose 6FF/LS of 966ml contains the active fraction F2 of TPO (gross protein, 2,762mg; Average relative reactivity, 847; Gross activity, 2,339,000).

(7) Sephacryl S-200 HR＜gel permeation chromatography 〉

At sample is under the XB6 situation about criticizing (referring to Fig. 1)

Phenyl Sepharose 6FF/LS is contained the active fraction F2 (217ml of TPO; Protein concn, 1.45mg/ml; Gross protein, 315mg; Relative reactivity, 1,230) mixing to obtain 362ml NaCl final concentration with 144.8ml5M NaCl solution is the solution of 2M, use use YM3 film (diameter 76mm, Amicon Corp. produces) ultra-filtration equipment with the gained solution concentration to about 50ml.

The 8M urea that in this solution, adds equal volume (50ml), thus acquisition 100ml contains 1M NaCl and final concentration is the solution of 4M urea.This solution concentration to about 80ml, is made the sample of 88.78ml, add to Sephacryl S-200 HR post then and (produce catalog number (Cat.No.) 17-0584-01 by Pharmaci Biotech; Diameter 7.5cm, height of bed 100cm) on.

After this, carry out wash-out with DPBS effectively with the flow velocity of 3ml/min, will discard uselessly 1, the elutriant behind the 200ml elutriant be collected in 60 polypropylene test tubes with every part of 45ml.Per two pipes are once measured, and remaining is stored in-85 ℃ and has finished Sephacryl S-200 HR until all samples that is got by 1,100 rat and handle.Based on measurement result, the fraction of lot number XB6 is grouped as follows:

(F1) pipe number 1-15 (is in the fraction at useless elutriant edge; Molecular weight is equal to or greater than 94,000)

(F2) pipe number 16-26 (molecular weight, 94,000 to 33,000)

(F3) pipe number 27-44 (molecular weight, 33,000 to 3,000)

(F4) pipe number 45-55 (molecular weight is less than or equal to 3,000)

By this way, respectively all each batches are added to Sephacryl S-200 HR processing, measured and store in-85 ℃ by the active F2 fraction of TPO that contains that Phenyl Sepharose 6FF/LS obtains.All each batches finished S-200 HR handle after and carrying out reversed phase chromatography (YMC-Pack PROTEIN-RP) before subsequently, the ultra-filtration equipment of these samples thawings and use YM3 film (diameter 76mm, Amicon Corp. makes) is concentrated two fens following samples of acquisition.Handle the concentrating sample that contains TPO active fraction F2 that is obtained by Sephacryl S-200 HR and be called " polymer TPO sample F 2 " hereinafter, be called " low molecule TPO sample F 3 " through the same F3 that handles.

Polymer TPO sample F 2 and low molecule TPO sample F 3 are to filter different wash-outs zone fraction in the chromatography to storing gel for convenience, term " polymer " and " low molecule " so and do not mean that the molecular weight that they are real.

Polymer TPO sample F 2 low molecule TPO sample F 3

Molecular weight 94,000-33,000 33,000-3,000

Cumulative volume 3,420ml 6,480ml

Cumulative volume (concentrating the back) 293ml 280ml

Total protein 262mg 51.3mg

Average relative reactivity 7,838 20,000

Gross activity 2,055,000 1,020,000

Low molecule TPO sample F 3 and polymer TPO sample F 2 are carried out purification step subsequently respectively.

The purifying of low molecule TPO sample F 3 is described in following step (8)-(11).

(8) YMC-Pack PROTEIN-RP＜reversed phase chromatography 〉

Low molecule TPO sample F 3 (gross protein, the 50.3mg that will in above-mentioned steps (7), obtain; Protein concn, 0.184mg/ml; Relative reactivity, 20,000; Gross activity, 1,007,000, cumulative volume, 274ml) mixing to obtain cumulative volume with solvent orange 2 A (0.025% trifluoroacetic acid (TFA)) and solvent B (the 1-propyl alcohol that contains 0.025%TFA) is 508.63ml, and propyl alcohol, TFA and protein final concentration are respectively 20%, 0.012% and the solution of 0.0989mg/ml.The insoluble substance that generates in this solution process of preparation comes out by centrifugation, supernatant liquor is divided into two parts of 254.3ml (25.2mg protein) and adds to the post that YMC-PackPROTEIN-RP is housed with the flow velocity of 2ml/min (YMC produces, catalog number (Cat.No.) A-PRRP-33-03-15; Diameter 3cm; Height of bed 7.5cm) on, this post has been used the 30%B balance in advance.The centrifugal precipitation is with containing 5mMCHAPS (3-[3-courage amido propyl group) dimethylamino]-1-propanesulfonic acid salt; DojindoLaboratories produces; Catalog number (Cat.No.) 75612-03-3) 20ml 20mM sodium acetate (pH 5.5) dissolving and upper prop.

Behind the sample upper prop, with about 50ml solvent (solvent orange 2 A: B=321) cross post to obtain the post fraction.Next step, beginning expansion process (in 120 minutes with 30%B to 45%B linear gradient eluant solution) is collected the elutriant of 36 polypropylene test tubes with every pipe 10ml.Remaining sample is repeated this process, collect, obtained every part of fraction test tube of 36 of ading up to that contains the 20ml elutriant like this with identical collection tube.Use the ultra-filtration equipment of using YM3 film (diameter 76mm, Amicon Corp. produces) will cross the post fraction and directly be concentrated into 20ml.

Get every part of each 0.1ml that crosses the 20ml fraction of post fraction and pipe 1 to 36 and mix with 20 μ l5%BSA, evaporation drying is dissolved in 0.25ml IMDM and measures in the nutrient solution, measures then to find out to contain the active fraction of TPO.The result has found the TPO activity in the fraction of pipe 17 to 27 (36.0 to 43.0% propyl alcohol concentration ranges), the YMC-PackPROTEIN-RP that these fractions are used as low molecule TPO sample F 3 sources altogether contains TPO active fraction F2 use.This fraction is stored in-85 ℃ until the YMC-Pack CN-AP step that is used for subsequently.The YMC-Pack PROTEIN-RP in low molecule TPO sample F 3 sources contains TPO active fraction F2

Cumulative volume 220ml

Protein concn 0.0130mg/ml

Gross protein 2.85mg

Relative reactivity 130,000

Gross activity 371,000

(9) YMC-Pack CN-AP＜reversed phase chromatography 〉

The YMC-PackPROTEIN-RP that the low molecule TPO sample F 3 that obtains in the above-mentioned steps (8) is originated contains TPO active fraction F2 214.9ml (gross protein, 2.79mg; Protein concn, 0.0130mg/ml; Relative reactivity, 130,000; Gross activity, 36,300) mix with the glycerine of 0.6ml50% and be concentrated into 1.8ml.This enriched material is less than or equal to 20% propyl alcohol and about 6% glycerine and adjusts to the 5ml volume with containing.

Enriched material is divided into 5 parts of column operations below uses (each operation 1ml and 0.555mg protein).The sample (with 0.6ml/min speed) that is divided is added to the post that is covered with YMC-PackCN-AP, and (YMC produces, catalog number (Cat.No.) AP-513; Diameter 6mm; Height of bed 250mm) on, the TFA that contains the 1-propyl alcohol as solvent orange 2 A and 0.05% with 0.1%TFA is as solvent B, and said post carries out balance with 15%B in advance.Behind the application of sample, the concentration of propyl alcohol is increased to 25%B by 15%B, and in 65 minutes, the concentration of B is increased to 50% by 25% linearity.After in the end an operation (the 5th) is finished, 1ml is contained that the solution of removing proteinic same component adds on the post and handle to obtain still to be present in the TPO activity in the post with same method.Owing to adopt identical polypropylene tube to store the elutriant of 6 operations, obtained the test tube that 44 every pipes contain the 7.2ml elutriant altogether.

The fraction of each above-mentioned acquisition is got 30 μ l (each fraction 1/240) mix with 20 μ l5%BSA, evaporation drying is dissolved in 0.24ml IMDM again and measures in the substratum and measure to determine to contain the active fraction of TPO.The result has found strong TPO activity in the fraction of pipe 28 to 33 (37.0 to 42.0% propyl alcohol scopes), the main TPO active fraction of the YMC-Pack CN-AP FA that these fractions are originated as low molecule TPO sample F 3 altogether.

The main TPO active fraction of the YMC-Pack CN-AP FA in low molecule TPO sample F 3 sources

Cumulative volume 43.20ml

Protein concn 0.00863mg/ml

Gross protein 0.373mg

Relative reactivity 800,000

Gross activity 298,400

(10) Capcell Pak C1 300＜whole reversed phase chromatography 〉

The low molecule TPO sample F of the 43.20ml that will in above-mentioned steps (9), obtain 3 sources contain 43.12ml (total protein, 0.372mg among the TPO active fraction FA; Protein concn, 0.00863mg/ml; Relative reactivity, 800,000; Gross activity, 297,500) mix and the concentrated 0.1ml of acquisition glycerine solution with 0.2ml 50% glycerine.

With this solution and 2ml solvent orange 2 A (0.1%TFA): the solution of solvent B (the 1-propyl alcohol that contains 0.05%TFA)=85: 15 (15%B) mixes with preparation 2.1ml and contains about 14% propyl alcohol, about 4.8% glycerine and the proteinic sample of 0.177mg/ml.This solution that makes is added in advance with 15%B equilibrated Capcell Pak C1 300A post (Shiseido Co., Ltd. production; Catalog number (Cat.No.) C1 TYPE:SG 300A; Diameter 4.6mm, height of bed 250mm) on, in 65 minutes, increase to of the flow velocity processing of the solution of 38%B from 27%B with 0.4ml/min with linear gradient.Collect in elutriant to 72 polypropylene tube so that 0.6ml is a.

3 μ l of each fraction of gained (each fraction 1/200) are mixed with 20 μ l 5%BSA, convert matrix to 225 μ l IMDM and measure nutrient solution, measure the fraction of having diluted 75 times.

Each fraction is got 1 μ l (fraction 1/600) is used for electrophoresis, with its evaporation drying and with the non-reduced sample buffer of 10 μ l in 95 ℃ of processing 5 minutes to carry out SDS-PAGE.Sample after will handling then uses 15-25%SDS-polyacrylamide precast gel (DaiichiPure Chemicals Co., Ltd production) SDS-PAGE, and with 2D-Silver StainII " DAICHI " (by Daiichi Pure Chemicals Co., Ltd., produce catalog number (Cat.No.) 167997; Hereinafter referred to as " silver dyeing medicine box ") the dyeing of silver dyeing medicine box.(by Daiichi Pure Chemicals Co., Ltd. produces with [DAIICHI]-III lower molecular weight marker; Catalog number (Cat.No.) 181061; Hereinafter referred to as " DPC III ") as the molecular weight marker thing.

The result of said determination has found significant TPO activity in the fraction of pipe 35 to 43 (30.0 to 32.5% propyl alcohol concentration ranges).The fraction of pipe 36 to 42 wherein (30.5 to 32.0% propyl alcohol concentration range) is altogether as main TPO active fraction FA.The results are shown in Fig. 2.

In the time will comparing with measurement result by the protein content that chromatogram is inferred, find that gained fraction gross protein is 39.6 μ g, protein concn is 9.4 μ g/ml, and relative reactivity is 4,890,000, and gross activity is 193,600.The detection of the SDS-PAGE pattern of managing 36 to 42 TPO active fraction has been shown be associated with the activity intensity existence of band of staining power.In addition, the apparent molecular weight of finding this non-reduced band is 17,000 to 19,000 with as-reduced standard molecular weight protein comparison on same gel the time, and this shows that this band is likely TPO.

(11) from running gel＜15%SDS-PAGE〉extraction TPO active protein

Contain the example that the active fraction FA of TPO analyzes

4,200 μ l lower molecular weight TPO sample F, 3 source TPO active fraction FA (gross protein, the 39.6 μ g that in above-mentioned steps (10), obtain; Protein concn, 9.4 μ g/ml; Relative reactivity, 4,890,000; Gross activity, 193,600) in, to be used for the 5.5 μ l that active protein extracts (fraction 1/764) and be used for silver-colored painted 2.5 μ l (fraction 1/1680) changing sample tube separately over to, evaporation drying, the non-reduced sample buffer that is used for SDS-PAGE with 10 μ l left standstill under the room temperature 18 hours then in 37 ℃ of reactions 1 hour, carried out the SDS reaction thus.

With dye in advance Low Range Marker (Bio-Rad Labooatories, Inc. produce, 161-0305) and aforementioned DPC III as the molecular weight marker thing.Utilize the microslab gel, according to normally used method (Laemmli, Nature, vol.227, pp.680-685,1970) in 4 ℃ of 15%SDS-PAGE that carry out these samples.After electrophoresis is finished, with cutter rapid cutting-out of silver-colored stained gel part carried out in preparation and insert in the stationary liquid, dye with aforesaid silver dyeing medicine box then.

In addition, the gel that will be used for all molecular weight ranges of detection of active is cut into 34 by knife, the wide 1.5-2.5mm of each gel electricity, with its Kobayashi method (Kobayashi, M., Seikagaku (Biochemistry) with improvement a little, vol.59, no.9,1987, published by theJapanese Biochemistay Sociery) pulverize.Being ground into each gel film of small shreds and 0.3ml extracts damping fluid (500mM NaCl 0.05%BSA) mixes, and shakes 6 hours to extract in 4 ℃ for 20mM Tris-HCl, pH8.

To wherein adding 500mM potassiumphosphate (pH 6.8) so that final concentration is 20mM.After shaking 1 hour under 4 ℃, the gained mixture is gone in the Ultra Free C3GV 0.22 μ m filtering device (Millipore Corp. produces, UFC3 OGV OS), 1,000 * g (4,000rpm) descend centrifugal 15 minutes to remove sedimentary SDS, regain the supernatant liquor of generation.Filtrate is gone in the Ultra Free C3-LGC ultra-filtration equipment (the demarcation molecular weight 10,000 that dams, MilliporeCorp. produces, UFC3 LGC 00), with 3,000 * g (7,000rpm) centrifugal.When the concentrated solution volume reaches about 50 μ l, add 20mM sodium phosphate buffer (pH7.2) 300 μ l, carry out ultrafiltration again.

Repeat the ultrafiltration of twice usefulness 300 μ l 20mM sodium phosphate buffer, to remove remaining SDS.After this, repeat similar step and detect the sample (300 μ l) that inoculum preparation is sterilized subsequently and is used for the TPO determination of activity to be exchanged into.

Clearly detect three protein bands by silver dyeing, said silver dyeing has shown that based on DPC III molecular weight marker thing apparent molecular weight is about protein of 17,000 to 19,000,14,000 to 11,000.

In abovementioned steps (10), observed in the electrophoresis of Capcell Pak C1 post TPO active fraction that to have activity intensity and apparent molecular weight relevant with stain density be about band of 17,000 to 19,000.In the experiment of this step (11), in about 17,000 to 19,000 the band of apparent molecular weight, found TPO activity (referring to Fig. 3).

Based on The above results, the verified TPO active protein in the active fraction in the Capcell Pak C1 300A post is purified to detectable level on running gel.Based on the silver-colored stain density of the band that is obtained by 15%SDS-PAGE, the measurement of possible TPO protein (apparent molecular weight about 17,000 to 19,000) is decided to be about 1.7 μ g in total TPO active fraction.

The purifying of polymer TPO sample F 2 obtains describing in following step (12) to (15).

(12) YMC-Pack PROTEIN-RP＜reversed phase chromatography 〉

With polymer TPO sample F 2 (gross protein, the 257mg that obtain in the above-mentioned steps (1); Protein concn, 0.894mg; Relative reactivity, 7,840; Gross activity, 2,015,000; Cumulative volume, 287ml) mixing to obtain cumulative volume with the solvent B (the 1-propyl alcohol that contains 0.025%TFA) of 95.8ml (1/3 volume of sample) is 383ml, propyl alcohol, TFA and protein final concentration are respectively about 25%, 0.006% and the solution of 0.671mg/ml.The solution of 0.025%TFA is used as solvent orange 2 A.The insoluble substance that forms in input specimen preparation process is separated it with centrifugal, the supernatant liquor that is produced is divided into 6 62.3ml (42.8mg protein) part and adds in advance with the 30%B balance, is covered with post (YMC production, the catalog number (Cat.No.) A-PRRP-33-03-15 of YMC-Pack PROTEIN-RP with the flow velocity of 2ml/min; Diameter 3cm; Height of bed 7.5cm) on.The throw out of centrifugal generation is dissolved in the 20mM sodium acetate (pH5.5) that 10ml contains 5mM CHAPS, also adds on the post.

After application of sample is finished, with the solvent (solvent orange 2 A: B=3: 1) cross post of about 50ml must be the post fraction.Next step begins a stepping elution process (be the solvent to 45%B that linear gradient changes with 30%B and carry out wash-out in 120 minutes), with every pipe 15ml elutriant is collected in 24 polypropylene tube.6 samples that separate are repeated this process with identical collection tube, thereby obtain to add up to the fraction test tube that 24 pipes, every pipe contain the 90ml elutriant.To cross the post fraction and manage 1 fraction altogether, directly be concentrated into 90ml with the ultra-filtration equipment that uses YM3 film (76mm diameter, Amicon Corp. produces).

To cross post fraction and pipe 1 fraction mixture and manage 2 and respectively get 0.3ml to the fraction of pipe 24 and mix with 10 μ l 5%BSA, evaporation drying be dissolved in the 0.3ml IMDM mensuration nutrient solution, measures then to find out to contain the active fraction of TPO.The result has found the TPO activity in the fraction of pipe 10 to 15 (34.0 to 39.5% propyl alcohol concentration ranges), the YMC-Pack PROTEIN-RP TPO active fraction F2 that these fractions are originated as polymer TPO sample F 2 altogether.This fraction is stored in-85 ℃ until the YMC-Pack CN-AP step that is used for subsequently.

The YMC-Pack PROTEIN-RP TPO active fraction F2 in polymer TPO sample F 2 sources

Cumulative volume 540ml

Protein concn 0.021mg/ml

Gross protein 11.4mg

Relative reactivity 227,000

Gross activity 2,588,000

(13) gel permeation chromatography under Seperdex 75pg＜CHAPS exists 〉

YMC-PackPROTEIN-RP TPO active fraction F2 (gross protein, 11.3mg with the polymer TPO sample F that obtains in the above-mentioned steps (12) 2 sources; Protein concn, 0.021mg/ml; Relative reactivity, 227,000; Gross activity, 2,565,000) 538.2ml mixes with 0.6ml 50% glycerine and evaporation concentration.To wherein adding 18ml 20mM CHAPS, stir then, subsequently in 4 ℃ of incubations 41 hours.After this, (Pharmacia Biotech produces, catalog number (Cat.No.) 17-1070-01 first sample to be added to the post that is covered with HiLoad26/60 Superdex 75pg; Diameter 2.6cm, height of bed 60cm) on, with containing the flow velocity wash-out of the DPBS of 5mM CHAPS with 1ml/min.Each sample is got 4ml (protein concn 0.466mg/ml; Protein 1.86mg) adds on the post.

In this example, by whole YMC-Pack PROTEIN-RP TPO active fraction or 6 parts are repeated Superdex 75 column operation processes 6 times.The elutriant of each operation is collected in 45 test tubes with every part of 5ml, thereby has finally obtained every part of 45 parts of fractions that contain the 30ml elutriant after having finished 6 column operations.

The 0.1ml that gets in every part of fraction of gained mixes with 5% BSA 10 μ l, and evaporation drying is dissolved in 0.25ml IMDM and measures in the nutrient solution, measures then to find out to contain the active fraction of TPO.The result has found the TPO activity in the fraction (molecular weight ranges from 78,000 to 3,000) of pipe 13 to 31, the Superdex 75pg TPO active fraction F2 that the fraction of pipe 13 to 31 is originated as polymer TPO sample F 2 altogether.

The Superdex 75pg TPO active fraction F2 in polymer TPO sample F 2 sources

Cumulative volume 540ml

Protein concn 0.00216mg/ml

Gross protein 1.17mg

Relative reactivity 1,750,000

Gross activity 2,041,000

(14) YMC-Pack CN-AP＜reversed phase chromatography 〉

513.2ml (gross protein, 1.11mg among the Superdex 75pg TPO active fraction F2 (molecular weight, 78,000-3,000) in 540ml polymer TPO sample F 2 sources that will in above-mentioned steps (13), obtain; Protein concn, 0.00216mg/ml; Relative reactivity, 1,750,000; Gross activity, 1,943,000) mixes with the solvent B (the 1-propyl alcohol that contains 0.05%TFA) of 1/10 volume, and it is added in advance with solvent orange 2 A (0.1%TFA) and solvent B with the flow velocity of 0.6ml/min and to be covered with the post of YMC-Pack CN-AP with the 15%B equilibrated (YMC produces, catalog number (Cat.No.) AP-513, diameter 6mm, height of bed 250mm) on.After this process was finished, propyl alcohol concentration increased to 25%B by 15%B, and increased to 50%B by the 25%B linear gradient in 65 minutes.

Before beginning YMC-Pack CN-AP column chromatography, be used for test operation to confirm active suitable recovery with 1/20 of total application of sample sample.After this, be divided into 2 duplicate samples to carry out twice operation with remaining 19/20.In other words, column operation repeats three times.Owing to store the elutriants of operating for three times, so obtained the test tube that 44 every pipes contain the 3.6ml elutriant with same 44 polypropylene tube.

Each fraction of gained is got 5 μ l (each fraction 1/720) measure nutrient solution with 0.25ml IMDM and mix, measure then to find out the TPO active fraction.The result has found very strong TPO activity in the fraction of pipe 24 to 30 (the propyl alcohol concentration range is 36.0 to 42.0%), the main TPO active fraction of the YMC-Pack CN-AP FA that these fractions are originated as polymer TPO sample F 2 altogether.

The YMC-Pack CN-AP TPO active fraction FA in polymer TPO sample F 2 sources

Cumulative volume 25.20ml

Protein concn 0.0246mg/ml

Gross protein 0.620mg

Relative reactivity 700,000

Gross activity 434,000

(15) Capcell Pak C1 300A＜final reversed phase chromatography 〉

24.66ml (gross protein, 0.606mg among the YMC-Pack CN-AP TPO active fraction FA in 25.20ml polymer TPO sample F 2 sources that will in above-mentioned steps (14), obtain; Protein concn, 0.0246mg/ml; Relative reactivity, 700,000; Gross activity, 424,000) mix evaporation concentration with 0.4ml 50% glycerine.

In this way, obtain to contain propyl alcohol, 10% glycerine and the 2ml concentrating sample of 0.303mg/ml protein concn of percent n concentration.With solvent orange 2 A (0.1%TFA) and solvent B (containing 0.05%TFA) it is added to post (Shiseido Co., Ltd. production, the catalog number (Cat.No.) C1 TYPE:SG 300A that is covered with Capcell Pak C1 300A in advance with the 15%B equilibrated; Diameter 4.6mm; Height of bed 250mm) on, carries out this process, in this process, increase to 38% by 27%B 65 minutes internal linear gradients with flow velocity 0.4ml/min.With every pipe 0.6ml elutriant is collected in 72 polypropylene test tubes.

Every pipe gained fraction is got 0.75 μ l (each fraction 1/800) mix with 20 μ l 5%BSA, matrix converts 225 μ l IMDM to and measures nutrient solution, measures the fraction of having diluted 300 times then.

Each fraction 2 μ l (fraction 1/300) that take a sample are used for electrophoresis, evaporation drying and with 10 μ l irreducibility sample buffers in 95 ℃ of processing 5 minutes to carry out SDS-PAGE.The sample that to handle is used to use the SDS-PAGE of 15-25%, SDS-polyacrylamide precast gel (Daiichi Pure Chemicals Co., Ltd. produces) then, dyes with previously described silver dyeing medicine box.With aforesaid DPC III as the molecular weight marker thing.

The result of said determination has found significant TPO activity in the fraction of pipe 33 to 39 (the propyl alcohol concentration range is 29.5 to 31.5%).In these fractions, the fraction that will manage 34 to 39 (propyl alcohol concentration ranges 30.0 to 31.5%) is altogether as main TPO active fraction FA.The inspection of main TPO active fraction SDS-PAGE pattern has been shown under non-reduced condition apparent molecular weight ranges 17,000 to 19, between 000, a colour band being associated with activity intensity of its stain density, this is similar to the situation of TPO active fraction in low molecule TPO sample F 3 sources in the described step of preamble (10).

＜embodiment 2 〉

Analyze the aminoacid sequence of purification of rat TPO part

According to Iwamatsu (Iwamatsu et al., " Shin Kiso Seikagaku Jikken-ho (New Basic Biochemical Experiments) ", vol4, pp.33-84, pub.Maruzeu; Iwamatsu, A., Seikagaku (Biochemistry), vol.63, no.2, pp.139-143,1991; Iwamatsu, A., Electrophoresis, vol.13, pp.142-147,1992) method is to carrying out amino acid sequence analysis by rat TPO candidate albumen matter that obtain, that be present among the Capcell PakC1 300A post TPO active fraction FA in embodiment 1 purification step (10).Be about to sample and carry out SDS-PAGE and electrotransfer to poly(vinylidene fluoride) (PVDF) film.This protein on the pvdf membrane reduction and the S-alkylation after, the protein of above-mentioned processing is carried out completely and in steps original position limited enzymatic hydrolysis with three kinds of proteolytic enzyme, make it digestion or peptide fragment, separate the peptide Duan Bingyong reversed phase chromatography that is produced in each digestion step and carry out purifying, analyze its aminoacid sequence with high sensitive determined amino acid sequence method.Hereinafter describe this process in detail.

The example that TPO candidate albumen matter among the Capcell Pak C1 300A TPO fraction FA in low molecule TPO sample F 3 sources is analyzed

(1) concentrates Capcell Pak C1 300A post TPO fraction FA (pipe number 36 to 42)

The low molecule TPO sample F 3 deutero-Capcell Pak C1 300A post TPO active fraction FA that 4,200 μ l are obtained in the purification step (10) of embodiment 1 (pipe number 36 to 42) (gross protein, 39.6 μ g; Protein concn, 9.4 μ g/ml; Relative reactivity, 4,890,000; Gross activity, 193,600) 4,151 μ l in (total fraction 98.8%) are used for amino acid sequence analysis.The gross protein of being inferred by chromatogram is 39.1 μ g, and wherein about 1.6 μ g are the TPO candidate albumen matter of being dyed by silver after SDS-PAGE, and apparent molecular weight is about 17,000 to 19,000.

This sample is mixed with glycerine, concentrate to obtain 5 μ l glycerine solutions with method of evaporation.To wherein adding the non-reduced damping fluid be used for SDS-PAGE and 1M Tris-HCl (pH8) adjusting its pH, thereby obtain the sample that contains 200mM Tris-HCl (pH 8.0), 50mM Tris-HCl (pH 6.8), 1.1%SDS, 2mM EDTA, 0.02% tetrabromophenol sulfonphthalein and 30% glycerine of about 25 μ l.

The gained sample was at room temperature kept 14 hours, handled 5 minutes to produce effectively suitable SDS reaction under no superheated situation in 60 ℃ then.

(2) electrophoresis

Preparation Micro-Slab gel (4.0% acrylamide spacer gel and 15% acrylamide separating gel) is that the steady current of 17.5mA carried out SDS-PAGE 2 hours with 12.5mA earlier under room temperature then.With the Low Range Marker that dyes in advance (Bio-Rad, 161-0305) and DOCIII as the molecular weight marker thing.After finishing, electrophoresis immediately the protein molecule that obtains is transferred to (referring to following step) on the pvdf membrane.

The part of sample is being used for another use 15-25% polyacrylamide precast gel (Multi Gel 15/25 under the non-reduced condition or make sample reduction with dithiothreitol (DTT) (DTT) after, Daiichi Pure Chemicals Co.Ltd produces, catalog number (Cat.No.) 211072) electrophoresis.After the gained gel is dyeed with previously described silver dyeing medicine box, confirmed that the molecular weight of the desired TPO of becoming protein band is about 19,000 under reductive condition, and the TPO candidate albumen matter purity of Capcell Pak C1 300A post is percentum.In addition, because the movability of this band is different under non-reduced and reductive condition, so point out this candidate albumen matter to contain at least one disulfide linkage.

(3) by protein and test strip on the electroblotting method transfer pvdf membrane

Application partial desiccation transfer device (Model KS-8460, Marysol produces) carries out protein transduction and moved 1 hour on pvdf membrane (ProBlott, Applied Biosystems produces, catalog number (Cat.No.) 400994) under the steady current of 160mA (11 to 17V).Use the solution of forming by 0.3M Tris and 20% methyl alcohol (pH 10.4) as positive electrolytic solution, the solution of being made up of 25mM Tris and 20% methyl alcohol (pH10.4) is as transfer film solution, and the solution of being made up of 25mM Tris, 40mM hexosamine and 20% methyl alcohol (pH 10.4) is as catholyte.

When with the film after the transfer of Ponceau S dyeing solution (containing 0.1g Ponceau S and 1ml acetate in the 100ml water) dyeing gained, detect a plurality of bands, confirm that one of them is the band of the candidate albumen matter of molecular weight about 19,000.The peptide section that this band is downcut to be used for carrying out subsequently generates step.

The enzyme spectrum analysis and the amino acid sequence analysis of (4) peptide fragment generation, peptide

For to after reduction on the pvdf membrane, having carried out shifting and the alkylating TPO candidate albumen of S-matter is carried out fragmentation completely, used three kinds of following proteolytic enzyme Restriction Enzyme hydrolysis of being done step by step.

Digestion for the first time: lysyl endopeptidase (Ltd. produces, catalog number (Cat.No.) 129-02541 for Achromobacter lyticus m497-1, Wako PureChemical Industries).

Digestion for the second time: endoproteinase Asp-N (Boehringer-Mannheim Corp. produces, catalog number (Cat.No.) 1054589)

Digest for the third time: trypsinase-TPCK (Worthington Biochemical produces, catalog number (Cat.No.) 3740)

Reclaim the peptide fragment that each enzymic digestion obtains, add to Wakosil-II 5C18 C18 reversed-phase column (Wako Pure Chemical Industries, Ltd. produce, diameter 2.0mm, length 150mm) on, and with the flow velocity of 0.25ml/min and 30 ℃ column temperature, (Virahol: acetonitrile=7: 3 0.02%TFA) made B increase to 50%B by 1% linear gradient in 30 minutes and carries out wash-out to use solvent orange 2 A (0.05%TFA) and solvent B.In this way, make the enzyme spectrum analysis (see figure 4) of peptide.Reclaim gained peptide Duan Bingyong one gas phase Protein Sequencer (PPSQ-2, Shimadzu Corp. produces) and carry out the Edman degraded.After this, each amino acid that reclaims successively from sequenator is used by the C18 reversed phase column chromatography of isocratic elution and is identified that its N-terminal of said amino acid is joined by the PTH coupling.The results are summarized in hereinafter.

Carry out the aminoacid sequence of the peptide fragment of digestion acquisition for the first time by the lysyl endopeptidase

The fragment aminoacid sequence

AP3 (K) XYYESZ (X is A, S, G, M or Q, and Z is E or K)

(SEQ?ID?NO：184)

AP6 (K) XRAAZ (X is E or Q, and Z is E or N) (SEQ ID NO:185)

AP7 (K) AGXCSG (can not all be identified) (SEQ ID NO:186)

AP8 (K) XPVPPACDPRLL (X is I, T or S) (SEQ ID NO:187)

AP12 (K)DSFLADVK(SEQ?ID?NO：188)

AP5 (can not be identified)

AP20 (can not be identified)

AP21 (can not be identified)

AP23 (can not be identified)

Carry out the amino acid analysis of the peptide fragment of digestion acquisition for the second time by endoproteinase Asp-N

The fragment aminoacid sequence

ASP2 (can not be identified)

ASP2 (can not be identified)

ASP6 (can not be identified)

ASP11 (can not be identified)

Digest the amino acid analysis of the peptide section of acquisition for the third time by trypsinase-TPCK

The fragment aminoacid sequence

TP2 (K or R) TLPTXAVP (SEQ ID NO:189)

TP3 (K or R) TLPTXAVP

In above-mentioned sequence, what show in the N-terminal bracket is to infer the amino-acid residue that from enzymic digestion completely.

(5) the amino acid whose homology analysis＜homology search of gained 〉

Be contained in the protein that a known report crosses or whether have a protein to have similar sequence in order to understand gained aminoacid sequence whether, (KodakIntemational Biotechnologies Inc.) analyzes it with sequence analysis software Mac Vector.Just about the message context of known protein matter or known, used Entrez Release 6 databases (NationalCenfer for Biotechnology Information, National Library of Medicine, Natioual Institute of Health, USA, published on August 15,1993).Database comprises following content:

Entrez Release 6 databases

NCBI-GenBank，August?15，1993(Release?78.0)

EMBL，July?15，1993(Release?35.0?plus?updates)

DDBJ，July，1993

SWISS-PROT，April，1993(Release?25.0)

PIR，June?30，1993(Release?37.0)

PDB，April，1993

PRF，May，1993

dbEST，July?15，1993(Release，1.10)

U.S.and?European?patents

The result is sequence (K) DSFLADVK of AP12 and the interior sequence KDSFLDVK[PIR database registration number A40066 of rat corticosteroid-binding globulin (CBG) precursor; Smithand Hammond; " Rat corticosteroid-binding globulin:primary structure andmessenger ribonucleic acid levels in the liver under different physiologicalconditions. ", Mol.Endocrinol., (1989), 3,420-426] fit like a glove just.

The KQYYESE sequence (SEQ ID NO:193) that (K) XYYESZ (X is A, S, G, M or Q, and Z is E or K) sequence of further inspection demonstration and AP3 has high similarity is included in the rat CBG aminoacid sequence.In rat CBG, interconnection corresponding to the sequence of AP12 and AP3, thus formed internal amino acid sequence KDSFLADVKQYYESE (SEQ ID NO:190).

As for other segmental aminoacid sequence except that AP12 and AP3, do not find protein or gene that its similarity should take in.

＜embodiment 3 〉

Analysis is by the biological nature of thrombocytopenia rat plasma deutero-TPO

(1) measures in the system (liquid culture system) at rat CFU-MK

As typical example, Fig. 5 shown use from the partially purified TPO sample of thrombocytopenia rat plasma (by the purification step (8) of embodiment 1-2, describe, from the TPO active fraction F2 of YMCPack Protein-RP post) dose response curve.When microscopically is periodically observed cultured cells, identify Megakaryocytic generation with ripe, the increase of cell size just, this may carry out with the increase of megalokaryocyte number.Significant especially the variation is the formation of having found the megalokaryocyte projection the last day (almost can not identify the formation of Megakaryocytic projection in the time of the 3rd day) of just cultivating at the 4th day.Such projection forms and is called endochylema projection formation (Leven and Yee, Blood, vol.69, pp.1046-1052,1987) or the formation of thromboblast projection (Topp et al., Blood, vol.76, pp.912-924,1990), the latter is considered to the platelet precursors structure of further being broken up by ripe megalokaryocyte and is considered to be in the terminal stage of external present observable megalokaryocyte differentiation.Owing to observe so morphologic variation with the TPO sample with high frequency separately, possible this factor can stimulate CFU-MK propagation and differentiation alone, produces ripe megalokaryocyte and the final thrombocyte that discharges.

(2) in colony mensuration system

When adopting colony mensuration system to detect by the partially purified TPO sample of thrombocytopenia rat plasma, the TPO in rat plasma source has stimulated the formation of megakaryocyte colony, said colony the has been measured system applies cell or the Gp II b/III a of unsegregated rat bone marrow cell, each isolation/concentration step ⁺The CFU-MK fraction.Compare with the megakaryocyte colony that causes by other cytokine such as rat IL-3, mouse GM-SF or people EPO, to be each colony be made up of the megalokaryocyte of peanut more the feature of the megakaryocyte colony that TPO causes, but each megalokaryocyte volume is bigger, this means ripen in advance.In addition, because TPO does not produce or only produce seldom other clone colony, the Meg-CSF of TPO is active thereby can be considered to megalokaryocyte specific.Based on these facts, clearly TPO has the biological characteristics that is different from other cytokine such as rat IL-3, mouse GM-CSF and people EPO, and unique Meg-CSF activity is arranged.

Partially purified TPO sample is also to CD34 in the blood plasma by the thrombocytopenia rat ⁺, derive from the DR of human bone marrow cell or people's strand hemocyte ⁺The cell fraction shows that its Meg-CSF is active and significantly increased the number of people's megakaryocyte colony, shows that this factor do not have species specificity.

＜embodiment 4 〉

Rat produces cell specific of TPO

(1) rat produces the screening of the organ of TPO

In order to guarantee to be used for the mRNA source of rat TPO gene clone, carried out screening that rat TPO produces organ and specific.At first, regularly, cultivate its cell (lung and liver are the section of organ), detect the culture supernatants that is produced with rat CFU-MK mensuration system from suffering from thrombocytopenic rat and obtain marrow, lung, liver and spleen by using P55 antibody.Yet this initial trial does not obtain obvious result.Carried out further trial afterwards, cultivate with collagenase perfusion by the prepared liver cell of liver of using the thrombopenia rat that P55 antibody causes, this is because consider between liver that one piece of report points out rat and the TPO generation certain relation (Siemensma et al. to be arranged, J.Lab.Clin.Med., vol.86, pp.817-833,1975).The gained culture supernatants is added on the WGA-Agarose post, the fraction that fractionation has been adsorbed on Vydac phenyl reversed-phase column then, the TPO in rat plasma source has found closely similar activity in active identical position in rat CFU-MK mensuration system.In normal rat liver cell culture thing supernatant liquor, also found more weak but identical activity.These results show that forcefully liver is one of organ that produces TPO.

(2) the screening rat produces the clone of TPO

Based on The above results, carried out the screening that rat produces the clone of TPO.At first, each clone in the clone in 20 kinds of rat livers source cultivated in succeeding transfer culture liquid matrix separately reach almost converging state, change substratum, continue cultivation 3 days with the identical matrix of nutrient solution separately of having replenished 5%FCS until cell.When having the generation of TPO with mensuration according to top step (1) institute each gained culture supernatants of described method partial purification, found significant TPO activity in the clone in three rat liver parenchyma sources, these three kinds of clones are called McA-RH8994 cell (ATCC preserving number CRL 1602; Becker et al., " Oncodevelopmental Gene Expression " ed.by Fishman and Sell, Academic Press, NY.pp.259-270,1976; Available from Dainippon PharmaceuticalCo., Ltd.), H4-II-E cell (ATCC preserving number CRL 1548; Pitot et al., Nat.Cancer Inst.Monogr., vol.13, pp 229-245,1964; Available from DainipponPharmaceutical Co., Ltd.) with HTC cell (Thompson et al., Proc Natl.Acad.Sci.USA, vol.56, pp.296-303,1966; Available from Dainippon PharmaceuticalCo., Ltd.).

(3) the TPO activity in analyzing in detail McA-RH8994 cell, H4-II-E cell and the HTC cell

To detect by biochemistry and the biological characteristics that these three kinds of rat cells are excretory TPO activated protein, and compare with the TPO in rat plasma source.

With the McA-RH8994 cell suspension in containing α-MEM (-) liquid nutrient medium of 10%FCS and move into 175cm ²The plastics tissue culture flasks in, every bottle contains 1 * 10 ⁶Individual cell.At 5%CO ₂After 3 days, change substratum into contain 5%FCS IMDM substratum in 37 ℃ of cultivations in the incubator, and continue to cultivate 3 days, reclaim the culture supernatants of gained.The H4-II-E cell suspension is being contained in the Dulbecco ' s improvement Eagle liquid nutrient medium (glucose 4.5g/l, hereinafter referred to as " DMEM ") of 10%FCS and moving into 175cm ²The plastics tissue culture flasks in, every bottle contains 5 * 10 ⁵Individual cell.At 5%CO ₂After 3 days, change substratum into contain 5%FCS IMDM substratum in 37 ℃ of cultivations in the incubator, continue to cultivate 3 days, reclaim the gained culture supernatants.Equally, with the HTC cell suspension in containing the DMEM liquid nutrient medium of 5%FCS and move into 175cm ²The plastics tissue culture flasks in, every bottle contains 2.5 * 10 ⁵Individual cell.At 5%CO ₂, after 3 days substratum is changed into the IMDM substratum that contains 5%FCS and continues cultivation 3 days in 37 ℃ of cultivations in the incubator.Reclaim the gained culture supernatants.

Use respectively and go up clear liquid from 2 of these three clones cultivation gained, the TPO that each clone is originated according to the method by XRP purifying TPO described in the embodiment 1-2 carries out partial purification.Its result's roughly situation has hereinafter been described.

At first, make each culture supernatants concentrate about 6 times with ultra-filtration equipment and also change substratum into 20mM Tris-HCl damping fluid (pH 8.0) with the SephadexG-25 post.The gained elutriant adds on the Q-Sepharose FF post, this post is washed with 20mM Tris-HCl (pH8.0), then the fraction of absorption 20mM Tris-Hcl (pH8.0) wash-out that contains 175mM NaCl.The fraction of gained wash-out adds on the WGA-agarose column, and this post is washed with PBS, adsorbed fraction 20mM sodium phosphate (pH 7.2) wash-out that contains 0.2M GlcNAc and 0.15M NaCl.The gained elutriant adds on the TSK-gel AF-BLUE 650MH post, this post is washed adsorbed fraction 2M NaSCN wash-out with the 20mM sodium phosphate (pH 7.2) that contains 1M NaCl.The gained elutriant adds on the Phenyl-Sepharose 6FF/LS post, this post is washed with the 50mM sodium phosphate (pH 7.2) that contains 1.5M ammonium sulfate earlier, again with the 0.8M ammonium sulfate flushing that contains the 36mM sodium phosphate, adsorbed then fraction 20mM sodium phosphate (pH 7.2) wash-out.Gained adsorbed that fraction concentrates and with anti-phase Vydac Protein C4 post (The Separations Group production, catalog number (Cat.No.) 214TP51015; Diameter 1cm; Height of bed 15cm) carries out fractionation.Be about to sample and add to and use in advance on the 20%B equilibrated C4 post, the 1-propyl alcohol with launching to contain among the 0.1%TFA and expansion solvent B in the solvent orange 2 A 0.05%TFA increased to 40%B by the 20%B linear gradient in 90 minutes, carried out effective wash-out with the flow velocity of 1ml/min.Wash-out went out every kind of TPO active protein that derives from these clones when the result was 30-43% in 1-propyl alcohol concentration.

When detecting in each purification step sample TPO with rat CFU-MK mensuration system when active, the result shows that the active TPO that originates with XRP of the TPO of these three kinds of clones has similar pattern (referring to embodiment 1-2).Table 2 has shown the relative reactivity in each purification step that detects with rat CFU-MK mensuration system, activity yied or the like.In addition, when the TPO that detects the elutriant derive from final reversed-phase column with rat CFU-MK system is active, at same peak area discover the TPO that TPO is active and XRP originates of said three clones.When using rat Gp II b/III a ⁺When the colony that CFU-MK separates and the spissated non-adherent cell that goes to obtain in the adhering step carries out reversed-phase column TPO active fraction is measured, active wash-out pattern of Meg-CSF and the active wash-out pattern of TPO closely similar (referring to table 3) with the detection of rat CFU-MK mensuration system.In addition, similar to the TPO situation in XRP source, the TPO activity of each clone in three clone does not form or seldom forms the colony of other clone.

According to the method for describing among the embodiment 1-2, the active fraction that will come from every kind of storage of reversed-phase column adds on the SDS-PAGE post.When detecting the TPO activity when extraction protein from the gel that is produced and with rat CFU-MK mensuration system, the apparent molecular weight of the TPO in the TPO in discovery XRP source, the TPO that the McA-RH8994 cell is originated and H4-II-E cell source is respectively 17,000 to 22,000,33,000 to 39,000 and 31,000 to 38,000, and it is 17,000 to 22,000 and 28 that the TPO in HTC cell source shows apparent molecular weight, 000 to 35,000.

Therefore, these results have shown the TPO protein that is produced by McA-RH8994 cell, H4-II-E cell and HTC cell at the TPO that is being equal to the XRP source aspect its biological characteristics, although its biochemical characteristic is slightly different between mutually on the apparent molecular weight.Significantly find it is that the TPO activated protein molecule that contains in the blood may be this possibility of product that thereon special or unconventional site part digests in the cell of its generation or after its secretion for one of the present invention.It is also pointed out and may have the TPO gene (mRNA and cDNA) with different lengths.

Table 2 rat cell is the purifying of TPO

Clone McA-RH8994 HTC H4-II-E

Step TP ^*1 RA ^{* 2}TA ^{* 3}TP RA TA TP RA TA

(mg) (mg) (mg)

Culture supernatants 4,806 8 38,450 5,760 5 28,800 4,087 5 20440

Sephadex?G25 4824 16 77180 6458 12 77500 4011 5 20050

Q-Sepharose?FF 1973 20 39460 3112 15 46680 1821 15 27320

WGA-Agarose 76.0 1350 102600 132.0 250 33000 80.0 90 7200

TSK-gel AF-Blue 5.0 12,500 62,500 9.2 7,500 69,000 5.4 150 810

650MH

Phenyl-Sepharose 14.7 500 7350 13.1 2500 32750 11.4 170 1940

6FF/LS

Vydac?Protein?C4 0.23 - - 0.75 - - 0.11 - -

^*1, gross protein; ^{* 2}, relative reactivity; ^{* 3}, gross activity

Table 3 is by rat TPO (anti-phase C4 post fraction)

The rat megakaryocyte colony that stimulates forms

Wash-out propyl alcohol XRP colony McA-RH8994 colony HTC colony H4-II-E colony

30.0-32.6％ 0 33 4 18

32.6-34.7％ 0 132 19 50

34.7-36.7％ 67 290 291 230

36.7-38.8％ 70 214 183 103

38.8-40.9％ 2 15 5 28

40.9-43.0％ 0 4 0 4

＜embodiment 5 〉

Structure is used for the expression vector (pEF18S) in cDNA library

The carrier that the construction cDNA fragment can be easy to be integrated into, and this carrier can set up the cDNA high expression level efficient of having cloned, with clone and the expression that is used for TPO cDNA.Promptly by substituting SR α promotor from expression vector pEF18S construction of expression vector pEF18S (referring to Fig. 6) with elongation factor 1 α (EF1 α) promotor that is known as a high expression level promotor.The promotor of elongation factor 1 α obtains by the following method, promptly partly digest expression vector pEF-BOS (the Mizushima et al. of 1 μ g with Restriction Enzyme HindIII and EcoRI, Nucleic Acids Res., vol.18, p.5322,1990), digest is used to carry out 2% sepharose (FMC BioProducts production) electrophoresis to isolate about 1, the dna fragmentation of 200bp, and with Prep-A-Gene DNA purification kit (Bio-Rad Laboratories, Inc. produces; Be one to be used for the test kit of selectivity purify DNA, it is based on Willis et al. at Bio Techniques, vol.9, pp.92-99, the method development of being reported in 1990, it is by cellular silica furtherance matrix DNA absorption carrying out effectively selectivity purify DNA) this dna fragmentation of purifying.Gained dna fragmentation part 100ng is connected (Liuet al., Proc.Natl.Acad.Sci.USA, vol.90, pp.8957-8961,1993) with the expression vector pME18S of the 50ng that has digested with HindIII and EcoRI in advance.With commercially available host's strain---and high competence (Competent High) E.coli DH5 cell (Toyobo Co., Ltd. produces; A kind of by Hanahan et al., J.Mol.Biol., vol.166, pp.557-558, the competence E.coli strain of 1983 modification method preparation) carrier that made up with gained transforms.Cultivate after the transformant 12 colonies of picked at random and plasmid DNA purification from each colony.Obtained to add up to the clone of desired plasmid 10 contain (pEF18S) with the Restriction Enzyme digestion pattern of analyzing these DNA branches.After this, a selected clone is cultivated to prepare a large amount of plasmid DNA.

Basically carry out the purifying of plasmid DNA according to the method for describing among the Molecular Cloning (Sambrook et al., Cold Spring HarborLabordorg Press, 1989).Being about to institute obtains and clones pEF18S in 37 ℃ of LB substratum (1%Becto-tryptones that contain 50 μ g/ml penbritins at 50ml, the 0.5%Becto-yeast extract, overnight incubation 0.5%NaCl), the gained cell suspension that centrifugal back is collected is at 4ml TEG-lysozyme soln (25mM Tris-HCl, pH8,10mM EDTA, 50mM glucose, 0.5% N,O-Diacetylmuramidase) in.Add 8ml 0.2N NaOH/1%SDS solution to wherein first, and then add in 6ml 3M potassium/5M acetate solution with thorough suspension cell.With suspension centrifugal after, handle the gained supernatant liquor with the phenol/chloroform (1: 1) that is mixed with same volume Virahol, centrifugal then.Gained is precipitated that little group is dissolved in the TE solution (10mM Tris-HCl, pH 7.5,1mM EDTA) and handle, use phenol/chloroform (1: 1) to handle then, use ethanol sedimentation again with RNase.Gained is precipitated little group be dissolved in again in the TE solution, add NaCl and polyoxyethylene glycol 3,000 to both final concentrations subsequently and be respectively 0.63M and 7.5%.After centrifugal, will precipitate little group and be dissolved in the TE solution and use ethanol sedimentation.In this way obtained the said plasmid DNA of about 300 μ g.Will be wherein 100 μ g with EcoRI and NotI complete digestion and carry out 0.8% sepharose (FMC BioProducts production) electrophoresis, with the carrier segments that reclaims Prep-A-Gene DNA purification kit (Bio-Rad Laboratocies, Inc. produce) purifying, with the 55 μ g plasmid DNA that obtain in cDNA library construction subsequently, to use.

＜embodiment 6 〉

The mRNA purifying of McA-RH8994 cell

The McA-RH8994 cell that shows relative greater activity during the colony that is chosen at embodiment 4 is measured is as the material that is used for rat TPO cDNA clone and carry out following experiment.

Basically carry out the separation of whole RNA according to the method for describing among the Molecular Cloning (Sambrook et al., ColdSpring HarborLaboratory Press, 1989).Promptly the McA-RH8994 cell grows to fusion in the culture dish that 15 diameters are 90mm.After removing fluid matrix, cell in each ware thoroughly is suspended in 0.8ml 5M guanidine solution (5M guanidine thiocyanate, 5mM Trisodium Citrate (pH 7.0), 0.1M beta-mercaptoethanol, 0.5% sodium sarcosyl sulfate (Sodium sarcosylsulfate)) in, gained suspension in all culture dish is collected in the test tube, cumulative volume is adjusted to 20ml with guanidine solution.Will be owing to the cytoclasis viscid gained mixture that becomes repeats about 20 piping and druming till this mixture becomes hardly viscous with the 20ml syringe that 18G syringe needle (afterwards changing the 21G syringe needle into) is housed.With 18ml 5.7MCsCl-0.1M EDTA (pH 7.5) as a buffer layer that is used for the polyallomer centrifuge tube of Beckman SW 28 rotors, the mode that aforesaid about 20ml mixture is not destroyed with each layer places on the buffer layer gently, and this test tube is almost filled.Prepared then test tube 20 ℃ with 25, centrifugal 20 hours of 000rpm.The little group of the precipitation that is produced is dissolved in the TE solution with behind twice of a small amount of 80% alcohol flushing, uses phenol/chloroform (1: 1) to extract then, carries out ethanol sedimentation with 3M sodium acetate and 2.5 times of volume of ethanol of 1/10 volume again.In this way from about 10 ⁸Obtained the total RNA of about 2.5mg in the individual cell.

Use Oligotex ^TM-dT30 (Super) is purifying poly (A) from total RNA ⁺RNA (used Oligotex ^TM-dT30 (Super) is produced by Japan Synthetic Rubber/Nippon Roche; By covalent attachment few dT molecule is fixed on the latex particle, and poly (A) ⁺The purifying of RNA can be by carrying out with using the few dT post similar methods that generally is used for this purpose.The result has obtained 20 μ g poly (A) from the total RNA of about 500 μ g ⁺RNA.

＜embodiment 7 〉

The structure in rat cdna library

(Pharmacia produces with Time Saver TM cDNA synthetic agent box; For based on Okayama and Berg, Mol.Cell.Biol., vol.2, pp.161-170, the cDNA test kit of 1982 modification method) and DIRECTIONAL CLONING TOOLBOX, the 5 μ g poly (A) that from embodiment 6, obtain ⁺Having synthesized among the RNA has the EcoRI recognition site and at its 3 ' end the double-stranded cDNA of NotI recognition site is arranged that (used DIRECTIONALCLONING TOOLBOX is produced by Pharmacia at its 5 ' end; It is one group by the primer 5 ' that contains an a NotI recognition sequence-AACTGGAAGAATTCGCGGCCGCAGGAA (T) who is used for synthetic cDNA ₁₈-3 ' (SEQ ID NO:15) and the linker 5 '-AATTCGGCACGAG-3 ' (SEQ ID NO:16) that is used to add an EcoRI recognition sequence and 5 '-CTCGTGCCG-3 ' (SEQ ID NO:17) form).With the synthetic cDNA of institute with is connected with 1.2 μ g expression vector pEF18S (referring to embodiment 5) of EcoRI and NotI digestion in advance, and be transformed among the previously described high competence E.coliDH5 of 8.4ml (Toyobo Co., Ltd. production).The result has obtained 5.3 * 10 ⁵Transformant.

＜embodiment 8 〉

With PCR preparation (clone) rat TPO cDNA fragment

With 530 of structure among the embodiment 7,000 clone's McA-RH8994 cDNA library is overnight incubation in the 50ml LB matrix that contains 50 μ g/ml penbritins, and with QIAGEN-tip 100 (DIAGEN produces, be used for the anionresin silicon post of DNA purifying) from cell purifying McA-RH8994 cDNA library plasmid by centrifugal collection.Obtain the plasmid DNA of about 200 μ g.

Synthetic 2 antisense nucleotide primer AP8-1R and AP8-2R and corresponding to the peptide fragment AP8 aminoacid sequence of describing among the embodiment 2 corresponding to the plasmid vector pEF-18S (referring to Fig. 6) that is used to prepare the cDNA library.2 of first intron of people's elongation factor 1 α have adopted nucleotide primer EF1 α-1 and EF1 α-2.(Applied Biosystems produces by utilizing 394 DNA/RNA Synthesizer; Be a synthesizer based on β-cyanoethylamdite method) carry out the synthetic of these primers effectively, and be used for OPC post (the Applied Biosystems production of synthetic DNA purifying; Be one to be used for the reverse phase silica gel post that purifying contains the synthetic DNA of trityl group) effectively it has been carried out purifying.Each dna molecular so synthetic and purifying is dissolved in the TE solution to final concentration is 50 μ M and stores in-20 ℃ until application.Synthesize the synthetic oligonucleotide in following process, used and purifying in addition in kind.

Primer AP8-1R and AP8-2R are the mix primer that contains 17 continuous nucleotides as (Proc.Natl.Acad.Sci.USA, vol.82, pp.1931-1935,1985) of Takahashi et al report, have mixed Hypoxanthine deoxyriboside in the said Nucleotide.

Based on Uetsuki et al. (J.Biol.Chem., vol.264, pp.5791-5798,1989) the 1491st to 1512 of the genome sequence of report and 1513 s' to 1532 nucleotide sequence synthesizes primer EF1 α-1 and the EF1 α-2 that contains 21 and 20 Nucleotide respectively.

AP8：Ile?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu (SEQ?ID?NO：18)

Thr (SEQ?ID?NO：19)

Ser (SEQ?ID?NO：20)

AP8-1R：3′-ACG?CTG?GGG?GCI?GAI?GA-5′ (SEQ?ID?NO：21)

A A A?T A A (SEQ?ID?NO：22)

T (SEQ?ID?NO：23)

C (SEQ?ID?NO：24)

AP8-2R：3′-GGG?GGG?CGG?ACG?CTG?GG-5′ (SEQ?ID?NO：25)

A A A A A (SEQ?ID?NO：26)

T T T (SEQ?ID?NO：27)

C C C (SEQ?ID?NO：28)

EF1a-1：5′-GGA?TCT?TGG?TTC?ATT?CTC?AAG-3′(SEQ?ID?NO：29)

EF1a-2：5′-CCT?CAG?ACA?GTG?GTT?CAA?AG-3′?(SEQ?ID?NO：30)

Use 3 μ g McA-RH8994 cDNA library plasmids as template, AP8-1R (500pmol) and EF1 α-1 (100pmol) are as primer and band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR test kit (Takara Shuzo Co., Ltd. produces, and is one group of thermally-stabilised Taq polysaccharase, reaction buffer and dNTP that is used for PCR) passes through GeneAmp ^TMPCRsystem 9600 (Perkin-Elmer produces, and is the thermo cycler of a PCR) carries out PCR (100 μ l volumes; In 95 ℃ of heating 2 minutes, carry out 35 circulations, each circulation is by 95 ℃ of sex change 1 minute, formed in 40 ℃ of annealing 1 minute with in 72 ℃ in synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes).The specificity of amplification of DNA fragments in order to improve has been carried out further PCR (100 μ l volumes; In 95 ℃ of heating 2 minutes, carry out 35 circulations, each circulation is included in 95 ℃ of sex change 1 minute, synthesized 1 minute in 45 ℃ of annealing 1 minute with in 72 ℃, at last in 72 ℃ of incubations 7 minutes), this PCR makes template with the PCR solution of 1 μ l gained, makes primer with EF1 α-2 (100pmol) and AP8-2R (500pmol).

The reaction solution that is obtained is carried out 2% sepharose (FMC BioProducts production) electrophoresis to separate the dna fragmentation as about 330bp of PCR primary product, said fragment utilizes aforesaid Prep-A-Gene DNA purification kit (Bio-Rad Laboratories, Inc. produces) to be further purified.Use T4 dna ligase (Life Technologies productions) with the dna fragmentation subclone of gained purifying to PCR TM II carrier (carrier that is used for the TA clone of PCR product, Invitrogen production).Because the heat-stabilised poly synthase that uses among the PCR has the activity of terminal enzyme (DNA), the 3 ' end that the character of utilizing this enzyme adds to the DNA of pcr amplification with a deoxyadenylic acid makes the direct subclone of amplification of DNA fragments to the PCR with 5 '-dT cohesive terminus ^TMIn the II carrier.28 clone purifications selecting at random from the clone who is produced with QIAGEN-tip100 (DIAGEN production) go out plasmid DNA molecule, and utilize Taq Dye Deoxy ^TM(Applied Biosystems produces Terminator Cycle Sequening Kit, be the two method of deoxidation Proc.Natl.Acad.Sci.USA based on Sanger et al., vol.74, pp.5463-5467,1977, the test kit of in the nucleotide sequencing that PCR helps, using with fluorescence dye), measure its nucleotide sequence by 373A dna sequencing instrument (a kind of fluorescence sequenator, Applied Biosystems produces).

When from the gained dna fragmentation, select coding above shown in the AP8 aminoacid sequence three amino-acid residues (the Ile/Thr/Ser)-Val-Pro of contiguous AP8-2R primer dna fragmentation and when its total length checked order, this fragment had comprised the cDNA of 261bp.Segmental the 173rd to 175 the coding methionine(Met)s of this cDNA, and coding framework is consistent with the amino acid framework of AP8.Because the 173rd that has inserted said dna fragmentation to 175 sequence and the sequence of Kozak (Kozak, M., Cell, vol.44, pp.238-292,1986) unanimity, therefore seem that this cDNA fragment contains a translation and starts the zone, the proteic N-end of coding rat TPO.Get rid of the segmental nucleotide sequence of A1 of carrier sequence and be shown in the Sepuence Listing (SEQ ID NO:1) that invests hereinafter by the aminoacid sequence that it is extrapolated.

＜embodiment 9 〉

With PCR screening rat TPO cDNA

Previously described cDNA library is divided into about 10, in 000 clone's the little storehouse, contain overnight incubation in the aforementioned LB substratum of 50 μ g/ml penbritins, use automatic plasmid tripping device PI-100 (VER-3.0 then at 1ml, Kurabo Industries, Ltd. produces; Be one based at Molecular Cloning, Sambrook et al., Cold Spring Harbor LaboratoryPress, 1989) in automatic plasmid DNA extraction element on the improved method of disclosed alkaline SDS method carry out plasmid DNA and extract).The cDNA Segment A 1 that is based on that step is separated has therewith been synthesized two following oligonucleotide and has been carried out purifying.

(one section of the from the 1st to 17 of SEQ ID NO:1 sequence has adopted sequence to 5 ' CGAGGGTGTACCTGGGTCCTG3 ' (SEQ ID NO:31); CGAG represents a connector sequence)

5 ' CAGAGTTAGTCTTGCGGTGAG3 ' (SEQ ID NO:32) (one section antisense sequences that SEQ ID NO:1 sequence is the from the 212nd to 232)

As template, institute's synthetic oligonucleotide is as primer and band AmpliTaq with 1/30 volume of each plasmid DNA sample that obtains in the step in the above ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR Reagent Kit (Takara Shuzo Co., Ltd. produces) passes through GeneAmp ^TMPCR System 9600 (PERKIN-ELMER production) carries out PCR (carry out 30 circulations, each circulation is included in 94 ℃ of sex change 30 seconds, synthesizes 1 minute in 66 ℃ of annealing 30 seconds with in 72 ℃).The result is 3 specific bands that detect 236bp in 100 little storehouses being detected.When one in 3 little storehouses is divided into about 900 clones' inferior little storehouse when extracting plasmid DNA and in kind carrying out PCR again, 3 in 100 examined inferior little storehouses detect specific band.When one in the little storehouse, 3 Asias is divided into 40 clones' little storehouse again and carries out same screening process, found specific band for 3 in 100 examined little storehouses.Go up cultivation with one in the little storehouse of these candidates at the LB plate that is supplemented with 50 μ g/ml penbritins (substratum that contains 15% agar), each formed colony is carried out the plasmid DNA extraction and carries out PCR in the same way.The result is that 2 in 100 clones that detected detect positive band.

＜embodiment 10 〉

The order-checking of rat TPO cDNA

Basically carry out the purifying of plasmid DNA according to the method described in the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989).Each equal overnight incubation in the 50ml LB substratum that contains 50 μ g/ml penbritins with 2 clones obtaining among the embodiment 9 has obtained about 300 μ g plasmid DNA after carrying out purifying by the same quadrat method described in the embodiment 6.

According to the same quadrat method described in the embodiment 8 the gained plasmid DNA is checked order to determine the containing segmental complete nucleotide sequence of A1, used Taq Dye Deoxy in this process ^TMTerminator Cycle Sequening Kit (Applied Biosystems production).The result is that two clones' nucleotide sequence is identical, and this shows that they are same clones.Select one of them clone, the plasmid that it is contained is called pEF18S-A2 α.Its nucleotide sequence and be shown among the Sequence Listing (SEQ ID NO:2) with the aminoacid sequence of its reckoning.

The sequence that is shown among the Sequence Listing (SEQ ID NO:2) has notable attribute.In the sequence encoding in 172bp 5 ' non-translational region downstream be rich in the aminoacid sequence of hydrophobic amino acid, it is 21 initial amino acid whose protein excretion signal sequences that this sequence is considered to contain with methionine(Met).This protein contains 3 ' non-translated sequence of 126 amino-acid residues, 1,025 Nucleotide and at terminator codon (TAA) poly A tail chain afterwards.This protein contains the one section sequence (the from the 1st to 12 amino acid among the SEQID NO:2) corresponding to the aminoacid sequence AP8 that analyzes among the embodiment 2, but does not contain the glycosylated one section consensus sequence of N-.Tightly be positioned at the Paraterminal 1624-1629 nucleotide sequence of 3 ' non-translated sequence and be different from one section consensus sequence, but potential polyadenylation sequence seemingly.

The carrier pEF18S-A2 α that is loaded with by E.coli strain DH5 is preserved in Japan's international trade and Department of Industry's industrial science and technology department bio-science and institute of human technology country storage FERM BP-4565 on February 14th, 1994 by the inventor.

＜embodiment 11 〉

The expression of rat TPO cDNA and the active affirmation of TPO in the COS1 cell

Promptly comprise chloroquine processing (Sompayrac et al., Proc.Natl.Acad.Sci.USA, vol.78, pp.7575-7578,1981 according to the following DEAE-dextran method of revising a little; Luthman et al., Nucl.Acids Res., vol.11, pp.1295-1308,1983) plasmid pEF18S-A2 α is transfected in the COS1 cell.(ATCC CRL 1650) is suspended in the DMEM substratum of the previously described 10%FCS of containing with the COS1 cell, inserts in the 100mm plastics tissue culture ware, at 5%CO ₂Reached for about 40% stage of merging in 37 ℃ of cultivations until cell in the incubator.Therewith mutually independently, to be dissolved in 30 μ l HBS (21mM HEPES, 145mMNaCl, pH 7.1) in pEF18S-A2 α (10 μ g) add in the 4ml DMEM substratum, this culture medium supplemented has DEAE-dextran (Pharmacia production), 80 μ M chloroquines (Sigma Chemical Co. production), 8% (v/v) HBS and 9% (v/v) Nu-Serum (Collaborative Research, Inc. produces) of 500 μ g/ml.The DMEM substratum of using that the gained mixture is added to above-mentioned cultivation washes twice COS1 cell, at 5%CO ₂Continue to cultivate 5 hours in 37 ℃ in the incubator.After this, the culture supernatants in the sucking-off culture dish, the cell that stays in the ware adds 15ml again and contains the DMEM substratum of 10%FCS at 5%CO after washing twice with the DMEM substratum ₂Cultivated recovery gained culture supernatants 3 to 5 days in 37 ℃ in the incubator.

The gained culture supernatants is dialysed fully with the MDM substratum and estimate with rat CFU-MK detection system.Discovery at plasmid pEF18S-A2 alpha expression COS1 cell culture supernatant liquid in the TPO activity be the (see figure 7) of dose-dependently.Similar to the TPO in XRP source, many megalokaryocytes have formed the cytoplasm projection that prolongs in 4 days cultivation.In contrast, in a transfection do not find TPO activity (Fig. 7) in the COS1 cell culture supernatant liquid of pEF18S.In M-07e mensuration system, M-07e cell proliferation enhanced activity is a dose-dependently in the COS1 cell culture supernatant liquid of also having found at plasmid pEF18S-A2 alpha expression, but in a transfection find in the COS1 cell culture supernatant liquid of pEF18S.These results show that A2 α contains coding and has the active proteinic cDNA of TPO.

Next step promotes thrombopoietic ability to prepare partially purified TPO sample in order to detect this TPO activity in vivo.At first, with transfection the COS1 cell of plasmid pEF18S-A2 α in the serum free medium that is supplemented with 0.2mg BSA, cultivated 3 days, thereby obtain about 5.8 liters of serum-free culture thing supernatant liquors.Adding proteinase inhibitor p-APMSF in this serum-free culture thing supernatant liquor is 1mM to final concentration, and 0.22 μ m strainer filters this mixture.To gained 5,793ml filtrate (protein concn, 0.229mg/ml; Gross protein, 1,326mg; Relative reactivity, 1,000; Gross activity, 1,326,000) middle 0.85moles (288g altogether) NaCl that adds 1000ml, thus obtaining 5,849ml contains the solution of 0.822M NaCl.Prepared solution is added to the TSK-gel AF-BLUE 650MH post of having crossed with 20mM sodium phosphate (pH7.2) balance that contains 1M NaCl in advance with the flow velocity of 7ml/min, and (Tosoh Corp. produces, catalog number (Cat.No.) 08705; Diameter 5cm, height of bed 6cm) on.After sample pipetting volume finished, with the 20mM sodium phosphate (pH 7.2) 7 that contains 1M NaCl, 900ml crossed post as elutriant.Store elutriant and concentrated, obtained post fraction F1 (460ml with a ultra-filtration equipment (Omega Ultrasette demarcates molecular weight cut-off 8,000, and Filtron produces); Protein concn, 2.11mg/ml; Gross protein, 973mg; Relative reactivity, 16.3).Next step, elute soln changes 2M NaSCN into, and the ultra-filtration equipment (diameter 76mm, Amicon Corp. produces) of usefulness band YM3 film is concentrated into 6.81ml with the TPO active fraction F2 (2840ml) of the TSK-gel AF-BLUE 650MH absorption of wash-out.Total protein among this TPO active fraction F2 is 12.5mg, and the albumen productive rate of this step F 2 is 0.62%.The TPO relative reactivity is calculated as 240.Next step, F2 is added to HiLoad 26/60Superdex 200pg, and (Pharmacia Biotech produces, catalog number (Cat.No.) 17-1071-01; Diameter 2.6cm; Height of bed 60cm) goes up and launch with the flow velocity of the 20mM sodium acetate that contains 50mM NaCl (pH 5.5) with 1ml/min.After launching beginning, found the TPO activity in the elutriant of 194 to 260ml scopes behind application of sample.These elutriants are stored, obtained Superdex 200pg TPO active fraction F2 (66ml; Protein concn, 0.112mg/ml; Gross protein, 7.41mg; Relative reactivity, 142,860; Gross activity, 1,058,600).Next step, preparation buffer A (20mM sodium acetate, pH 5.5) and buffer B (20mM sodium phosphate, pH 7.2, contain 500mM NaGl), this TPO active fraction is added to the strong cat ion exchange column RESOURCE S that crosses with 1 00%A balance in advance with the flow velocity of 1ml/min, and (Pharmacia Biotech produces, catalog number (Cat.No.) 17-1178-01; Diameter 0.64cm; Height of bed 3cm) on.After this, utilize in 40 minutes the linear gradient that goes to 100%B by 100%A to carry out wash-out with the flow velocity of 0.3ml/min.(from 5%B to 32%B) detects the TPO activity in the elutriant of relative broad range.Store these elutriants and concentrated, obtain RESOURCE S TPO active fraction F2 (1.65ml with the ultra-filtration equipment (diameter 25mm is produced by Amicon Corp.) of band YM3 film; Protein concn, 4.74mg/ml; Gross protein, 7.82mg; Relative reactivity, 71,400; Gross activity, 558,600).

Continuous 5 days subcutaneous administrations of partially purified TPO sample (474 μ g (100 μ l)/only/day) had been surveyed platelet count purpose 1CR male mice (9 age in week) to the same day before administration.In contrast, in kind use BSA (200 μ g (100 μ l)/only/day) or as the damping fluid of partial purification TPO solvent (100 μ l/ only/day) administration.Blood is collected from the heart of every mouse in after the administration second day the last time, and (F800, Toa Iyo Denshi produces) measures number of platelets with hemocytometer.In the mouse of using partial purification TPO, comparing platelet count with the platelet count before the administration has increased about 2.14 times.Compare with control group, the increase of platelet count is than high about 1.74 times of the mouse of giving BSA, than high about 1.9 times of the mouse of giving damping fluid in the mouse of using partial purification TPO.These results show that TPO has promoted that thrombocyte generates in the body.In addition, because in the mouse of using partial purification TPO, the quantity that is called as proteic immunosuppressive acid protein of chmice acute phase (IAP) does not raise, so this shows that effectively TPO is different from IL-6 and IL-11 aspect the acute phase protein inducing.

＜embodiment 12 〉

The detection of TPO mRNA in the rat tissue

In order to locate the tissue that rat TPO mRNA expresses in the rat body, from different rat tissues, extract RNA.Rat with 6 of sums carries out roentgen radiation x by the same procedure of describing among the embodiment 1, excising different tissues (brain, thymus gland, lung, liver, the heart, spleen, small intestine, kidney, testis and medullary cell) on one's body from rat the 11st to 14 day the time after the irradiation, and freezing in liquid nitrogen immediately.Extract by carrying out total RNA effectively with RNA separation agent ISOGEN (Wako Pure Chemical Industries, Ltd produces).Determine the amount of used ISOGEN according to the weight of each freezing tissue sample, the tissue sample that will add this reagent is with pressure-even pulp crusher (Physcotron ^_NS-60, NITI-ON Medical ﹠amp; Physical Instruments MFG.Co., Ltd produces) handle until the tissue of being smashed fully (about 10, under the 000rmp 45 to 60 seconds).Utilization is carried out total RNA based on the method for the sour guanidine phenol chloroform method (Anal.Biochem., vol.162, pp.156-159,1987) of Chomczynski et al. with homogenate and is extracted.As a result, from each tissue, obtained total DNA of 1.1 to 5.6mg.

Utilize Oligotex ^TM-dT30 (Supper) (Japan Synthetic Rubber/NipponRoche production) is purified into 20 μ g poly (A) from the total RNA of about 500 μ g ⁺RNA.

Use random primer, from 1 μ g poly (A) available from each tissue ⁺First strand of chain of synthetic cDNA among the RNA.That is, with 1 μ g poly (A) ⁺RNA is dissolved in the 10 μ l sterilized waters, in 70 ℃ of incubations 15 minutes, and cooling fast then.To wherein add the 75pmoles random primer (TakaraShuzo Co., Ltd.), 10U RNase inhibitor (Bochringer-Mannheim Coop.), 50mM Tris-HCl (pH 8.3), 75mM of KCl, 3mM MgCl ₂With 200U SuperScript ^TMII (a kind of ThermoScript II of producing) by Life Technologies.Prepared solution (cumulative volume 20 μ l) incubation 1 hour under room temperature, and the reaction soln that is produced in 70 ℃ of incubations 10 minutes so that enzyme deactivation is stored in-20 ℃ then until use.

Synthesize the new primer that is used for PCR based on the rat TPO cDNA sequence that embodiment 10 obtains.The sequence of institute's synthetic primer is as follows:

RTPO-I:5 '-CCT GTC CTG CTG CCT GCT GTG-3 ' (SEQ ID NO:33) (among the SEQ ID NO:2 the 347th to 367)

RTPO-N:5 '-TGA AGT TCG TCT CCA ACA ATC-3 ' (SEQ ID NO:34) (corresponding to the 1005th to 1025 antisense primer among the SEQ ID NO:2).

With each synthetic cDNA solution of 1/10 volume as template, each synthetic rTPO-I of institute of 1 μ M and rTPO-N as primer and band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR Reagent Kit (Takara Shuzo Co., Ltd. produces) utilizes GeneAmp ^TMPCR System 9600 (PERKIN-ELMER production) carries out PCR in 100 μ l volumes, in 95 ℃ of heating 2 minutes, repeat 30 circulations, each circulation be included in 95 ℃ of sex change 1 minute, in 57 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.When each reaction soln with gained carries out electrophoresis and detects amplified band with 2% sepharose (FMCBioProducts production), on the gel that comes from brain, liver, small intestine and kidney, found like being the specific band of TPO mRNA.These results show that the expression of TPO mRNA in the rat betides in these organs, although the amount of its expression can not be judged.As if may exist in human body the result of similar phraseology and embodiment 4 to combine when taking in, liver is the suitable initial substance that obtains people TPO cDNA.

＜embodiment 13 〉

The structure in the cDNA library in people's normal liver source

Based on the result of embodiment 12, select the initial substance of liver as the TPO cDNA that is used to clone people.According to the same method of describing among the embodiment 7, use Time Saver ^TMCDNA synthetic agent box (Pharmacia production) and DIRECTIONAL CLONING TOOLBOX (Pharmacia production) are from the poly (A) in normal people's liver source that 5 μ g merchants sell ⁺Having synthesized among the RNA (being produced by Clontech, is a product that extracts based on the sour guanidine phenol chloroform method of Chomczynski et al.) at its 5 ' end has the EcoRI recognition site and the double-stranded cDNA of NotI recognition site is arranged at its 3 ' end.The synthetic cDNA of institute is connected with the previously described expression vector pEF18S of NotI digestion with EcoRI in advance with 1.2 μ g, and is converted among the previously described high competence E.coli DH5 of 8.4ml (Toyobo Co., Ltd. produces).The result has obtained 1.2 * 10 ⁶Transformant.

＜embodiment 14 〉

With PCR preparation (clone) people TPO cDNA fragment

Use random primer, from the poly (A) in the commercially available normal people's liver of μ g source ⁺Synthetic first strand of chain of cDNA among the RNA (Clontech production).Be about to 1 μ g poly (A) ⁺RNA is dissolved in the 10 μ l sterilized waters, in 70 ℃ of incubations 15 minutes, and cooling fast then.To wherein add the 75pmoles random primer (Takara Shuzo Co., Ltd), 10U RNase inhibitor (Boehringer-Mannheim Corp.), 50mM Tris-Hcl (pH 8.3), 75mM KCl, 3mM MgCl ₂With 200U ThermoScript II SuperScript ^TMII (Life Technologies).With prepared solution (cumulative volume 20 μ l) in 37 ℃ of incubations 1 hour, and with the gained reaction soln in 70 ℃ of incubations 10 minutes so that enzyme deactivation is stored in-20 ℃ then until application.

According to the synthetic primer that is used for PCR of rat TPO cDNA sequence (SEQ ID NO:2).The sequence of institute's synthetic primer is as follows:

RTPO-AIN:5 '-ATG GAG CTG ACT GAT TTG CTC-3 ' (SEQ ID NO:35) (among the SEQ ID NO:2 the 173rd to 193)

RTPO-N:5 '-TGA AGT TCG TCT CCA ACA ATC-3 ' (SEQ ID NO:36) (corresponding to the 1005th to 1025 antisense primer among the SEQ ID NO:2).

As template, 1 μ M synthetic rTPO-AIN of every kind of institute and rTPO-N are as primer and band AmpliTaq with the synthetic cDNA solution of 1/10 volume ^TMThe GeneAmp of DNA Polymerase ^TMPCR Reagent Kit (Takara Shuzo Co., Ltd produces) utilizes GeneAmp ^TMPCR System 9600 (PERKIN-EIMER production) carries out PCR in 100 μ l volumes, in 95 ℃ of heating 2 minutes, repeat 35 circulations, each circulation be included in 95 ℃ of sex change 1 minute, in 40 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

The gained reaction soln is carried out 2% sepharose (FMC BioProducts) electrophoresis to isolate the dna fragmentation as about 620bp of PCR primary product, and it utilizes previously described Prep-A-Gene DNA purification kit (Bio-Rad Laboratories.Inc.) to carry out purifying subsequently.The nucleotide sequence of purified dna fragmentation utilizes previously described Taq DyeDeoxy ^TMTerminatex Cycle Sequening Kit (Applied Biosystems production) is directly determined by 373A dna sequencing instrument (Applied Biosystems production).The nucleotide sequence of the eliminating primer part of being measured and the aminoacid sequence of calculating thus are shown among the SequenceListing (SEQ ID NO:3).

This has got rid of the long 580bp of dna fragmentation of primer sequence.When comparing, people cDNA demonstrates has 80% homology with the rat cdna nucleotide sequence, and this shows this dna fragmentation some people TPO cDNA that encoded.

＜embodiment 15 〉

With PCR screening people TPO cDNA clone

Based on the synthetic corresponding primer of people TPO that carries out PCR of SEQ ID NO:3.Institute's synthetic primer sequence is as follows:

HTPO-I:5 '-TTG TGA CCT CCG AGT CCT CAG-3 ' (SEQ ID NO:37) (among the SEQ ID NO:3 the 60th to 80)

HTPO-J:5 '-TGA CGC AGA GGG TGG ACC CTC-3 ' (SEQ ID NO:38) (corresponding to the 479th to 499 antisense primer among the SEQ ID NO:3).

The human cDNA library that amplification makes up in embodiment 13, and (every storehouse contains about 100 to be divided into a plurality of little storehouses, 000 clone), contain overnight incubation in the previously described LB substratum of 50 μ g/ml penbritins at 1ml, with automatic plasmid tripping device PI-100 (VER-3.0, KuraboIndustries, Ltd. produces) carry out plasmid DNA and extract.The DNA that is extracted is dissolved in the TE solution.

With the 5% DNA sample that extracts as template, every kind of synthetic oligonucleotide of 1 μ M (hTPO-I and hTPO-J) as primer and band AmpliTaq ^TMThe GeneAmp of DNA Polymerase ^TMPCR Reagent Kit (Takara Shuzo Co., Ltd. produces) passes through GeneAmp ^TMPCR system 9600 in 20 μ l volumes, carry out PCR (35 circulations altogether, each circulation be included in 95 ℃ of sex change 1 minute, in 59 ℃ of annealing 1 minute and 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes).The result detects special band among in 90 used little storehouses 3.Be divided into Ya Xiaoku with one in 3 little storehouses, each contains about 5,000 clones approximately, is purified into plasmid DNA to carry out PCR with identical method from little storehouse, 90 Asias.The result detects specific band in little storehouse, 5 Asias.Be divided into little storehouse again with one in these 5 little storehouses, each contains 250 clones, extracts plasmid DNA from 90 little storehouses.When the sample with these extractions in kind carries out PCR, in three little storehouses, detect specific band.One of them further is divided into Ya Xiaoku with these three little storehouses, and each contains 30 clones, and plasmid DNA purification from little storehouse, 90 Asias is by carrying out PCR with quadrat method.The result is to detect specific band in little storehouse, 3 Asias.One of them is cultivated on the aforementioned LB plate of the penbritin that contains 50 μ g/ml with the little storehouse of candidate, and each of formed 90 colonies is carried out plasmid DNA extract and in kind carry out PCR.The result has finally obtained clone HL34.

＜embodiment 16 〉

The order-checking of people TPO cDNA

Basically carry out the purifying of plasmid DNA according to the method for describing among the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989).In the 50ml LB substratum that contains 50 μ g/ml penbritins, will clone the HL34 overnight incubation, will be in the previously described TEG-lysozyme soln of 4ml by centrifugal collected cell suspension.To wherein adding 8ml 0.2N NaOH/1%SDS solution, and then add 6ml 3M potassium/5M acetate solution, suspension cell fully.With suspension centrifugal after, the gained supernatant liquor is handled with phenol/chloroform (1: 1), mix with the Virahol of equal volume, centrifugal then.Gained precipitates that little group is dissolved in the TE solution and handles with RNase, uses phenol/chloroform (1: 1) to handle then, uses ethanol sedimentation again.Gained is precipitated little group be dissolved in again in the TE solution, add NaCl and polyoxyethylene glycol 3,000 to its final concentration subsequently and be respectively 0.63M and 7.5%.After centrifugal, precipitate little group and be dissolved in the TE solution, use ethanol sedimentation.By this way, about 300 μ g pEF18S-HL34 plasmid DNA have been obtained.

Purified plasmid DNA is added on the previously described 373A dna sequencing instrument (AppliedBiosystems production), so that with previously described Taq Dye Deoxy ^TMTerminaterCycle Sequening Kit (Applied Biosystems production) measures its complete nucleotide sequence.The nucleotide sequence of being surveyed and be shown among the SequenceListing (SEQ ID NO:4) by the aminoacid sequence of its reckoning.In this example, will in nucleotide sequencing, be used as primer based on the nucleotide sequence synthetic oligonucleotide of SEQ ID NO:3 and the synthetic oligonucleotide that designs based on the internal sequence that obtains by sequential analysis.

The result has confirmed that plasmid clone pEF18S-HL34 comprises the cDNA fragment of a 861bp, and contain with embodiment 2 in the aminoacid sequence AP8 (the 1st to 12 amino acids among the SEQ ID NO:4) that analyzes and TP2/TP3 (the 157th to 162 amino acids among the SEQ ID NO:4) sequence with high homology.As if this dna fragmentation is its 25th open reading frame that has been start code, but do not have terminator codon, it contains the poly A tract shape sequence of 76 bases at its 3 ' end.It just contains, and the aminoacid sequence of 253 amino-acid residues before poly A tract shape sequence shows that with rat TPO cDNA corresponding section (the aminoacid sequence part that comprises 147 residues that shows among the SEQ ID NO:2) 84% homology is arranged.As a result, find that this clone is the dna fragmentation of coding corresponding to the people cDNA part of rat TPO cDNA.As if owing to lack terminator codon and have poly A tract shape sequence at its 3 ' end, this clone is not complete cDNA, but the artifact that in cDNA library construction process, produces.

＜embodiment 17 〉

Expressing human TPO cDNA and confirmation TPO activity in the COS1 cell

According to the method for embodiment 11 with gained plasmid clone pEF18S-HL34 transfection to the COS1 cell.Promptly carry out transfection with the plasmid DNA of 10 μ g by the DEAE-dextran method that comprises the chloroquine processing.Cultivate the COS1 cells 3-5 days in 37 ℃, collect supernatant liquor then.

With fully the dialyse culture supernatants of gained of IMDM substratum, and assess with rat CFU-MK mensuration system.In the COS1 cell culture supernatant liquid that plasmid pEF18S-HL34 expresses, detecting the TPO activity is dose-dependently (Fig. 8).Cultivate after 4 days, many megalokaryocytes have formed the cytoplasm projection that increases.In contrast, in only expressing the COS1 cell culture supernatant liquid of pEF18S, do not find TPO activity (Fig. 8).In M-07e mensuration system, only in the COS1 cell culture supernatant liquid of it being expressed, found M-07e cell proliferation enhanced activity by the transfection of plasmid pEF18S-HL34.These results show that pEF18S-HL34 contains the gene that coding has the TPO active protein.In addition, this shows that also people TPO acts on rat megalokaryocyte progenitor cell (gutless specificity).

＜embodiment 18 〉

The expression of people TPO absence type cDNA and the active confirmation of TPO

The clone HL34 that obtains among the embodiment 15 contains the cDNA that has poly A tract shape continuous sequence at its 3 ' end, and this sequence is not present among the rat TPO cDNA, therefore like the artifact for experiment.The result prepares the cDNA molecule of having removed poly A tract shape sequence and whether has the TPO activity by disappearance cDNA expressed proteins to observe.Utilize PCR preparation disappearance cDNA.The primer sequence that is used for PCR is as follows, has added a Restriction Enzyme recognition site (EcoRI adds to hTPO5, and NotI and two terminator codon TAA and TGA add to hTPO3) at 5 ' end of each primer.

HTPO5:5 '-TTT GAA TTC GGC CAG CCA GAC ACC CCG GCC-3 ' (SEQ ID NO:170) (among the SEQ ID NO:4 the 1st to 21)

hTPO3：5’-TTT?GCG?GCC?GCT?CAT?TAT?TCG?TGT?ATC?CTG?TTC

AGG TAT CC-3 ' (SEQ ID NO:171) (corresponding to the 757th to 780 antisense primer among the SEQ ID NO:4).

With the plasmid DNA 1 μ g of the plasmid clone pEF18S-HL34 that obtains among the embodiment 16 as template, each synthetic hTPO5 of institute of 10 μ M and hTPO3 as primer and band AmpliTaq ^TMThe GeneAmp of DNA Polymerase ^TMPCR Reagent Kit (TakaraShuzo Co., Ltd. produces) utilizes GeneAmp ^TMPCR System 9600 (PERKIN-ELMER production) carries out PCR in 100 μ l volumes, repeat 15 circulations, each circulation be included in 95 ℃ of sex change 1 minute, in 65 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last 72 ℃ of incubations 7 minutes.The band of the about 800bp that is obtained with Restriction Enzyme EcoRI and NotI digestion carries out purifying, then among the expression vector pEF18S that subclone was handled with same Restriction Enzyme extremely in advance.From the transformant that is produced, select 5 and contain the segmental clone of about 800bpDNA, prepare a large amount of plasmid DNA according to method described in the embodiment 5.The total length of the amplification region of the about 800bp of each plasmid is carried out the crash consistency of nucleotide sequence analysis with the nucleotide sequence finding to analyze among itself and the embodiment 16 (among the SEQ ID NO:4 the 1st to 780).

The plasmid clone that is obtained is called pHT1-231.The carrier pHT1-231 contained by E.coli DH5 is preserved in national bio-science of Ministry of International Trade and Industry industrial technology department of Japan and human technical institute by the inventor on February 14th, 1994, and its preserving number is FERM BP-4564.

According to the method for embodiment 11 with the gained plasmid transfection to the COS1 cell.Promptly carry out transfection with 10 μ g plasmid DNA by the DEAE-dextran method that comprises the chloroquine processing.The COS1 cell was cultivated the collection supernatant liquor 3-5 days in 37 ℃.

With the IMDM substratum gained culture supernatants of fully dialysing, and estimate with rat CFU-MK mensuration system.In the COS1 cell culture supernatant liquid that plasmid pHT1-231 expresses, found TPO activity (Fig. 9).In 4 days that cultivate, many megalokaryocytes have formed the cytoplasm projection that increases.In contrast, in the COS1 cell culture supernatant liquid that has only plasmid pEF18S to express, do not find TPO activity (Fig. 9).In M-07e mensuration system, only in the COS1 cell culture supernatant liquid that plasmid pHT1-231 expresses, found M-07e cell proliferation enhanced activity.These results show that pHT1-231 contains coding and has the active cDNA of TPO.

＜embodiment 19 〉

Prepare people TPO cDNA 3 ' end region with PCR

Because the clone HL34 of preparation contains the cDNA that comprises poly (A) shape of tail sequence among the embodiment 15, so this shows that its 3 ' end is incomplete.Therefore attempt obtaining total length 3 ' end region with PCR.Based on the sequence of measuring among the embodiment 16, synthesized the primer of the following 4 kind of 5 ' side that is used for PCR:

hTPO-H：5’-AGC?AGA?ACC?TCT?CTA?GTC?CTC-3’(SEQ?ID?NO：39)

(the 574-594 position of SEQ ID NO:4)

hTPO-K：5’-ACA?CTG?AAC?GAG?CTC?CCA?AAC-3’(SEQ?ID?NO：40)

(the 595-615 position of SEQ ID NO:4)

hTPO-N：5’-AAC?TAC?TGG?CTC?TGG?GCT?TCT-3’(SEQ?ID?NO：41)

(the 660-680 position of SEQ ID NO:4)

hTPO-O：5’-AGG?GAT?TCA?GAG?CCA?AGA?TTC-3’(SEQ?ID?NO：42)

(the 692-712 position of SEQ ID NO:4)

Synthesize following 3 ' the side primer that contains the mixed nucleus thuja acid at 3 ' four terminal base places, to begin the cDNA that increases from poly (A) part.Also synthesized and do not had the anchor of mixed nucleotides primer.

hTPO?3mix：5’-TAG?CGG?CCG?C(T) ₁₇?G?GGG-3’(SEQ?ID?NO：43)

A?AAA-3’(SEQ?ID?NO：44)

C?TTT-3’(SEQ?ID?NO：45)

CCC-3’(SEQ?ID?NO：46)

HTPO 3 anchors: 5 '-TAG CGG CCG C (T) ₁₁-3 ' (SEQ ID NO:47)

As what done among the embodiment 14, from the poly (A) in the commercially available normal people's liver source of 1 μ g ⁺RNA (Clontech production) synthesizes first strand of chain of cDNA, but usefulness is that (it is included in the TimeSaver that is produced by Pharmacia to 0.5 μ g oligo dT primer ^TMAmong the cDNA Synthesis Kit).With the synthetic cDNA solution of 1/10 volume as template, the hTPO 3mix primer of the hTPO-H primer of 20 μ M and 10 μ M and band AmpliTaq ^TMThe GeneAmp of DNA Polymerase ^TMPCR Reagent Kit (Takara Shuzo Co., Ltd. produces) utilizes GeneAmp ^TMPCR System 9600 (PERKIN-ELMER) carries out PCR in 50 μ l volumes, and in 96 ℃ of heating 2 minutes, repeat 10 circulations, each circulation be included in 96 ℃ of thermally denatures 1 minute, in 48 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

The solution that forms with the PCR first time of 1/10 volume is made the hTPO-K primer of 20 μ M that template, volume are 50 μ l and the hTPO 3mix of 10 μ M carries out the PCR second time, in 96 ℃ of heating 2 minutes, repeat 10 circulations, each circulation be included in 96 ℃ of thermally denatures 1 minute, in 63 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

Forming solution by the PCR second time of 1/10 volume, to make template, volume be that 20mMhTPO-N primer and the 10 μ M hTPO 3mix primers of 50 μ l carry out PCR for the third time, in 96 ℃ of heating 2 minutes, repeat 10 circulations, each circulation be included in 96 ℃ of thermally denatures 1 minute, in 63 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

Forming solution with the PCR for the third time of 1/10 volume, to make template, volume be that 20 μ M hTPO-O primers and the 10 μ M hTPO 3mix primers of 50 μ l carry out PCR the 4th time, in 96 ℃ of heating 2 minutes, repeat 10 circulations, each circulation be included in 96 ℃ of thermally denatures 1 minute, in 63 ℃ of annealing minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

Make template, 50 μ l, 20 μ M hTPO-O primers and 20 μ M hTPO3 anchor primers with the 4th PCR formation solution of 1/10 volume and carry out PCR the 5th time, in 96 ℃ of heating 2 minutes, repeat 10 circulations, each circulation be included in 96 ℃ of thermally denatures 1 minute, in 58 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, at last in 72 ℃ of incubations 7 minutes.

The gained reaction soln is carried out 2% sepharose (FMC Bio-Products production) electrophoresis, separation is as the dna fragmentation of about 600bp of PCR primary product, it utilizes previously described Prep-A-Gene DNA purification kit (Bio-Rad Laboratories, Inc. produces) to carry out purifying subsequently.Utilize previously described Taq Dye Deoxy ^TMTerminater CycleSequening Kit (Applied Biosystems production) directly measures the nucleotide sequence of purified dna fragmentation by 373A dna sequencing instrument (Applied Biosystems production).Nucleotide sequence of being measured and the aminoacid sequence of calculating thus are shown in Sequence Listing (SEQ ID NO:5).

This dna fragmentation has 130 amino acid whose nucleotide sequences of having encoded from primer hTPO-O, and its heel has in 3 ' the terminal sequence more than 180 Nucleotide (the 577th later Nucleotide be can not determine).Rise from 30 aminoacid sequences of glycine and the consensus amino acid sequence of the 203-232 position among the SEQ ID NO:4.The nucleotide sequence of 1-94 position is also consistent with the nucleotide sequence of 692-785 position among the SEQID NO:4.

Among the embodiment 17 in cDNA fragment and the present embodiment fragments sequence analytical results through pcr amplification make people have reason to estimate that people TPO albumen is made up of 353 amino acid that contain 21 amino acid signal sequences that are shown among the SEQ ID NO:6.

＜embodiment 20 〉

The structure in the cDNA library in people's normal liver source

Do not have the codon of termination and as if therefore be cDNA synthetic artifact owing to the clone HL34 of gained among the embodiment 15 directly contains poly A tract shape sequence on 3 ' end of its open reading frame, so sell people's liver poly (A) of originating with 5 μ g merchants ⁺RNA preparation (Clontech production) rebuilds the cDNA library.By being used for cDNA synthetic SuperScript ^TMLambdaSystem and λ Cloning Kit and SuperScript ^TMII RNase H ^-It is synthetic that (both produce by LIFETECHNOLOGIES) carries out cDNA.With poly (A) ⁺RNA carries out thermally denature, adds to 20 μ l then and invests reaction solution test kit, that contain the few dT that the NotI sequence included as primer (50mM Tris-HCl, pH 83,75mM KCl, 3mM MgCl ₂, 1mM DTT, 1mM dNTP mix, 200U SuperScript ^TMII RNase H ^-) in, then 37 ℃ of incubations 60 minutes.(in 16 ℃ of incubations 2 hours, this reaction solution contained 25mM Tris-Hcl (pH 8.3), 100mMKCl, 5mM MgCl in 150 μ l reaction solutions in the synthetic back of second strand of chain of cDNA ₂, 250 μ M dNTP mix, 5mM DTT, 40U E.coliDNA polysaccharase I, 2U E.coli RNase H and 10U E.coli dna ligase), add 10U T4 archaeal dna polymerase, with the gained mixture in 16 ℃ of incubations 5 minutes.Reaction solution 65 ℃ of heating 10 minutes, is extracted and uses SizeSep with the equal volume phenol/chloroform ^TM400 column spinners (a kind of TimeSaver that produces by Pharmacia that invests ^TMColumn spinner among the cDNA Synthesis Kit, that be used to remove low-molecular-weight dna) removes the cDNA molecule of length less than 400bp.After adding EcoRI connector (investing the Directional CloningToolbox that Pharmacia produces), digest handled sample and add to SizeSep again with NotI ^TMOn 400 column spinners to remove low-molecular-weight dna.Institute's synthetic 1.3 μ g are had the EcoRI recognition sequence and have the bifilar cDNA of NotI recognition sequence at 3 ' end at its 5 ' end be connected with the expression vector pEF18S that digested with EcoRI and NotI, be converted into then among the high competence E.coli DH5 of 9.2ml (Toyobo Co., Ltd. produces).Income earner's liver cDNA library (hTPO-F1) contains 1.0 * 10 ⁶Individual transformant.

＜embodiment 21 〉

Screening TPO cDNA clone from people's liver cDNA library hTPO-F1

Based on Sequence ID Nos:3 that shows among the SEQUENCE LISTING and the 6 synthetic corresponding primers of people TPO cDNA that are used for PCR.The sequence of institute's synthetic primer is as follows:

HTPO-I:5 '-TTG TGA CCT CCG AGT CCT CAG-3 ' (SEQ ID NO:48) (60-80 position among the SEQ ID NO:3)

HTPO-KU:5 '-AGG ATG GGT TGG GGA AGG AGA-3 ' (SEQ ID NO:49) (corresponding to the antisense primer of 901-921 bit sequence among the SEQ ID NO:6).

With the people's liver cDNA library hTPO-F1 (1.0 * 10 that makes up among the embodiment 20 ⁶Individual transformant) divide in 3 little storehouses (storehouse 1-3), Jiang Xiaoku is freezing.Make template and carry out PCR as primer with the plasmid DNA that makes from each little storehouse with each synthetic oligonucleotide of 1 μ M (hTPO-I and hTPO-KU).With band AmpliTaq ^TMThe GeneAmp of DNA Polymerase ^TMPCRReagent Kit (Takara Shzuo Co., Ltd produces) passes through GeneAmp ^TMPCR System9600 (PERKIN-ELMER production) carries out PCR in 100 μ l volumes (35 circulations altogether, each circulation are included in 95 ℃ of sex change 1 minute, synthesized 1 minute in 59 ℃ of annealing 1 minute and in 72 ℃; At last in 72 ℃ of incubations 7 minutes).The result is when with from plasmid DNA that No. 3 little storehouses make the time, and having increased has the dna fragmentation of desired size.Then No. 3 little storehouses are divided into Ya Xiaoku, each inferior little storehouse contains 15,000 transformant, with these inferior little storehouse overnight incubation, extracts plasmid DNA with automatic plasmid tripping device P1-100 then in the 1ml LB substratum that contains 50 μ g/ml penbritins.The DNA that is extracted is dissolved in the TE solution, the gained solution with 5% as template to use same primers as indicated above and PCR under the same conditions.Result 6 in 90 little storehouses have found to have the amplification of the DNA of desired size.One of them is divided into Ya Xiaoku again with these positive little storehouses, makes each inferior little storehouse contain 1,000 when clone, extracts plasmid DNA and carries out PCR with described same procedure above, does not observe the amplification of DNA.On the running gel by the dna fragmentation of a series of pcr amplifications, the density of band thins down when Ya Xiaoku is further segmented.This seemingly hangs down that the rate of recovery caused because institute's relatively poor production of interested clone causes plasmid DNA.Therefore, use the colony hybrid method with No. 3 original little storehouses and carry out another time screening.

Scattered on the 100 LB agar plates of diameter 15cm in No. 3 little storehouses, its inoculation intensity is 4,100 colonies of growing on the every LB agar plate.After the flat board of being inoculated from every prepared a replica plate, one of them cultivated 6 hours to be recovered in dull and stereotyped colony of upward growing and to extract the plasmid DNA sample in 37 ℃ with replica plate.When in identical mode mentioned above these DNA samples being carried out PCR, in little storehouse, 100 Asias one observes an amplification that is equal to the band of desired size.Use BIODYNE ^TMA TRANSFER MEMBRANE (PALL production) makes 2 replica filter by the flat board in this little storehouse, Asia.The sex change of these filters was carried out by it being immersed successively among the 10%SDS 10 minutes, 0.5N NaOH/1.5M NaCl 10 minutes and 0.5M Tris-Hcl (pH 8.0)/1.5M NaCl in 10 minutes, carry out 30 minutes wind dryings, in vacuum oven, cured 1 hour again in 80 ℃ thereafter.The filter that cured washes with replenishing 6 * SSC with 1%SDS (being dissolved in 20 * SSC stock solution preparation that 175.3gNaCl in 1 premium on currency and 88.2g Trisodium Citrate are formed by dilution).The prehybridization of institute's flushing filter is by shaking in the 30ml reaction solution and carry out in 42 ℃ of incubations 30 minutes, while, and said reaction solution is by 50% methane amide, 5 * SSC, 5 * Denhar dt ' s solution (being made by the 50 * Denhardt ' s liquid that contains 5g Ficoll, 5g polyvinylpyrrolidone and 5g bovine serum albumin fraction V in 500ml water), 1%SDS and 20 μ g/ml salmon sperm dnas.Behind the prehybridization, with containing the 30ml hybridization solution replacement(metathesis)reaction liquid of identical component, with indicate [α- ³²P] probe of dCTP (Amersham production) mixes, and shakes incubation 20 hours in 42 ℃ then.The label probe that is used for this experiment is the EcoRI/BamHI fragment of plasmid pEF18S-HL34, it is making from 5 ' terminal part and the purified part of mark to the 458th bit base by purifying SEQ ID NO:4, and the mark of said purification part is by using Megaprime DNA Labelling System (based on Anal.Biochem., 132,6-13,1983 disclosed methods, the test kit of producing by Amersham) the random primer technology carry out.Filter after the processing in 42 ℃ of flushings 30 minutes, washed 30 minutes in 42 ℃ in 0.2 * SSC/0.1%SSD liquid in 2 * SSC/0.1%SDS liquid then.Use intensifying screen and X-OMAT then ^TMAR5 film (Eastman Kodak production) carries out radioautograph in 16 hours with filter at-70 ℃.As a result, observe and be considered to the male individual signals.From the former dull and stereotyped colony of collecting about corresponding to this signal, and on 10cm LB agar plate, inoculate again.50 colonies of incubation growth on this flat board respectively carry out PCR with aforementioned primer hTPO-I and hTPO-KU to the DNA sample of these colonies under the same terms as previously described.The result has only found to be equal to the amplification of the band of desired size in a clone, this clone is called pHTF1.

＜embodiment 22 〉

Determine the nucleotide sequence of people TPO cDNA clone pHTF1

Basically press the method plasmid DNA purification of describing among the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989).In the LB substratum that contains 50 μ g/ml penbritins, will clone the pHTF1 overnight incubation.The cell of centrifugal collection gained is suspended from the aforesaid TFG-lysozyme soln of 4ml then.In this solution, add 8ml0.2N NaOH/1%SDS solution, add 6ml 3M potassium/5M acetic acid solution then so that cell suspends fully.With suspension centrifugal after, handle the supernatant liquor of gained with phenol/chloroform (1: 1), mix with the equal-volume Virahol, centrifugal then.The particle of gained is dissolved in TE solution, uses RNase and phenol/chloroform (1: 1) to handle then, then carry out ethanol sedimentation.The gained precipitation is dissolved in TE again, to wherein adding NaCl and polyoxyethylene glycol 3,000, makes its final concentration reach 0.63M and 7.5% respectively subsequently.After centrifugal, solids precipitation is dissolved in TE solution and uses ethanol sedimentation.In this way, obtain 300 μ g plasmid DNA pHTF1.

The plasmid DNA of purifying thus is used for above-mentioned 373A dna sequencing instrument (being made by AppliedBiosystems) so that with above-mentioned Taq Dye Deoxy ^TMTerminater CycleSequening test kit (being made by Applied Biosystems) is determined the complete nucleotide sequence.The definite thus nucleotide sequence and the aminoacid sequence of supposition are listed in (SEQ IDNO:7) in the sequence table.In nucleotide sequence is determined, be that basic synthetic oligonucleotide is used for nucleotide sequence as primer and determines in order to the nucleotide sequence of SEQ ID NO:6 with by the internal sequence that its serial response analysis obtains.

The result, confirm that clone pHTF1 contains the cDNA fragment of 1.721bp, and with embodiment 2 in the aminoacid sequence AP8 (amino acid no 1 to 12 among the SEQ ID NO:7) and the TP2/TP3 (amino acid no 157 to 162 among the SEQ ID NO:7) that analyze homology is highly arranged.The open reading frame that this dna fragmentation seems to contain 5 ' non-coding region of 101 bases, be made up of 353 amino-acid residues is (from the Met residue at 102 to 104 nucleotide codings, stop at the Gly residue of 1158 to 1160 nucleotide codings), follow by the 3 ' non-coding region of terminator codon (TAA), 531 bases and the polyA tailer sequence of 30 bases, think in full accord by the people TPO aminoacid sequence of the aminoacid sequence of open reading frame encoded protein matter and the prediction shown in the SEQ ID NO:6.The cDNA sequence of pHTF1 is bigger than the supposition cDNA sequence shown in the SEQ ID NO:6, contains 77 additional bases in 5 ' side, and before its polyA tailer sequence, in 3 ' side 347 additional bases is arranged.And nucleotides sequence is listed in and is different from SEQ ID NO:6 on 3 positions.Be the A (position 84) among the SEQ ID NO:7, A (position 740) and G (position 1198) are respectively C, T and A in SEQ ID NO:6.Include only the sudden change of position 740 at protein coding region, but because A and T all are the 3rd bases of Thr codon, therefore this sudden change can not cause amino acid change.Although at that time and do not know the reason that these bases replace, analyze plasmid clone pHTF1 confirmer TPO albumen and form by 353 amino-acid residues that have 21 amino acid signal sequences.After estimating to remove signal sequence, the molecular weight of mature protein is 35,466.

The carrier pHTF1 that is carried by E.coli bacterial strain DH5 is deposited at the National Institute ofBioscience and Human-Technology on March 24th, 1994 with registration number No.FERM BP-4617 by the inventor, Agency of Industrial Science andTechnology, Ministry of International Trade and Industry, Japan.

＜embodiment 23 〉

Expressing human TPO cDNA clone and conclusive evidence TPO activity in the COS1 cell

Press the method for embodiment 11, with the plasmid clone pHTF1 transfection COS1 cell that obtains thus, promptly the DEAE-dextran method through comprising that chloroquine is handled is finished transfection with 10 μ g plasmid DNA.The COS1 cell of transfection was cultivated 3 days in 37 ℃, collected culture supernatants then.

Culture supernatants is thoroughly dialysed to the IMDM substratum, then with the estimation of rat CFU-MK detection system.In the COS1 of expression plasmid pHTF1 cell conditioned medium liquid, (Figure 10 a) to detect the TPO activity with dosage dependence form.On the contrary, (Figure 10 a) not have the TPO activity in the COS1 cell culture supernatant liquid of expression plasmid pEF18S only.Obtained similar result with the M-07e detection system.The COS1 cell conditioned medium liquid of expression plasmid pHTF1 relies on the propagation (Figure 10 b) that mode obviously increases the M-07e cell with dosage therein.These presentation of results, pHTF1 contain the proteinic gene that coding has the TPO activity.

＜embodiment 24 〉

Human cloning TPO chromosomal DNA

Personnel selection TPO cDNA is as probing pin clone people TPO chromosomal DNA.Used genomic library is by from the Gene Research Center in the clone, Tohoku University T.Yamamoto professor's institute gives that (Sakai et al is at J.Biol.Chem., 269,2173-2182,1994 have reported this library, by partly digesting human chromosome DNA with restriction enzyme Sau 3AI, the BamHI site that then the part digestion product is connected to the phage vector λ EMBL 3 of Stratagene manufacturing makes up).The basic method of describing among the Molecular Cloning (Sambrook et al., ColdSpring Harbor Laboratory Press, 1989) of pressing, personnel selection TPO cDNA is that probe screens this library., the library is inoculated into contains NZYM (the NZ amine, the 5g NaCl that in 1 premium on currency, contain 10g, 5g Bacto YeastExtract, 2g MgSO as the host with E.coli LE392 ₄7H ₂O and 15g agar on 15-cm flat board pH7.0), contain 30,000 phage particles with such flat board of inoculation size.Use BIODYNE ^TMA TRANSFER MEMBRANE (being made by PALL) is from two replica filters of the dull and stereotyped preparation of each 18 of preparing thus.By filter membrane being immersed among the 0.5N NaOH/1.5M NaCl 10 minutes, in 0.5M Tris-Hcl (pH 8.0)/1.5M NaCl 10 minutes then, then dry air was 30 minutes, subsequently in vacuum oven in 80 ℃ roasting 1.5 hours and make its sex change.The filter membrane of handling is thus contained 50% formaldehyde, 5 * SSC, finishing prehybridization in 42 ℃ of incubations 1 hour in the 500ml reaction soln of 5 * Denhardt ' s solution, 1%SDS and 20 μ g/ml salmon sperm DNAs.In order to be used as probe, through pcr amplification people TPO cDNA fragment (among the SEQ IDNO:7 178 to 1,025 bit base), purify then, with Random Primer DNALabelling box (by Takara Shuzo with Anal.Biochem., 132,6-13, the dna marker box of disclosed random primer manufactured in 1983) use ³²The fragment of P mark purifying.In this PCR, used primer sequence is as follows: hTPO-I:5 '-TTG TGA CCT CCG AGT CCTCAG-3 ' (SEQ ID NO:50) (position 178 to 198 among the SEQ ID NO:7) hTPO-N:5 '-AGG GAA GAG CGT ATA CTG TCC-3 ' (SEQ ID NO:51) (position 1 among the SEQ ID NO:7, the corresponding antisense primer of 005 to 1,025 sequence).

Use isotope-labeled probe, contain in the reaction soln identical in 42 ℃ of hybridization 20 hours with the prehybridization solution component at 500ml.At room temperature use 2 * SSC/0.1%SDS solution to wash 3 times the filter membrane of gained, washed one time 1 hour with 0.1 * SSC/0.1%SDS solution at 68 ℃ then through 5 minutes.Then with strengthening screen and X-OMAT ^TMAR5 film (being made by EastmanKodak) makes filter membrane through 16 hours radioautograph at-70 ℃.As a result, obtain 13 positive signal.On former flat board, collect the plaque that is equivalent to each positive signal approximately, then with on inoculating with the 15-cmNZYM flat board in the inoculation size that forms 1,000 plaque on each flat board.Prepare two duplicating films so that under condition same as described above, finish hybridization from the flat board of each gained.As a result, on all filter membranes of 13 groups, all detected positive signal.From the flat board of each gained, reclaim a plaque so that prepare phage DNA with the dull and stereotyped lysate method of describing among the Molecular Cloning.Contain the PCR of the primer of following sequence by use, detecting from 13 clones thus, whether the phage DNA sample of preparation exists the cDNA coding region.

HTPO-L:5 '-GGC CAG CCA GAC ACC CCG GCC-3 ' (SEQ ID No:52) (position 1 to 21 among the SEQ ID NO:6)

HTPO-F:5 '-ATG GGA GTC ACG AAG CAG TTT-3 ' (SEQ ID No:53) (antisense primer that is equivalent to position 127 to 147 sequences among the SEQ ID NO:6)

HTPO-P:5 '-TGC GTT TCC TGA TGC TTG TAG-3 ' (SEQ ID No:54) (position 503 to 523 among the SEQ ID NO:6)

HTPO-V:5 '-AAC CTT ACC CTT CCT GAG ACA-3 ' (SEQ ID No:55) (antisense primer that is equivalent to position 1,070 to 1,090 sequence among the SEQ ID NO:6)

When with these primers when finishing PCR, as if 5 among 13 clones contain from the complete amino acid coding region of cDNA prediction.These 5 the contained chromosomal DNA molecules of clone contain the similar length of an about 20kb, and preliminary restriction enzyme analysis through in advance shows that structure much at one.Therefore, screen such clone (clone λ HGT1), use the Southern engram analysis then.That is, the μ g DNA with limiting enzyme EcoRI or HindIII complete digestion clone λ HGT1 through 0.8% agarose gel electrophoresis, transfers to BIODYNE with the band on the gel then ^TMOn the ATRANSFER MEMBRANE (making) by PALL.The filter membrane dry air of gained 30 minutes was baked 2 hours in 80 ℃ in vacuum oven then.By containing 50% formaldehyde at 50ml, 5 * SSC, 5 * Denhardt ' s solution in the reaction soln of 1%SDS and 20 μ g/ml salmon sperm DNAs, is finished prehybridization in the 42 ℃ of filter membrane incubations that will handle thus 1 hour.For as probe, through pcr amplification people TPO cDNA fragment (178 to 1,025 base among the SEQ ID NO:7), purifying then, and with Random Primer DNA Labelling box (by Takara Shuzo manufacturing) with ³²The fragment of P mark purifying.Use isotope-labeled probe, contain in the reaction soln identical, finished hybridization through 20 hours in 42 ℃ with the prehybridization solution component at 50ml.At room temperature, with the filter membrane of gained with 2 * SSC/0.1%SDS solution through washing in 5 minutes 3 times, then at 68 ℃, washed again 1 time through 1 hour with 0.1 * SSC/0.1%SDS solution.Then with strengthening screen and X-OMAT ^TMAR5 film (Eastman Kodak makes) makes filter membrane through 16 hours radioautograph in-70 ℃.As a result, under the situation of HindIII digestion, observe single band of an about 10kb.Therefore, 10 μ g DNA with HindIII digestion clone λ HGT1, then through 0.8% agarose gel electrophoresis, downcut the band of 10kb from gel, with Prep-A-Gene DNA purification cassette (Bio-Rad makes) purifying, subclone is in the cloning vector pUC13 that has digested with HindIII in advance (Pharmacia makes) then.In this case, the high competence E.coli DH5 that produces with TOYOBO is as host strain.

In resulting clone, screening contains the segmental clone of 10kb Hind III, is called pHGT1.

The estriction map of phage clone λ HGT1 is listed among Figure 11.

＜embodiment 25 〉

Determine the nucleotide sequence of people TPO karyomit(e) clone pHGT1

The basic method of describing among the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989) of pressing is cultivated clone pHGT1 and plasmid DNA purification.Clone pHGT1 is contained overnight incubation in the LB substratum of 50 μ g/ml penbritins at 50ml.The cell of centrifugal collection gained is suspended in the aforesaid TEG-lysozyme soln of 4ml then.In this solution, add 8ml 0.2N NaOH/1%SDS solution earlier, add 6ml 3M potassium/5M acetic acid solution then to make cell suspension fully.After suspension was centrifugal, the supernatant liquor of handling gained with phenol/chloroform (1: 1) mixes with the Virahol of equal volume, and was centrifugal then.The particle of gained is dissolved in TE solution, and uses RNase, use phenol/chloroform (1: 1) to handle then, then ethanol sedimentation.The particle of gained is dissolved in the TE solution again, subsequently to wherein adding NaCl and polyoxyethylene glycol 3,000 so that its final concentration reaches 0.63M and 7.5% respectively.After centrifugal, particle is dissolved in TE solution, uses ethanol sedimentation then.Use this method, obtained the plasmid DNA pHGT1 of about 300 μ g.

With above-mentioned Taq Dye Deoxy ^TMTerminater Cycle Sequening box (AppliedBiosystems produces) is used for above-mentioned 373A dna sequencing instrument (Applied Biosystems produces) to determine the nucleotide sequence around the protein-coding region of cDNA nucleotide sequence prediction with the plasmid DNA of purifying thus.The definite thus nucleotide sequence and the aminoacid sequence (SEQ ID NO:8) of supposition in sequence table, have been listed.In this case, with the oligonucleotide that is used for the cDNA nucleotide sequence analysis among the embodiment 22 and with the interior sequence that obtains through its serial response analysis be the primer that the synthetic oligonucleotide of basic design is determined as nucleotide sequence.

As a result, find to contain from the complete coding region of the aminoacid sequence of SEQ IDNO:6 supposition, and the nucleotide sequence of coding region and SEQ ID NO:6's is in full accord by the chromosomal DNA that plasmid clone pHGT1 carries.In addition, count since 5 ' side in the zone that is equivalent to amino acid-coding exon, and containing 4 length is 231bp, 286bp, the intron of 1932bp and 236bp (Figure 11).Also have nucleotides sequence to be listed in the cDNA nucleotide sequence that is different from SEQ ID NO:7 on 3 positions, the position identical (different positions between the SEQ ID NO:6 and 7) of description among described 3 positions and the embodiment 22.Be the A (position 84) among the SEQ ID NO:7, A (position 740) and G (position 1198) are respectively C, T and A in SEQ ID NO:8.Therefore, the nucleotides sequence that discloses the people TPO cDNA clone pHTF1 that obtains among the embodiment 21 is listed in the nucleotide sequence that is different from human chromosome dna clone pHGT1 on 3 positions.Therefore, for whether these sudden changes of analyzing in the cDNA clone pHTF1 sequence reflect chromosomal DNA sequence, other 4 clones' nucleotide sequence among 5 karyomit(e) clones that determine to obtain separately through screening.With the phage DNA sample for preparing according to the dull and stereotyped lysate method of describing among the Molecular Cloning, carry out sequential analysis through direct nucleotide sequencing method.With aligning primer used among the embodiment 22 (in can analysis of nucleotide sequences on the basis of that part of sequences in aforementioned 3 sudden change positions synthetic), through aforesaid 373A dna sequencing instrument (making) and aforesaid Taq Dye Deoxy by Applied Biosystems ^TMTerminaterCycle Sequening box (being made by Applied Biosystems) is finished each clone's order-checking.The nucleotide sequence of finding all 4 clones is identical with SEQ ID NO:6 all.In these 4 clones, the Nucleotide that is equivalent on the position 84 and 740 of SEQ ID NO:7 is replaced by C and T respectively.But is G in the position among 1,198, two clones, is A among two clones in addition.In other words, this shows that original chromosome DNA had two types nucleotide sequence originally.At present, this species diversity in the not clear nucleotide sequence is to result from homologous chromosomes or polygene.In addition, the difference in this explanation nucleotide sequence may be caused by racial difference.Because poly (A from the Clontech purchase ⁺) RNA is the Caucasian, and chromosomal DNA is Japanese.

The inventor will be preserved in the national bio-science and the human body technical institute of Japan by the carrier pHGT1 that E.coli bacterial strain DH5 carries with registration number No.TERM BP-4616 on March 24th, 1994, industrial science and technology agency department, Ministry of International Trade and Industry.

＜embodiment 26 〉

The activity of expressing human TPO chromosomal DNA and definite TPO in the COS1 cell

The plasmid clone pHGT1 that is obtained by subclone contains 4 EcoRI recognition sequences altogether, and 3 at insertion portion, and 1 in carrier.Nucleotide sequence analysis shows, contains the proteinic coding region of whole person TPO in the dna fragmentation of an about 4.3kb, and this fragment is between the EcoRI recognition sequence and the EcoRI recognition sequence in the carrier of the most close insertion fragment 5 ' side.Therefore, this fragment is linked to each other with the expression vector pEF18S that EcoRI handles, and obtain 4 people TPO expression plasmid pEFHGTE#1-4 (seeing Figure 11).By preparing these plasmid DNA, finish and express experiment.Substantially press the method plasmid DNA purification of describing among the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989), obtain the plasmid DNA of about 250 μ g thus.

Press the method for embodiment 11, with the clone pEFHGTE#1-4 transfection COS1 cell that obtains thus.That is,, finish transfection by 10 μ g plasmid DNA with the DEAE-dextran method that comprises that chloroquine is handled.The COS1 cell of transfection 37 ℃ of incubations 3 days, is collected culture supernatants then.

To the thorough dialysis culture thing of IMDM substratum supernatant liquor, then with the estimation of rat CFU-MK detection system.In expressing 4 clones' (pEFHGTE#1-4) COS1 cell conditioned medium liquid respectively, the TPO of detection activity is that dosage relies on mode.On the contrary, in the COS1 cell conditioned medium liquid of single expression plasmid pEF18S, there is not the TPO activity.In Figure 12 a, provided the representative data that obtains with pEFHGTE#1.In the M-07e detection system, obtained similar result.The COS1 cell conditioned medium liquid of expressing 4 clones (pEFHGTE#1-4) respectively relies on the growth that mode obviously increases the M-07e cell with dosage.Listed the representative data that obtains with pEFHGTE#1 among Figure 12 b.

These presentation of results plasmid clones pEFHGTE#1-4 has functional people TPO chromosomal DNA.

＜embodiment 27 〉

Preparation people TPO absence type DNA also expresses and definite TPO activity in the COS1 cell

Presentation of results among the embodiment 18, even after removing its 3rd carboxyl (its carboxyl third), people TPO also can show its biological activity.Therefore, in order further to estimate biologically-active moiety, test and lack derivative.In the present embodiment, detect TPO disappearance derivative and bring into play the bioactive ability of external TPO, described derivative has lacked several 20,40,60 or 68 amino acid of C-terminal of the TPO protein (amino acid/11-231) from the pHT1-231 coding.The shortest derivative (amino acid/11-163) has still comprised the aminoacid sequence that is equivalent to the TP2/3 of rat plasma TPO described in the embodiment 2.As template, the synthetic oligonucleotide is as primer, through PCR preparation disappearance plasmid with the DNA of the plasmid clone pHT1-231 that obtains among the embodiment 18.The sequence of the primer that PCR is used is as follows:

hTPO-5：5’-TTT?GAA?TTC?GGC?CAG?CCA?GAC?ACC?CCG?GCC-3’(SEQ?ID?NO：56)

(by what obtain on the sequence that an EcoRI recognition sequence is added to the position 1 to 21 among the SEQ ID NO:4; It is identical with the sequence described in Fig. 9);

hTPO-S：5’-TTT?GCG?GCC?GCT?CAT?TAG?CTG?GGG?ACA?GCT?GTGGTG?GGT-3’(SEQ?ID?NO：57)

(the antisense primer that is equivalent to the sequence of position 555 to 576 among the SEQ ID NO:4, its method for making is by having added two terminator codon TAA and TGA and a NotI recognition sequence, to be used to prepare the disappearance derivative of coding site 1 to 163 amino-acid residue);

hTPO-4：5’-TTT?GCG?GCC?GCT?CAT?TAC?AGT?GTG?AGG?ACT?AGAGAG?GTT?CTG-3’(SEQ?ID?NO：58)

(antisense primer that is equivalent to the sequence of position 576 to 600 among the SEQ ID N0:4, its method for making are by adding two terminator codon TAA and TGA and a NotI recognition sequence, to be used to prepare the disappearance derivative of coding site 1 to 171 amino-acid residue);

hTPO-30：5’-TTT?GCG?GCC?GCT?CAT?TAT?CTG?GCT?GAG?GCA?GTGAAG?TTT?GTC-3’(SEQ?ID?NO：59)

(the antisense primer that is equivalent to the sequence of position 636 to 660 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, the amino-acid residue of described disappearance derivative coding site 1 to 191); With

hTPO-2：5’-TTT?GCG?GCC?GCT?CAT?TAC?AGA?CCA?GGA?ATC?TTGGCT?CTG?AAT-3’(SEQ?ID?NO：60)

(the antisense primer that is equivalent to the sequence of position 696 to 720 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, the amino-acid residue of described disappearance derivative coding site 1 to 211).

As template, each 10 μ M is synthetic hTPO-5 (being used for 5 ' side) and hTPO-2 thus with the plasmid DNA of the clone pHT1-231 that obtains among the 1 μ g embodiment 18 ,-3 ,-4 and-S (being used for 3 ' side) is as primer and band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR test kit (being made by Takara Shuzo) with 100 μ l volumes, uses GeneAmp ^TMPCRSystem 9600 (being made by PERKIN-ELMER) repeats 20 circulations altogether, and each circulation is contained in 95 ℃ of sex change 1 minute, in 65 ℃ of annealing 1 minute and 72 ℃ synthetic 1 minute, and then in 72 ℃ of incubations 7 minutes, thereby finish PCR.With the required band that limiting enzyme EcoRI and NotI digestion are obtained by each PCR, the digestion product with gained carries out 1% sepharose (being made by FMC BioProducts) electrophoresis to separate the main dna fragmentation with desired size by each pcr amplification then.With Prep-A-Gene DNA purification cassette (making) purifying separated DNA fragment thus by Bio-Rad, then with its subclone in advance in the expression vector pEF18S of identical restriction enzyme treatment.In this case, the high competent E.coli DH5 that makes with TOYOBO is as host strain.From gained transformant from each PCR, screen 4 to 5 segmental clones of insertion that contain required size with basically by MolecularCloning (Sambrook et al., Cold Spring Harbor Laboratory Prass, 1989) method described in prepares the plasmid DNA sample.In a series of aforesaid operations, obtain the plasmid DNA sample from following disappearance derivative: the disappearance derivative (pHT1-163#1-5) of coding site 1 to 163 amino-acid residue, the disappearance derivative (pHT1-171#1-4) of coding site 1 to 171 amino-acid residue, the disappearance derivative (pHT1-211#1-4) of the disappearance derivative (pHT1-191#1-4) of coding site 1 to 191 amino-acid residue and coding site 1 to 211 amino-acid residue.Total length amplification region to each plasmid DNA is carried out nucleotide sequence analysis, finds that the nucleotides sequence shown in it and the SEQ ID NO:4 shows consistence completely.

Press the method for embodiment 11, with the clone's transfection COS1 cell that obtains thus.That is: the DEAE-dextran method through comprising that chloroquine is handled is carried out transfection with the plasmid DNA sample of each 10 μ g.With the COS1 cell cultures of transfection 3 days, reclaim culture supernatants then.

To the thorough dialysis culture thing of IMDM substratum supernatant liquor, then with the assessment of rat CFU-MK detection system.Expressing pHT1-211 respectively, pHT1-191, in the COS1 cell conditioned medium liquid of pHT1-171 or pHT1-163, detecting the TPO activity is that dosage relies on mode.Use pHT1-211#, the representative data that pHT1-191# and pHT1-171#2 obtain is listed in Figure 13 a, and has listed the data that obtained by pHT1-163#2 in Figure 13 b.In the M-07e detection system, obtained similar result.Express pHT1-211 respectively, pHT1-191, the COS1 cell conditioned medium liquid of pHT1-171 or pHT1-163 obviously improves the propagation of M-07e cell.Listed the representative data of using pHT1-211#1, pHT1-191#1, pHT1-171#2 to obtain among Figure 14.

Half disappearance people TPO still can keep its external activity even these results show the above C-terminal of Ser (the 163rd), and the biologically-active moiety that convincingly demonstrates people TPO is positioned at, and to terminate in Ser (position 163) be half N-terminal on boundary.

＜embodiment 28 〉

Preparation and expression in the COS1 cell and the activity of C-terminal deletion type people TPO

Show its active necessary zone in order to analyze for people TPO protein, the disappearance derivative that obtains from embodiment 27 further lacks the C-end amino acid, detects the TPO activity of expressing in the COS1 cell then.With the plasmid clone pEF18S-HL34 that obtains among the embodiment 16, prepare expression plasmid since the nucleotide sequence of the C-terminal amino acid residue of 163 Ser by disappearance coding.Carried out the structure of these disappearance plasmids effectively with PCR.The primer sequence for preparing for PCR is used is as follows:

hTPO-5：5’-TTT?GAA?TTC?GGC?CAG?CCA?GAC?ACC?CCG?GCC-3’(SEQ?ID?NO：61)

(by what prepare in the sequence that the EcoRI recognition sequence is added to position 1 to 21 among the SEQ ID NO:4; Listed identical sequence among the embodiment 18);

hTPO-150：5’-TTT?GCG?GCC?GCT?CAT?TAG?AGG?GTG?GAC?CCTCCT?ACA?AGC?AT-3’(SEQ?ID?NO：62)

(corresponding to the antisense primer of the sequence of position 514 to 537 among the SEQ ID NO:4, two used terminator codon TAA of preparation deletion mutant and TGA and NotI recognition sequence prepare by adding, the amino-acid residue of described deletion mutant coding site 1 to 150);

hTPO-151：5’-TTT?GCG?GCC?GCT?CAT?TAG?CAG?AGG?GTG?GACCCT?CCT?ACA?A-3’(SEQ?ID?NO：63)

(corresponding to the antisense primer of the sequence of position 518 to 540 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, described disappearance derivative coding site 1 to 151 amino-acid residue);

hTPO-153：5’-TTT?GCG?GCC?GCT?CAT?TAC?CTG?ACG?CAG?AGGGTG?GAC?CC-3’(SEQ?ID?NO：64)

(corresponding to the antisense primer of the sequence of position 526 to 546 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, described disappearance derivative coding site 1 to 153 amino-acid residue);

hTPO-154：5’-TTT?GCG?GCC?GCT?CAT?TAC?CGC?CTG?ACG?CAGAGG?GTG?GA-3’(SEQ?ID?NO：65)

(corresponding to the antisense primer of the sequence of position 529 to 549 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, described disappearance derivative coding site 1 to 154 amino-acid residue);

hTPO-155：5’-TTT?GCG?GCC?GCT?CAT?TAG?GCC?CGC?CTG?ACGCAG?AGG?GT-3’(SEQ?ID?NO：66)

(corresponding to the antisense primer of the sequence of position 532 to 552 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, described disappearance derivative coding site 1 to 155 amino-acid residue);

hTPO-156：5’-TTT?GCG?GCC?GCT?CAT?TAT?GGG?GCC?CGC?CTGACG?CAG?AG-3’(SEQ?ID?NO：67)

(corresponding to the antisense primer of the sequence of position 535 to 555 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, described disappearance derivative coding site 1 to 156 amino-acid residue);

hTPO-157：5’-TTT?GCG?GCC?GCT?CAT?TAG?GGT?GGG?GCC?CGCCTG?ACG?CA-3’(SEQ?ID?NO：68)

(corresponding to the antisense primer of the sequence of position 538 to 558 among the SEQ ID NO:4, two used terminator codon TAA of preparation disappearance derivative and TGA and NotI recognition sequence prepare by adding, the amino-acid residue of described disappearance derivative coding site 1 to 157).

With the plasmid DNA of the 1 μ g that obtains among the embodiment 16 clone pEF18S-HL34 as template, with each 10 μ M thus the synthetic oligonucleotide (hTPO-5 is used for 5 ' side, hTPO-150,-151 ,-153 ,-154,-155 ,-156 and-157 are used for 3 ' side) finish PCR as primer.With containing AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR test kit (being made by Takara Shuzo) utilizes GeneAmp ^TMPCR System 9600 (being made by PERKIN-ELMER) repeats 20 circulations altogether, whenever be circulated in 95 ℃ of sex change 1 minute, annealed 1 minute and synthesized 1 minute, thereby in 100 μ l volumes, finished the PCR reaction in 7 minutes in 72 ℃ of final incubations then for 66 ℃ at 72 ℃.Digest the required band that obtains by each PCR with limiting enzyme EcoRI and NotI, make the digestion product of gained carry out 1% sepharose (making) electrophoresis then to separate the main dna fragmentation that obtains by each PCR with required size by FMCBioProducts.With the dna fragmentation of Prep-A-Gene DNA purification cassette (making) purifies and separates by Bio-Rad, then with its subclone in the expression vector pEF18S that uses identical restriction enzyme treatment in advance.In this case, use the high competence E.coli DH5 that produces by TOYOBO as host strain.From gained transformant from each PCR test, screen 3 to 5 segmental clones of insertion that contain required size so that substantially by Molecular Cloning (Sambrook etal., Cold Spring Harbor Laboratory Press, 1989) method prepares the plasmid DNA sample described in.Through a series of described operations, from following disappearance derivative, prepare plasmid DNA: the disappearance derivative (pHT1-150#21 of coding site 1 to 150 amino-acid residue, 22 and 25), disappearance derivative (the pHT1-151#16 of coding site 1 to 151 amino-acid residue, 17 and 18), the disappearance derivative (pHT1-153#1 to 5) of coding site 1 to 153 amino-acid residue, the disappearance derivative (pHT1-154#1 to 5) of coding site 1 to 154 amino-acid residue, the disappearance derivative (pHT1-155#1 to 5) of coding site 1 to 155 amino-acid residue, the disappearance derivative (pHT1-157#1 to 5) of the disappearance derivative (pHT1-156#1 to 5) of coding site 1 to 156 amino-acid residue and coding site 1 to 157 amino-acid residue.

In the plasmid DNA sample of these purifying, by utilizing Taq Dye Deory ^TMTerminater Cycle order-checking box (Applied Biosystems) 373A dna sequencing instrument (making) detection pHT1-50#21 by Applied Biosystems, 22 and 25 and pHT1-151#16,17 and 18 sequence, confirm thus that in the full length nucleotide sequence TPOcDNA sequence of expection does not replace.

Press the method for embodiment 11, use clone's transfection COS1 cell of gained respectively.That is: the DEAE-dextran method by comprising that chloroquine is handled is finished transfection with the plasmid DNA sample of each 10 μ g, cultivates and reclaims culture supernatants after 3 days.With the culture supernatants of foregoing IMDM cultivation and dialysis gained, then with the assessment of M-07e detection system.In the COS1 cell culture supernatant liquid of corresponding clone's transfection of using coding C-terminal deletion derivative, detect the TPO activity, described disappearance derivative is respectively by 1 to 151 amino acids, 1 to 153 amino acids, 1 to 154 amino acids, 1 to 155 amino acids, 1 to 156 amino acids or 1 to 157 amino acids are formed.All these derivatives 151 all contain the Cys residue in the position.But do not detect the TPO activity in the COS1 cell culture supernatant liquid of the clone's transfection that lacks derivative with the C-end side is made up of the 1-150 amino acids of coding, the Cys residue on 151 in this derivative has also been lacked.

＜embodiment 29 〉

Preparation and expression in the COS1 cell and the activity of N-terminal deletion type people TPO

Show its active necessary zone in order to analyze TPO protein, further lack the-terminal amino acid of the disappearance derivative that obtains among the embodiment 28, detect the active expression of TPO of gained disappearance derivative then.With the plasmid clone pHT1-163 that obtains among plasmid clone pEF18S-HL34 that obtains among the embodiment 16 and the embodiment 27, the nucleotide sequence by the-terminal amino acid residue of disappearance behind the coded signal sequence prepares expression plasmid.Carry out the structure of these disappearance plasmids effectively with PCR.As follows in PCR, using prepared primer sequence:

hTPO-5：5’-TTT?GAA?TTC?GGC?CAG?CCA?GAC?ACC?CCG?GCC-3’(SEQ?ID?NO：69)

(by making in the sequence that the EcoRI recognition sequence is added to position 1 to 21 among the SEQ ID NO:4; Listed identical sequence among the embodiment 18);

hTPO3：5’-TTT?GCG?GCC?GCT?CAT?TAT?TCG?TGT?ATC?CTG?TTCAGGTATCC-3’(SEQ?ID?NO：70)

(corresponding to the antisense primer of the sequence of position 757 to 780 among the SEQ ID NO:4, two terminator codon TAA and TGA and NotI recognition sequence prepare by adding; The synthetic identical sequence is used to prepare the disappearance derivative of coding site 1 to 231 amino-acid residue);

hTPO-S：5’-TTT?GCG?GCC?GCT?CAT?TAG?CTG?GGG?ACA?GCT?GTGGTG?GGT-3’(SEQ?ID?NO：71)

(corresponding to the antisense primer of the sequence of position 555 to 576 among the SEQ ID NO:4; Be used to prepare the disappearance derivative of coding site 1 to 1 63 amino-acid residue);

hTPO-13：5’-AGT?AAA?CTG?CTT?CGT?GAC?TCC?CAT?GTC?CTT?CACAGC?AGA?CTG?AGC?CAG?TG-3’(SEQ?ID?NO：72)

(the position 124 to 173 among the SEQ ID NO:4; Be used to prepare the derivative of the amino-acid residue that lacks position 1 to 12);

hTPO-13R：5’-CAT?GGG?AGT?CAC?GAA?GCA?GTT?TAC?TGG?ACAGCG?TTA?GCC?TTG?CAG?TTA?G-3’(SEQ?ID?NO：73)

(, being used to prepare the derivative of the amino-acid residue that has lacked position 1 to 12) corresponding to the antisense primer of the sequence of position 64 to 87 among the SEQ ID NO:4 and 124 to 148;

hTPO-7：5’-TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGTGAC?TCC?CAT?GTC?CTT?C-3’(SEQ?ID?NO：74)

(position 106 to 154 among the SEQ ID NO:4 is used to prepare the derivative of the amino-acid residue that lacks position 1 to 6);

hTPO-7R：5’-TTT?ACT?GAG?GAC?TCG?GAG?GTC?ACA?GGA?CAGCGT?TAG?CCT?TGC?AGT?TAG-3’(SEQ?ID?NO：75)

(, being used for the amino acid whose derivative that preparation has lacked position 1 to 6) corresponding to the antisense primer of the sequence of position 64 to 87 among the SEQ ID NO:4 and 106 to 129;

hTPO-8：5’-GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?GACTCC?CAT?GTC?CTT?CAC?A-3’(SEQ?ID?NO：76)

(the position 109 to 157 among the SEQ ID NO:4; Be used to prepare the derivative of the amino-acid residue that has lacked position 1 to 7); With

hTPO-8R：5’-CAG?TTT?ACT?GAG?GAC?TCG?GAG?GTC?GGA?CAGCGT?TAG?CCT?TGC?AGT?TAG-3’(SEQ?ID?NO：77)

(corresponding to the antisense primer of the sequence of position 64 to 87 among the SEQ ID NO:4 and 109 to 132; Be used to prepare the derivative of the amino-acid residue that has lacked position 1 to 7).

(1) preparation has lacked the derivative (pHT13-231) of the amino-acid residue of position 1 to 12

With the plasmid DNA of the 1.4 μ g that obtain among the embodiment 18 clone pEF18S-HL34 as template and each 5 μ M thus the synthetic oligonucleotide (in a combination, hTPO-13 and hTPO-3 are arranged, another in conjunction with in hTPO-5 and hTPO-13R are arranged) carry out PCR as primer.With containing AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase (making) by Takara Shuzo ^TMThe PCR test kit, GeneAmp ^TMPCR System 9600 (being made by PERKIN-ELMER) after 5 minutes, repeats 30 circulations in 95 ℃ of sex change altogether, each circulation comprises 95 ℃ of sex change 1 minute, 65 ℃ of annealing 1 minute and 72 ℃ synthetic 1 minute, last 72 ℃ of incubations 7 minutes again, thus in 100 μ l volumes, finish the PCR reaction.Make each PCR product go up electrophoresis to separate the main dna fragmentation of using Prep-A-Gene DNA purification cassette (making) purifying subsequently, be dissolved in then in the 15 μ l TE damping fluids with expection size by Bio-Rad at 1.2% sepharose (producing) by FMC BioProducts.After this, the gained solution with each 1 μ l is that template is finished second PCR.

Synthetic primer (hTPO-5 and hTPO3) with each 5 μ M is finished second PCR.With containing AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase (making) by Takara Shuzo ^TMThe PCR test kit, GeneAmp ^TMPCR System 9600 (making) by PERKIN-ELMER, after 5 minutes, repeat 30 circulations in 95 ℃ of sex change altogether, each circulation is included in 95 ℃ of sex change 1 minute, synthetic 1 minute of 60 ℃ of annealing 1 minute and 72 ℃, thus last 72 ℃ again incubation in 100 μ l volumes, finished PCR in 7 minutes and react.With each PCR product carry out 1.2% sepharose (making) electrophoresis by FMC BioProducts with separate with after the main dna fragmentation with expection size of Prep-A-Gene DNA purification cassette (making) purifying by Bio-Rad be dissolved in then in the 15 μ lTE damping fluids.After limiting enzyme EcoRI and NotI digestion, use the solution of the phenol/chloroform extraction gained of equal volume, carry out ethanol sedimentation then.After centrifugal, the precipitation of gained is dissolved in the 15 μ lTE damping fluids, subclone is in the expression vector pEF18S that uses identical restriction enzyme treatment in advance then.In this case, the high competence E.coli DH5 that makes with TOYOBO is as host strain.Transformant from gained, screening contains expect that segmental 45 of the insertion of size clones so that substantially by Molecular Cloning (Sambrook et al., ColdSpring Harbor Laboratory Press, 1989) method described in, preparation plasmid DNA sample.In this way, can obtain the plasmid DNA of the disappearance derivative (pHT13-231) of encode protein molecule, in described protein molecule, from the original acid residue of position 1 to 231, lack the amino-acid residue of position 1 to 12.With primer hTPO-5 and hTPO3 these 45 clones are carried out PCR, confirm in 8 clones, the insertion fragment with expection size is approximately arranged.Utilize Taq Dye Deoxy ^TMTerminater Cycle Sequening box (AppliedBiosystems) detects wherein 3 clones' sequence with 373A dna sequencing instrument (being made by Applied Bisystems), obtain a clone pHT13-231#3 thus, it contains designed TPOcDNA and the desired disappearance that replaces etc. in whole nucleotide sequence.

(2) prepare derivative (pHT7-163), wherein lack the amino-acid residue of position 1 to 6

Although because in above-mentioned steps (1), design the 231st amino acids as being used to prepare the proteinic C-terminal of the TPO that lacks derivative, but find even when further lacking C-terminal amino acid, still can express the TPO activity, therefore in this case, be used to prepare the C-terminal that lacks derivative by the conduct of the 163rd amino acids.For the same reason, in step (3) subsequently, also use 163 amino acids as C-terminal.As template, the synthetic oligonucleotide of each 5 μ M (hTPO-7 and hTPO-S combination, hTPO-5 and hTPO-7R in conjunction with) carries out PCR as primer with the 1.4 μ g plasmid DNA of the clone pHT1-163 that obtains among the embodiment 27.With having AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase (making) by Takara Shuzo ^TMThe PCR test kit is through GeneAmp ^TMPCR System 9600 (being made by PERKIN-ELMER) is in 100 μ l volumes, in 95 ℃ of sex change after 5 minutes, repeat 30 circulations altogether, each circulation is included in 95 ℃ of sex change 1 minute, annealed 1 minute and synthesized 1 minute for 65 ℃ at 72 ℃, then 72 ℃ of last incubations 7 minutes, thereby finish the PCR reaction.Make each PCR product have the main dna fragmentation of desired size with separation through 1.2% sepharose (making) electrophoresis by FMC BioProducts, use Prep-A-Gene DNA purification cassette (making) purifying subsequently, be dissolved in then in the 15 μ lTE damping fluids by Bio-Rad.Finish PCR for the second time with the solution that each 1 μ l prepares thus as template.

Synthetic primer (hTPO-5 and hTPO-S) with each 5 μ M carries out the PCR second time.With band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase (making) by Takara Shuzo ^TMThe PCR test kit is through GeneAmp ^TMPCR System 9600 (being made by PERKIN-ELMER) is in 100 μ l volumes, in 95 ℃ of sex change after 5 minutes, repeat 30 circulations altogether, each circulation is included in 95 ℃ of sex change 1 minute, 60 ℃ of annealing were synthesized 1 minute in 1 minute and 72 ℃, then 72 ℃ of last incubations 7 minutes, thereby finish the PCR reaction.Make each PCR product have the main dna fragmentation of desired size with separation through 1.2% sepharose (making) electrophoresis by FMC BioProducts, use Prep-A-Gene DNA purification cassette (making) purifying subsequently, be dissolved in then in the 15 μ lTE damping fluids by Bio-Rad.After limiting enzyme EcoRI and NotI digestion, with the phenol/chloroform of equal volume and the solution of the extraction of ethanol sedimentation subsequently gained.After centrifugal, with the resolution of precipitate of gained in 15 μ lTE damping fluids, then with its subclone to the expression vector pEF18S that digests with identical restriction enzyme in advance.In the case, with high competence E.coli DH5 (by TOYOBO preparation) as host strain.Transformant from gained, screen 30 segmental clones of insertion that contain required size so that substantially by Molecular Cloning (Sambrook etal., Cold Spring Harbor Laboratory Press, 1989) method of describing in prepares the plasmid DNA sample.In this way, can obtain the plasmid DNA of the disappearance derivative (pHT7-163) of encode protein molecule, in described protein molecule, from SEQ ID NO:4, lack 1 to 6 amino-acid residue in the original acid residue of position 1 to 163.When with primer hTPO-5 and hTPO-S, make these clones behind PCR, confirm in all clones, all to contain the institute that has an appointment and expect big or small insertion fragment.For these, by using Taq DyeDeoxy ^TMThe 373ADNA sequenator of Terminater Cycle Sequening box (Applied Biosystems) (being made by Applied Biosystems) detects wherein 3 clones' sequence, obtain 2 clones thus, pHT7-163#4 and #29, the desired disappearance that both contain designed TPOcDNA sequence respectively and replace on the complete nucleotide sequence etc.

(3) preparation has wherein lacked the derivative (pHT8-163) of 1-7 amino acids residue

Press the essentially identical method of above-mentioned example that lacks the derivative (pHT7-163) of 1-6 amino acids residue with preparation, preparation has lacked the derivative (pHT8-163) of 1-7 amino acids residue.As template, the synthetic oligonucleotide of 5 μ M (hTPO-8 and hTPO-S combination, hTPO-5 and hTPO-8R in conjunction with) carries out PCR as primer with the 1.4 μ g plasmid DNA of the clone pHT1-163 that obtains among the embodiment 27.With band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase (making) by TakaraShuzo ^TMThe PCR test kit is through GeneAmp ^TMPCR System9600 (being made by PERKIN-ELMER) in 100 μ l volumes, after 5 minutes, repeats 30 circulations in 95 ℃ of sex change altogether, each circulation comprises 95 ℃ of sex change 1 minute, synthetic 1 minute of 65 ℃ of annealing 1 minute and 72 ℃ 72 ℃ of last incubations 7 minutes, react thereby finish PCR then.The main dna fragmentation that makes each PCR product have the expection size with separation through 1.2% sepharose (making) electrophoresis by FMC BioProducts, use Prep-A-Gene DNA purification cassette (making) purifying subsequently, be dissolved in then in the 15 μ lTE damping fluids by Bio-Rad.After this, carry out the PCR second time with each prepared solution of 1 μ l as template.

Carry out the PCR second time with each synthetic primer of 5 μ M (hTPO-5 and hTPO-S).With band AmpliTaq ^TMThe GeneAmp of archaeal dna polymerase ^TMPCR Reagent Kit (TakaraShuzo manufacturing) utilizes GeneAmp ^TMPCR System 9600 (PERKIN-ELMER production) after 5 minutes, repeats 30 circulations 95 ℃ of sex change, each circulation is included in 95 ℃ of sex change 1 minute, in 60 ℃ of annealing 1 minute and in 72 ℃ synthetic 1 minute, then 72 ℃ of last incubations 7 minutes, thereby finish the PCR reaction.The main dna fragmentation that makes each PCR product have the expection size with separation through 1.2% sepharose (producing) electrophoresis by FMC BioProducts, use Prep-A-Gene DNA purification cassette (producing) purifying subsequently, be dissolved in then in the 15 μ lTE damping fluids by Bio-Rad.After limiting enzyme EcoRI and NotI digestion, with the phenol/chloroform of equal volume and the solution of the extraction of ethanol sedimentation subsequently gained.After centrifugal, gained precipitation is dissolved in the 15 μ lTE damping fluids, then with its subclone in the expression vector pEF18S that has digested with identical restriction enzyme in advance.In this example, with high competent E.coli DH5 (making) by TOYOBO as host strain.Transformant from gained, screen 30 contain expect that the segmental clone of insertion of size is so that substantially by Molecular Cloning (Sambrook et al., Cold Spring Harbor Laboratory Press, 1989) method of describing in prepares the plasmid DNA sample.In this way, can obtain the plasmid DNA of the disappearance derivative (pHT8-163) of encode protein molecule, in described protein molecule, from the 1-163 position original acid residue of SEQ ID NO:4, lack the amino-acid residue of 1-7 position.With primer hTPO-5 and hTPO-S, make these clones behind PCR, confirm in all clones, all to contain the insertion fragment of the expection size of having an appointment.By using Taq Dye Deoxy ^TMThe 373A dna sequencing instrument of Terminater Cycle Sequening box (Applied Biosystems) (being made by Applied Biosystems) detects wherein 3 clones' sequence, obtain 2 clones thus, pHT8-163#33 and #48, the expection disappearance that contains the TPO cDNA sequence of design respectively and on the complete nucleotide sequence, replace etc.

(4) expression deletion derivative and confirm the TPO activity in the COS1 cell

Press the method for embodiment 11, respectively with the deletion clone transfection COS1 cell that obtains thus.Promptly with the DEAE-dextran method that comprises that chloroquine is handled, the plasmid DNA sample of each 10 μ g is finished transfection, cultivates after 3 days, reclaims culture supernatants.The culture supernatants that obtains is thus thoroughly dialysed to aforesaid IMDM substratum, then with the assessment of M-07e detection system.

As a result, detect weak in the culture supernatants of COS1 cell but tangible TPO activity, described COS1 cell is clone's transfection of the disappearance derivative be made up of the 7-163 amino acids with coding.Yet, in COS1 cell culture supernatant liquid, do not detect the TPO activity with clone's conversion of the derivative formed by 8-163 amino acids or 13-231 amino acids of coding.

＜embodiment 30 〉

The people TPO cDNA plasmid (pHTP1) of preparation total length

The expression vector that structure contains the whole amino acid of the people TPO cDNA coding region of being supposed among the SEQ ID NO:6 is expressed at mammalian cell being used for.

In order to prepare the dna fragmentation that covers whole people TPO cDNA coding region, finish PCR with following method.

The nucleotide sequence of used primer is as follows:

HTPO-1:5 '-TTG TGA CCT CCG AGT CCT CAG-3 ' (SEQ ID NO:78) (position 105 to 125 among the SEQ ID NO:6);

SA:5 '-CAG GTA TCC GGG GAT TTG GTC-3 ' (SEQ ID NO:79) (with respect to the antisense primer of the sequence of position 745-765 among the SEQ ID NO:6); With

HTPO-P:5 '-TGC GTT TCC TGA TGC TTG TAG-3 ' (SEQ ID NO:80) (position 503 to 523 among the SEQ ID NO:6); With

hTPO-KO：5’-GAG?AGA?GCG?GCC?GCT?TAC?CCT?TCC?TGA?GACAGA?TT-3’(SEQ?ID?NO：81)

(by a restriction enzyme NotI recognition sequence and GAGAGA sequence (SEQ ID NO:82) being added to the sequence for preparing in the antisense sequences with respect to the sequence of position 1066 to 1086 among the SEQ ID NO:6).

Carry out the PCR first time with the clone pEF18S-HL34 that obtains among the 300ng embodiment 16 as template.With the primer hTPO-1 of each 0.5 μ M and the Vent R of SA and 1 unit ^TMArchaeal dna polymerase (making) by New England BioLabs, finish PCR (repeat 30 circulations altogether, each the circulation be included in 96 ℃ of incubations 1 minute, 62 ℃ 1 minute and 72 ℃ 1 minute, then 72 ℃ of last incubations 7 minutes) final concentration of reaction soln component is as follows: 10mMKCl, 10mM (NH ₄) ₂SO ₄, 20mM Tris-HCl (pH 8.8), 2mM MgSO ₄, 0.1%Triton X-100 and 200 μ M dNTP mixtures.

The commercially available poly (A) that 1mg is obtained from people's normal hepatocytes ⁺RNA goods (by the Clontech preparation) were 70 ℃ of heating 10 minutes, rapidly in cooled on ice, then with 10mM DTT, 500 μ MdNTP mixtures, 25ng random primer (by Takara Shuzo preparation), 10 RNase of unit inhibitor (by the Boehringer-Mannheim preparation) and 200 SuperScript of unit ^TMII RNaseH ^-(being made by LIFE TECHNOLOGIES) mixes, then 37 ℃ of incubations 1 hour with synthetic cDNA.After this, with the reaction soln of the synthetic cDNA of 1/20 volume as template, each 2.5 μ M primer hTPO-P and hTPO-KO and 2.5 AmpliTaq of unit ^TMArchaeal dna polymerase (Takara Shuzo manufacturing) carries out the PCR second time (repeat 30 circulations altogether, each circulation was included in 96 ℃ of incubations 1 minute, 58 ℃ of 1 minute and 72 ℃ 1 minute).

The first time that makes gained respectively and PCR solution for the second time through 1% agarose gel electrophoresis with separates separately contain the big or small corresponding main dna fragmentation of expection, use Prep-A-GeneDNA purification cassette (by the Bio-Rad purifying) purifying subsequently.After this, finish PCR for the third time with the solution that obtains thus as template respectively.Vent R with 1 unit ^TMDNA polymkeric substance (being made by NewEngland BioLabs) carries out this reaction (96 ℃ of heating 2 minutes, repeat 3 circulations then altogether, every circulation was included in 96 ℃ of incubations 2 minutes and 72 ℃ of incubations 2 minutes, then at 72 ℃ of incubations 7 minutes again).The gained reaction soln is mixed with hTPO-1 and the hTPO-KO of each 1 μ M, 96 ℃ of heating 2 minutes, then through the reaction of 25 round-robin, every circulation be included in 96 ℃ 1 minute, 62 ℃ of 1 minute and 72 ℃ of incubations of 1 minute are at last at 72 ℃ of incubations 7 minutes again.With the water saturated phenol-chloroform of equal volume, use the reaction soln of the chloroform extraction gained of equal volume then, use ethanol sedimentation (2.5 volume ethanol contain the glycogen that 0.3M sodium-acetate and 0.5 μ l are made by Boehriger-Mannheim) to handle extract then, to reclaim DNA.DNA with restriction enzyme BamHI and NotI digestion recovery, then through 1% agarose gel electrophoresis, with isolating thus the master tape of Prep-A-Gene DNA purification cassette (Bio-Rad manufacturing) purifying, with the pBluescriptII SK of restriction enzyme BamHI and NotI digestion in advance with expection size ⁺Carrier (being made by Stratagene) links to each other, and is transformed into then among the high competent E.coliDH5 (being made by TOYOBO).4 clones of screening are with preparation plasmid DNA sample from the clone of gained.By utilizing Taq Dye Deoxy ^TMThe 373A dna sequencing instrument of Terminater Cycle Sequening box (Applied Biosystems) (being made by Applied Biosystems) detects the sequence of the plasmid DNA sample of purifying, obtain a clone thus, pBLTP, the TPO cDNA sequence that contains design does not replace in the nucleotide sequence between BamHI and NotI in the zone.

With limiting enzyme EcoRI and BamHI digestion clone pBLTP, use 1% agarose gel electrophoresis, have a high-molecular weight band with Prep-A-Gene DNA purification cassette (by the Bio-Rad manufacturing) purifying is isolating thus.With identical method, with the dna fragmentation of restriction enzyme treatment pEF18S-HL34 with the about 450bp of purifying.Each the DNA sample that obtains is thus linked to each other, be transformed into then among the high competent E.coli DH5 (making) by TOYOBO.Prepare the plasmid DNA sample to obtain containing the segmental clone pBLTEN of people TPO cDNA insertion from the bacterium colony of gained.Digest the pBLTEN that obtains thus with limiting enzyme EcoRI and NotI, through 1% agarose gel electrophoresis, transform box (making) purifying isolating thus about 1 with Prep-A-Gene DNA by Bio-Rad, the dna fragmentation of 200bp links to each other and is transformed among the high competent E.coli DH5 (being made by TOYOBO) through the expression vector pEP18S of same restrictions enzymic digestion then with in advance.Prepare the clone of plasmid DNA sample from institute's DCRP with the insertion fragment pHTP1 that obtains containing whole person TPO cDNA coding region.Prepare plasmid DNA and be used for following experiment from this clone is a large amount of.The basic method described in the Molecular Cloning (Sambrook et al., Cold Spring HarborLaboratory Press, 1989) of pressing prepares plasmid DNA.

＜embodiment 31 〉

Make up Mammals expression plasmid pDEF202-hTPO-P1 so as in Chinese hamster ovary (CHO) cell expressing human TPO

Digest the 1mg plasmid pMG1 that contains the little gene of little mouse dihydrofolate reductase (DHFR) with limiting enzyme EcoRI and BamHI, contain the fragment (about 2.5kb) of the little gene of mouse DHFR through agarose gel electrophoresis with separation.The separated DNA fragment is dissolved in 25ml by 50mM Tris-HCl (pH 7.5), 7mM MgCl ₂, in the reaction soln that 1mM 2 mercapto ethanol and 0.2mM dNTR mixture are formed, mix with 2 unit klenow fragments, then room temperature incubation 30 minutes so that all form blunt end at two ends of dna fragmentation.Phenol/chloroform handle and ethanol sedimentation after, the fragment of gained is dissolved in the 10ml TE solution (10mM Tris-HCl (pH 8.0)/1mM EDTA).With restriction enzyme Smal digestion mammalian expression vector pEF18S, with alkaline phosphatase (making) dephosphorylation, use T4 dna ligase (making) to link to each other to obtain expression vector pDEF202 then with the dna fragmentation that contains the little gene of mouse DHFR by Takara Shuzo by Takara Shuzo.

Then, the expression vector pDEF202 that makes up with limiting enzyme EcoRI and SpeI digestion, then through agarose gel electrophoresis to separate a bigger dna fragmentation.With T4 dna ligase (making) by Takara Shuzo, will be by digestion contains the people TPO cDNA that the plasmid pHTP1 of people TPOcDNA (cloning P1) obtains and links to each other to obtain being used for the plasmid pDEF202-hTPO-P1 of expressing human TPO cDNA with this linearizing pDEF202 carrier with SpeI with limiting enzyme EcoRI.Described structure plasmid contains the SV40 replication origin, people's elongation factor 1-α-promotor and be used to transcribe the early stage polyadenylation signal of SV40 of people TPO cDNA, little gene of mouse DHFR and pUC18-replication origin and β-Nei Xiananmei gene (Amp ^r).

＜embodiment 32 〉

Expressing human TPO in Chinese hamster ovary celI

Tissue culture ware (Falcon) with a diameter 6cm keeps Chinese hamster ovary celI (DHFR strain in the α-MEM that contains 10% foetal calf serum (FCS) (α-MEM (-) is replenished by xanthoglobulin and thymidine); Urlaub and Chasin, Proc.Natl.Acad.Sci.USA, vol.77, p4216 (1980)).Transform Chinese hamster ovary celI by following calcium phosphate method (CellPhect is made by Pharmacia) with the pDEF202-hTPO-P1 plasmid.The 10mg plasmid pDEF202-hTPO-P1 of preparation among the embodiment 31 is mixed with 120ml buffer A and 120ml water, then with the mixture of gained room temperature incubation 10 minutes.This solution is mixed with the 120ml buffer B again, and at room temperature put 30 minutes again.This DNA mixture is added in the substratum, at CO ₂Incubation is 6 hours in the insulation can.After 6 hours, with serum-free α-MEM (-) with the culture washed twice, handled two minutes with the α-MEM (-) that contains 10% dimethyl sulfoxide (DMSO), containing 10% dialysed in the non-selection substratum (α-MEM (-) that replenishes with xanthoglobulin and thymidine) of FCS incubation 2 days then.Cultivate after 2 days, containing the 10% screening cell in the selection substratum (α-MEM (-)) of FCS of having dialysed.In order to screen the transformant of the positive phenotype of band DHFR, with trypsinase/EDTA solution-treated cell, then with selecting substratum to suspend.Cell in the 6cm tissue culture ware is assigned in 5 10cm tissue culture wares or 12 the 24 hole tissue culture wares, in selecting substratum, cultivated then.Interval exchange substratum with 2 days.With the CFU-MK test, M-07e test or Ba/F3 test detect the people TPO activity in the substratum of the Chinese hamster ovary celI of the positive phenotype of band DHFR-.In the selection substratum that replenishes with the 25nM methotrexate, further screening is secreted into cell in the substratum so that the cell clone of the high quantity people TPO of separation of produced with people TPO.

In this example, also can transfection CHO cell by usefulness pHTP1 and pMG1 plasmid co-transfection Chinese hamster ovary celI.

The applicant will be deposited at Japanese bio-science and the state-run institute of people's body technique in January 31 nineteen ninety-five with the CHO strain (CHO-DUKXB11) of plasmid pDEF202-hTPO-P1 transfection with preserving number FERM BP-4988, industrial science and technology department, Ministry of International Trade and Industry.

＜embodiment 33 〉

Structure is used for X63.6.5.3 cell recombinant vectors BMCGSneo-hTPO-P1

With restriction enzyme XhoI and NotI digestion 1mg mammalian expression vector pBMCGSneo, then through agarose gel electrophoresis with carrier of separating DNA part.With the T4 dna ligase this dna fragmentation is linked to each other to obtain required expression vector pBMCGSneo-hTPO-P1 with the people TPO cDNA (P1 clone) that obtains by the plasmid pBLTEN that contains people TPO cDNA with restriction enzyme XhoI and NotI digestion.This expression plasmid contains the intron in cytomegalovirus early promoter, part rabbit beta globin gene source and is used to transcribe polyadenylation region that people TPO cDNA transcribes, people's beta globin gene, 69% bovine papilloma virus 1 gene, thymidine kinase promoter and polyadenylic acid zone, phosphotransferase I gene (neomycin resistance gene) and pBR322 replication origin and β-Nei Xiananmei gene (Amp ^r), people TPO cDNA is connected in the site, downstream of cytomegalovirus promotor.

＜embodiment 34 〉

In the X63.6.5.3 cell, express

In essential substantially (DME) substratum of the Dulbecco ' s that contains 10% foetal calf serum, cultivate the X63.6.5.3 cell.Press the following described electroporation method of using by BMCGSneo hTPO plasmid transfection X63.6.5.3 cell.

The plasmid BMCGSneo-hTPO-P1 that obtains among the 20mg embodiment 33 is added to contains 10 ⁷In the 750 μ lDME substratum of cell, then mixture is placed in the electroporation sample pool that breach is 4mm, put 10 minutes at 4 ℃.Then sample pool is put in the electroporation device (BTX600, by BTX make) so that at 380V, finished transgenosis under the condition of 25mF and 24_.After the transgenosis, sample pool was put 15 minutes in 4 ℃ again, then with cell washing once with the DME that contains 10% foetal calf serum.Cells transfected is suspended among the DME that 50ml contains 10% foetal calf serum, is distributed in each hole in the 96 hole tissue culture wares, then at CO ₂Cultivated 2 days in the insulation can.Cultivate after 2 days, change substratum, changed a subculture then every 3 days with the DME that contains 10% foetal calf serum and 1mg/ml G418 (making) by GIBSCO.Use CFU-MK, the people TPO activity in M-07e or the Ba/F3 inspection transformant substratum.To secrete people TPO with restriction dilution clone and clone twice to set up people TPO production clone to the transformant in the substratum.

＜embodiment 35 〉

Extensive expressing human TPO in the COS1 cell

Press the description among the embodiment 11, finish the transfection of COS1 cell by the DEAE-dextran method that comprises the chloroquine processing.175cm with collagen protein bag quilt ²Culturing bottle, in the IMDM that contains 10% (v/v) FCS in 37 ℃ at 5%CO ₂Cultivating COS1 cell (ATCC CRL1650) in the insulation can converges up to cell 100%.In order to make the collagen protein bag, will with 1mM HCl 25ml collagen solution (Cellmatrix type 1-C, the Lwaki makes) 25ml that its concentration transfers to 0.3mg/ml be added to each 175cm by culture flask ²Culture flask in, at room temperature put 1 hour, reclaim collagen solution, the flask that will handle thus with 20 to 50ml PBS washs once then.By 20ml being contained the IMDM of 250 μ g/ml DEAE-dextran (Pharmacia manufacturing); 60 μ M chloroquines (Sigma manufacturing) and 10% (v/v) Nu-Serum (Collaborative manufacturing) mix with plasmid in being dissolved in 500 μ lPBS, and the gained mixture is added to an above-mentioned 175cm ²In the contained COS1 cell of culture flask (before transfection, described cell washing being crossed once), then at 5%CO with IMDM ₂In the insulation can, thereby cell cultures was finished transfection in 3 hours in 37 ℃.After this, culture supernatants is removed in suction, with IMDM with cell washing once, mixes with the 50ml serum free medium, then at 5%CO ₂Cultivate 5 days to reclaim culture supernatants in 37 ℃ in the insulation can.In single job, used 175cm ²100-260 culture flask, and be recovered to 5 to 13 liters culture supernatants.By with being supplemented with 5 μ g/ml Regular Insulin (Sigma manufacturing), 5 μ g/ml Transferrins,iron complexess (Sigma manufacturing), 10 μ M monoethanolamines (making) by Wako Pure ChemicalIndustries, 20nM Sodium Selenite (making) and 200 μ g/ml BSA (the high purity bovine albumin of FAF is made by Nichirei) preparation serum free medium by Sigma.

＜embodiment 36 〉

People's total length TPO that purifying is expressed in the COS1 cell (deriving from expression plasmid pHTP1.P1 clone) and biological activity thereof

Activity and the purifying of the people's total length TPO (deriving from expression plasmid pHTP1) that expresses in the COS1 cell are described below.In order to detect the activity that thrombocyte increases, prepare partially purified product earlier, and then purifying obtains high-purity product.In following preparation steps, mainly detect the TPO activity with the M-07e detection system.In rat CFU-MK detection system, find similar TPO activity.When finishing these and detect, human serum albumin (HSA) is added in each sample final concentration to reach 0.02 to 0.05% respectively.

At first, at 5%CO ₂In, be used in and contain 0.2g BSA among the 1000ml, the 5mg Sigma I8405, the 5mg human transferrin is in the serum-free IMDM substratum of 0.02mM monoethanolamine and 25nM Sodium Selenite, press Ohashi and Sudo (Hideya Ohashi and Tadashi Sudo, Biosci.Biotech.Biochem.58 (4), 758-759,1994) method, to cultivate 5 days in 37 ℃ with the COS1 cell of plasmid pHTP1 transfection, obtain 7 liters of serum-free culture thing supernatant liquors thus.(4 (2-amino-ethyl)-benzenesulfonyl villiaumite acid (are made by Merk with proteinase inhibitor p-APMSF and Pefabloc SC; article number 24839) is added to the final concentration that reaches about 1mM in the serum-free culture thing supernatant liquor, then filters to reclaim supernatant liquor with 0.2 μ m filter.With a ultrafiltration unit (Omega Ultrasette, it is 8,000 that the normal molecular amount is blocked, and is made by Filtron; Or PLGC Pellicon Cassetle, it is 10,000 that the normal molecular amount is blocked, and is made by Millipore) with about 10 times of this supernatant concentration, with the enriched product (protein concn: 3.38mg/ml of 723ml; Gross protein 2,445mg; Relative reactivity 43,000; Gross activity: 105,100,000) mixes to obtain 804ml with the ammonium sulfate of every 1000ml 1.6mol (total 288g) and contain the solution that final concentration is a 1.5M ammonium sulfate, the flow velocity that divides with 10ml/ is used for Macro-PrepMethyl HIC post (diameter 5cm with gained solution then, height of bed 9cm, make article number 156-0080 by Bio-Rad), this post is in advance with 20mM sodium citrate buffer solution (pH 5.2) the balance mistake that contains 1.5M ammonium sulfate.Behind the last sample, with the 20mM sodium citrate buffer solution (pH 5.2) that contains 1.25M ammonium sulfate carry out wash-out with must be post fraction F1 (2,384ml; Protein concn, 0.864mg/ml; Gross protein 2,061mg; Relative reactivity; 6,000).

Then, change elutriant into Trisodium Citrate, pH 5.8, with collect fraction F2 (1,092ml; Protein concn 0.776mg/ml; Gross protein 847mg; Relative reactivity, 150,000).

F2 (1 with the Macro-Prep Methyl HIC post that obtains thus, 081ml) flow velocity that divides with 10ml/ is used for SP Sepharose Fast Flow post (diameter 3cm, height of bed 10cm, Pharmacia Biotech makes, article number 17-0729-01), this post is used 20mM sodium citrate buffer solution (pH 5.8) balance mistake in advance.Behind the last sample, with 20mM sodium citrate buffer solution (pH 5.6) wash-out that contains 110mM NaCl with obtain the F1 fraction (2,262ml; Protein concn 0.270mg/ml; Gross protein 610mg, relative reactivity 30,000).Then, elute soln is changed into the 20mM sodium citrate buffer solution (pH 5.4) that contains 400mM NaCl to collect F2 fraction (856ml; Protein concn, 0.189mg/ml; Gross protein 162mg, relative reactivity 300,000).Then, again elutriant is changed into the 20mM sodium citrate buffer solution (pH 5.2) that contains 1000mM NaCl to collect the F3 fraction (370ml of wash-out; Protein concn 0.034mg/ml; Gross protein 12.6mg; Relative reactivity 150,000).

With the main TPO active fraction F2 (845ml) of SP Sepharose Fast Flow post step and final concentration is that about 10% 1-propyl alcohol mixes, the flow velocity that divides with 3ml/ is used for LA-WGA post (diameter 2cm then, height of bed 14cm, make by Honen, article number WG-007), this post is in advance with 20mM sodium citrate buffer solution (pH 5.4) the balance mistake that contains 400mM NaCl.Behind the last sample, usefulness contains the 20mM Trisodium Citrate of 400mM NaCl and the mixture wash-out of 1-propyl alcohol (9: 1) obtains F1 fraction (64.4ml; Protein concn: 0.0178mg/ml; Gross protein 1.15mg, relative reactivity: 17,220).Then elute soln is changed into contain 0.4M GlcNAc and 10%1-propyl alcohol 20mM sodium citrate buffer solution (pH 6.1) to collect F2 fraction (45ml; Protein concn 0.0104mg/ml; Gross protein 0.470mg; Relative reactivity 675,000).

The active F2 fraction of main TPO (340ml) of LA-WGA column operation is mixed with the TFA of final concentration about 0.005%, then through YMC-Pack CN-AP (YMC makes, article number AP-513 for diameter 6mm, height of bed 250mm)) column chromatography.That is, as developping agent A, the 1-propyl alcohol that contains 0.05%TFA is as developping agent B with 0.1%TFA, and the flow velocity that divides with 0.6ml/ makes sample use 15%B equilibrated YMC-Pack CN-AP post through in advance.Behind the last sample, propyl alcohol concentration is brought up to 25%B from 15%B.Finished wash-out to the concentration linear gradient increase of 50%B through 65 minutes with 25%B, use the polypropylene test tube to collect elutriant simultaneously with every 1.5ml (2.5 minutes).

The eluate of 0.5 μ l (1/3,000 part) in each test tube is mixed with HSA, detect culture solution through ultrafiltration and concentration with the 0.25ml IMDM that obtains containing 0.05%HSA, to differentiate the TPO active fraction after testing.As a result, find strong TPO activity (relative reactivity is about 630,000 to 4,800,000), collect these test tubes as TPO active fraction FA (13.5ml) at 24 to No. 30 test tubes (propyl alcohol concentration is between 35.0 and 42.0%).

With 0.1%TFA as developping agent A, the 1-propyl alcohol that contains 0.05%TFA makes the FA level lease making Capcell Pak CI 300A (diameter 4.6mm, the height of bed 150mm that are obtained by YMC-Pack CN-AP post as developping agent B, Shiseido makes, article number CI TYPE:SG 300A) column chromatography.To mix with 0.3ml glycerine by the fraction FA part (8.9ml) that YMC-Pack CN-AP column operation obtains, through centrifugal evaporation concentration, B with 2.5ml 10% mixes then, the Capcell Pak CI300A post of flow velocity through crossing with the 20%B balance in advance that the solution of gained is divided with 0.4ml/.Behind the last sample,, increase wash-out 50 minutes with 20%B to the concentration linear gradient of 40%B then, use the every 1ml of polypropylene test tube (2.5 minutes) to collect elutriant simultaneously earlier with 20%B wash-out 5 minutes.

1 μ l (1/1,000 part) elutriant in each test tube is mixed with HSA, and ultrafiltration and concentration is to obtain containing the 0.25ml IMDM detection solution of 0.05%HSA, to differentiate the TPO active part by detecting.As a result, in 20 to No. 23 test tubes (propyl alcohol concentration is between 28.5 to 32.5%), find strong TPO activity (relative reactivity is about 3,000,000 to 22,500,000), collect these test tubes as the high reactivity fraction.

＜embodiment 37 〉

The molecular weight of the people TPO that detection is expressed in the COS1 cell

Owing to added sugar chain, inferred that therefore the molecular weight of the people's total length TPO (deriving from expression plasmid pHTP1, the F1 clone) that expresses should be greater than the molecular weight of inferring from the size of peptide chain in the COS1 cell.As a result, the first step is used following method, prepares partially purified TPO fraction from the culture supernatants that contains the people's total length TPO (deriving from expression plasmid pHTP1, the F1 clone) that expresses the COS1 cell.Promptly, with developping agent A (0.1% trifluoroacetic acid (TFA)) and developping agent B (the 1-propyl alcohol that contains 0.05%TFA), the culture supernatants of 0.3ml is used extremely in advance through 25%B equilibrated YMC-Pack PROTEIN-RP (diameter 0.46cm, height of bed 15cm, make by YMC, article number A-PRRP-33-46-25) post, 25% B passed through post 5 minutes with the flow velocity that 0.4ml/ divides, and finished separation with 25%B through 50 minutes to the linear density gradient of 50%B then.Found the TPO activity in the elutriant in propyl alcohol concentration is 34.5% to 43.5% scope, through centrifugal these elutriants of evaporation evaporation drying to obtain partially purified sample.

Then, after the SDS-PAGE running gel of under with the non-reduced condition described in the embodiment 1, finishing, extracting protein, detect the TPO activity with the M-07e detection system, perhaps press the Western analytical method described in the embodiment 45 hereinafter, DPC III with reduction-processing is labeled as the basis, measures molecular weight.As a result, found that the TPO activity in about 69,000 to 94,000 wide molecular weight scope, confirms change of molecular weight thus.In addition, (making with the N-glycanase by Genzyme, article number: 1472-00) digest its N-glycosidic linkage type sugar chain after, DPC III with reduction-processing is labeled as the basis, the apparent molecular weight that measures TPO is 36,000 to 40,00O, greater than about 35,000 the molecular weight of inferring from the size of peptide chain.Therefore, also effectively explanation have an O-glycosidic linkage type sugar chain.

With identical method, the molecular weight of people's total length TPO that discovery is expressed in the COS1 cell (deriving from expression plasmid pHTP1, the P1 clone) is 63,000 to 83,000.

＜embodiment 38 〉

The biological property of people TPO

Mainly use culture supernatants to detect people TPO to people and the hemapoietic influence of rat by the COS1 cell of pHTF1 transfection.

Using from the CD34 of human cord blood preparation ⁺DR ⁺During the colony of cell fraction detects, the formation of people TPO obvious stimulation megakaryocyte colony.For example, under the condition that 10% (v/v) culture supernatants with the COS1 cell of pHT1-231 transfection exists, by 6,000 CD34 ⁺DR ⁺Cell forms 11.5 megakaryocyte colonies.In order to detect the influence of people TPO, prepare CD34 from human peripheral by following method to people's megalokaryocyte progenitor in the peripheral blood ⁺Cell.From from the white corpuscle fraction that human peripheral obtains, removing the cell that adheres to vinyl disc with the Ficoll-Paque density gradient.Subsequently, from non-adherent cell, remove SBA (soybean agglutinin) positive cell by using AIS Microselecter SBA (Asahi Medical) to eliminate.On AISMicroselecter CD34, cultivate the cell of gained, under the condition that the culture supernatants of the COS1 of transfection cell exists, cultivate CD3 in the liquid medium within ⁺Collect the cell of absorption during cell, CD34 ⁺Cell is observed the Gp II b/III a of large volume ⁺The selective proliferative of cell is at these Gp II b/III a ⁺Find also in the cell that ploidy increases.These results illustrate that effectively people TPO has selective action to the progenitor of people's megalokaryocyte pedigree, and stimulate its propagation and differentiation.

Using for the highly enriched Gp II b/IV a of CFU-MK ⁺Colony detect, people TPO induces the megakaryocyte colony that forms significant amounts, described CFU-MK is from rat bone marrow cell and Gp II b/III a in front ⁺The non-adherent cell of the shaping that the cell step obtains.For example, under the condition that the COS1 cell culture supernatant liquid of 20% (v/v) transfection exists, by 1,000 Gp II b/III a ⁺Cell forms 34.5 megakaryocyte colonies, by 28.5 megakaryocyte colonies of non-adherent cell formation of 20,000 shapings.In addition, although the non-adherent cell fraction that is shaped contains various green blood progenitors rather than CFU-MK, only just form megakaryocyte colony under the situation that has people TPO, this illustrates that effectively people TPO has selective action to the progenitor of megalokaryocyte pedigree.Under the situation that the culture supernatants of 20% (v/v) transfection COS1 cell exists, the Gp II b/III a of rat marrow will be derived from ⁺Cultivate after 3 to 5 days the increase of clearly observing ploidy on the 5th day of cultivating in the cell liquid medium within.

＜embodiment 39 〉

Structure is used for expressing at E.Coli the carrier of the fused protein (hereinafter referred to as " GST-TPO (1-174) ") of glutathione-S-transferase (GST) and people TPO (amino-acid residue of 1-174)

In order to help expressing human TPO in E.Coli, preparation coding people TPO also contains the artificial gene of the preferred codon of E.Coli.The nucleotides sequence of this DNA is listed in-1 and contains and be useful on the amino-terminal M et codon (ATG) of translating startup in E.Coli.

Preparation synthetic oligonucleotide 1 to 12:

1：5′-CTAGAAAAAACCAAGGAGGTAATAAATAATGAGCCC

GGCTCCGCCAGCTTGTGACCTTCGTGTTCTGTCT-3′(SEQ?ID?NO：83)；

2：5′-CAGTTTAGACAGAACACGAAGGTCACAAGCTGGCGG

AGCCGGGCTCATTATTTATTACCTCCTTGGTTTTTT-3′(SEQ?ID?NO：84)；

3：5′-AAACTGCTTCGCGACTCTCACGTGCTGCACTCTCG

TCTGTCCCAGTGCCCGGAAGTTCACCCGCTGCCG-3′(SEQ?ID?NO：85)；

4：5′-CGGGGTCGGCAGCGGGTGAACTTCCGGGCACTGGG

ACAGACGAGAGTGCAGCACGTGAGAGTCGCGAAG-3′(SEQ?ID?NO：86)；

5：5′-ACCCCGGTTCTGCTTCCGGCTGTCGACTTCTCCCT

GGGTGAATGGAAAACCCAGATGGAAGAGACCAAA-3′(SEQ?ID?NO：87)；

6：5′-CTGACCTTTGGTCTCTTCCATCTGGGTTTTCCATT

CACCCAGGGAGAAGTCGACAGCCGGAAGCAGAAC-3′(SEQ?ID?NO：28)；

7：5′-GCTCAGGACATCCTGGGTGCAGTAACTCTGCTTCT

GGAAGGCGTTATGGCTGCACGTGGCCAGCTTGGC-3′(SEQ?ID?NO：89)；

8：5′-GGTCGGGCCAAGCTGGCCACGTGCAGCCATAACGC

CTTCCAGAAGCAGAGTTACTGCACCCAGGATGTC-3′(SEQ?ID?NO：90)；

9：5′-CCGACCTGCCTGTCTTCCCTGCTTGGCCAGCTGTC

TGGCCAGGTTCGTCTGCTGCTCGGCGCTCTGCAG-3′(SEQ?ID?NO：91)；

10：5′-CAGAGACTGCAGAGCGCCGAGCAGACGAACCTGGC

CAGACAGCTGGCCAAGCAGGGAAGACAGGCA-3′(SEQ?ID?NO：92)；

11：5′-TCTCTGCTTGGCACCCAGCTGCCGCCACAGGGCCG

TACCACTGCTCACAAGGATCCGAACGCTATCTTCC-3′(SEQ?ID?NO：93)；and

12：5′-AAGACAGGAAGATAGCGTTCGGATCCTTGTGAGCA

GTGGTACGCCCTGTGGCGGCAGCTGGGTGCCAAG-3′(SEQ?ID?NO：94)

Then by 1mM ATP, 10mM Tris-acetate, in the solution that 10mM magnesium acetate and 50mM potassium acetate are formed, with T4 kinases (making) by Pharmacia respectively with the synthetic oligonucleotide phosphorylation of 2-11.For these synthetic oligonucleotide are made 6 double chain DNA fragments, with 1 and 2,3 and 4,5 and 6,7 and 8,9 and 10, and 11 and 12 combinations are by 10mM Tris/HCl (pH 7.5), 10mM MgCl with these synthetic oligonucleotides ₂Make each group in conjunction with annealing in the solution of forming with 50mM NaCl.Then, handle 3 double chain DNA fragments of 1 and 2,3 and 4 and 5 and 6 respectively with T4 ligase enzyme (LifeTechnology manufacturing), and 3 double chain DNA fragments in addition of 7 and 8,9 and 10,11 and 12, this 2 kinds of reaction solns handled with identical method again with the T4 ligase enzyme.Digest the dna fragmentation that obtains through ligation with BamHI (making) by Boehringer-Mannheim, then through 2% agarose gel electrophoresis to reclaim about 390 to the fragment of 400bp, use Prep-A-GeneDNA purification cassette purifying subsequently, subclone is in advance in the pUC18 of XbaI and BamHI digestion (doing the host with E.Coli DH5 α) then.From these DCRP, filter out the clone who has coding people TPO and contain the artificial gene of the preferred codon of following E.coli with nucleotide sequence analysis, and called after pUC18 (XB) (1-123).In sequence table (SEQ ID NO:9), listed the dna sequence dna of coding strand.

10 1 20 30 40 50 60

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAGCCCGGCT?CCGCCAGCTT?GTGACCTTCG

TTTTTT?GGTTCCTCCA?TTATTTATTA?CTCGGGCCGA?GGCGGTCGAA?CACTGGAAGC

XhaI 2

70 80 3 90 100 110 120

TGTTCTGTCT?AAACTGCTTC?GCGACTCTCA?CGTGCTGCAC?TCTCGTCTGT?CCCAGTGCCC

ACAAGACAGA?TTTGACGAAG?CGCTGAGAGT?GCACGACGTG?AGAGCAGACA?GGGTCACGGG

4

130 140 150 5?160 170 180

GGAAGTTCAC?CCGCTGCCGA?CCCCGGTTCT?GCTTCCGGCT?GTCGACTTCT?CCCTGGGTGA

CCTTCAAGTG?GGCGACGGCT?GGGGCCAAGA?CGAAGGCCGA?CAGCTGAAGA?GGGACCCACT

6

190 200 210 220 7?230 240

ATGGAAAACC?CAGATGGAAG?AGACCAAAGC?TCAGGACATC?CTGGGTGCAG?TAACTCTGCT

TACCTTTTGG?GTCTACCTTC?TCTGGTTTCG?AGTCCTGTAG?GACCCACGTC?ATTGAGACGA

8

250 260 270 280 290 9?300

TCTGGAAGGC?GTTATGGCTG?CACGTGGCCA?GCTTGGCCCG?ACCTGCCTGT?CTTCCCTGCT

AGACCTTCCG?CAATACCGAC?GTGCACCGGT?CGAACCGGGC?TGGACGGACA?GAAGGGACGA

10

310 320 330 340 350 360

TGGCCAGCTG?TCTGGCCAGG?TTCGTCTGCT?GCTCGGCGCT?CTGCAGTCTC?TGCTTGGCAC

ACCGGTCGAC?AGACCGGTCC?AAGCAGACGA?CGAGCCGCGA?GACGTCAGAG?ACGAACCGTG

11?370 380 390 400 410 420

CCAGCTGCCG?CCACAGGGCC?GTACCACTGC?TCACAAGGAT?CCGAACGCTA?TCTTCC

GGTCGACGGC?GGTGTCCCGG?CATGGTGACG?AGTGTTCGTA?GGCTTGCGAT?AGAAGGAACAG?AA

12 BamHI

With Oligo dT primer, from the poly (A) in 1 μ g people normal hepatocytes source ⁺The synthesizing single-stranded cDNA of RNA, the cDNA building-up reactions solution with 0.1 volume is that template is carried out PCR then.With hTTPO-C and hTTPO-Z (EcoRI) as primer, (96 ℃ of incubations 2 minutes, repeat 30 circulations altogether, each circulation was included in 95 ℃ of incubations 1 minute to carry out PCR reaction in 100 μ l volumes, 58 ℃ of 1 minute and 72 ℃ 1 minute are at 72 ℃ of incubations 7 minutes more at last).Digest the people TPO cDNA fragment that obtains in this way with BamHI and EcoRI, then through 2% agarose gel electrophoresis to reclaim the fragment of about 600bp, use Prep-A-Gene DNA purification cassette purifying subsequently, subclone is in advance with among the pUC18 of EcoRI and BamHI digestion (E.coli DH5 α is the host) then.Filter out the clone of the correct people TPO nucleotide sequence of coding through nucleotide sequence analysis, and be called pUC18 (BE) (124-332).The oligonucleotide sequence of used primer is as follows in the PCR reaction:

HTPO-C:5 '-GGA GGA GAC CAA GGC ACA GGA-3 ' (SEQ ID NO:95) (pHT1 clone's position 329 to 349); With

hTPO-Z(EcoRI)：5’-CCG?GAA?TTC?TTA?CCC?TTC?CTG?AGA?CAGATT-3’(SEQ?ID?NO：96)

(preparation by an EcoRI recognition sequence being added in the antisense primer that is equivalent to 1,143 to 1,163 of pHTF1 clone).

Clone pUC18 (BE) (124-332) with BamHI and EcoRI digestion, then through the C-end side fragment of 2% agarose gel electrophoresis with the people TPO cDNA that reclaims about 600bp, use Prep-A-Gene DNA purification cassette purifying subsequently, then subclone in advance with the pUC18 (XB) of EcoRI and BamHI digestion (1-123) in (with E.coli DH5 α as the host).The clone who obtains with this method is called pUC18 (XE) (1-332).

Because by preparation and to express the C-terminal deletion construct of various people TPO cDNA verified with the active embodiment of measuring body stranger TPO, in the people TPO of 1 to 163 amino acids residue peptide fragment, there is people TPO activity, therefore makes up the expression vector that contains this peptide fragment.In this example, express the dna sequence dna of coding GST-TPO (1-174).

Because restriction enzyme SacI identification corresponding to the nucleotide sequence of pHTF1 clone's 681-686 position (173 and 174 amino-acid residues), utilizes the recognition site of this restriction enzyme to import 2 termination codons with two synthetic oligonucleotides.That is, by 10mM Tris/HCl (pH7.5), 10mMMgCl ₂In the solution of forming with 50mM NaCl, utilize DNA connecting box (Takara Shuzo manufacturing), with two synthetic oligonucleotide SSE1 and SSE2 annealing, with the double chain DNA fragment that obtains thus import through pUC18 (XE) that about 480bp people TPOcDNA C-terminal fragment has therefrom been removed in SacI and EcoRI digestion (1-332) in, obtain cloning pUC18 (XS) (1-174) (with E.coli DH5 α as the host) thus.The sequence of synthetic oligonucleotide used herein is as follows:

SSE1：CTAATGAG(SEQ?ID?NO：97)；

SSE2：AATTCTCATTAGAGCT(SEQ?ID?NO：98)；

SacI SSE1? EcoRI

5?′-CTAATGAG-3′(SEQ?ID?NO：99)

3′-TCGAGATTACTCTTAA-5′(SEQ?ID?NO：100)

SSE2

Digest the above-mentioned clone PUC18 (XS) that obtains (1-174) with XbaI and EcoRI, then through the fragment of 2% agarose gel electrophoresis with about 600bp of the 1-174 amino acids residue of recovery coding people TPO, use this fragment of Prep-A-Gene DNA purification cassette purifying subsequently, subclone is to the pBluescript II SK that digests with XbaI and EcoRI in advance then ⁺(Stratagene manufacturing) (using E.coli DH 5 α) as the host.The clone who obtains with this method is called pBL (XS) (1-174).With identical method, by XbaI and HindIII digestion clone pBL (XS) (1-174) with about 550bp fragment of the 1-174 amino acids residue that reclaims coding people TPO, use the described fragment of Prep-A-Gene DNA purification cassette purifying subsequently, subclone is in advance with among the pCFM536 (EP-A-136490) of XbaI and Hind III digestion (is the host with E.coli DH5 α) then.Be called pCFM536/hT (1-174) with the resulting clone of this method.

For effective expression GST-TPO (1-174), utilize PGEX-2T (Pharmacia) to carry out following experiment, pGEX-2T is the expression vector of glutathione-S-transferase (GST) fused protein.With pCFM536/hT (1-174) as template, and two PCR primer GEX1 and GEX3 carry out the PCR reaction, and (96 ℃ of incubations 2 minutes, repeat 22 circulations altogether, each circulation was included in 95 ℃ of incubations 1 minute, 41 ℃ of 1 minute and 72 ℃ 1 minute are at last 72 ℃ of incubations 7 minutes).Digest the people TPO encode fragment that obtains with this method with NaeI and EcoRI, then through 2% agarose gel electrophoresis to reclaim the fragment of about 550bp, use the described fragment of Prep-A-GeneDNA purification cassette purifying subsequently, it is cloned in advance with among the pGEX-2T of EcoRI and SmaI digestion (is the host with E.coli DH5 α), filter out the clone of the correct people TPO nucleotide sequence of coding then with nucleotide sequence analysis, be called pGEX-2T/hT (1-174) is used to express GST-TPO (1-174) with preparation transformant.The sequence of used primer is as follows in the PCR reaction:

GEX1：5’-ATC?GCC?GGC?TCC?GCC?AGC?TTG?TGA?C-3’(SEQ?ID?NO：101)

(21 to 39 of SEQ ID NO:10 prepare by the NaeI recognition sequence is added to); With

GEX3：5’-GCC?GAA?TTC?TCA?TTA?GAG?CTC?GTT?CAG?TGT-3’(SEQID?NO：102)

(corresponding to the antisense primer of the sequence of 523-549 position among the SEQ ID NO:10).

This expression plasmid contains the GST protein DNA sequence that coding is connected to zymoplasm identification polypeptide and people TPO (1-174 amino acids).In sequence table, listed the dna sequence dna of coding zymoplasm identification polypeptide and people TPO (1-174 amino acids) in (SEQ ID NO:10).

＜embodiment 40 〉

In E.coli, express GST-TPO (1-174)

With the 60ml LB substratum of the penbritin that contains 50 μ g/ml on vibrator with the transformant of preparation among the embodiment 39 in 37 ℃ of overnight incubation, the nutrient solution of 25ml gained is added to contains 1 of 50 μ g/ml penbritins, in the 000ml LB substratum, on vibrator in 37 ℃ of cultivations up at A ₆₀₀OD reach 0.7 to 0.8.Then, IPTG is added to the final concentration that reaches 0.1mM in the nutrient solution, continues again shaking culture 3 hours to induce the expression of GST-TPO (1-174).

＜embodiment 41 〉

The GST-TPO that purifying is expressed in E.coli (1-174), and prove its biological activity

With 5.9 grammes per square metre group bacterial strains freeze cell suspension in 10ml water, use the broken instrument fragmentation of high pressure then, described bacterial strain production derives from the GST-TPO (1-174) that people TPO nucleotide sequence-coding is cloned pGEX-2T/hT (1-174).Make suspension centrifugal,, remove most of contaminating protein matter, groups of cells is graded at precipitation partially recycled GST-TPO (1-174).Then, the precipitation that contains GST-TPO (1-174) of gained partly is suspended in the 5ml water, subsequently while stirring to wherein adding 6ml 1M Tris damping fluid (pH 8.5), 120ml 10M urea and 16ml water.Stir 5 minutes the dissolving inclusion after, gained solution is divided into 4 parts to finish following step (1)-(4).

(1) use 20mM Tris damping fluid (pH 8.5) with 10 times of a diluted samples.To wherein adding reduced glutathion and Sleep-promoting factor B, make its concentration that reaches 5mM and 0.5mM respectively, then in 4 ℃ of incubated overnight.The mixture of gained is centrifugal to reclaim the GST-TPO (1-174) as supernatant liquor, with pH is 2 times of 5.5 20mM Trisodium Citrate dilutions, with acetate pH is transferred to 5.5 then, GST-TPO (1-174) solution added to use 20mM Trisodium Citrate (pH 5.5) equilibrated SP Sepharose Fast Flow (making article number 17-0729-01 by Pharmaeia Biotech) cationic exchange coloum in advance.After washing this post with 20mM sodium citrate buffer solution (pH5.5), with 20mM sodium citrate buffer solution (pH 5.5) the wash-out GST-TPO (1-174) that contain 500mM NaCl.The 129ml elutriant is mixed with 2.6ml 1M Tris damping fluid (pH 8.5), with pH is that 8.1 gained mixture is used for Glutathione Sepharose 4B (being made article number 17-0756-01 by Pharmacia Biotech) post with absorption GST-TPO (1-174).Behind the PBS washing column, with the 20mM Tris buffer solution elution GST-TPO (1-174) that contains the 10mM reduced glutathion.The elutriant of gained is mixed with the zymoplasm of 37NIH unit, put 4 hours,, be used for the GST of Glutathione Sepharose4B post then, and be recovered in the TPO (1-174) in the non-absorption fraction with absorption digestion with 10 times of PBS dilutions in room temperature.

The non-absorption fraction that reclaims is diluted 3 times with 20mM sodium citrate buffer solution pH 5.5, be used for using in advance identical damping fluid equilibrated SP Sepharose Fast Flow cationic exchange coloum then, with the required material of 0-500mM NaCl wash-out of the linear density gradient that is dissolved in same buffer.

(2) all operations of completing steps (1) under the condition of existence 0.1% Spheron MD 30/70 (polysorbate 80).

(3) be that 8.5 20mM Tris damping fluid is with 10 times of a diluted samples with the pH value.To wherein adding reduced glutathion and Sleep-promoting factor B, make its final concentration be respectively 5mM and 0.5mM, then 4 ℃ of overnight incubation.The mixture of gained is centrifugal to collect the GST-TPO (1-174) as supernatant liquor, and the 20mM sodium citrate buffer solution with pH value 5.5 dilutes 2 times then, with acetate pH is transferred to 5.5 again.GST-TPO (1-174) solution is added in advance through 20mM sodium citrate buffer solution (pH 5.5) equilibrated SP Sepharese Fast Flow Zeo-karb.Behind 20mM sodium citrate buffer solution (pH 5.5) washing resin, with 20mM sodium citrate buffer solution (pH 5.5) the wash-out GST-TPO (1-174) that contain 500mM NaCl.With the 1M Tris damping fluid of pH 8.5 pH of elutriant is transferred to 8, mix so that remove the gst polypeptide sequence through cracking with the zymoplasm of 320 NIH units at zymoplasm identification polypeptide joint, put 4 hours in room temperature, 20mM sodium citrate buffer solution with pH 5.5 dilutes 5 times, add to then in advance through same buffer equilibrated SP Sepharose Fast Flow cationic exchange coloum, be used in the required material of 0-500mM NaCl wash-out of same buffer neutral line density gradient.

(4) all operations of completing steps (3) under the condition of existence 0.1% Spheron MD 30/70.

To thoroughly dialyse to the IMDM substratum in each fraction of the NaCl of about 200-400mM density wash-out through SP Sepharose Fast Flow cation exchange column chromatography, then with the assessment of rat CFU-MK detection system.Under the condition that reductive agent exists, analyze this grade timesharing with SDS-PAGE, detecting corresponding to molecular weight is that the band (purity 1-20%) of 19kd is a main protein band of this fraction.With SDS-PAGF this band is carried out the N-terminal sequence analysis and by the method for describing among the embodiment 1 after pvdf membrane shifts, confirm that this band contains the TPO sequence that is expressed as pGEX-2T/hT (1-174)-derived fusion proteins.The aminoacid sequence of the supposition of gained TPO is [Gly ^-1] TPO, given the known activity of zymoplasm on the sequence of zymoplasm identification polypeptide joint and the joint.

＜embodiment 42 〉

Structure is used for being expressed in the carrier that there is the people TPO (1-163 amino acids) of replacement position 1 (Ser-〉Ala) and position 3 (Ala-〉Val) at E.coli

With the clone pUC18 (XE) for preparing among XbaI and the EcoRI digestion embodiment 39 (1-332), through 2% agarose gel electrophoresis to reclaim the fragment of about 1000bp, the 1-332 amino acids residue of this fragment coding people TPO, use this fragment of Prep-A-Gene DNA purification cassette purifying subsequently, subclone is in advance through the pBluescript II SK of XbaI and EcoRI digestion then ⁺In (making) (is the host with E.coli DH5 α) by Stratagene.The clone who obtains in this way is called pBL (XE) (1-332).Then, (1-332) zone of (366-489 position) changes the optimal codon of E.coli into from its BamHI recognition sequence to 163 amino acids will to clone pBL (XE).Prepare the synthetic oligonucleotide 13-20 shown in following, then in containing the identical test tube of solution with every pair of synthetic oligonucleotide 13 and 14,15 and 16, and 17 and 18 phosphorylation, described solution is by 0.1mM ATP, 10mM Tris-acetate, and 10mM magnesium acetate and 50mM potassium acetate are formed.Add 1/10 volume again by 100mM Tris/HCl (pH 7.5), 100mM MgCl ₂Behind the solution of forming with 500mM NaCl, with gained solution heating 3 minutes, cool to room temperature was to obtain double chain DNA fragment then in boiling water bath.3 pairs of double chain DNA fragments that then connect gained with DNA connecting box (Takara Shuzo manufacturings): 13 and 14,15 and 16,17 and 18, the product that usefulness is thus connected is as template, and synthetic oligonucleotide 19 and 20 is finished PCR for primer.With the PCR product of BamHI and HindIII digestion gained, then through 2% agarose gel electrophoresis so that with the fragment of the about 130bp of Prep-A-Gene DNA purification cassette recovery.With described fragment subclone in advance with the pBL (XE) of BamHI and HindIII digestion (1-332) in (with E.coli DH5 as the host).From the clone of gained, filter out the clone who contains following nucleotide sequences with sequential analysis, and called after pBL (XH) is (1-163):

13：5′-GATCCGAACGCTATCTTCCTGTCTTTCCAGCACCTGCTGCGT-3′

(SEQ?ID?NO：103)；

14：5′-TTTGCCACGCAGCAGGTGCTGGAAAGACAGGAAGATAGCGTTCG-3′

(SEQ?ID?NO：104)；

15：5′-GGCAAAGTTCGTTTCCTGATGCTGGTTGGCGGTTCTACCCTG-3′

(SEQ?ID?NO：105)；

16：5′-ACGCACAGGGTAGAACCGCCAACCAGCATCAGGGAAACGAAC-3′

(SEQ?ID?NO：106)；

17：5′-TGCGTTCGTCGGGCGCCGCCAACCACTGCTGTTCCGTCTTAATGAA-3′

(SEQ?ID?NO：107)；

18：5′-AGCTTTCATTAAGACGGAACAGCAGTGGTTGGCGGCGCCCGACGA-3′

(SEQ?ID?NO：108)；

19:5 '-AAGGATCCGAACGCTATCTTCCTG-3 ' (SEQ ID NO:109); With

20：5′-AGAAGCTTTCATTAAGACGGAACA-3′(SEQ?ID?NO：110).

For the expression quantity that improves people TPO (1-163 position) and prevent protease hydrolysis N-end, structure is used to express the expression vector of mutant human TPO (1-163 position) (hereinafter referred to as " h6T (1-163) "), and described mutant human TPO is at people TPO (1-163 position) ([Ala ¹, Val ³] TPO (1-163)) and position 1 (Ser becomes Ala) and position 3 (Ala becomes Val) replacement is arranged, simultaneously at-1 coding Lys, at-2 coding Met ([Met ^-2, Lys ^-1, Ala ¹, Val ³] TPO (1-163)).Prepare following 4 kinds of synthetic oligonucleotide, by 1mM ATP, the 10mMTris-acetate, in the solution that 10mM magnesium acetate and 50mM potassium acetate are formed, with T4 kinases (Pharmacia manufacturing) with synthetic oligonucleotide 2-9 and 3-3 phosphorylation.In order to make these synthetic oligonucleotide form double chain DNA fragment, by 10mM Tris/HCl (pH 7.5), 10mM MgCl ₂In the solution of forming with 50mM NaCl with each to single stranded DNA fragment 1-9 and 2-9 and 3-3 and 4-3 annealing.Then two pairs of double-stranded DNAs of gained of forming by 1-9 and 2-9 and 3-3 and 4-3 with DNA connecting box (Takara Shuzo manufacturings) processing.Will through dna fragmentation subclone that ligation obtains in advance through the pBL (XH) of XbaI and NruI digestion (1-163) in, with the sequential analysis screening by correct clone's (is the host with E.coliDH 5 α) and called after pBL (XH) h6T (1-163) that replaces of following synthetic oligonucleotide:

1-9：5′-CTAGAAAAAACCAAGGAGGTAATAAATAATGAAAGCACCTGTACCA-3′

(SEQ?ID?NO：111)；

2-9：5′-CAGGTGGTACAGGTGCTTTCATTATTTATTACCTCCTTGGTTTTTT-3′

(SEQ?ID?NO：112)；

3-3：5′-CCTGCATGTGATTTACGGGTCCTGTCTAAACTGCTGCG-3′

(SEQ?ID?NO：113)；

4-3：5′-CGCAGCAGTTTAGACAGGACCCGTAAATCACATG-3′

(SEQ?ID?NO：114)；

10 1-9 20 30 40

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAAGCACCT

TTTTTT?GGTTCCTCCA?TTATTTATTA?CTTTCGTGGA

XhaI 2-9

50 60? 3-3 70 80

GTACCACCTG?CATGTGATTT?ACGGGTCCTG?TCTAAACTGC?TGCG

CATGGTGGAC?GTACACTAAA?TGCCCAGGAC?AGATTTGACG?ACGC

4-3

(SEQ?ID?NO：115)

Clone pBL (XH) (1-163) to reclaim the fragment of about 500bp with XbaI and HibdIII digestion.The 1-163 amino acids residue of this fragment coding mutant human TPO, use this fragment of Prep-A-Gene DNA purification cassette purifying subsequently, be cloned in advance pCFM536 (EP-A-136490) with XhaI and HindIII digestion (with the E.coli JM109 that transforms by pMW1 (ATCC No.39933) in advance as the host) then.The clone's called after pCFM536/h6T (1-163) that obtains with this method.Be used to express mutant human TPO with the E.coli bacterial strain that contains this expression vector as transformant, i.e. h6T (1-163).This expression plasmid contains the dna sequence dna shown in the ordered list (SEQ ID NO:11).

＜embodiment 43 〉

In E.coli, express h6T (1-163)

Expression by himself λ PL promotor control expression plasmid pCFM536 under cI857 repressor Gene Handling.60ml LB substratum with penbritin that contains 50 μ g/ml and 12.5 μ g/ml tsiklomitsins, on vibrator with the transformant that obtains among the embodiment 42 30 ℃ of overnight incubation, 25 μ l nutrient solutions of gained are added to 1000ml contain in the LB substratum of 50 μ g/ml penbritins, on vibrator in 37 ℃ of cultivations up at A ₆₀₀The OD value reach 1.0-1.2.After this, the about 330ml LB substratum that is heated to 65 ℃ is added in the nutrient solution so that making the final temp of substratum is 42 ℃, continues shaking culture 3 hours to induce the expression of h6T (1-163) at 42 ℃.

＜embodiment 44 〉

The h6T that purifying is expressed in E.coli (1-163) also confirms its biological activity

3.6g is produced h6T (1-163) recombinant bacterial strain freeze cell suspension in 10ml water, with the broken instrument fragmentation of high pressure.Make suspension centrifugal, reclaim the precipitation part and remove most of contaminating protein matter, groups of cells is graded.The precipitation that is reclaimed that will contain h6T (1-163) partly is suspended in the 7ml water, adds 3ml Tris damping fluid (pH 8.5) while stirring, and then adds urea (final concentration, 8M), and Guanidinium hydrochloride (final concentration, 6M), N-sarcosyl (final concentration, 2%).After dissolving inclusion in stirring at room 5-20 minute, with the pH value be 8.5 20mM Tris damping fluid with 10 times of gained solution dilutions, make protein refolding 4 ℃ of overnight incubation.In this example, outside the deacration oxidation, use gsh and copper sulfate as additive.Through centrifugal, h6T (1-163) is recovered in the supernatant liquor.Exist under the situation of reductive agent, analyze each through SDS-PAGE and reclaim a level timesharing, detect one corresponding to molecular weight 18kd for the main protein band of each fraction (purity, 30-40%).With SDS-PAGE this band is carried out the N-terminal sequence analysis, shift with pvdf membrane by the method described in the embodiment 1 then, prove that this band contains the TPO sequence that is expressed as pCMF536/h6T (the 1-163)-mutant of deriving TPO.Each fraction is thoroughly dialysed to the IMDM substratum, and, find all that in all fractions dosage relies on the TPO activity of form with the assessment of rat CFU-MK detection system.

＜embodiment 45 〉

Prepare anti--TPO peptide antibody and use SDS-PAGE and Western analyzing and testing TPO

Successfully preparing anti--TPO peptide antibody makes and might detect TPO protein through immunological method.The result, 3 from the TPO aminoacid sequence of determining, have been screened as antigen useful relatively zone (seeing below) as if, zone with each screening, press Tam (Proc.Natl.Acad.Sci.USA, 85,5409-5413,1988) synthetic four chain multiple antigenic peptide (MAP) the type peptides of method, then with immune 2 rabbits of the various institutes synthetic peptide of 100 μ g 8 times to obtain corresponding antiserum(antisera) sample.

Contained aminoacid sequence in synthetic peptide antigen

(a) rat TPO (9-28) (peptide RT1 district)

PRLLNKLLRDSYLLH RRLSQ(SEQ?ID?NO：116)

(the amino-acid residue of determining from gene, 24 R is former to be S.)

(b) rat TPO (46-66) (peptide RT2 district)

FSLGEWKTQTEQSKAQDILGA(SEQ?ID?NO：117)

(c) rat TPO (163-180) (peptide RT4 district)

SRTSQLLTLNKFPNR LLD(SEQ?ID?NO：118)

(the amino-acid residue of determining from gene, the LLD of 178-180 position is former to be TSG.)

Then, in these antiserum(antisera) samples, anti--RT1 peptide and anti--RT2 peptide are at first through a-protein (PROSEP-A; Make article number 8427 by Bioprocessing Ltd.) column chromatography with preparation IgG fraction (be respectively 2,344mg and 1,920mg), by itself and active form vitamin H (NHS-LC-Biotin II; PIERCE makes, article number 21336) coupling and make the decomposing biological elementizations at different levels that are respectively 54mg and 32mg.The sample that will contain the TPO that recombinates is through SDS-PAGE, use then with method electroblotting identical described in the embodiment on PVDF or nitrocellulose filter,, finish Western with ordinary method and analyze as first antibody with these biotinylated antibody.

That is, the film behind the trace is used by 20mM Tris-HCl and the solution washing (TBS) formed of NaCl (pH 7.5) 5 minutes O.5M, washed 2 times each 5 minutes, use blocker (BlockAce again with the 0.1%Tween20 (TTBS) that contains TBS; Make article number uk-B25 by Dainippon Pharmaceutical) handled 60 minutes.Then, with contain 10 μ g/ml biotinylated anti--the TTBS solution of TPO peptide antibody, 0.05%BSA and 10%BlockAce handles film 60 minutes, and is each 5 minutes with TTBS washing 2 times then.After this, with by by the TTBS solution dilution 5 that contains 10%BlockAce, the avidin of alkaline phosphatase-mark of 000 times (is made by LeincoTechnologies, article number A108) solution that obtains is handled film 30 minutes, again with TTBS washing 2 times each 5 minutes, washed 5 minutes with TBS, use alkaline phosphatase substrate (making article number 170-6432 by Bio-Rad) colour developing then.At room temperature finish above-mentioned Western engram analysis.

The result, it not only can be identified in the multiple recombinant rat TPO protein of expressing in the COS1 cell, and be identified in the various recombinant human TPO protein of expressing in COS1 cell and the E.coli cell (illustrative ground, people TPO as the plasmid pHTP1-that in the COS1 cell, expresses or plasmid pHTF1-source, with glycosidic linkage-cracked product and the product of zymoplasm digestion and the mutant TPO:h6T (1-163) that expresses in E.coli of the GST-TPO that expresses in E.coli (1-174), all these all are described in an embodiment).In addition, these results also make and may analyze various types of recombinant human TPO.

Except above-mentioned points, also proved the possibility of preparation Anti-Human TPO peptide antibody.The antibody that is obtained by these technology not only can be used for Western to be analyzed, and can by antibody column purifying TPO and commonly used be auxiliary immunological method with antibody.

Screening expects to have suitable relatively antigenic 6 zones (seeing Table 4) in the people TPO aminoacid sequence shown in the SEQ ID NO:7.Synthetic four poly-multiple antigenic peptide (MAP) peptide types, each monomer are respectively with different regional corresponding.With every kind of peptide with 2 rabbits of 100mg/ time dosage immunity 8 times.

Different therewith, also synthesized Cys residue wherein with the monomeric peptide of the C-terminal bonding in each peptide district.With this peptide as the test antigen so that determine the antigen titration degree with the enzyme immunodetection.As a result, determined that its antigen titration degree of serum of above-mentioned preparation increases, therefore with these serum as antiserum(antisera).

Thereby by preparing antibody with the antiserum(antisera) of producing at this peptide with two rabbits of each antigen peptide immunity.According to different rabbit individualities, two kinds of anti--HT1 peptide antibodies with gained are called anti--HT1-1 peptide antibody and anti--HT1-2 peptide antibody respectively.

To illustrate the purifying of anti--HT1-1 peptide antibody below.

At first, with the HT1 monomeric peptide and 12ml Sulfo-Liak coupling gel (Pierce, the article number 44895) coupling of Cys residue bonding.In brief, will contain antigenic peptide solution with coupling buffer (50mM Tris, 50mM EDTA-NapH8.5) the equilibrated gel coupling of 6 volumes (relative gel volume) 15 minutes.Incubation is after 30 minutes, with the coupling buffer detergent gel of 3 volumes (with respect to gel volume) then.The coupling buffer that will contain 0.05M L-Cys-HCl is added in the gel through blocking unreacted radical more than 15 minutes with the amount of 1ml/ml gel.Behind the incubation 30 minutes, with 8 volumes (with respect to gel volume) coupling buffer detergent gel.At room temperature finish all linked reactions.Therefore, peptide is with 28.3% coupling rate and gel covalent attachment, and preparation contains the antigenicity of 0.8mg peptide/ml gel then.

The antiserum(antisera) that 76.7ml (protein content 3620mg) is contained anti--HT1-1 peptide antibody (is extracted out from a rabbit, total amount is 78.4ml) add in advance through containing 50mM phosphate buffered saline buffer (pH8) the equilibrated antigen post of 150mM NaCl and 0.05% sodiumazide, then with the identical effluent fraction (protein content 3680mg) of damping fluid washing to obtain 105.9ml.Use the fraction of 0.1M citrate buffer (pH 3.0) wash-out absorption then, and then use carbonate buffer solution (pH 9.9) neutralization of 21.1ml 0.1M, ultrafiltration then (with Amicon YM30 film) concentrates to obtain containing 150mM NaCl and 0.05%NaN ₃50mM phosphate buffered saline buffer (pH8) in purifying anti--the HT1-1 peptide antibody.

Similarly, preparation following antibody: anti--HT1-2 peptide antibody (60.0mg); Anti--HT2-1 peptide antibody (18.8mg); Anti--HT2-2 peptide antibody (8.2mg); Deng.Can prepare anti-HT3 with similar methods arrives-the HT6 peptide antibody.

By making resisting-the HT1-1 peptide antibody of 3mg affinity purification with activatory vitamin H (Pierce, NHS-LC-Biotin II, article number 21336) coupling, anti--the HT1-2 peptide antibody, anti--HT2-1 peptide antibody or anti--HT2-2 peptide antibody biotinylation.

To import from the gene of that coding schedule 4 is listed aminoacid sequence and make the culture supernatants of Chinese hamster ovary celI of its expression behind the partially purified recombinant human TPO standard substance SDS-PAGE, with Western trace (on nitrocellulose filter or PVDF), find that all above-mentioned antibody purified all can discern and detect people TPO.

Table 4

Included people TPO aminoacid sequence in four poly-MAP type antigenic synthetic peptides

People TPO (amino acid no 8-28) peptide HT1 district:

DLRVLSKLLRDSHVLHSRLSQ(SEQ?ID?NO：119)

People TPO (amino acid no 47-62) peptide HT2 district:

SLGEWKTQMEETKAQD(SEQ?ID?NO：120)

People TPO (amino acid no 108-126) peptide HT3 district:

LGTQLPPQGRTTAHKDPNA(SEQ?ID?NO：121)

People TPO (amino acid no 172-190) peptide HT4 district:

NELPNRTSGLLETNFTASA(SEQ?ID?NO：122)

People TPO (amino acid no 262-284) peptide HT5 district:

SLPPNLQPGYSPSPTHPPTGQYT(SEQ?ID?NO：123)

People TPO (amino acid no 306-332) peptide HT6 district:

PSAPTPTPTSPLLNTSYTHSQNLSQEG(SEQ?ID?NO：124)

＜embodiment 46 〉

Preparation resists-TPO peptide antibody post

Because the anti--rat TPO peptide antibody that obtains among the embodiment 45 can be discerned rat and people TPO molecule, therefore will resist-immunoglobulin (Ig) (IgG) fraction of RT1 peptide antibody and the resisting-RT2 peptide antibody-TPO peptide antibody post anti-that link to each other with the gel support of chemical activation to prepare with following method.Respectively from the two kind antibody of two rabbit anteserum preparations as material.That is, from anti--RT1 peptide antibody of two rabbits preparation respectively called after anti--RT1-1 peptide antibody and anti--RT1-2 peptide antibody, from anti--RT2 peptide antibodies of other 2 rabbits preparations respectively called after anti--RT2-1 peptide antibody and anti--RT2-2 peptide antibody.Owing to respectively these antibody are used for the preparation of antibody column, therefore obtain 5 posts altogether, promptly 2 resist-RT1 peptide antibody posts (hereinafter being called " anti--the RT1-1 antibody column " and " anti--the RT1-2 antibody column "), 2 anti--RT2 peptide antibody posts (hereinafter referred to as " anti--the RT2-1 antibody column " and " anti--the RT2-2 antibody column ") and one by will resist-the RT1-2 peptide antibody with resist-the RT2-1 peptide antibody mixes, the antibody column (anti-RT1-2+2-1 mixed antibody post) that mixture and gel coupling are prepared then.

Each antibody is dissolved in the solution of 50mM sodium phosphate and 0.15M NaCl (pH 8.0), the final concentration that reaches 5mg/ml is (perhaps for anti--RT1+2 mixed antibody post, anti--RT1-2 peptide antibody and anti--the RT2-1 peptide antibody respectively is 2.5mg/ml), with the solution of 2.31ml gained and the expansible formyl of 1.54ml-activatory gel (Formyl-Cellulofine, Chisso makes) mix, in 4 ℃ of linked reactions of carrying out 2 hours.To the reductive agent that wherein adds 1.1ml 10mg/ml (Trimethylamine borine (TMAB) solution is made article number 680246 by Seikagaku kogyo) solution, then carry out 6 hours linked reaction again, centrifugal subsequently recovery gel section.The 10ml purified water is added in the gel, through the gel section of centrifugal recovery, this step is repeated 4 times to remove unreacted antibody molecule once more.Then, with gel and the 4.6ml blocking solution (0.2M sodium phosphate and 1M thanomin, pH 7.0) and the mixing of 1.1ml reductant solution of gained, at 4 ℃ of active groups of handling 2 hours with blocking-up unreacted gel at least.After this, centrifugal with purified water and DPBS detergent gel with whizzer, be placed in the little cylindrical tube, with 3M potassium sulfocyanate solution and 0.1M Gly-HCl (pH 2.5) solution washing, use the DPBS balance, store then.

Anti--the RT1-1 antibody column, anti--the RT1-2 antibody column, anti--the RT2-1 antibody column, in 5 kinds of anti--TPO peptide antibody gels of anti--RT2-2 antibody column and anti--RT1-2-2-1 mixed antibody post, the coupling rate of corresponding IgG fraction is respectively 97.4%, 95.4%, 98.4%, 98.3% and 99.4%.In addition, the quantity with every gel volume link coupled IgG fraction is respectively: 5.6mg/ml gel, 5.8mg/ml gel, 5.7mg/ml gel, 5.7mg/ml gel and 2.9mg/ml gel.As a result, with the source and the antigenic difference of antibody, coupling quantity and efficient do not have obvious variation, finish the experiment shown in the following example 47 with these antibody columns.

＜embodiment 47 〉

Derive from the TPO of culture supernatants (by what obtain), definite then its biological activity with anti--TPO antibody column and reversed phase column chromatography purifying with expression vector pHTP1 transfection COS1 cell

Carry out vitro detection to assess following purification of samples with the M-07e detection system.To from embodiment 35, partly transform the sample (fraction except that main TPO fraction by the TPO that obtains with expression vector pHTP1 transfection COS1 cell gained culture supernatants, promptly use the 20mM Trisodium Citrate, pH 5.8 washing Macro-Prep Methyl HIC posts cross the later fraction F3 of post fraction F1 and F2 and the fraction F1 and the F3 of SP Sepharose Fast Flow post) mix inferior collecting tank fraction with preparation TPO (5,463.79ml; Protein concn, 0.490mmg/ml; Gross protein, 2,676mg; Relative reactivity 12,100; With gross activity 32,380,000), use ultra-filtration equipment (Omega Ultraset then, it is 8,000 that the normal molecular amount is blocked, and is made by Filtron) concentrate, change the solvent that concentrates fraction into DPBS, handle small samples with the ultra-filtration equipment (Anicon manufacturing) of being furnished with the YM-10 film again and contain 0.05%NaN so that it becomes ₃120.2ml DPBS solution.Then, obtain among the embodiment 46 all 5 kinds anti--TPO peptide antibody gels are mixed, make an antibody column (diameter 1.6cm, height of bed 4.8cm are called anti--RT1+2 mixed antibody post), TPO is added to this post with the flow velocity that 0.033ml/ divides to the collecting tank fraction.After finishing sample, use the DPBS wash-out, it is very little up to the UV absorption value to collect elutriant, concentrates the elutriant of collection thus must be post fraction F1 (82.62ml with the ultra-filtration equipment (Amicon manufacturing) of being furnished with the YM-10 film then; Protein concn, 14.3mg/ml; Gross protein 1.184mg; Relative reactivity 67,500; Gross activity 79,900,000).Next, the F2 fraction (92.97ml that adsorbs with acid elutriant (0.1M Gly-HCl, pH 2.5) wash-out post; Protein concn, 0.12mg/ml; Gross protein, 11.1mg; Relative reactivity, 257,100, gross activity, 2,860,000).Still contain the TPO activity although cross post fraction F1, its relative reactivity of TPO that is further purified antibody column absorption has improved about 20 times.Promptly, with 0.1%TFA is developping agent A, the 1-propyl alcohol that contains 0.05%TFA is developping agent B, will mix with the developping agent B of 1/10 volume from the F2 fraction that antibody column obtains, and mixture is used in advance through 20%B equilibrated Capcell Pak CI 300A post with the flow velocity that 0.4ml/ divides, thereby (Shiseido makes to finish Capcell Pak CI300A, article number CI TYPE:SG300A, diameter 4.6mm, height of bed 150mm, with a diameter 4.6mm, the front pillar of height of bed 35mm connects) column chromatography.After going up sample fully, with 20%B wash-out 5 minutes, and then with linear density gradient 20%B to 40%B wash-out 50 minutes, so that 1ml (2.5 minutes) is a part of elutriant is collected in the polypropylene test tube.

The elutriant of 2 μ l in each test tube (fraction 1/500) is mixed with HSA, and through ultrafiltration and concentration, the 0.25ml IMDM that obtains containing 0.02%HSA detects culture solution and is used for identifying after testing the TPO active fraction.As a result, (in the scope of propyl alcohol concentration at 28.5-32.5%) found strong TPO activity in the sample of 20 to No. 23 test tubes.In addition, the method described in the embodiment 45 of pressing determines to exist TPO behind these samples of Western engram analysis, based on DPC III molecular weight marker, after detecting under reductive condition, its apparent molecular weight is 60,000-70,000, also exist molecular weight to be respectively 32 simultaneously, 000-43,000 and 20,000-30, other molecule of 000.

＜embodiment 48 〉

Determine the biological activity of TPO, described TPO derives from the culture supernatants that obtains by with expression vector pHTP1 transfection COS1 cell, and through Capcell Pak CI 300A column purification

Collect the TPO active fraction of purifying among the embodiment 36, promptly the 20-23 test tube of Capcell Pak CI 300A post (propyl alcohol concentration is in 28.5% and 32.5% scope) mixes with 0.21ml glycerine, then through centrifugal evaporation concentration.The guanidine hydrochloride solution of gained enriched material with 0.21ml 6M mixed, be diluted to 1ml with DPBS, with Sephadex G25 post (NAP-10, make by PharmaciaBiotech, article number 17-0854-01), carry out buffer-exchanged with the DPBS that contains 0.01%HSA, with the 1.1ml DPBS that contains 0.01%HSA, obtain TPO active fraction FA (2.6ml) at last then.In order to detect the TPO biological activity of this sample, and carry out detecting in the body.That is, with this active fraction through subcutaneous administration in ICR male mice (8 week age), every group comprises 4 animals, every day every animal 100 μ l dosage totally 5 days (gross activity of measuring through the M-07e detection system is 110,000).In contrast, the 100 μ lDPBS that contain 0.01%HSA with identical method subcutaneous administration.With second day that uses at last, collect blood so that measure platelet count before using with minicell counter (F800, Toa Lyo Denshi makes) from the eyeground.In the TPO treatment group, with use before compare, after having used, platelet count has on average increased about 1.42 times, and is higher 1.23 times than control group, and significant difference (p＜0.05, Studeut t-check) is arranged between them.On these results' basis, confirm to have the ability that improves platelet count in the body by the aforementioned people TPO of mammalian cell production.

＜embodiment 49 〉

Determine the biological activity of thick TPO fraction, described TPO fraction derives from 33 liters of culture supernatants that obtain by with expression vector pHTP1 transfection COS1 cell, and by the cationic exchange coloum partial purification

(1) carries out vitro detection to assess following purification of samples with the M-07e detection system.With with identical method described in the embodiment 36, obtain 33 liters of serum-free culture thing supernatant things by expression vector pHTP1 transfection COS1 cell, filter to reclaim supernatant liquor by one 0.22 μ m filters then.With a ultra-filtration equipment (PLGC pellicon Cassette, it is 10,000 that the normal molecular amount is blocked, and is made by Millipore) it is concentrated 10 times, mix with the proteinase inhibitor p-APMSF of 1mM final concentration then to obtain 2, the sample of 018ml (protein concn 3.22mg/ml; Gross protein 6,502mg, relative reactivity 66,000; Gross activity, 429,100,000).Then use ultra-filtration equipment (Omega Ultraset, it is 30,000 that the normal molecular amount is blocked, and is made by Filtron) to concentrate again, obtain molecular weight and be fraction (volume, 1,190ml more than 30,000 or 30,000; Protein concn, 2.54mg/ml; Gross protein 3,020mg, relative reactivity 82,500; Gross activity, 249,000,000) and molecular weight be fraction (volume 2,947ml below 30,000 or 30,000; Protein concn 0.471mg/ml; Gross protein 1,402mg; Relative reactivity, 4,500, gross activity 6,310,000).Be 30,000 or be lower than in 30,000 fractions at molecular weight, have the TPO activity, illustrate culture supernatants may contain its from zooblast, express or the excretory process in.Reduced the TPO of its molecular weight.On the other hand, with 20mM sodium citrate buffer solution (pH 6.1) exchange molecular weight 30,000 or be higher than 30, the damping fluid of 000 fraction, and the flow velocity that divides with 5ml/ adds in advance through 20mM sodium citrate buffer solution (pH6.1) equilibrated SP Sepharose Fast Flow (diameter 2.6cm, height of bed 29cm is made article number: 17-0729-01) post by PharmaciaBiotech.After last sample finishes, this post is washed and wash-out with 20mM sodium citrate buffer solution (pH 6.1).Then, the solution of forming as developping agent A with by developping agent A and 1M NaCl with 20mM sodium citrate buffer solution (pH 6.1) is as developping agent B, flow velocity with the 3ml/ branch, with linear gradient 0%B-50%B wash-out 215 minutes, by 50%B-100%B wash-out 20 minutes, collect an elutriant with every 30ml (10 minutes) again with the polypropylene test tube.Detect each elutriant when determining activity distribution with the M-07e detection system, find in very wide scope, all can find the TPO activity.As a result, collect with concentration be the fraction that comprised the post fraction of 50mM or lower NaCl wash-out as the F1 fraction, use 50-1, the main TPO level of 000mMNaCl wash-out is divided into the F2 fraction.The volume of F1 fraction is 1,951ml (protein concn, 2.05mg/ml; Gross protein, 3,994mg, relative reactivity; 13,500; Gross activity 53,900,000), F2 is 649.8ml (protein concn 1.11mg/ml; Gross protein 721mg; Relative reactivity 268,000; Gross activity, 193,000,000).

(2) determine the biological activity of SP Sepharose Fast Flow fraction F2

By Sephadex G 25 post (NAP-25, Pharmacia Biotech makes, article number 17-0852-01), with isolating 2.5ml SP Sepharose Fast Flow fraction F2 in the 3.5ml DPBS buffering exchange above-mentioned steps (1) that contains 0.01%HSA, determine this sample (protein concn, TPO biological activity 1.46mg/ml) with detecting in the body.That is, give ICR male mice (8 age in week) with the active fraction subcutaneous administration, every group comprises 4 animals, every animal μ l every days 100 totally 5 days (gross activity of being measured by the M-07e detection system is 123,000).In contrast, the 100 μ l DPBS that will contain 0.01%HSA with identical method through subcutaneous administration.Blood is collected so that with minicell counter (F800 is made by Toa LyoDeushi) measurement platelet count in before using and after using second day from the eyeground.In using the group of TPO, to use the back that finishes and compare with using preceding value, platelet count on average increases about 1.29 times, and higher 1.12 times than control group, and significant difference (p＜0.05, Student t-check) is arranged between them.These presentation of results, the aforementioned people TPO that is produced by Mammals has the ability that improves platelet count.

＜embodiment 50 〉

Structure is used for the recombinant vectors at Chinese hamster ovary celI expressing human TPO chromosomal DNA, pDEF202-ghTPO

With restriction enzyme KpnI and SpeI digested vector pDEF202, the fragment that contains mouse DHFR minigene and SV40 polyadenylation signal then through agarose gel electrophoresis with separation, use T4 dna ligase (being made by Takara Shuzo) to connect then and obtain expression vector pDEF202-ghTPO, the fragment that obtains thus contains by remove the carrier DNA that the zone that contains the SV40 polyadenylation signal obtains from plasmid pEFHGTE with restriction enzyme KpnI and SpeI processing.This plasmid contains the SV40 replication origin, the people extends factor 1-α promotor, is used to transcribe the early stage polyadenylation region of SV40, mouse DHFR minigene, pUC18 replication origin and the β-Nei Xiananmei gene (Amp of people TPO gene ^r), and people TPO chromosomal DNA is connected in the site, downstream that the people extends factor 1-α promotor.

＜embodiment 51 〉

Expressing human TPO chromosomal DNA in Chinese hamster ovary celI

Flat board (Falcon manufacturing) with a diameter 6cm is being cultivated Chinese hamster ovary celI (a kind of dhfr at the α-MEM that contains 10% foetal calf serum (α-MEM (-) replenishes with thymidine and xanthoglobulin) ^-Bacterial strain; Uvlaub and Chasin, Proc.Natl.Acad.Sci USA, vol.77, p4216,1980) make its growth, use the cell of calcium phosphate method (Cellphect, Pharmacia makes) transfection gained then.

That is, with the 10 μ g plasmid pDEF202-ghTPO and 120 μ l buffer A and the 120 μ l H that prepare among the embodiment 50 ₂O mixes, then in room temperature with the mixture incubation of gained 10 minutes.Again this solution is mixed with 120 μ l buffer B, in room temperature incubation 30 minutes again.Prepared dna solution is placed in the flat board, at CO ₂Cultivated 6 hours in the insulation can.Remove substratum and with α-MEM (-) with the dull and stereotyped washing of gained 2 times after, the α-MEM (-) that will contain 10% dimethyl sulfoxide (DMSO) was added in the flat board, room temperature treatment 2 minutes.Then, add and to contain the 10% non-selection substratum (α-MEM (-) op.cit. replenishes with xanthoglobulin and thymidine) of having dialysed foetal calf serum, cultivated then 2 days, finish selection with containing the 10% selection substratum (α-MEM (-), no xanthoglobulin and thymidine) of having dialysed foetal calf serum.Use the trypsin treatment cell, and the cell that will handle is distributed in the dull and stereotyped of 5 diameter 10cm or 20 the 24 hole flat boards in a diameter 6cm flat board, cell is continued to cultivate, changed in per 2 days simultaneously and once select substratum, thereby finish selection.When detecting measurement people TPO activity, in the flat board of observing cell proliferation or hole, in the supernatant liquor, people TPO activity is arranged with Ba/F3.

In this example, also can carry out the transfection of Chinese hamster ovary celI with pEFHGTE and pMG1 cotransfection CHO.

＜embodiment 52 〉

Structure is used at the carrier of E.coli expressing human TPO protein (1-163 amino acids residue) (hereinafter referred to as " hMKT (1-163) ") and determines its expression, in described TPO protein ,-1 and-2 add Lys residue and Met residue respectively

In order to express its 1-and the amino-acid residue identical protein of 3-amino acids residue with people TPO protein (1-163 amino acids residue) same position, with following synthetic oligonucleotide 1-13,2-13,3-3 and 4-3, press and identical method described in the embodiment 42, structure is used for expressing at E.coli the carrier pCFM536/hMKT (1-163) of hMKT (1-163), also claims [Met ^-2, Lys ^-1] TPO (1-163):

1-13：5′-CTAGAAAAAACCAAGGAGGTAATAAATAATGAAATCTCCTGCACCA-3′

(SEQ?ID?NO：125)；

2-13：5′-CAGGTGGTGCAGGAGATTTCATTATTTATTACCTCCTTGGTTTTTT-3′

(SEQ?ID?NO：126)；

3-3：5′-CCTGCATGTGATTTACGGGTCCTGTCTAAACTGCTGCG-3′

(SEQ?ID?NO：127)；

4-3：5′-CGCAGCAGTTTAGACAGGACCCGTAAATCACATG-3

(SEQ?ID?NO：128)；

10 1-1320 30 40

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAATCTCCT

TTTTTT?GGTTCCTCCA?TTATTTATTA?CTTTAGAGGA

XhaI 2-13

50 60 3-3 70 80

GCACCACCTG?CATGTGATTT?ACGGGTCCTG?TCTAAACTGC?TGCG

CGTGGTGGAC?GTACACTAAA?TGCCCAGGAC?AGATTTGACG?ACGC

3-3

(SEQ?ID?NO：129)

This expression plasmid contains the dna sequence dna shown in the ordered list (SEQ ID NO:12).After this, use the expression of inducing hMKT (1-163) with method identical described in the embodiment 43.

Make the marking protein that obtains thus through SDS-PAGE, transfer to then on the pvdf membrane, by the-terminal amino acid sequential analysis, confirm that this protein contains the aminoacid sequence of expressed hMKT (1-163) again.

＜embodiment 53 〉

Get the people TPO of the people TPO that expresses among the comfortable E.coli with Guanidinium hydrochloride and gsh refolding, h6T (1-163), purifying and determine its biological activity then

The cell that freezes of the 1.2g for preparing among the embodiment 43 being produced the recombinant strain of h6T (1-163) is suspended from the 3ml water, uses the high pressure crusher fragmentation.Suspension is centrifugal, reclaim the precipitation part, remove most of protein, groups of cells of polluting and grade.The precipitation that contains h6T (1-163) that reclaims thus partly is suspended in the water that final volume is 4ml.1ml 1M Tris damping fluid (pH 8.5) is added in the suspension while stirring, and then adds 20ml 8M Guanidinium hydrochloride, subsequently stirring at room 5 minutes with the dissolving inclusion., with 10 times of gained solution dilutions 5mM reduced glutathion and 0.5mM Sleep-promoting factor B are dissolved in the solution of dilution while stirring with 20mM Tris damping fluid (pH 8.5), with gained solution 4 ℃ of overnight incubation.Through centrifugal, h6T (1-163) is recovered in the supernatant liquor.Concentrate the 160ml supernatant liquor of gained with YM10 ultra-filtration membrane (making) by Amicon, then with DPBS change damping fluid with obtain the fraction that final volume is 3.4ml (protein concn, 2.18mg/ml).This fraction to the thorough dialysis of IMDM substratum and with after the assessment of rat CFU-MK detection system, has been found strong TPO activity (relative reactivity, 58,000).

The TPO active fraction of above-mentioned preparation is carried out detecting in the body.That is, with active fraction through subcutaneous administration in ICR male mice (7 week age), every group of 4 animals, every continuous 5 days of animal μ l every days 170 (gross activity of being measured by rat CFU-MK detection system is 22,000).In contrast, with identical method, with 170 μ l DPBS subcutaneous administration in 6 animals of control group.Before using and after used second day and 3 days, collect blood from the eyeground so that with minicell counter (F800 is by Toa Lyo Denshi manufacturing) measurement platelet count.In using the group of TPO, compare with the value before using, at the 2nd day that has used, platelet count on average improved about 2.15 times, even after having used 3 days, to be worth be 2.13 times, still remain unchanged.Behind the 2nd day and 3 days of having used, the platelet count in the TPO-treatment group is higher 1.73 and 1.80 times than control group, and significant difference (p＜0.001, Student t-check) is arranged between them.These results show, are produced and had by the people TPO of method for preparing the ability of raising platelet count in the body by E.coli.

＜embodiment 54 〉

With the people TPO that N-dodecanoyl sodium sarcosinate and copper sulfate refolding are expressed in E.coli, h6T (1-163), purifying is also determined its biological activity then

The 0.6g of preparation among the embodiment 43 is produced h6T (1-163) recombinant strain freeze cell suspension in 3ml water, use the high pressure crusher fragmentation, centrifugal then recovery precipitates part.To precipitate the part be suspended in the 3.1ml water after, with 0.19ml 1M Tris damping fluid (pH 9.2), 11.25 μ l1MDTT, 38 μ l 0.5M EDTA and 0.38ml 10% Septochol sodium solution are added in the suspension while stirring, and the mixture of gained was at room temperature stirred 40 minutes.Then with its centrifugal with reclaim the precipitation part and remove most contaminating protein matter, groups of cells is graded.The precipitation of gained is suspended from the 4ml water, and centrifugal recovery contains the precipitation part of h6T (1-163).The precipitation that is reclaimed is suspended from the 3.8ml water, 0.2ml 1M Tris damping fluid (pH8) and 1ml 10%N-dodecanoyl sodium sarcosinate are added in the suspension while stirring, at room temperature stir 20 minutes then with the dissolving inclusion.Gained solution is mixed with 5 μ l1% copper sulfate, at room temperature stir spend the night (about 20 hours).The supernatant liquor part that the solution centrifugal of gained is contained h6T (1-163) with recovery, the 5ml supernatant liquor mixes with 5ml water and 10ml 20mM Tris damping fluid (pH 7.7), mix with the centrifugal exchange resin of 2.6g 20-50 order Dowex 1-X4 chloride form then, then stirred 90 minutes., subsequently that this fraction is centrifugal to reclaim supernatant liquor with glass filter deionizing exchange resin to reclaim the fraction that resin does not adsorb.The gained supernatant liquor is used in advance through 20mM Tris damping fluid (pH7.7) equilibrated SP Sepharose Fast Flow cationic exchange coloum, with the NaCl wash-out of identical damping fluid by linear gradient 0-500mM.Each fraction of SP Sepharose Fast Flow cation exchange column chromatography wash-out is thoroughly dialysed to the IMDM substratum, and, strong TPO activity (relative reactivity, 19 have been found for the elutriated fraction of about 100mM in NaCl concentration with the assessment of rat CFU-MK detection system, 000,000).(Ultra Free CL, it is 5,000 that normal molecular is blocked, and is made article number UFC4LCC25 by Millpore) concentrates 1.6 times (2.5ml, protein concn, 25 μ g/ml) with this fraction with a ultra-filtration equipment.Exist under the condition of reductive agent, analyzing institute's spissated level timesharing with SDS-PAGE, detect a main band that is equivalent to TPO (purity, 70-80%).

Detect the TPO active fraction of using method for preparing with detection method in the body.That is, in ICR male mice (8 age in week), each group comprises 4 animals, every continuous 5 days of animal μ l every days 100 (gross activity of being measured by rat CFU-MK detection system is 47,500) with the active part subcutaneous administration.In contrast, with identical method, will contain 100 μ l 20mMTris damping fluid (pH 7.7) subcutaneous administration of 100mM NaCl.Before using,, collect blood so that measure platelet count with minicell counter (F800 is made by Toa Lyo Denshi) from the eyeground with second day that has used.In using the group of TPO, with use before compare, use finish after, platelet count has on average increased about 1.73 times, and higher 1.59 times than control group, and significant difference (p＜0.01, Student t-check) is arranged between the two.These presentation of results are by ability E.coli production and that raising platelet count in the body is arranged by the people TPO of method for preparing.

＜embodiment 55 〉

The large scale culturing of Chinese hamster ovary celI

With the Chinese hamster ovary celI system (CHO28-30 cell, 25nM MTX resistance) of following method large scale culturing by the production people TPO that obtains in the Chinese hamster ovary celI of people TPO expression plasmid pDEF202-hTPO-P1 transfection in the embodiment 32.In containing the DMEM/F-12 substratum (GIBCO) of 25nM MTX and FCS, cultivate and the propagation Chinese hamster ovary celI.Behind the trypsin solution isolated cell, with 1 * 10 ⁷Individual cell inoculation with the rotating speed of 1rpm, was cultivated 3 days in 37 ℃ in the revolving bottle that contains the 200ml same medium (ex Falcon, Falcon 3000) then.Cultivate after 3 days, culture supernatants is removed in suction, uses the adherent Chinese hamster ovary celI of 100ml PBS rinsing then.Be added in the bottle neither containing the 200ml DMEM/F-12 substratum (GIBCO) that 25nM MTX do not contain 10%FCS yet, with the rotating speed of 1rpm in 37 ℃ with cell cultures 7 days.Cultivate after 7 days, reclaim culture supernatants as parent material to be used for purge process subsequently.Finish said process to obtain the culture supernatants of 100L with 500 revolving bottles.

＜embodiment 56 〉

Purifying people TPO from the Chinese hamster ovary celI system that produces TPO

(1) the serum-free culture thing supernatant liquor that obtains in will about 100L embodiment 55 filters to obtain its filter thing by the filter of 0.22 μ m, then at ultra-filtration equipment (RLTK Pelliconcassette, it is 30,000 that the normal molecular amount is blocked, ex Millipore) upward concentrate.Replace the solvent of enriched material with pure water after, proteinase inhibitor p-APMSF (Wako Pure Chemicals) and Pefabloc SC (Marck) are added to the final concentration that is respectively 1mM and 0.35mM in the aqueous solution of gained to obtain 3628ml molecular weight 30,000 or greater than 30,000 fraction (protein concn: 1.60mg/ml; Gross protein 5805mg; Relative reactivity: 1,230,000: gross activity: 7,149,000,000).Press subsequently described in the embodiment 45, with this fraction of Wastern engram analysis.As a result, the proteinic molecular weight of contained TPO is between 66,000 and 100,000.In more detailed the detection, find in crossing the post fraction, to contain the TPO kind that molecular weight is lower than above-mentioned TPO.

With a ultra-filtration equipment (PLGC Pellicon cassette, the normal molecular amount of blocking 10,000 Millipone) concentrates separately and contains molecular weight and be not more than 30, the ultrafiltration thing of 000 TPO is to obtain the lower molecular weight TPO fraction (protein concn: 0.36mg/ml of 1901ml; Gross protein: 684mg; Relative reactivity: 245,500; Gross activity: 167,900,000).This shows produced low-molecular-weight TPO kind during cell cultures.

Then, 764g ammonium sulfate and 144.5ml 0.5M sodium citrate buffer solution (pH5.5) are added to 3614ml, and to contain molecular weight be 30,000 or greater than the fraction of 30,000 TPO to obtain the solution that 4089ml contains 1.41M (final concentration) sodium sulfate and 17.7mM (final concentration) sodium citrate buffer solution.Centrifugally from solution, remove undissolved material, obtain clear soln.

Settled solution is added to the 20mM sodium citrate buffer solution through containing 1.2M ammonium sulfate (pH 5.5) equilibrated Macro-Prep Methyl HIC post (Bio-Rad, article number: 156-0080 in advance with the flow velocity that 25ml/ divides; Diameter 5cm, height of bed 24.5cm).After last sample finishes, carry out wash-out with the 20mM sodium citrate buffer solution (pH 5.5) that contains 1.2M sodium sulfate.Go up the fraction of concentrated wash-out must be post fraction F1 (4455ml at ultra-filtration equipment (exFitron.Omega Ultrasette, the normal molecular amount blocks 8,000) subsequently; Protein concn: 0.400mg/ml; Gross protein: 1780mg; Relative reactivity: 1,831,000).

Then, with 20mM Trisodium Citrate (pH 6.0) as elution buffer by this post to obtain elutriant, use identical ultra-filtration equipment (that is, Omega Ultrasette, the normal molecular amount blocks 8,000) to concentrate then to collect F2 fraction (1457ml; Protein concn: 0.969mg/ml; Gross protein: 1411mg; Relative reactivity: 1,715,000).In F2, with SDS-PAGE alleged occurrence molecular weight 66,000 to 100,000 protein.Through the Western engram analysis, prove that this protein is TPO.

Then, will add in advance through 20mM sodium citrate buffer solution (pH 6.0) equilibrated SP Sepharose FastFlow (Pharmacia Bioteck, article number 17-0729-01 with the flow velocity that 15ml/ divides from the F2 of wash-out on the Macro-Prep Methyl HIC post; Diameter 5cm, height of bed 12cm).After last sample finishes, carry out wash-out with the 20mM sodium citrate buffer solution (pH 6.0) that contains 50mM NaCl.Collect elutriant and called after F1 fraction (3,007; Protein concn: 0.226mg/ml; Gross protein 679mg; Relative reactivity: 88,830).After this, replace elution buffer to collect the F2 fraction (931ml of wash-out with the 20mM sodium citrate buffer solution (pH5.4) that contains 750mMNaCl; Protein concn: 0.763mg/ml; Gross protein: 710mg; Relative reactivity: 5,558,000), use then ultra-filtration equipment (Filtron, Omega (Ultrasette, the normal molecular amount blocks 8,000; And Amicon, the YN3 film) be concentrated to 202ml.

Then, the flow velocity that the active F2 fraction of the spissated TPO of containing (197ml) is divided with 3ml/ adds to Sephacryl S-200HR gel filter post (Pharmacia Biotech, article number 17-0584-05; Diameter 7.5cm, height of bed 100cm).Collect elution volume the 1st respectively, 200-1785ml; 1785-2010ml, 2010-2280ml and 2280-3,000ml is so that obtain fraction F1 (585ml; Protein concn: 1.00mg/ml; Gross protein: 589ml, relative reactivity: 4,118,000), F2 (225ml, protein concn: 0.263mg/ml; Gross protein: 59.2mg; Relative reactivity: 2,509,000), F3 (270ml; Protein concn: 0.119mg/ml, gross protein: 32.1mg; 2,535,000) and F4 (720ml relative reactivity:; Protein concn: 0.0467mg/ml; Gross protein: 33.6mg; Relative reactivity: 1,155,000).Therefore, determine that by gel-filtration fractionated TPO activity has very wide molecular weight ranges.Behind isolating lease making SDS-PAGE at different levels and Western engram analysis, find that it is 66,000 to 1,000 that F1 mainly contains molecular weight, 000 TPO molecular species; The molecular weight of the TPO molecular species of F2 is 32,000 to 60,000, and the molecular weight of TPO molecular species is 32,000 to 42,000 among the F3.And all TPO molecules have the TPO activity.

Carry out the-terminal amino acid The sequencing results based on the TPO molecule that to molecular weight is 66,000 to 100,000, confirm that the TPO molecule has the proteinic aminoacid sequence of people TPO genes encoding.

In addition, use by the N-glycanase (ex Genzyme, article number: 1472-00), neuraminidase (Nakarai-Tesqu, article number 242-29SP), in-alpha-N-Acetylgalactosaminidase (Seikagaku Kogyo, article number: 100453) and O-glycosides enzyme (Boehringer MannheimBiochemica, article number 1347101) separately or in conjunction with the Glycosylase of composition, to molecular weight is 66,000-100,000 TPO molecule carry out the enzymic digestion experiment, carry out SDS-PAGF then and analyze.As a result, find that as desired from its theoretical molecular, the molecular weight of the polypeptide portion of TPO is about 36,000, and be the glycoprotein of the sugar chain that is connected with O-of band N-.

＜embodiment 57 〉

From the Chinese hamster ovary celI of producing people TPO is purifying people TPO

(1) 211.4g ammonium sulfate is added in the serum-free culture thing supernatant liquor of the Chinese hamster ovary celI that 1L obtains with the method among the embodiment 55, then, makes mixture pass through 0.2 μ m filter (exGelman Science, article number 12992).The filtrate of gained is used for the 20mM sodium acetate buffer through containing 1.2M ammonium sulfate (pH 5.6) equilibrated Macro-Prep Methyl HIC post (Bio-Rad, article number 156-0081, diameter 50mm, height of bed 90mm) in advance with the flow velocity that 15ml/ divides.After last sample finishes, carry out wash-out with the 450ml 20mM acetate buffer (pH5.6) that contains 1.2M ammonium sulfate.The fraction of wash-out is used for anti-phase Vydac C4 post (The Separations Group, article number: 214BTP54, diameter 4.6mm, height of bed 250mm) with the flow velocity that 0.75ml/ divides.With post washing 15 minutes, finish wash-out to the 66-minute linear gradient that contains 94% alcoholic acid 10mM Tris damping fluid (pH6.4) (being called " developping agent B ") with the 10mM Tris damping fluid (pH 6.4) that contains 5% ethanol (being called " developping agent A ") with developping agent A.In Figure 15, listed the chromatogram that obtains.As the result that SDS-PAGE analyzes, think TPO and be that the molecule (molecular weight is 65,000-100,000) of 68-72 minute fraction is a single band (seeing Figure 16) on the SDS-PAGE gel corresponding to the residence time behind the application of sample.Further Western analysis revealed gained protein is TPO.

The-terminal amino acid analysis revealed of protein example, this protein have the proteinic aminoacid sequence of people TPO genes encoding.

＜embodiment 58 〉

Preparation is used for the recombinant virus at insect cell inner expression people TPO

Plasmid pHTP1 with preparation among limiting enzyme EcoRI and the NotI digestion embodiment 30 then through the band of 1% agarose gel electrophoresis with about 1200bp, uses Prep-A-Gene DNA purification cassette purifying subsequently.Then with the DNA of purifying with link to each other with the pretreated transfer vector pVL1393 of same restrictions enzyme (Invitrogen), be transformed into then among the high competence E.coli DH5 (ToyoBoseki).Screening contains the clone pVL1 393/hTPO of the full length coding region of people TPO cDNA from the colony of gained.Press the method for describing among the Molecular Cloning (Sambrook et al., Cold SpringHarbor Laboratory Press, 1989) and prepare plasmid DNA, use BaculoGold then from this clone ^TMThe transfection of transfection box is cultivated the supernatant liquor that contained virus in 4 days with recovery with cells transfected at 27 ℃ in Sf-900 substratum (Lifetechnology) in insect cell Sf21 (Invitragen).With supernatant liquor with 1: 10 ⁹～1: 10 ⁵Dilution, in-35mm (diameter) pod (Shale), at 27 ℃ of supernatant liquors with the 1ml dilution with about 7 * 10 ⁵Sf21 cell infection 1 hour.After removing supernatant liquor, 1% hot agarose in the Sf-900 substratum is added in the cultivation, it is solidified, then in moistening air, cultivated 6 days in 27 ℃.Detect the plaque of a formation, virus is discharged into from plaque in the 200 μ l Sf-900 substratum.Infect the Sf21 cell so that virus multiplication with the virus clone that obtains in the flat board of 24-hole.With phenol/chloroform, ethanol sedimentation is handled from what single plaque obtained and is contained viral liquid to reclaim viral DNA then, uses it as template then, and the Auele Specific Primer of personnel selection TPO cDNA is finished PCR.Screening contains the recombinant virus of people TPO cDNA on the basis of specific amplification dna fragmentation.Supernatant liquor with the recombinant virus that contains carrier TPO cDNA infects the Sf21 cell with virus of proliferation then.

＜embodiment 59 〉

At Sf21 expressed in insect cells people TPO and differentiate the TPO activity

At 175cm ²Cultivate the Sf21 cell in the culture flask to reach about 80% fusion, the recombinant virus of then using the carrier TPO cDNA of preparation among the embodiment 58 is cultivated 4 day to reclaim culture supernatants in 27 ℃ with the gained cell thereafter in 27 ℃ of infection 1 hour in the Sf-900 substratum.At NAP ^TM-5 posts (Pharmacia) are gone up the culture supernatants that replaces gained with the IMDM substratum.In rat CFU-MK detection and M-07e detection, in the gained supernatant liquor, detect the TPO activity that significantly relies on form with dosage.Also differentiated the recombinant human TPO that expresses in the Sf21 cell with the Western analysis of describing among the embodiment 45.

＜embodiment 60 〉

By derive from N-dodecanoyl sodium sarcosinate and copper sulfate refolding clone pCFM536/h6T (1-163) varient people TPO, h6T (1-163) and purifying h6T (1-163), described clone is carried at the people TPO base sequence of expressing among the E.coli.

The recombinant microorganism that freezes of the production h6T (1-163) of preparation among the 30g embodiment 43 is suspended in the 300ml water, with high pressure shredder assembly (10,000psi, Rannie High Pressure Laboratory) fragmentation, centrifugal then to reclaim the precipitation part.To precipitate part and be suspended in the 90ml water, add water then while stirring again up to the total amount that reaches 150ml.Add 9ml 1M Tris damping fluid (pH 9.2), 540 μ l 1M DTT subsequently in mixture while stirring, 1.8ml 0.5M EDTA and 18ml 10% oxycholic acid sodium then at room temperature stirred 30 minutes.Centrifugal recovery precipitation part, and remove most of protein and microorganism component of polluting.Add 180mlDTT to obtain a suspension in precipitation, centrifugal then recovery contains the precipitation part of h6 (1-163).In the precipitation of gained, add 300ml water to obtain suspension, again to wherein adding entry while stirring so that total amount of liquid is 570ml.At room temperature with 30ml 1M Tris damping fluid (pH8), 150ml 10%N-dodecanoyl sodium sarcosinate is added in the mixture, stirs 20 minutes with dissolving h6T (1-163).To wherein adding 750 μ l, 1% copper sulfate, mixture is at room temperature stirred spend the night (about 20 hours) again.After centrifugal recovery contains the supernatant liquor fraction of h6T (1-163), in the 750ml supernatant liquor, add 750ml water and 1500ml 20mM Tris damping fluid (pH 7.7), then add 3ml Spheron MD 30/70 (Nikko Chemicals) while stirring.600gDowex 1-X4 (20-50 order, chloride form) ion exchange resin is added in the gained solution, at room temperature stirred 90 minutes.Reclaim the fraction of non-absorption with glass filter after, with 750ml 20mM Tris damping fluid (pH 7.7) washing ion exchange resin.To not adsorb and wash fraction bonded solution with 2N sodium hydroxide and transfer to pH9.2, be used for (the ID 5cm * of 20mM Tris damping fluid (pH 9.2) the equilibrated Q-Sepharose Fast Flow anion-exchange column through containing 0.1% Spheron MD 30/70 in advance then 10cm) to reclaim the not fraction of absorption.With hydrochloric acid the pH that gained does not adsorb fraction is transferred to 7.2, add to (the ID 5cm * 10cm), use the NaCl wash-out of same buffer neutral line gradient 0M again of 20mM Tris damping fluid (pH 7.2) the equilibrated SP Sepharose FastFlow post through containing 0.1% Spheron MD 30/70 in advance to 500mM.The fraction of analyzing wash-out with SDS-PAGE reaches 0.1% concentration to collect the TPO fraction to wherein adding trifluoroacetic acid.With the solution of gained add to Capcell Pak 5 μ m300A C1 posts (ID 2.1cm * 5cnm * 2, Shiseido) after, finish reversed-phase HPLC with the 1-propyl alcohol linear gradient elution method that concentration in 0.1% trifluoroacetic acid increases gradually.Under the situation of no reductive agent, on SDS-PAGE, analyze elutriant.As a result, fractionate out three fractions, each fraction is diluted 3 times with 0.1% trifluoroacetic acid according to the wash-out position in reversed-phase HPLC.With identical method, the fraction of each wash-out is added to above-mentioned reversed-phase HPLC post.There is not under the situation of reductive agent the called after Fr.S-a analyzing on the SDS-PAGE, three TPO fractions of the gained of Fr.S-b and Fr.S-c (seeing Figure 17) according to the elution order on reversed-phase HPLC.As a result, be about 18KDa (Fr.S-a) at molecular weight, about 19KDa (Fr.S-b) or 18KDa (Fr.S-c) detect a single band (seeing Figure 18).Behind amino acid analysis, each amino acid composition of determining is almost consistent with its corresponding theory value of estimating from sequence data.In addition, the result of-terminal amino acid analysis shows that they are desired sequences.Protein quantity with each definite fraction of amino acid analysis is 0.64mg (Fr.S-a), 1.81mg (Fr.S-b) or 3.49mg (Fr.S-c).After the IMDM substratum dialysed each fraction fully, carry out M-07e and detect.As a result, the relative reactivity of each fraction is about 1,620,000 (Fr.S-a), 23,500,000 (Fr.S-b) or 746,000,000 (Fr.S-c).

＜embodiment 61 〉

Derive from the people TPO that clones pCFM536/h6T with Guanidinium hydrochloride and the refolding of Cys-Gelucystine, h6T (1-163) and purifying h6T (1-163), described clone is carried at the people TPO base sequence of expressing among the E.coli

With the freezing that recombinant microorganism is added in the 500ml water and suspend of the production h6T (1-163) of preparation among the 50g embodiment 43, with high pressure shredder assembly (10,000psi, Rannie High PressureLaboratory) fragmentation, centrifugal then recovery precipitation part.The precipitation of gained is suspended in the water, adds entry while stirring and make amount of liquid reach 250ml.Thereafter, to wherein adding 15ml 1M Tris damping fluid (pH 9.2), 900 μ l 1M DTT, 3ml 0.5M EDTA and 30ml 10% Sodium desoxycholate also at room temperature stirred 30 minutes.After centrifugal, reclaim precipitation and remove most of protein that pollutes, microorganism component etc. simultaneously.300ml 5mMDTT is added in the precipitation, makes its suspension, centrifugal then recovery contains the precipitation part of h6T (1-163).The precipitation part that reclaims that will contain h6T (1-163) is suspended in the water, reaches the cumulative volume of 104ml.In suspension, add 20ml 1MTris damping fluid (pH 8.5), add 376ml 8M Guanidinium hydrochloride then while stirring, under room temperature, stir 10 minutes subsequently with dissolving h6T (1-163).To wherein adding the 2500ml 20mM Tris damping fluid (pH 8.5) that contains 0.1% Spheron MD 30/70, add the 2000ml 20ml Tris damping fluid (pH 8.5) that contains the 1M Guanidinium hydrochloride then while stirring, add 5mM Cys and 0.5mM Gelucystine (cystin) again.The solution that obtains thus is incubated overnight in 4 ℃, and the h6T (1-163) in the centrifugal recovery supernatant liquor uses Prep Scale UF cartridge PLDC ultra-filtration membrane (Millipore) to concentrate then.Replace the damping fluid of enriched material to reach 1 up to final volume, 000ml with the 20mM Tris damping fluid (pH 9.2) that contains 0.1% Spheron MD 30/70.Gained solution is added in advance through containing 20mM Tris damping fluid (pH 9.2) equilibrated Q-Sepharose Fast Flow anion-exchange column (the ID 5cm * 10cm), be used in same buffer neutral line gradient 0M to 500mMNaCl wash-out then of 0.1% Spheron MD 30/70.Be recovered in the fraction (240ml) of about 20mM to about 150mM NaCl wash-out.With 20mM Tris damping fluid (pH 7.2) fraction of gained is diluted 4 times so that cumulative volume reaches 960ml, with acetate pH is transferred to 7.2 then, add to again in advance through containing 20mM Tris damping fluid (pH 7.2) equilibrated SP Sepharose Fast Flow cationic exchange coloum (the ID 5cm * 10cm), use same buffer neutral line gradient 0M-500mM NaCl wash-out then of 0.1% Spheron MD 30/70.On SDS-PAGE, analyze elutriant to collect the TPO fraction.Trifluoroacetic acid is added in the TPO fraction reaches 0.1% up to its final concentration.The solution of gained is used for Capcell Pak5 μ m 300A C1 post, and (ID 2.1cm * 5cm * 2 Shiseido), are used in the 1-propyl alcohol that concentration increases gradually in 0.1% trifluoroacetic acid subsequently, finish reversed-phase HPLC by the linear gradient elution method.Do not having under the situation of reductive agent, analyzing elutriant, be fractionated into 2 fractions according to the wash-out position in reversed-phase HPLC then through SDS-PAGE.According to the elution order in reversed-phase HPLC (seeing Figure 17), respectively two TPO fractions are called Fr.G-a and Fr.G-d.Do not having under the situation of reductive agent, on SDS-PAGE, analyzing each fraction.As a result, at position detection to the single band (see Figure 18) of molecular weight for about 18KDa (Fr.G-a) or about 32KDa (Fr.G-d).In addition, exist under the condition of reductive agent, the SDS-PAGE analysis revealed of above-mentioned fraction in these two fractions, all detects a single band at molecular weight for about 20KDa position.The result of each fraction amino acid analysis shows: its each amino acid whose component is almost consistent with its corresponding theory value of estimating from sequence data.In addition, the result of-terminal amino acid analysis shows that they are sequences of expection.The protein mass of each fraction of determining from the result of amino acid analysis is 2.56mg (Fr.G-a) or 1.16mg (Fr.G-d).After each fraction dialysed fully to IMDM, carry out M-07e and detect.As a result, the relative reactivity of TPO fraction is about 3,960,000 (Fr.G-a) or about 7,760,000 (Fr.G-d).

＜embodiment 62 〉

Structure is used for expressing at Chinese hamster ovary celI the recombinant vectors pDEF202-hTPO163 of the people TPO (amino acid/11-163) (hereinafter referred to as " hTPO163 ") of partial-length

With the carrier pDEF202 that makes up in limiting enzyme EcoRI and the SpeI Processing Example 31, reclaim bigger carrier segments with agarose gel electrophoresis then.With T4 dna ligase (Takara-Shuzo) with this fragment with contain coded amino acid-21 and link to each other to obtain expression vector pDEF202-hTPO163 by handling to the hTPO163 cDNA that the plasmid pEF18S-hTPO163 of the hTPO163 cDNA of 163 (SEQ ID NO:13) prepares with limiting enzyme EcoRI and SpeI.Replication origin, the people that this plasmid contains SV40 extends replication origin and the β-Nei Xiananmei gene (Amp of factor 1-α promotor, the early stage polyadenylation of SV40 site, mouse DHFR minigene, pUC18 ^r), wherein, hTPO163 cDNA is connected in the downstream, site that the people extends factor 1-α-promotor.

＜embodiment 63 〉

In Chinese hamster ovary celI, express hTPO163

With 6cm plate (Falcon), containing in the α MEM of 10% foetal calf serum (α-MEM (-) contains thymidine and xanthoglobulin), make (the dhfr of Chinese hamster ovary celI system ^-Bacterial strain, Urlaub andChasin, Proc.Natl.Acad.Sci.USA, 77, p4216,1980) growth, then through transfectum method (Seikagaku Kogyo K.K.), transform with the pDEF202-hTPO163 plasmid.

In brief, the 10 μ g plasmid pDEF202-hTPO163 that prepare among the embodiment 62 are mixed with 240 μ l 0.3M NaCl, then with 20 μ l transfectum and 220 μ l H ₂The mixture of O mixes.Dna solution dropwise is added in the plate, next at CO ₂Cultivated 6 hours in the insulation can.From plate, remove substratum, use α-MEM (-) washed twice then, then add the 10%DMSO that contains α-MEM (-), again room temperature incubation 2 minutes.After this, the non-selection substratum (α-MEM (-) that contains xanthoglobulin and thymidine) that in plate, adds the foetal calf serum that contains 10% dialysis, then cultivated again 2 days, go up screening at the selection substratum (α-MEM (-) that does not contain xanthoglobulin and thymidine) of the foetal calf serum that contains 10% dialysis then.By with the cell trypsin treatment, the cell in the plate of each above-mentioned 6cm is divided to the plate of 5 10cm or 20 24 hole plates, continue then to cultivate to change a subculture every 2 days with fresh substratum simultaneously, thereby finish screening.Detect the TPO activity of checking plate or hole supernatant liquor with Ba/F3, observe the TPO activity thus.After with the selection substratum that contains the 25nM methotrexate cell being divided into 1: 15 cell concn, will in supernatant liquor, observe the active cell transfer of TPO in flat board or hole, cultivate the cell that makes its growth and clone methotrexate resistance subsequently again.

In addition, by pEF18S-hTPO163 and pMG1 cotransfection being finished the conversion of Chinese hamster ovary celI in the Chinese hamster ovary celI.

CHO bacterial strain (CHO-DUKXB11) with plasmid pDEF202-hTPO163 transfection is preserved in Japanese national bio-science and human technical institute by the applicant January 31 nineteen ninety-five, industrial science and technology department, Ministry of International Trade and Industry, preserving number FERM BP-4989.

＜embodiment 64 〉

The large scale culturing of Chinese hamster ovary celI

As follows the Chinese hamster ovary celI system of large scale culturing by the production hTPO163 that will obtain in the Chinese hamster ovary celI of hTPO163-expression plasmid pDEF202-hTPO163 transfection in the embodiment 63 (CHO 109 cells are cultivated the [α-MEM that does not contain xanthoglobulin and thymidine in the selection of the foetal calf serum that is containing 10% dialysis ^-] in obtain through above-mentioned screening).Growth CHO 109 cells in containing the DMEM/F-12 substratum (GIBCO) of 10%FCS.Behind trypsin solution collection (or trypsinized) cell, with 10 * 10 ⁷Individual cell inoculation was cultivated 3 days in 37 ℃ with the rotating speed of 1rpm in the Falcon revolving bottle that contains the 200ml same medium (Falcon 3000) then.Substratum is removed in suction, with the surface of 100ml PBS rinsing cell cultures.The 200ml DMEM/F-12 substratum (GIBCO) that does not contain 10%FCS is added in the cell cultures, cultivated 7 days in 37 ℃ with 1rpm then.Be used for subsequently purification step with the culture supernatants of collecting as initial substance.In 300 revolving bottles, finish similar process to obtain 60L serum-free culture thing supernatant liquor.

＜embodiment 65 〉

Purifying hTPO163 from the Chinese hamster ovary celI system that produces hTPO163

(1) the 60L serum-free culture thing supernatant liquor that obtains among the embodiment 64 strainer by 0.22 μ m is filtered to collect the filter thing, use then ultra-filtration equipment (Filtron, molecular weight blocks 10,000) concentrates, to obtain spissated fraction (600ml, 11.2mg protein/ml, gross protein 6430mg).Analyze this fraction with anti--HT1 peptide antibody through Western, show that having apparent molecular weight is the hTPO163 protein of 20,000 to 26,000 expression.

At Sephadex G-25 Fine post (Pharmacia-Biotech, article number 17-0032-02 with 10mM sodium phosphate buffer (pH 6.8) pre-equilibration; Diameter 10cm, height of bed 30cm) go up the concentrated culture supernatants (537ml) of processing gained to obtain protein fraction F1 (938ml, protein concn 4.9mg/ml, the gross protein 4594mg) solution in 10mM sodium phosphate buffer (pH 6.8).

To add in advance through 10mM sodium phosphate buffer (pH 6.8) equilibrated SP SepharoseFast Flow post (Pharmacia-Biotech, article number: 17-0729-01 with the flow velocity that 15ml/ divides from this protein fraction (929ml) of Sephadex G-25 Fine post; Diameter 5cm, height of bed 12cm), use 10mM sodium phosphate buffer (pH 6.8) wash-out then, again with containing 10% alcoholic acid same buffer wash-out.Wash-out is combined into F1 fraction (1608ml, protein concn 2.13mg/ml, gross protein 3426mg).Carry out the main hTPO163 elutriant (651ml, protein concn 1.67mg/ml, gross protein 1087mg) of wash-out to obtain the F2 fraction for the second time with containing 750mM NaCl and 25% alcoholic acid 10mM sodium phosphate buffer (pH 6.8) again.

Add ethanol and purified water ethanolic soln to the active F2 fraction of TPO (200ml) that contains with preparation 300ml 45% (final concentration) from SP Sepharose Fast Flow post.Remove because of adding the insoluble substance that ethanol produces through centrifugal.The flow velocity that supernatant liquor is divided with 2ml/ injects through 50% solvent orange 2 A (10mM sodium acetate buffer, pH 6.7) (10mM contains 90% alcoholic acid sodium acetate buffer to add 50% solution B, pH 6.7) SOURCE 15RPC post (Pharmacia-Biotech, the article number: 17-0727-02 of pre-equilibration; Diameter 2cm, height of bed 20cm).Add 45% solvent B with 55% solvent orange 2 A then and wash this post not material of absorption, the flow velocity wash-out that divides with 1.5ml/ with following elution process: 55%B 5 minutes then under wash-out almost completely; Linear gradient 50%B is to 100%B more than 140 minutes; 100%B 35 minutes.Collect each fraction every 5 minutes (being equivalent to the 7.5ml volume).Make all level lease making SDS-PAGE, Western analyzes to detect the wash-out scope of hTPO163 then.As a result, found in the elutriant in 66% to 87% alcoholic acid scope that apparent molecular weight is about 20,000 to 26,000 highly purified hTPO163.In these hTPO163 protein, from the reversed-phase column early wash-out down be the hTPO163 of higher molecular weight, its wetting ability raising of glycosylated hTPO163 molecule is described.

CHAPS is added to 88.8ml from the hTPO163 elutriated fraction of SOURCE 15RPC post (promptly, the hTPO163 fraction (90ml) of wash-out in 68% to 86.5% ethanol scope), however mixture concentrated and washing to obtain containing the 2.5ml enriched material of about 5% ethanol and 4mM CHAPS.Subsequently, the flow velocity that this enriched material is divided with 1.5ml/ adds to through 10mM sodium phosphate buffer (pH 6.8) equilibrated Superdex 75pg post (Pharmacia-Biotech, article number: 17-1070-01), diameter 2.6cm, height of bed 60cm).Behind the last sample 60 minutes to, collect elutriated fraction with the amount (that is: per 4 minutes) of each 6ml.As a result, press that SDS-PAGE determines, in the fraction of test tube numbers 16 at least 31, wash-out hTPO163.Standard molecular weight marker (the mixture of Bio-Rad is used corresponding to pressing in this wash-out position, Gel Filtration Standard, article number: 151-1901, and Calbiochem, insulin, article number: about 44,000 to about 6,000 the molecular weight ranges that gel-filtration 407696) is determined.In addition, the order that seemingly reduces gradually with degree of glycosylation of these hTPO163 molecules and eluted.All hTPO163 kinds of collecting test tube number 16 to 31 (elution volume: 180 arrive 276ml) are as the AF fraction.Except that the FA part, collect test tube number 16 to 18 (elution volume: 180 arrive 198ml) respectively, 19 to 24 (elution volumes 198 to 234ml) and 25 to 31 (elution volume: fraction 234 to 276ml), distinguish called after fraction FH, FM and FL then.Fraction FH, FM and the FL combination of part also can be prepared the FA fraction.Figure 19 is described foregoing.

(2) then, will illustrate in greater detail hTPO163 elutriated fraction FH, FM, FL and FA from aforementioned (1) middle Superdex 75pg.By with embodiment 1 in identical method determine the-terminal amino acid sequence of above-mentioned each hTPO163 kind, but the Ser residue of most of N-end all can not identify.The sugar that this explanation connects O-has been added on the terminal Ser of N-.In addition, confirm that the sequence behind the terminal Ser of N-is the aminoacid sequence of inferring from the gene order of hTPO.Through amino acid analysis (the AccQ.Tag method Wasters) is determined, at FH, FM, the proteinic concentration of the hTPO163 among FL and the FA is respectively 10.2ng/ml, 6.2ng/ml, 0.84ng/ml and 3.2ng/ml illustrate that this concentration is the peptide moiety that does not contain any sugar chain.Under non-reduced condition, with many gel 15/25 (Dai-ichi Kagaku.Yakuhin, the prefabricated polyacrylamide gel of 15-25%) or under the reductive condition, make these fractions (each 100ng) through SDS-PAGE with DTT, silver-dyeing then (Daiichi Pure Chemicals).As a result, each fraction of finding these fractions all contains highly purified hTPO163.Under reductive condition, use DPC III molecular weight marker (Daiichi Dure.Chemicals) as criterion calculation, at FH, FM, the apparent molecular weight of hTPO163 is respectively 24 among FL and the FA, 000-21,500,23,000-21,000,23,000-20,500 and 23,500 to 20,500 (seeing Figure 20).In addition, under reductive condition Western analytically, with biotin labeled SDS-APGE standard substance (Bio-Rad, Biotynylated SDS-PAGE Standards, Board Range: the FH of Ji Suaning article number 161-0319), FM, the apparent molecular weight of hTPO is respectively 26,000 to 22,000 among FL and the FA, 25,500 to 22,000,26,000 to 21,000 and 26,000 to 21,000.FH, FM, the discordance of FL and FA molecular weight may be that the discordance of the sugar chain that is connected of O-causes.Therefore, with neuraminidase (Neuraminidase, Nacalai tesque, article number: 242-29SP) digest,, on SDS-PAGE, analyze each fraction FH, FM, FL and FA then with the DTT reduction.The result, in all fractions, apparent molecular weight is about 19,000, the discordance that the hTPO molecular weight is described mainly be owing to hTPO163 protein link coupled sugar chain in the discordance of sialic acid amount cause, and in Chinese hamster ovary celI, the hTPO163 that obtains obtains as glycoprotein expressing.

(3) detect the FH that obtains in (2), FM, the external activity of FL and FA fraction with the M-07e detection system.As a result, specific activity is 511,000,000,775 relatively, 000,000,1,150,000,000 and 715,000, and 000/mg hTPO163 protein (weight that does not contain the peptide moiety of any sugar weight).

＜embodiment 66 〉

Structure is used for expressing respectively at-1 and adds Lys and at the E.coli carrier of-2 people TPO (amino acid/11-332) (hereinafter referred to as " hMKT (1-332) ") that add Met and express hMKT (1-332)

For the full length amino acid sequence of expressing human TPO in E.coli, change amino acid/11 64 into what follows the preferred codon of E.coli to the used codon of amino acid 332.

Table 5

21：5′-CTCCCGAACCGTACCAGCGGCCTGCTGGAAACCAACTTTACCGCGAG-3′

(SEQ?ID?NO：130)

22：5′-GGTAAAGTTGGTTTCCAGCAGGCCGCTGGTACGGTTCGGGAGCTCGT-3′

(SEQ?ID?NO：131)

23：5′-CGCGCGTACCACCGGCAGCGGCCTGCTGAAATGGCAGCAGGGCTTTCGT-3′

(SEQ?ID?NO：132)

24：5′-AGCCCTGCTGCCATTTCAGCAGGCCGCTGCCGGTGGTACGCGCGCTCGC-3′

(SEQ?ID?NO：133)

25：5′-GCGAAAATCCCGGGCCTGCTGAACCAGACCAGCCGTAGCCTGGATCAGAT-3′

(SEQ?ID?NO：134)

26：5′-ATCCAGGCTACGGCTGGTCTGGTTCAGCAGGCCCGGGATTTTCGCACGAA-3′

(SEQ?ID?NO：135)

27：5′-CCCGGGCTATCTGAACCGTATCCATGAACTGCTGAACGGCACCCGTG-3′

(SEQ?ID?NO：136)

28：5′-GTGCCGTTCAGCAGTTCATGGATACGGTTCAGATAGCCCGGGATCTG-3′

(SEQ?ID?NO：137)

29：5′-GCCTGTTTCCGGGCCCGAGCCGTCGCACCCTGGGCGCGCCGGATATCAG-3′

(SEQ?ID?NO：138)

30：5′-ATCCGGCGCGCCCAGGGTGCGACGGCTCGGGCCCGGAAACAGGCCACGG-3′

(SEQ?ID?NO：139)

31：5′-ATCAGCTCTGGCACCAGCGATACCGGCAGCCTGCCGCCGAACCTGCAGCC-3′

(SEQ?ID?NO：140)

32：5′-CAGGTTCGGCGGCAGGCTGCCGGTATCGCTGGTGCCAGAGCTGATATCCG-3′

(SEQ?ID?NO：141)

33：5′-GGGCTATAGCCCGAGCCCGACCCATCCGCCGACCGGCCAGTATACCCTGTT-3′

(SEQ?ID?NO：142)

34：5′-GGTATACTGGCCGGTCGGCGGATGGGTCGGGCTCGGGCTATAGCCCGGCTG-3′

(SEQ?ID?NO：143)

35：5′-TCCGCTGCCGCCGACCCTGCCGACCCCGGTGGTTCAGCTGCATCCGCTGC-3′

(SEQ?ID?NO：144)

36：5′-GGATGCAGCTGAACCACCGGGGTCGGCAGGTCGGCGGCAGCGGAAACAG-3′

(SEQ?ID?NO：145)

37：5′-TGCCGGATCCGAGCGCGCCGACCCCGACCCCGACCAGCCCGCTGCTGAACA-3′

(SEQ?ID?NO：146)

38：5′-AGCAGCGGGCTGGTCGGGGTCGGGGTCGGCGCGCTCGGATCCGGCAGCAGC-3′

(SEQ?ID?NO：147)

39：5′-CCAGCTATACCCATAGCCAGAACCTGAGCCAGGAAGGCTAATGAAGCTTGA-3′

(SEQ?ID?NO：148)

40：5′-CTTCATTAGCCTTCCTGGCTCAGGTTCTGGCTATGGGTATAGCTGGTGTTC-3′

(SEQ?ID?NO：149)

41：5′-ACGAGCTCCCGAACCGTACCA-3′ (SEQ?ID?NO：150)

42：5′-CTGATATCCGGCGCGCCCAGG-3′ (SEQ?ID?NO：151)

43：5′-CGGATATCAGCTCTGGCACCA-3′ (SEQ?ID?NO：152)

44：5′-TCAAGCTTCATTAGCCTTCCT-3′ (SEQ?ID?NO：153)

Contain in 0.1mM ATP, 10mM Tris-acetate, 10mM magnesium acetate, the 50mM potassium acetate solution, with the T4 ligase enzyme (Pharmacia) in the same test tube with the synthetic oligonucleotide: 21 and 22,23 and 24; 25 and 26; 27 and 28; 29 and 30; 31 and 32; 33 and 34; 35 and 36; 37 and 38; Or 39 and 40 phosphorylation.Then 1/10 volume contained 100mM Tris/HCl (pH 7.5), 100mM MgCl ₂, 500mM NaCl solution is added in the reaction mixture, boils in water-bath 3 minutes, makes its cooling to form double-stranded DNA then.With four groups of double-stranded DNAs: i.e. oligonucleotide 21 and 22/23 and 24 (combination-A); Oligonucleotide 25 and 26/27 and 28 (combination-B); With oligonucleotide 31 and 32/33 and 34 (combination-C); And oligonucleotide 35 and 36/37 and 38/39 and 40 (combination-D) use DNA connecting box (Takara-Shuzo) to be connected respectively thereafter, will be made up-A links to each other with combination-B, similarly, will make up-C links to each other with combination-D to obtain connector-1 and connector-2 respectively.With connector-1 with-2 as template, oligonucleotide-41 and-42 is used for connector-1 as primer, and oligonucleotide-43 and-44 is used for connector-2 as primer, carries out PCR.With the PCR product of SacI and EcoRV and EcoRV and HindIII digestion connector-1 and-2, electrophoresis is also used Prep-A-Gene DNA purification cassette purifying so that reclaim the fragment of about 240bp and 250bp respectively on 2% sepharose then respectively.Two fragment subclones of gained are arrived in SacI and the predigested pBluescript II of HindIII KS+ (Stratagene) (usefulness E.coli DH5 is as the host).In the clone of gained, filter out clone and called after pBL (SH) by order-checking and (174-332) (see SEQ IDNO:154) with the base sequence shown in the table 6.

Table 6

CTC?CCG?AAC?CGT?ACC?AGC?GGC?CTG?CTG?GAA?ACC?AAC?TTT?ACC?GCG?AGC

Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser

174 180

GCG?CGT?ACC?ACC?GGC?AGC?GGC?CTG?CTG?AAA?TGG?CAG?CAG?GGC?TTT?CGT

Ala?Arg?Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg

190 200

GCG?AAA?ATC?CCG?GGC?CTG?CTG?AAC?CAG?ACC?AGC?CGT?AGC?CTG?GAT?CAG

Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln

210 220

ATC?CCG?GGC?TAT?CTG?AAC?CGT?ATC?CAT?GAA?CTG?CTG?AAC?GGC?ACC?CGT

Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg

230

GGC?CTG?TTT?CCG?GGC?CCG?AGC?CGT?CGC?ACC?CTG?GGC?GCG?CCG?GAT?ATC

Gly?Leu?Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile

240 250

AGC?TCT?GGC?ACC?AGC?GAT?ACC?GGC?AGC?CTG?CCG?CCG?AAC?CTG?CAG?CCG

Ser?Ser?Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro

260

GGC?TAT?AGC?CCG?AGC?CCG?ACC?CAT?CCG?CCG?ACC?GGC?CAG?TAT?ACC?CTG

Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu

270 280

TTT?CCG?CTG?CCG?CCG?ACC?CTG?CCG?ACC?CCG?GTG?GTT?CAG?CTG?CAT?CCG

Phe?Pro?Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro

290 300

CTG?CTG?CCG?GAT?CCG?AGC?GCG?CCG?ACC?CCG?ACC?CCG?ACC?AGC?CCG?CTG

Leu?Leu?Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu

310

CTG?AAC?ACC?AGC?TAT?ACC?CAT?AGC?CAG?AAC?CTG?AGC?CAG?GAA?GGC?TAA

Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

320 330 332

TGA?AGC?TTG?A

Then, with following synthetic oligonucleotide 45 and 46 as primer, pBL (XH) h6T (1-163) of preparation finishes PCR for template among the embodiment 42, with BamHI and SacI digestion PCR product, follows electrophoresis on 6% polyacrylamide gel so that reclaim the fragment of about 160bp from gel.

45：5’-AAGGATCCGAACGCTATCTTCCTG-3’(SEQ?ID?NO：155)

46：5’-GGGAGCTCGTTCAGGGTCAGAACCAGA

GAGGTACGAGACGGAACAGCAGTGGTTGG-3’(SEQ?ID?NO：156)

With SacI and HindIII digestion pBL (SH) (174-332), then with Prep-A-GeneDNA purification cassette purifying digestion product to obtain the fragment of about 480bp.With two fragment subclones of above-mentioned preparation to (E.coli DH5 is as the host in BamHI and the predigested pBluescript II of HindIII KS+ (Stratahene).) in.

In the clone of gained, filter out clone and called after pBL (BH) by order-checking and (123-332) (see SEQ ID NO:157) with the base sequence shown in the table 7.

Table 7

G?GAT?CCG?AAC?GCT?ATC?TTC?CTG?TCT?TTC?CAG?CAC?CTG?CTG?CGT?GGC

Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly

123 130

AAA?GTT?CGT?TTC?CTG?ATG?CTG?GTT?GGC?GGT?TCT?ACC?CTG?TGC?GTT?CGT

Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg

140 150

CGG?GCG?CGG?CCA?ACC?ACT?GCT?GTT?CCG?TCT?CGT?ACC?TCT?CTG?GTT?CTG

Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu

160

ACC?CTG?AAC?GAG?CTC

Thr?Leu?Asn?Glu?Leu

170 174

PBL (XH) h6T (1-163) with preparation among BamHI and the HindIII digestion embodiment 42, the pBL (BH) that similarly digests above-mentioned preparation connects together two fragments to obtain cloning pBL (XH) h6T (1-334) thereafter (123-332) to obtain the fragment of about 640bp.In addition, digest the pCFM536/hMKT (1-163) of preparation among the embodiment 52 to obtain the fragment of an about 270bp with XbaI and SfiI, subsequently, with this fragment with link to each other through the pBL of same restrictions enzymic digestion (XH) h6T (1-334) to obtain cloning pBL (XH) hMKT (1-334).Behind XbaI and HindIII digestion pBL (XH) hMKT (1-334), obtain about 1040bp fragment of an encoding mutant type people TPO amino acid/11-332, purifying then, and be cloned in XbaI and the predigested pCFM536 of HindIII (EP-A-136490) and (use the E.coli JM109 that transforms in advance by pMW (ATCC No.39933) as the host.)。With clone's called after pCFM536/hMKT (1-332) of gained, be used to express mutant protein hMKT (1-332) protein as transformant with the E.coli bacterial strain that carries this expression vector.Expression plasmid pCFM536/hMKT (1-332) contains the dna sequence dna shown in the SEQ IDNO:14.

Contain in the LB substratum of 50 μ g/ml penbritins and 12.5 μ g/ml tsiklomitsins at 60ml, with above-mentioned transformant in 30 ℃ of incubated overnight, then culture (25ml) is added in the 1000ml LB substratum that contains 50 μ g/ml penbritins, in 36 ℃ of shaking culture up to OD ₆₀₀Reach 1.0 to 1.2.About 330ml LB substratum of 65 ℃ are added in the culture so that make the finishing temperature of culture reach 42 ℃, continue shaking culture 3 hours again with abduction delivering varient people TPO in 42 ℃; HMKT (1-332) (is also referred to as [Met ^-2-Lys ^-1] TPO (1-332).

The culture of gained is directly carried out the SDS-PAGE analysis.In SDS-PAGE analyzes, use Multigen 15/25 (Dai-ichi Chemical Co.).After the blue dyeing of electrophoresis and coomassie, according to the transformant of inducing hMKT (1-332) protein expression, molecular weight is about 35KD place on gel, detects to have the specific protein of abduction delivering.In addition, behind SDS-PAGE and the electroblotting (using nitrocellulose filter), with the anti--HT1 peptide antibody reaction of preparation among above-mentioned expressed protein and the embodiment 45.After the dyeing, be about 35KD place, detect a band, illustrate and expressed hMKT (1-332) at molecular weight.

＜embodiment 67 〉

Make people TPO substitutive derivative, its in the COS7 cell expression and differentiate its activity

According to following method, whether research replaces the amino acid whose several derivatives of people TPO with other amino acid moieties the TPO activity.

Used by following structure present embodiment, be used for the carrier pSMT201 that expresses at zooblast.

At first, handle the cDNA that contains the mouse erythropoietin receptor with restriction enzyme KpnI and EcoRI and (derive from D ' doctor Andrea of Dana Farbor Cancer Institute: Cell:57,277-285 (1989)) expression plasmid pXM-mEPORn, the pXM carrier segments that electrophoresis has been removed the cDNA of mouse erythropoietin receptor with recovery on sepharose then.Then, with synthetic two oligonucleotide that are used for different clone's restriction sites is imported above-mentioned expression vector of dna synthesizer (ABI).The synthetic oligonucleotide has following basic sequence:

Primer-1:

5’-CCTCGAGGAATTCCTGCAGCCCGGGACTAGTATCGGCTACCCCTACGACGTCCCCGACTACG

CCGGCGTCCATCACCATCACCATCACTGAGCGGCCGCC-3’(SEQ?ID?NO：158)

Primer-2:

5’-AATTGGCGGCCGCTCAGTGATGGTGATGGTGATGAGCGCCGGCGTAGTCGGGGACGTCGTAG

GGGTAGCCGATACTAGTCCCGGGCTGCAGGAATTCCTCGAGGGTAC-3’(SEQ?ID?NO：159)

Two oligonucleotide are mixed and annealing to form double chain oligonucleotide, exist then under the situation of T4DNA ligase enzyme (Takara-Shuzo), link to each other to obtain expression vector pDMT201 with the pXM carrier of above-mentioned recovery.In order from pDMT201, to remove mouse DHFR cDNA contained among the pDMT201, use NotI and HpaI digested vector pDMT201 and pEF18S respectively, then through agarose gel electrophoresis so that from the pDMT201 carrier DNA, reclaim big fragment and from the pEF18S carrier DNA, reclaim a less fragment.Use T4 dna ligase (Takara-Shuzo) that these fragments are connected together to obtain expression vector pSMT201 then.As shown in figure 21, pSMT201 contains three fens leader sequences of replication origin, enhancer sequence, adenovirus major late promoter's sequence, adenovirus, splicing signal sequence, the early stage polyadenylation site sequence of SV40, the adenovirus VA rna gene sequence of SV40, replication origin and the β-Nei Xiananmei gene (Amp of pUC18 ^r), and the following restriction site that is used to connect required gene: Bg III, PstI, KpnI, XhoI, EcoRI, SmaI, SpeI and NotI site.With the pHTP that carries total length people TPOcDNA of explanation among EcoRI and the SpeI digestion embodiment 30 to obtain the people TPO cDNA fragment of total length, subsequently subclone in similar predigested carrier pSMT201 to obtain plasmid pSMT201-hTPO.

As template, make up plasmid β GL-TPO/pBlue with the plasmid pSMT201-hTPO that obtains thus at first as follows, be used to prepare the template of required derivative with this plasmid conduct.

In β GL-TPO/pBlue, 5 '-non-that rabbit betaglobulin leader sequence is added to people TPO is translated the site with the method (Annweiler et al., Nucleic Acids Research, 19:3750,1991) of Annweiler ' s.In order to reach this purpose, with following pair of DNA chain of chemosynthesis:

5’-AATTCCAAGATCTCACACTTGCTTTTGACACAAC

TGTGTTTACTTGCAATCCCCCAAAACAGACAGACCC-3 ' (SEQ ID NO:160) and

5’-GGGTCTGTCTGTTTTGGGGGATTGCAAGTAAACA

CAGTTGTGTCAAAAGCAAGTGTGAGATCTTGG-3’(SEQ?ID?NO：161)，

Link to each other to obtain having inserted the carrier GLp/Blue of leader sequence with the section that obtains with SmaI digested vector Bluescript II SK+ (Toyo-boseki) through EcoRI.

Finish PCR with following primer sequence:

Sma-ATG：5’-GGCCCGGGATGGAGCTGACTGAATTGCTC-3’

(SEQ?ID?NO：162)

(that is: the 102-122 sequence of the SEQ ID NO:7 that links to each other with the SmaI sequence); With

Terminal: 5 '-TCAAGCTTACTAGTCCCTTCCTGAGACAGATTCTG-3 '

(SEQ?ID?NO：163)

(that is: the antisense sequences of the 1140-1160 sequence of the SEQ ID NO:7 that links to each other with the HindIII sequence with SpeI).

With 1ng plasmid pSMT201-hTPO DNA is that template and 10 μ M synthetic primers are finished PCR.With TakaRa pcr amplification box (Takara-Shuzo) and Programmable ThermalController (MJ Research), under following condition, finish in the 100 μ l volumes PCR:94 ℃ 1 minute, 55 ℃ 2 minutes, 72 ℃ 2 minutes/circulation totally 3 circulations; Then 94 ℃ 45 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute/circulation totally 20 circulations.With chloroform extraction PCR product, ethanol-precipitation twice is suspended from the 100 μ l TE damping fluids then then.

Subsequently, produce with SmaI and HindIII restriction digestion PCR, with phenol/chloroform extraction, and through ethanol sedimentation.Gained precipitation is dissolved in the 10 μ l TE damping fluids, and subclone is to by (is the host with high competent E.coliJM109 (Toyo-boseki)) among the predigested carrier β of the same restrictions enzyme GL/pBlue then.In the transformant cell of gained, filter out 20 clones, the description of pressing substantially among the people (Molecular Cloning, Cold Spring HarborLaboratory Press (1989)) such as Sambrook prepares plasmid DNA from these clones.Use TaqDye Deoxy ^TMTerminater Cycle Sequencing box (Applied Biosystems, Inc) and 373A dna sequencing instrument (Applied Biosystems, Inc.) by the order-checking purification Identification plasmid DNA.As a result, the plasmid that confirms coding β GL-TPO/pBlue contain expection the TPOcDNA sequence and on its total length without any replacement.Behind Bg III and SpeI digestion β GL-TPO/pBlue, use phenol/chloroform extraction digestion product ethanol-precipitation then.Gained precipitation is dissolved in the 10 μ l TE damping fluids, then subclone in the carrier pSMT201 of same enzyme digestion (with high competent E.coli JM109 (Toyo-boseki) as the host.)。(Sambrook et al., above) the middle method of describing prepares plasmid DNA from the transformant cell to press MolecularCloning.As shown in figure 21, the structure of gained expression vector pSMT/ β GL-TPO is: at the Bg III/SpeI restriction site in the splicing signal sequence downstream of pSMT201 carrier, the betaglobulin leader sequence links to each other with people TPO cDNA.With this pSMT/ β GL-TPO carrier transfection in the COS cell.

In order to prepare people TPO substitutive derivative, in PCR, used Ito method (Ito et al., Gene, 102:67-70,1991).Specifically, two kinds of people TPO derivatives of illustrative ground preparation, wherein, the Arg-25 of people TPO and His-33 are replaced by Asn and Thr respectively.Correspondingly, these derivatives can be described as [Asn ²⁵] TPO and [Thr ³³] TPO.In PCR, use following primer:

T7：5′-TAATACGACTCACTATAGGGCG-3′(SEQ?ID?NO：164)

(corresponding to the T7 promoter region of Bluescript II SK+);

ΔBgIII：5′-AATTCCAAGATCACACACTTGC-3′(SEQ?ID?NO：165)

(being used to replace the BgIII recognition sequence);

Terminal: 5 '-TCAAGCTTACTAGTCCCTTCCTGAGACAGATTCTG-3 '

(SEQ?ID?NO：166)

(antisense of the 1140-1160 of the SEQ ID NO:7 that links to each other with HindIII with SpeI):

N3：5′-TGGGCACTGGCTCAGGTTGCTGTGAAGGACATGGG-3′

(SEQ?ID?NO：167)

(Arg25 of SEQ ID NO:7 → Asn): and

O9：5′-TGTAGGCAAAGGGGTAACCTCTGGGCA-3′(SEQ?ID?NO：168)

(His-33 of SEQ ID NO:7 → Thr).

With 1ng plasmid β GL-TPO/pBlue DNA is that template and each 10 μ g synthetic primer are finished the first step PCR.The combination of primer is: [1] Δ BgIII and " end " primer; [2] T7 and N3; [3] T7 and O9.With TakaRa pcr amplification box (Takara-Shuzo) and ProgrammableThrmal Controller (MJ Research), under following condition, finish in the 100 μ l volumes PCR:94 ℃ 1 minute, 55 ℃ 2 minutes, 72 ℃ 2 minutes/circulation totally 3 circulations; Then 94 ℃ 45 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute/circulation totally 17 circulations.With chloroform extraction PCR product and with ethanol sedimentation twice, then precipitation is dissolved in the 100 μ l TE damping fluids.Subsequently, make the PCR product (each 1 μ l) of gained through the PCR second time.Being combined as of template: PCR product [1]/[2] and PCR product [1]/[3].For primer, in both cases with T7 and terminal combination.At 95 ℃ of incubations after 10 minutes, add TakaRa Taq, under following condition, finish PCR:94 ℃ 1 minute, 55 ℃ of 2 minutes and 72 ℃ of 2 minutes/circulation totally 3 circulations, then 94 ℃ 45 seconds, 55 ℃ of 1 minute and 72 ℃ 1 minute/totally 9 circulations circulate.In each PCR product of gained, add 1 μ l Proteinase K (5mg/ml), 2 μ l 0.5M EDTA and 2 μ l 20%SDS, in 37 ℃ of incubations 30 minutes, so that the Taq inactivation, with phenol/chloroform extraction, and ethanol-precipitation.After this, digest the precipitation that is dissolved in the 20 μ l sterilized waters with BgIII and SpeI, then through phenol/chloroform extraction and ethanol-precipitation.The gained precipitation is dissolved in the 10 μ l TE damping fluids, and subclone is to (with high competent E.coli JM109 is the host in the expression vector pSMT201 of predigestion of same restrictions enzyme and calf intestinal alkaline phosphatase (Boehringer-Mannheim) processing subsequently.)。In the transformant of gained, every kind of situation filters out two clones, and (Sambrooket al., the above) method described in prepare plasmid DNA from the clone to press Molecular Cloning substantially.With 373A dna sequencing instrument and Taq Dye Deoxy ^TMTerminater Cycle Sequencing box (all from AppliedBiosystems, the Inc.) sequence of mensuration plasmid DNA purification.

Utilize primer [1] and [3] to contain the cDNA of coding TPO substitutive derivative (O9/TPO) by the plasmid of PCR preparation.Confirmed Thr (ACC) aminoacid replacement His 33 (CAC), and extended former C-end (Gly 332) by adding aminoacid sequence TSIGYPYDVPDYAGVHHHHHH (SEQ ID NO:169).This derivative is called [Thr ³³, Thr ³³³, Ser ³³⁴, Ile ³³⁵, Gly ³³⁶, Tyr ³³⁷, Pro ³³⁸, Tyr ³³⁹, Asp ³⁴⁰, Val ³⁴¹, Pro ³⁴², Asp ³⁴³, Tyr ³⁴⁴, Ala ³⁴⁵, Gly ³⁴⁶, Val ³⁴⁷, His ³⁴⁸, His ³⁴⁹, His ³⁵⁰, His ³⁵¹, His ³⁵², His ³⁵³] TPO.

On the other hand, utilize primer [1] and [2] to contain the cDNA of coding TPO substitutive derivative (N3/TPO) by the plasmid of PCR preparation.Confirmation by Asn (AAC) aminoacid replacement Arg25 (AGA), and replaced Glu 231 (GAA) and extended former C-end (Gly 332) by adding aminoacid sequence TSIGYPYDVPDYAGVHHHHHH by Lys (AAA).This derivative is called [Asn ²⁵, Lys ²³¹, Thr ³³³, Ser ³³⁴, Ile ³³⁵, Gly ³³⁶, Tyr ³³⁷, Pro ³³⁸, Tyr ³³⁹, Asp ³⁴⁰, Val ³⁴¹, Pro ³⁴², Asp ³⁴³, Tyr ³⁴⁴, Ala ³⁴⁵, Gly ³⁴⁶, Val ³⁴⁷, His ³⁴⁸, His ³⁴⁹, His ³⁵⁰, His ³⁵¹, His ³⁵², His ³⁵³] TPO.

By the DEAE-dextran method of describing among the embodiment 35 that chloroquine is handled that comprises, gained respectively cloned transfection in the COS7 cell.In brief, in transfection,, after 5 days, reclaim culture supernatants, use Centricon-30 (Amicon) to be concentrated to 1/20 volume subsequently so that detect its TPO activity of assessment by M-07e with 40 each plasmid DNA of μ g.As a result, in transfection respectively contain in the COS7 cell culture supernatant liquid of plasmid of cDNA of coding people TPO substitutive derivative N3/TPO and O9/TPO, detect that TPO is active to be dosage dependence mode (seeing Figure 22).

＜embodiment 68 〉

The insertion of preparation people TPO or disappearance derivative, its expression and evaluation TPO activity in the COS7 cell

Present embodiment will confirm whether the insertion of hTPO163 or disappearance derivative have the TPO activity.

The derivative of preparation is: His33-disappearance derivative ([Δ His ³³] TPO (1-163), dH33); Gly116-disappearance derivative ([Δ Gly ¹¹⁶] TPO (1-163), dG116); Arg117-disappearance derivative ([Δ Arg ¹¹⁷] TPO (1-163), dR116); Thr-inserts derivative ([His ³³, Thr ^{33 '}, Pro ³⁴] TPO (1-163), T33 '); Ala-inserts derivative ([His ³³, Ala ^{33 '}, Pro ³⁴] TPO (1-163), A33 ') and Gly-insertion derivative ([His ³³, Gly ^{33 '}, Pro ³⁴, Ser ³⁸] TPO (1-163), G33 '), wherein respectively with Thr, Ala and Gly insert between His33 and the Pro34; And Asn-inserts derivative ([Gly ¹¹⁶, Asn ^{116 '}, Arg ¹¹⁷] TPO (1-163), N116 '), Ala-inserts derivative ([Gly ¹¹⁶, Ala ^{116 '}, Arg ¹¹⁷] TPO (1-163), A116 ') and Gly-insertion derivative ([Gly ¹¹⁶, Gly ^{116 '}, Arg ¹¹⁷] TPO (1-163), G116 '), wherein respectively with Asn, Ala and Gly insert between Gly116 and the Arg117, and all sequences is all based on SEQ ID NO:13.

In these derivatives, T33 ' and N116 ' import Saliva Orthana type and Asn-mating type sugar chain respectively.

The method of describing with people such as Ito (Gene, 102:67-70,1991) prepares said derivative with PCR.Primer sequence used among the PCR is as follows:

dH33”5’-TGTAGGCAAAGGAACCTCTGGGCA-3’(SEQ?ID?NO：172)

(being used to prepare His33-disappearance derivative) based on the sequence shown in the SEQ ID NO:7;

T33 ': 5 '-TGTAGGCAAAGGAGTGTGAACCTCTGG-3 ' (SEQ ID NO:173) (be used to prepare the Thr-that between the His33 of the sequence shown in the SEQ ID NO:7 and Pro34, contains the Thr of insertion and insert derivative);

A33 ': 5 '-TGTAGGCAAAGGAGCGTGAACCTCTGG-3 ' (SEQ ID NO:174) (be used to prepare the Ala-that between the His33 of the sequence shown in the SEQ ID NO:7 and Pro34, contains the Ala of insertion and insert derivative);

G33 ': 5 '-TGTAGGCAAAGGTCCGTGAACCTCTGG-3 ' (SEQ ID NO:175) (be used to prepare the Gly-that between the His33 of the sequence shown in the SEQ ID NO:7 and Pro34, contains the Gly of insertion and insert derivative);

DG116:5 '-AGCTGTGGTCCTCTGTGGAGGAAG-3 ' (SEQ ID NO:176) (being used to prepare the Gly116-disappearance derivative on the sequence basis shown in the SEQ ID NO:7);

DR117:5 '-GTGAGCTGTGGTGCCCTGTGGAGG-3 ' (SEQ ID NO:177) (being used to prepare the Arg117-disappearance derivative on the sequence basis shown in the SEQ ID NO:7);

N116 ': 5 '-AGCTGTGGTCCTGTTGCCCTGTGGAGG-3 ' (SEQ ID NO:178) (be used for preparing the Asn-that between the Gly116 of the sequence shown in the SEQ ID NO:7 and Arg117, contains the Asn of insertion and insert derivative);

A116 ': 5 '-AGCTGTGGTCCTAGCGCCCTGTGGAGG-3 ' (SEQ ID NO:179) (be used for preparing the Ala-that between the Gly116 of the sequence shown in the SEQ ID NO:7 and Arg117, contains the Ala of insertion and insert derivative);

G116 ': 5 '-AGCTGTGGTCCTTCCGCCCTGTGGAGG-3 ' (SEQ ID NO:180) (be used for preparing the Gly-that between the Gly116 of the sequence shown in the SEQ ID NO:7 and Arg117, contains the Gly of insertion and insert derivative);

DRI:5 '-CGGGCTGCAGGATATCCAAGATCTCA-3 ' (SEQ ID NO:181) (being used to replace limiting enzyme EcoRI-recognition sequence);

T7:5 '-TAATACGACTCACTATAGGGCG-3 ' (SEQ ID NO:182) is (corresponding to Bluescript II SK ⁺The T7 promoter region); With

Terminal Notl 5 '-GGGCGGCCGCTCAGCTGGGGACAGCTGTGGTGGG-3 '

(SEQ?ID?NO：183)

(antisense of the 633-653 nucleotide sequence of SEQ ID NO:7 has wherein added terminator codon and NotI recognition sequence).

1ng plasmid β GL-TPO/pBlue DNA with preparation among the embodiment 67 is that template and 10 μ M synthetic primers are finished the first step PCR.Combination of primers is the primer (dH33, A33 ', G33 ', T33 ', dG116, dR117, A116 ', G116 ' and N116 ') of [1] dRI and terminal NotI or [2] T7 and sudden change.In PCR,, in 100 μ l final volume, finish PCR with TakaRa pcr amplification box (Takara-Shuzo) and Programmable Thermal Controller (MJ Research).In the PCR of [1] reaction, circulation be 94 ℃ 1 minute, 45 ℃ of 2 minutes and 72 ℃ 2 minutes are finished 3 circulations; Then carry out 1 circulation and be 94 ℃ 45 seconds, 45 ℃ of 1 minute and 72 ℃ of totally 17 circulations in 1 minute.On the other hand, under following condition, finish the PCR reaction of [2]; 94 ℃ 1 minute, 55 ℃ 2 minutes, 72 ℃ of totally 3 circulations in 2 minutes, then 94 ℃ 45 seconds, 55 ℃ 1 minute, 72 ℃ of totally 17 circulations in 1 minute.Before ethanol sedimentation 2 times, with each PCR product of chloroform extraction, the precipitation with gained is dissolved in the 100 μ l TE damping fluids then.

Then, finish the second step PCR with each PCR product of 1 μ l [1] and [2].Used primer is the combination of T7 and terminal NotI., after 10 minutes TakaRa Taq is added in each PCR reaction mixture at 94 ℃ of incubations.Under following condition, finish the 2nd PCR:94 ℃ 1 minute, 55 ℃ of 2 minutes and 72 ℃ of totally 3 circulations in 2 minutes; Then 94 ℃ 45 seconds, 55 ℃ of 1 minute and 72 ℃ of totally 9 circulations in 1 minute.5mg/ml Proteinase K, 2 μ l 0.5MEDTA and the 2 μ l 2%SDS of 1 μ l are added in each PCR product, then mixture is remained in 37 ℃ 30 minutes so that the Taq inactivation.With phenol/chloroform extraction PCR product, then ethanol sedimentation, after the precipitation of gained is dissolved in the 20 μ l sterilized waters.After EcoRI and NotI digestion,, use ethanol sedimentation then with phenol/chloroform extraction precipitation.The precipitation of gained is dissolved in the 10 μ l TE damping fluids, and subclone is to also using alkaline phosphatase (from calf intestinal, Boehringer-Mannheim) among the expression vector pEF18S of Chu Liing with the predigestion of same restrictions enzyme then.Used host cell is high competent E.coli JM109 (Toyo-Boseki).From the transformant of gained, press the method for describing among the Molecular Cloning (Sambook et al., Cold Spring Harbor LaboratoryPress, (1989)) substantially and prepare plasmid DNA.After this, with Taq Dye Deoxy ^TMTerminater Cycle Sequencing box (Applied Biosystems) and AppliedBiosystems 373A dna sequencing instrument are determined the nucleotide sequence of the plasmid DNA of purifying.In conjunction with, confirm coding dH33, A33 ', T33 ', dG116, dR117, A116 ', all plasmids of G116 ' and N116 ' all contain the TPO cDNA sequence of expection, and except that required site, without any the replacement of nucleotide sequence.In addition, in G33 ', observe base and replace [Pro38 (CCT) → Ser (TCT)], but be not on required site.

Press the method among the embodiment 11, gained respectively cloned transfection in the COS7 cell.In a word,, finish transfection, after 4 to 5 days, reclaim culture supernatants, then with the assessment of M-07e detection system with 10 each plasmid DNA of μ g with the DEAE-dextran method that comprises that chloroquine is handled.As a result, in each COS7 cell culture supernatant liquid of the plasmid transfection that inserts or lack derivative with coded amino acid, detecting TPO active is that dosage relies on mode (seeing Figure 23).On the contrary, in transfection and express in the COS7 cell culture supernatant liquid of expression plasmid pEF18S of the cDNA do not contain coding TPO derivative and do not have the TPO activity.

＜embodiment 69 〉

Preparation and purifying Anti-Human TPO peptide antibody

(1) from the people TPO aminoacid sequence of SEQ ID NO:191, filter out and think and be suitable for comparatively speaking as antigenic 6 zones (being shown in table 8), method (Proc.Natl.Acad.Sci.USA with Tam, 85,5409-5413,1988) four-chain peptide of synthetic multiple antigenic peptide (MAP) type therefrom.At every turn with 2 rabbits of this peptide immunity of 100 μ g, immunity 8 times.

Do not consider outside the above-mentioned situation, each peptide district shown in Cys residue and the SEQ ID N0:119-124 (is called HT1-6 district, peptide district, they correspond respectively to the sequence 8-28 of SEQ ID NO:191,47-62,108-126,172-190, the partial peptide of 262-284 and 306-332) C-terminal in conjunction with and produce the strand peptide.As detecting antigen,, in all tested serum, all found the increase of value for antibody with these with the enzyme-value for antibody of immunodetection detection from the serum of immune thus rabbit.Therefore, these serum are called anti--serum.

In addition, resist-serum as antigen affinity purification in following (2) with the synthetic peptide (being combined with the Cys residue) of above-mentioned strand again at its C-end.

(2) with one of above-mentioned antigen peptide two rabbits of immunity respectively, from the immune rabbit, prepare antibody respectively.Specifically, from two immunize rabbits, resisted-HT1-1 peptide antibody and anti--HT1-2 peptide antibody for anti--HT1 peptide antibody.

As an embodiment, hereinafter illustrate the purifying of anti--HT1-1 peptide antibody.

At first, the strand peptide (being combined with the Cys residue on it) with 30mg HT1 is coupled on the 12mlSulfo Link Couling Gel (by Pierce Co., producing article number 44895).Specifically, in 15 minutes time, will contain antigenic peptide solution and be coupled on coupling buffer (pH 8.5 for 50mM Tris, 5mM EDTA-Na) the equilibrated gel through 6 times of gel volumes.It was left standstill 30 minutes, with the coupling buffer detergent gel of 3 times of gel volumes.The coupling buffer that then will contain 0.05M L-cys-HCl adds in the gel with the speed of 1ml/ml-gel, makes untreated group blocking-up like this in 15 minutes time.After in statu quo leaving standstill 30 minutes, with the coupling buffer detergent gel of 8 times of gel volumes.At room temperature finish above-mentioned linked reaction.In this way, the peptide that will contain antigenic region is coupled on the gel by covalent attachment with 28.3% coupling rate, so as in the antigen post antigen peptide gel of coupling 0.8mg peptide on the preparation 1ml gel.After having collected whole blood from each immunize rabbit, obtain anti--serum that 78.4ml contains anti--HT1-1 peptide antibody.With 76.7ml anti--serum (protein content 3620mg) is added in advance on the 50mM phosphate buffered saline buffer through containing 150mMNaCl and 0.05% sodium azide (pH 8) the equilibrated antigen post, washs with identical damping fluid then.Therefore obtain 105.9ml and flow out fraction (protein content 3680mg).Then use the fraction of 0.1M citric acid (pH 3.0) wash-out absorption, by adding 21.1ml 0.1M carbonate buffer solution (pH 9.9) it is neutralized immediately subsequently, concentrate with ultrafiltration (using the YM30 film of producing by AmiconCo.), and at the 50mM phosphate buffered saline buffer that contains 150mM NaCl and 0.05% sodium azide (pH 8) purifying.Therefore, in damping fluid, obtain the anti--HT1-1 peptide antibody (protein content 77.7mg) of 11.2ml purifying.Method with same as described above is resisted-HT1-2 peptide antibody (60.0mg), anti-HT2-1 peptide antibody (18.8mg), anti--HT2-2 peptide antibody (8.2mg) etc.

With method same as described above, obtain anti-HT3 to anti--HT6 peptide antibody.

＜embodiment 70 〉

The detection that TPO Western analyzes

(1) in order to assess the anti--serum of gained among the embodiment 69, detects them with following method.

To carry out SDS-polyacrylamide gel electrophoresis (SDS-PAGE) from the partially purified standard recombinant human of the culture supernatants of Chinese hamster ovary celI TPO sample according to a conventional method, electroblotting on PVDF or nitrocellulose filter then, the amino acid-21 that in described Chinese hamster ovary celI, has imported and the expressed coding SEQID NO:6 gene to 332.Behind the trace, (TBS) this film was washed 5 minutes, washed 5 minutes with the TBS (TTBS) that contains 0.1%Tween20 then, wash 2 times, use blocker (Block Ace again with 20mM Tris-HCl and 0.5M NaCl (pH 7.5); Produce article number UK-B25 by Dai-NipponPharmaceutical Co.) handled 60 minutes.Each anti--serum that will contain one of anti--HT1-1 peptide antibody, anti--the HT2-1 peptide antibody, anti--the HT3-2 peptide antibody, anti--the HT4-1 peptide antibody, anti--HT5-2 peptide antibody and anti--HT6-1 peptide antibody with the TTBS solution that contains 0.05%BSA and 10%Block Ace is diluted to 1/1000 extent of dilution.Antibody with dilution thus carries out the Western detection as first antibody.Say exactly, will be with the TTBS solution that contains anti--TPO peptide antibody, 0.05%BSA and 10%BlockAcl by the recombinant human TPO sample preparation of above-mentioned processing 60 minutes, the TTBS washing is 5 minutes then.Then-rabbit anti-with containing (ab ') biotinylated antibody of goat (being produced article number L43015 by Celtag Co.) is as second antibody, and the TTBS of 0.05%BSA and 10%Block Ace processing 60 minutes, then with TTBS wash twice each 5 minutes.Then, use by the TTBS solution that contains 10%Block Ace and handled 30 minutes, thereafter with TTBS washing 2 times with the avidin of the alkaline phosphatase-mark of 1/5000 dilution (producing article number A108 by Leinco Technologies Co.), each 5 minutes, washed 5 minutes with TBS then.Then with alkaline phosphatase substrate (by Bio-Rad Co., production, article number 170-6432) colour developing.Under room temperature, finish above-mentioned Western and detect, thereby confirm that anti--serum can discern and detect people TPO.

(2) will be through anti--HT1-1 peptide antibody of each 3mg of the affinity chromatography purification among the embodiment 69, anti--the HT1-2 peptide antibody, anti--HT2-1 peptide antibody and anti--HT2-2 peptide antibody are weighed and by making it be coupled to activatory vitamin H (NHS-LC-Biotin II, by Pierce Co., produce article number 21336) on make its biotinylation.To carry out SDS-PAGE with above-mentioned (1) used identical standard recombinant human TPO sample, electroblotting on PVDF or nitrocellulose filter, carries out conventional Western and detects as first antibody with biotinylated each antibody then.Behind the trace, with TBS film was washed 5 minutes, washed 2 times with TTBS again, each 5 minutes, then handled 60 minutes at once with blocker (Block Ace).Then, with contain 1 μ g/ml biotinylated anti--the TTBS solution-treated of TPO peptide antibody, 0.05%BSA and 10%Block Ace 60 minutes, then with TTBS washing 2 times, each 5 minutes.Then use again by the TTBS solution that contains 10%BlockAce and (produce by Leinco Technologies Co. with the avidin of the alkaline phosphatase-mark of 1/5000 dilution, article number A108) handled 30 minutes, with TTBS washing 2 time, each 5 minute, again with TBS wash 5 minute thereafter.With alkaline phosphatase substrate (producing article number 170-6432 by Bio-Rad Co.) colour developing.At room temperature finish above-mentioned Western and detect, people TPO can be discerned and detect to conclusive evidence by antibody purified.

＜embodiment 71 〉

Prepare anti--TPO peptide antibody post and detect people TPO

The Anti-Human TPO peptide antibody identification people TPO that conclusive evidence obtains in embodiment 69.These antibody are coupled to anti-on the chromatography carrier-TPO peptide antibody post respectively to prepare.As an example, the following describes the preparation of anti--HT1-2 peptide antibody post.

(1) preparation contains the solution of 50mM sodium phosphate and 0.15M NaCl (pH 8.0) and 5mg/ml antibody.This solution of 0.8ml is mixed also coupling 2 hours with the formyl radical activatory gel (Formyl-Gellulofine is produced by Chisso Co.) of 1.54ml swelling in 4 ℃ then.Then, contain 10mg/ and rise reductive agent (Trimethylamine 99 borane (TMAB) is produced by Seikagaku Kogyo K.K., and article number is 680246) solution, make its coupling 4 hours more with it to wherein adding 1.1ml.The centrifugal then gel section that from reaction mixture, only reclaims.To wherein adding the 10ml pure water, reclaim gel section through centrifugal.This process is repeated 4 times to remove unreacted antibody.Block buffer reagent (pH 7.0 for 0.2M sodium phosphate, 1M thanomin) with 2.1ml then and added wherein 1.1ml reductant solution in 4 ℃ of Gel Treatment that will reclaim thus 2 hours, with the active group in the blocking-up unreacted gel.At last, use a whizzer, by the gel of water, 20mMTris-HCl and 0.15M NaCl (pH 8.0) washing gained.The gained gel is filled in the pillar test tube, also use 20mMTris-HCl and 0.15M NaCl (pH 8.0) balance with 3M Sodium Thiocyanate 99 and 0.1M Gly-HCl (pH 2.5) solution washing.The balance columns that reservoir gets.

In anti--HT1-2 antibody column, anti--TPO peptide antibody gel for the coupling rate of each IgG fraction up to 94.2%.The amount that is coupled to the IgG fraction on the per unit volume gel is the 1.9mg/ml-gel.With method same as described above, preparation coupling on every ml gel has the gel of 21.8mg IgG, and described IgG does not contain as antigenic TPO.So that press described in (2), from the TPO antibody column, remove the molecule of non-specific binding as last post (antibody column hereinafter referred to as) with it.

(2) another example for preparing anti--HT1-2 antibody column hereinafter is described.

To be added to the last antibody column (containing the 1ml gel) of preparation (1) from the standard model of the partially purified recombinant human TPO of Chinese hamster ovary celI culture supernatants, 20mMTris-HCl (pH 8.0) and 0.15M NaCl with 10 times of gel volumes pass through this post, collect fraction, imported and expressed the gene of any aminoacid sequence of coding SEQ ID NO:119-124 in the described Chinese hamster ovary celI by this post.Then, (0.1M Gly-HCl, pH2.5) wash-out is adsorbed onto the fraction on the last antibody column with 10 times of acid eluents to gel volume.Then, to be added in the anti--HT1-2 antibody column (containing the 2ml gel) of preparation (1) from the effusive fraction of last antibody column, 20mM Tris-HCl (pH 8.0) and 0.15M NaCl with 10 times of gel volumes wash this post, collect the fraction that flows through anti--HT1-2 antibody column simultaneously.Acid eluent (0.1M Gly-HCl with 8 times of gel volumes; PH 2.5) wash-out is adsorbed onto the fraction on anti--HT1-2 antibody column.Analyze these fractions with SDS-PAGE, prove that TPO is not adsorbed onto on the last antibody column, but with anti--HT1-2 antibody column specificity combines, and the nearly all TPO that is added in the sample all combines with latter's post.Confirm that thus in a kind of post in back, the TPO of at least 200 to 300 μ g/ml-gels combines with gel.

＜embodiment 72 〉

TPO is for the effect of platelet increasing number

With the normal ICR strain male mice in 20 8 ages in week, (collect blood from its eye socket vein; And measured platelet count with the minicell counting meter F-800 that Toa Iyo Denshi makes) be divided into four groups at random.With a group (contrast-iv group) among four groups of the 100 μ l PBS intravenous injections, continuous once a day 5 days.With 100 μ l solution (by through NAP-25 post [PharmaciaBiotech; Article number 17-0852-02] PBS replace the concentrated solution of the TPO active fraction F2 of the SPSepharose Fast Llow that obtains among the embodiment 56, prepare with the PBS dilution then, detecting relative reactivity through M-07e is 211,900) another group of intravenous injection (TPO-iv group), inject once every day, continuous 5 days.With 100 another groups of μ l PBS subcutaneous injection (contrast-SC group), continuous once a day 5 days, use simultaneously with TPO-iv group in identical method, a group (TPO-SC group) being left with 100 μ l subcutaneous injections, once a day, continuous 5 days.After begin to use 6,8,10,13 and 15 days, collect blood and with minicell count number (F-890 is made by Toa Iyo Denshi) platelet Counting number from the eye socket vein of each mouse.Provided the changing conditions of platelet count among Figure 24.Therefore, in contrast-iv group, even at high the 6th day of platelet counts (be 0 day that day of using), with use before compare, platelet count has increased by 44%, in contrast-sc group, even, also only increased by 47%, on the other hand the highest the 8th day of number, in the TPO-iv group,, compare with the number before using at the 6th day, increased by 177%, in the TPO-sc group, increased by 347% at the 6th day, at the 8th day, the highlyest increased by 493%.

From The above results, can confirmer TPO platelet increasing number, do not rely on the different of type and route of administration.

＜embodiment 73 〉

TPO is for the effect of platelet increasing number

The normal C3H/HeJ strain male mice (collect blood and measured platelet count with the minicell counter F-800 type that Tao Iyo Denshi makes from its eye socket vein) in 16 11 ages in week is divided into 4 groups at random.With 100 μ l PBS subcutaneous injections 1 group (control group) once a day, continuous 5 days.(by using the TPO active fraction that replaces the Sepha cryl S-200HR that obtains among the embodiment 56 through the PBS of NAP-25, prepare with the PBS dilution again, detect with 100 μ l solution through M-07e, relative reactivity is 83,000) another group of subcutaneous injection (TPO-1 group), once a day, continuous 5 days.(2 times of used TPO active fraction dilutions prepare by with PBS TPO-1 being organized with 100 μ l solution; Detect through M-07e, relative reactivity is 41,500) another group of subcutaneous injection (TPO-2 group), once a day, continuous 5 days.(dilution of used TPO active fraction prepares more than 2 times by TPO-2 is organized with 100 μ l solution; Detect relative reactivity, 20,750 through M-07e) last group of subcutaneous injection (TPO-3 group), once a day, continuous 5 days.

Blood is collected and with minicell counter (the F-800 type is made by Toa Iyo Denshi) platelet Counting number from the eye socket vein of mouse in after injection the 6th, 8,10 and 12 days.

Provided the changing conditions of platelet count among Figure 25.Therefore, in control group, platelet count does not almost change, in the group of injection TPO, and after injection the 8th day, the thrombocyte number average in all groups is increased to the highest degree of number.In addition, between each group, there is the difference of dose response.Therefore, in TPO-1 group, at the 6th day, existing about 200% increase at the 8th day, increased and reaches about 270%, both made then at the 12nd day to decrease, but still therefore the increase of the 65-% that has an appointment has significant difference (p＜0.01 with control group; Draw by the many comparing checks of Dunnet).In TPO-2 group, although the increase effect is organized less than TPO-1, but still found identical increase, at the 6th and 8 day, increased about 140% and about 160% respectively.At the 12nd day, number was reduced to and control group level much at one.The increase effect of TPO-3 group is weaker than the TPO-2 group, the highest the 8th day of number, the increase of 110-% is arranged approximately, still has significant difference (p＜0.01) with control group.

From The above results, can determine that people TPO is independent of the kind system of mouse and increases the platelet count of mouse, and its effect there is the dose response characteristic.

＜embodiment 74 〉

TPO is to because of using the restraining effect of the thrombocytopenia that carcinostatic agent causes

Male ICR mouse with age 30 8 weeks of 200mg/kg5-FU intravenous injection is divided into 2 groups (every group of 15 mouse) then at random.Following daystart (the 1st day), one group (control group) are with 100 μ l PBS subcutaneous injections, once a day, continuous 5 days, and another group (TPO group) is with TPO active fraction used among the 100 μ l embodiment 72 (detecting relative reactivity through M-07e is 211,900) subcutaneous injection, once a day, continuous 5 days.At the 4th, 6 and 8 day, from every group, select 5 mouse at random, collect blood and use minicell counter (the E-2500 type is made by Toa Iyo Denshi) from the eye socket vein then platelet count.Listed the changing conditions of platelet count among Figure 26.Therefore, in control group, use 5-FU after, As time goes on, platelet count and reducing, at the 6th day, thrombocyte numerical value minimum (for use value before the 5-FU 28%), and, increase about 1.3 times because of reducing to react at the 8th day.Even in TPO group, use 5-FU after, passing in time, platelet count reduces, and at the 6th day, numerical value minimum (for use value before the 5-FU about 52%).Yet at the 4th and 6 day, the difference between the platelet count was very little, and compares with control group at the 6th day, had kept obviously (p＜0.05; Because of Dunnet Multiple comparing check records) the high value.At the 8th day, compare with the value before using 5-FU, increase about 200%.

Can determine that from The above results the platelet count that people TPO suppresses to be caused by carcinostatic agent reduces.

＜embodiment 75 〉

TPO is to the therapeutic action of thrombocytopenia

With (50mg/kg) the intravenous injection ICR male mice of giving 36 7 ages in week of the mute nitre urea (ACNU) of pyrimidine hydrochloride, then mouse is divided at random 2 groups (every group of 18 mouse).

From next day (first day), with 200 one group of subcutaneous injection of μ l PBS (control group), twice of every day, continuously a couple of days, inject another group (TPO group), every day 2 times with TPO active fraction (not diluting) used among the 200 μ l embodiment 73 with PBS, continuous a couple of days, be added with 0.04% Tween80 (detect through M-07e, relative reactivity is 380,000) in the described TPO active fraction.

After the injection, with each the group in mouse be divided at random 3 groups-from one group, collected blood at the 5th day and 12 days; At the 8th day and 14 days, from another group, collect; At the 10th day, from remaining group, collect.Collect blood and use minicell counter (the F-800 type is made by Toa Iyo Denshi) platelet Counting number from the eye socket vein.Listed the changing conditions of platelet count among Figure 27.Therefore, in control group, use ACNU after, passing in time, platelet count reduces, and at 8-10 days, numerical value minimum (for use preceding the value of ACNU about 29%), but at the 12nd and 14 day, return to about 49% and about 74% respectively.On the other hand, in TPO group, at the 5th day, be reduced to and use the about 38% of the preceding value of ACNU, beginning then increases gradually.Therefore, at the 8th day, return to ACNU and use the about 63% of preceding value, and at the 10th day, platelet count is greater than the value of using before the ACNU.At the 12nd and 14 day, increased about 300% and about 400% respectively.

Just as described above, in control group, observe reduction 8-10 days, in the TPO group, observed increase, and at the 10th day, platelet count just is higher than the value of using before the ACNU.Therefore, can determine that people TPO can impel the recovery of the thrombocytopenia that causes because of carcinostatic agent.

Behind the same result who considers among the embodiment 74, can expect that now the type that people TPO can be independent of carcinostatic agent suppresses the reduction of platelet count and the recovery of promotion thrombocytopenia.

＜embodiment 76 〉

Behind BMT, TPO is to the therapeutic action of thrombocytopenia

With the radioactive radiation of 10Gy the C3H/HeN strain male mice in 48 7 ages in week is carried out full-body exposure, then use immediately from 1 * 10 of the mouse of same strain ⁶The medullary cell intravenous injection.Then mouse is divided into 2 groups at random, from next day (the 1st day), inject one group (control group) with PBS, and inject another group (TPO group) with TPO active fraction used among the embodiment 73 (detect through M-07e, relative reactivity is 44,000), two groups all is through subcutaneous injection, dosage 100ml, once a day, continuous 20 days.

After the injection beginning, the 5th, 10,14 and 21 days, select 6 mouse at random at every turn, collect blood from its eye socket vein, with minicell counter (the E-2500 type is made by Toa Iyo Denshi) platelet Counting number.

Listed the changing conditions of platelet count among Figure 28.Therefore, in all groups, after using BMT, passing in time, platelet count reduces, and at the 10th day, number minimum (for use number before the BMT about 3%).After this, recover gradually, in the time of the 14th day, the number in control group and the TPO group is respectively about 11% and about 13%.At the 21st day, only return to approximately 37% in the control group, and in the TPO group, return to approximately 65%, therefore, observe significant recovery promoter action.Can draw from The above results: the recovery of platelet count behind the people TPO of the preparation promotion application BMT the embodiment 56.

＜embodiment 77 〉

Behind radiation exposure, TPO is to the therapeutic action of thrombocytopenia

With the X-ray of 5Gy the ICR strain male mice in 36 8 ages in week is carried out full-body exposure, be divided into 2 groups then at random.From next day (first day), inject one group (control group) with PBS, (detect with used TPO active fraction among the embodiment 73 through M-07e, relative reactivity is 1,440,000) inject another group (TPO group), two groups all is subcutaneous injections, once a day, and for three days on end, then, from following daystart, (detected by M-07e, relative reactivity is 360 in subcutaneous injection, 000), continuous once a day 7 day.After the injection beginning, with every group be divided at random again 3 groups-from one group, collected blood at the 4th, 11 and 12 day, at the 7th and 13 day, from another group, collect; Collected from remaining one group at the 9th and 15 day.Collect blood and use minicell counter (F-800 type from the eye socket vein; Make by Toa Iyo Denshi) the platelet Counting number.In Figure 29, listed the changing conditions of platelet count.In control group, after x-ray bombardment, passing in time, platelet count reduces, at the 9th day, number minimum (be with the preceding number of x-ray bombardment about 25%).At the 11st and 13 day, number returned to about 38% and about 67% respectively, at the 15th day, returned to the value before the x-ray bombardment.In TPO group, at the 7th day, number was reduced to about 24% with preceding the number of x-ray bombardment, after this, begins increase, and number returned to about 82% in the 9th day.In the 11st day and later time, platelet count has exceeded with the number before the x-ray bombardment, and by the 21st day, has all kept this trend.As mentioned above, in control group, the 9th day of still being tending towards reducing of its number, the platelet count in the TPO group has begun to increase, and at the 11st day, number of platelets surpassed with the number before the x-ray bombardment, and all keeps increasing after this.On the other hand, in control group, return to the number before the x-ray bombardment and need 15 days.Can draw from these results: after the people TPO that produces has shortened with x-ray bombardment, reduce the time of recovering required of beginning from number of platelets among embodiment 56, and for the thrombocytopenia after the x-ray bombardment therapeutic action being arranged.

＜embodiment 78 〉

The effect of hTPO163 platelet increasing number

15 had been collected blood and used minicell counter (F-800 type from its eye socket vein; Make by Toa Iyo Denshi) to be divided into four groups-one group at random be control group for 15 C3H/HeN strain healthy male mices measuring platelet count, remaining be that A, B and C organize.With containing 0.1% first group of PBS subcutaneous injection (control group) from the serum of mouse, once a day, continuous 5 days.With about 40,000,000, about 8,000,000 and about 1,600, the dosage of 000/kg body weight/day (in the relative reactivity of the hTPO163 that detects through M-07e) is organized with TPO active fraction subcutaneous injection A, B and the C of the SP Sepharose Fast Flow that obtains among the embodiment 65, continuous 5 days, described TPO active fraction was diluted with the PBS that contains 0.1% mice serum.

Blood is collected from the eye socket vein of each mouse in after injection the 6th, 8,10 and 12 days, with minicell counter (F-800 type; Make by Toa Iyo Denshi) the platelet Counting number.In Figure 30, listed the changing conditions of platelet count.

Therefore, in control group, number of platelets does not almost change, and in the TPO group, injection back all mouse platelets number increases in the 8th day reach maximum.In each TPO group, all observe dose-response relationship.In A group, at the 6th and 8 day, 88% and about 100% the increase of having an appointment respectively, even at the 10th day, 97% the increase of still having an appointment, therefore, all there were significant differences (p＜0.01 is through the many comparing checks of Dunnet) with control group for all data.In B group, also observe similar increase, but the degree that increases is lower than the A group,, increases about 65% and about 84% respectively, show that there were significant differences (p＜0.01 or 0.05 obtains through the many comparing checks of Dunnet) with control group at the 6th and 8 day.Increase in the C group is lower than in the B group.In still had an appointment in the highest the 8th day 31% increase of number.Can confirm from The above results: but the hTPO163 platelet increasing number of preparation the embodiment 65, and also its effect shows as dose-response relationship.

＜embodiment 79 〉

HTPO163 is to the therapeutic action of thrombocytopenia

With the C3H/HeN strain male mice in age in mute 100 8 weeks of nitre urea (ACNU) intravenous injection of the pyrimidine hydrochloride of 50mg/kg, be divided into four groups of-control groups and A, B, C group then at random, every group of 25 mouse.From next day (the 1st day), with 5ml/kg PBS subcutaneous injection control group, once a day, continuous several days, with about 16,000,000, about 48,000,000 and 160,000, the dosage of 000/kg body weight/day (in the relative reactivity of the hTPO163 that detects through M-07e) is organized with TPO active fraction subcutaneous injection A, B, the C with the SP Sepharose Fast Flow of PBS dilution that obtain among the embodiment 65, once a day, continuous several days.Before the injection beginning, every group of mouse is divided into 5 groups again, then the 5th, 8,10,12 and 14 days collection blood.Collect serum from its eye socket vein, with minicell counter (E-2500 type; Make by Toa Iyo Denshi) the platelet Counting number.In Figure 31, listed the changing conditions of platelet count.In control group, use ACNU after, passing in time, platelet count reduces, and at 8-10 days, reaches Schwellenwert (being about 15-16% that ACNU uses preceding value), at 12 and 14 days, has only very little recovery, is respectively about 28%-about 51%.On the other hand, in A group, in the time of the 8th day, reduced number to use ACNU preceding about 25%.But after this, increase gradually and returned to about 34% and about 89% respectively at the 10th day and 12 days.Number the 14th is greater than the number before using ACNU.

As mentioned above, although in all groups, observed minimum number of platelets on the 8th day, and in the group of having used people TPO, when platelet count was minimum, the degree of reduction was lower than control group.In control group, even at the 10th day, platelet count did not almost recover yet, and in using the group of TPO, although the degree difference all has the recovery of platelet count in all groups.In the group of using 50 μ g/kg, recovery is all arranged, at the 12nd day, than having used the number height before the ACNU.Through relatively, in control group, even at the 14th day, only return to ACNU about 51% before using, clearly illustrate that therefore the favourable promotion of hTPO163 that produces among the embodiment 65 is from the recovery of the minimizing of platelet count.Prove that like this, also hTPO163 has therapeutic action to the thrombocytopenia that causes because of carcinostatic agent.

Be the embodiment of pharmaceutical preparation below.

＜embodiment 80 〉

The people TPO fraction that obtains among the embodiment 56 is concentrated, through sterilising treatment and freezing to obtain frozen product as injection formulations at-20 ℃.

＜embodiment 81 〉

The people TPO fraction that obtains among the embodiment 56 is concentrated, its 5ml is contained in the 10ml bottle with aseptic technique, in-20 ℃ of freeze-drying, with rubbery stopper beyond the Great Wall bottle to obtain freeze-dried substance as injection formulations.

＜embodiment 82 〉

The people TPO fraction that obtains among the embodiment 56 is concentrated, through sterile filtration and be contained in the 10ml bottle to obtain can be used as the product of injection formulations.

＜embodiment 83 〉

Concentrate the hTPO163 fraction that obtains among the embodiment 65, through aseptically process and in-20 ℃ of freeze-drying to obtain can be used as the frozen prods of injection formulations.

＜embodiment 84 〉

Concentrate the hTPO163 fraction that obtains among the embodiment 65, its 5ml be contained in the 10ml bottle with aseptic technique, in-20 ℃ of freeze-drying, then with the rubber stopper seal bottle to obtain can be used as the freeze-drying prods of injection formulations.

＜embodiment 85 〉

Concentrate the hTPO163 fraction that obtains among the embodiment 65, through sterile filtration and be contained in the 10ml bottle to obtain can be used as the product of injection formulations.

＜embodiment 86 〉

Concentrate the people TPO fraction that obtains among the embodiment 57, through aseptically process and freezing to obtain can be used as the frozen prods of injection formulations in-20 ℃.

＜embodiment 87 〉

Concentrate the people TPO fraction that obtains among the embodiment 57, use aseptic technique, its 5ml is contained in the 10ml bottle, in-20 ℃ of freeze-drying also with rubber stopper seal to obtain can be used as the freeze-drying prods of injection formulations.

＜embodiment 88 〉

Concentrate the people TPO fraction that obtains among the embodiment 57, through sterile filtration and be contained in the 10ml bottle to obtain can be used as the product of injection formulations.

＜embodiment 89 〉

Aplastic dog plasma

Except that the whole body radiation of the receptor being carried out 450 rads, by [Mazur, E.and South, K.Exp.Hematol.13:1164-1172 (1985); Arriaga, M., South K., Cohen J.L.and Mazur, E.M.Blood 69:486-492 (1987); Mazur, E., Basilico, D., Newton, J.L., Cohen, J.L., Charland, C., Sohl, P.A., and Narendran, A.Blood 76:1771-1782 (1990)] the aplastic dog plasma (" APK9 ") or the normal dog plasma (" NK9 ") of described production heparinization.

＜embodiment 90 〉

People's megalokaryocyte detects

The molecular biology manual that is being widely known by the people, Molecular Cloning as people such as Sambrook (Eds), second edition, people's' (volume) such as Cold Spring Harbor Laboratory Press (1987) and Ausubel Current Protocols in Molecular Biology, Greenassociates/Wiley Interscience provides the standard method of many processes of describing or other suitable method in the following example among the New York (1990).

Detecting APK9 and isolating APK9 stimulates from CD34 ⁺Progenitor is grown the Megakaryocytic ability of adult.By (Hokom, M.H., Choi, E.Nichol, J.L., Hornkohl, A., Arakawa, T.and Hunt, P.Molecular Biology of Haematopiesis 3:15-31,1994) the described CD34 screening cell that obtains from peripheral blood cells and following substratum, cultivating: with 1%Glutamine Pen-strep (Irvine Scientific, Santa Ana, CA) and the Dulbecco ' s substratum (IMDM that improves of the Iscove ' s of the few hematoblastic people AB plasma supplemented of 10% heparinization; GIBCO, Grand Island, NY).Also comprise 2 mercapto ethanol (10 ^-4M), pyruvic acid (110 μ g/ml), cholesterol (7.8 μ g/ml), adenosine, guanine, cytidine, uridine, thymidine, 2-deoxidation cytosine(Cyt), the 2-Desoxyadenosine, 2-pancreatic desoxyribonuclease (each 10 μ g/ml, Sigma), biosynthetic human insulin (10 μ g/ml), human transferrin (300 μ g/ml), soybean fat (1%, BoehringerMannheim Indianapolis, IN), people's recombinant basic fibroblast growth factor ((2ng/ml), Genzyme, Cambridge, MA), people's Urogastron (15ng/ml) of recombinating, platelet-derived somatomedin (10ng/ml, Amgen, Inc., Thousand Oaks, CA).CD34-is screened cell with 2 * 10 ⁵Ml is layered on Terasaki-type droplet plate (Vanguard, Inc.Neptrne, the NJ) cultivation in the hole (final volume 15 μ l).At 37 ℃, with the 5%CO of cell in humidity cabinet ₂Cultivated 8 days in the air, directly be fixed in the culture hole, (resist-GPIb, resist-GP II B, with the mono-clonal scintillation solution then (Biodesign) with anti--GpIb (Dako, Carpinteria, CA) insulation together with containing 1% glutaraldehyde.Make the immune response colour developing with streptavidin-beta-galactosidase enzymes detection system (HistoMark, Kirgegaard and Perry).Be inverted the megalokaryocyte of phase microscope with one with the blue look of 100 * amplification counting.With the result be expressed as the Megakaryocytic mean value in every hole+/-standard error (SEM) of mean value.In some cases, with " megalokaryocyte unit/ml " expression data, wherein, the positive APK9 that the degree of inducing megalokaryocyte to grow institute to sample is standardized into that experiment contrasts.1 unit instigates megalokaryocyte and 1 μ l APK9 standard substance to reach the Megakaryocytic amount of similar number.If available 5-10 μ g/ml MPL-X blocking-up is active, then can show its activity (soluble MPI acceptor) by mpl ligand.

In this system, shown the factor that APK9 contains stimulates people's megalokaryocyte to grow.CD34-screening cell was cultivated 8 days with 10%NK9, have only and can ignore the blue look megalokaryocyte of disregarding, and CD34-screening cell is cultivated with 10%APK9 a large amount of blue look megalokaryocytes was arranged in 8 days.

Figure 32 shows that the MpI-X that concentration is increased gradually is added in people's megalokaryocyte culture systems, and its blocking effect that megalokaryocyte is grown also increases gradually.During greater than 5 μ g/ml, is to suppress fully in the concentration of MpI-X.In this experiment, stimulate CD34-screening cell with 5%APK9.This shows, it is essential growing for people's megalokaryocyte with the interactional activity of MpI-X (the MpI part of supposition), and shows have the MpI part in APK9.

This paper also illustrates, grows essential MpI ligand activity for people's megalokaryocyte and is present among the APK9.In Iscove ' s substratum,, and be used for MpI-X affinity post with 6 times of APK9 (135ml) dilutions.Collect unconjugated material (effluent) and before detection, be concentrated into original volume.With the material of 10ml 1M NaCl elution of bound, filter 20% gleanings thoroughly and concentrate 4 times and be used for detecting.Single culture CD34-screening cell can not develop into megalokaryocyte in substratum.Develop into megalokaryocyte/hole, 48+/-8 in 5%APK9 (with the identical gleanings that is used for post) cultured cells.10% not in the binding substance cultured cells can not develop into megalokaryocyte.Cultured cells is grown and is megalokaryocyte/hole, 120+/-44 in 10% wash-out gleanings.In detection, just can suppress the activity of loading sample column and wash-out gleanings substantially fully with 5 μ g/ml MpI-X.

＜embodiment 91 〉

With mouse or the transfection of people MpI acceptor in mouse cell line

A. mouse MpI acceptor

With total length mouse MpI receptor cdna subclone in the expression vector of the transcripting promoter that contains the LTP that derives from the Moloney murine sarcoma oncovirus.With 5 these constructs of μ g and 1 μ g selected marker plasmid pWLNeo (Stratagene) bore a hole altogether IL-3 dependency mouse cell element (32D, cline23; Greenberger et al, DNAS 80:2931-2936 (1983)) in.Cell cultures was reclaimed after 5 days, containing 800 μ g/mlGeneticin (G418, culturing cell Sigma) and in the selection substratum of 1ng/ml mouse IL-3 then.With the survival cell with each little storehouse 2 * 10 ⁵Individual cell is divided into a plurality of little storehouses, continues then to cultivate up to growing the quantity that can further analyze.Detected the situation of 6 cell mass surface expression MpI acceptors by the facs analysis that uses the anti-peptide serum of multi-clone rabbit.With anti-peptide serum as hereinbefore, select the cell mass of a FACS somatotype.Screen a cell clone of parental cell line by growth in 10%APK9 and Geneticin.Screening remained on cell among the 1ng/ml mouse IL-3 after 35 days in APK9.Carry out this work with a subclone 1A6.1.

B. people MpI acceptor

With total length people MpI receptor sequence (Vigon, I et al, DNAS 89:5640-5644 (1992)) subclone in the expression vector that contains Maloney murine sarcoma oncovirus transcripting promoter (with the identical carrier of mouse acceptor).Use CaPO ₄Mammals transfection box (Stratagene) is with packing construct (LanduN.R.Littman, D.R., J.Virology 66:5110-5113 (1992)) transfection to 3 * 10 of 6 these constructs of μ g and 6 μ g amphoteric retroviruss ⁶In 293 cells.The identical cell of transfection again after 2 days carries out once after 4 days again.That day after the last transfection is with 293 cells and IL-3 dependency mouse cell line (32D, clone23; Greenberger et al, PNAS80:2931-2936 (1983)) cultivate together.After 24 hours, rescue 32D cell and (Path-o-cyte in the BSA gradient; Mills Inc.) forms band.Expansion cell and screening growth in 20%APK9 in 1ng/ml mouse IL-3.FACS by using the anti-peptide serum of multi-clone rabbit is according to the surface expression of cell receptor and pair cell is classified.Detect with these cells subsequently.

＜embodiment 92 〉

The 1A6.1 of MpI part detects

Washing 1A6.1 cell makes it not contain IL-3 and cell is placed on be supplemented with (the 1000 cells/total col/ of 15 μ l hole) among 10% foetal calf serum (FCS), Geneticin (800 μ g/ml) and 1% penicillin/streptomycin (Gibco) the α MEM (Gibco) of Terasaki-type droplet dish with 1: 1 serial dilution given the test agent again.After 48 hours, determine viable count in every hole through microscope.1 activity unit refers to obtain in every hole the live vol of 200 viable cell.If in detection, add 5-10 μ g/ml MpI-X and can block described activity fully, the then active MpI part that is meant.In APK9, the MpI ligand activity average out to 4400+/undergrown blood plasma of-539 units/ml.Unless stated otherwise, in detecting, 1A6.1 defined the unit of MpI ligand activity.

Substantially by with finish the detection that the MpI acceptor gene cells transfected of choosing is carried out with the identical method of 1A6.1 cell.

＜embodiment 93 〉

Proof MpI-part is present in the aplastic blood plasma of serum in mouse, dog, pig and people source

The MpI part is present in the aregeneratory blood plasma of serum in mouse, dog, pig and people source (table 9).From the BDF1 mouse, collected blood plasma in back 12 days at pre-irradiation and irradiation (500 rad).Detect blood plasma in 1A6.1 detects, the result shows with MpI-X (10 μ g/ml) can suppress 2000 units/ml activity basically fully.In people's megalokaryocyte detected, the mice plasma of irradiation also was a male, and its activity is 1833 units/ml, collects blood plasma from pre-irradiation and irradiation (450 rad) the dog after 10 days.Detection of active in 1A6.1 detection and the detection of people's megalokaryocyte.In two detections, all can detect activity, and all can suppress active fully with MpI-X (10 μ g/ml).Blood plasma was collected in pre-irradiation and irradiation (650 rad) in back 10 days from pig.In 1A6.1 detection and the detection of people's megalokaryocyte, detect blood plasma.In these two detections, demonstrate MpI ligand activity (can suppress) by 10 μ g/ml MpI-X can with compare in that the blood plasma of aregeneratory dog is being seen.Obtain its serum from aplastic philtrum.From the bone marrow transplantation patient, collect this material.Detect 6 patients' serum in 1A6.1 detects, its activity is 903 units/ml, 88% being caused by MpI part (can suppress with 10 μ g/ml MpI-X) wherein.In people's megalokaryocyte detects, detect 14 aregeneratory patients' serum.As one group, they show primary activity, are 941 megalokaryocyte units/ml, and available 10 μ g/ml MpI-X are suppressed fully.Comprise that mouse IL-3 data are with explanation 1A6.1.Detection specificity.Although the growth of this reconstitution cell activator inducing cell, 10 μ g/ml MpI-X can't block it.

Table 9

Planting 1A6.1 cell detection people megalokaryocyte detects

(units per ml) (megalokaryocyte unit/ml)

Matrix+MpI-X matrix+MpI-X

Normal mouse 0+/-0 0+/0 0+/-0 0+/-0

Aregeneratory mouse 2,000 0 1833 does not do

Normal dogs 0+/-0 0+/-0 0+/-0 0+/-0

Aregeneratory dog 4400+/-539 0+/-0 792+/-128 0+/-0

Normal pig 0+/-0 0+/-0 0+/-0 0+/-0

Aregeneratory pig 3866+/-1136 0+/-0 1284+/-182 10+/-10

Normal people 0+/-0 0+/-0 0+/-0 0+/-0

Aregeneratory people 903+/-64 114+/-33 941+/-178 0+/-0

Mouse IL-3 6000+/-565 6000+/-565 are not done not do

＜embodiment 94 〉

The people TPO derivative that preparation is expressed in the E.coli system

In order to improve biological activity, stability and solubility, design several TPO derivatives and in E.coli, express.The derivative that obtains with the aminoacid sequence of aforementioned SEQ ID NO:11 comprises that Arg replaces the [Met of 1 29 Leu ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹²⁹] TPO (1-163) (being also referred to as L129R); Arg replaces the [Met of 133 His ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹³³] TPO (1-163) (being also referred to as H133R), Arg replaces the [Met of 143 Met ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹⁴³] TPO (1-163) (being also referred to as M143R), Leu replaces the [Met of 82 Gly ^-2, Lys ^-1, Ala ¹, Val ³, Leu ⁸²] TPO (1-163) (being also referred to as G82L), Leu replaces the [Met of 146 Gly ^-2, Lys ^-1, Ala ¹, Val ³, Leu ¹⁴⁶] TPO (1-163) (being also referred to as G146L), Pro replaces the [Met of 148 Ser ^-2, Lys ^-1, Ala ¹, Val ³, Pro ¹⁴⁸] TPO (1-163) (being also referred to as S148P), Arg replaces the [Met of 59 Lys ^-2, Lys ^-1, Ala ¹, Val ³, Arg ⁵⁹] TPO (1-163) (being also referred to as K59R), Arg replaces the [Met of 115 Gln ^-2, Lys ^-1, Ala ¹, Val ³, Arg ¹¹⁵] TPO (1-163) (also claiming Q115R).

In order to prepare the TPO derivative, as template, synthesize the oligo Nucleotide that following sequence is arranged with the h6T (1-163) that describes among the embodiment 42:

L129R:5 '-ATCTTCCGTTCTTTCCAGCACCT-3 ' (being used for preparing the Arg-substitutive derivative that replaces the Leu-129 of the sequence shown in the SEQ ID NO:11 by Arg);

H133R：5’-TCTTTCCAGCGTCTGCTGCGT-3’

(being used for preparing the Arg-substitutive derivative that replaces the His-133 of the sequence shown in the SEQ ID NO:11 by Arg);

M143R：5’-CGTTTCCTGCGTCTGGTTGGC-3’

(being used for preparing the Arg-substitutive derivative that replaces the Met-143 of the sequence shown in the SEQ ID NO:11 by Arg);

G82L：5’-GGCCAGCTTCTGCCGACCTGCCT-3’

(being used for preparing the Leu-substitutive derivative that replaces the Gly-82 of the sequence shown in the SEQ ID NO:11 by Leu);

G146L：5’-ATGCTGGTTCTGGGTTCTACCCT-3’

(being used for preparing the Leu-substitutive derivative that replaces the Gly-146 of the sequence shown in the SEQ ID NO:11 by Leu);

S148P：5’-GTTGGCGGTCCGACCCTGTGCG-3’

(being used for preparing the Pro-substitutive derivative that replaces the Ser-148 of the sequence shown in the SEQ ID NO:11 by Pro); With

K59R：5’-GAAGAGACCCGCGCTCAGGACATCC-3’

(being used for preparing the Arg-substitutive derivative that replaces the Lys-59 of the sequence shown in the SEQ ID NO:11 by Arg);

Q115R：5’-CTGCCGCCACGTGGCCGTACCAC-3’

(being used for preparing the Arg substitutive derivative that replaces the Gln-115 of the sequence shown in the SEQ ID NO:11 by Arg).

Make up mutant plasmid with Sculptor vitro mutagenesis box (Amersham).The XbaI-HindIII fragment that will derive from the pCFM536/h6T described in the embodiment 42 (1-163) imports with XbaI and HindIII postdigestive Bluescript II SK (-) phagemid carrier (Stratagene, CaliforniaUSA) to obtain plasmid pSKTPO, be transformed into then among the E.coli JM109.(Takara Shuzo Japan) prepares the single stranded DNA that is used for mutagenesis from pSKTPO with helper phage M13KO7.With above-mentioned oligo Nucleotide, by supplier's explanation, will suddenly change imports the TPO gene.By supplier's explanation with dna sequencing box (Applied Biosystems, USA) sequencing analysis and determined the sudden change of TPO fully.

The XbaI-HindIII fragment that will prepare from the pSKTPO of sudden change imports the pCFM536 that digests with XbaI and HindIII.The plasmid pCFM536 that carries mutator gene is transformed among the E.coli#261 to obtain expressing the transformant of TPO derivative gene.

By previous embodiment 43, cultivate E.coli#261 with the pCFM536 conversion of sudden change.The cell granulations of collection purifying body was also stored 1 day in refrigerator at least.Refrigerated cell granulations (3g) is suspended in the 30ml20mM Tris damping fluid (pH 8.5) that contains 10mM EDTA, 10mM DTT and 1mM PMSF.Suspension is placed on ice and with the interval sonic treatment of 1 minute (at least) 5 times.With 15000rpm through the cell of centrifugal collection in 10 minutes through sonic treatment.

Particle suspension in containing the 30ml10mM Tris damping fluid (pH 8.7) of 8M Guanidinium hydrochloride, 5mM EDTA, 1mM PMSF, is added 50mg DTT and makes its reduction.Stir after 1-1.5 hour, the pH of solution is transferred to 5.0, be cooled to 4 ℃ before the dilution then with the HCl of dilution.

With the 1.5L 10mMCAPS damping fluid (pH 10.5) that contains 30% glycerine, 3M urea, 3mM cystamine and 1mM L-Lys dilute sample solution and spending the night gradually.The sample stirring after at least 2 days, was removed precipitation in centrifugal 45 minutes with 8000rpm.With 6m phosphoric acid the pH of solution is transferred to 6.8, dilute 2 times then.With 2 #2 filter paper (φ=90mm, Toyo filter paper, Japan) filtering solution, go up sample then to CM-Sepharose Fast Flow post (on 2.6 * 10cm) (Pharmacia).Wash this post with the 400ml 10mM phosphate buffered saline buffer (pH6.8) that contains 15% glycerine and 1M urea, then with 10mM phosphate buffered saline buffer (pH 7.2) balance that contains 15% glycerine.With linear gradient from the 10mM phosphate buffered saline buffer (pH 7.2) that contains 15% glycerine to the same buffer that contains 0.5MNaCl with the flow velocity of 1.0ml/min elute protein from the post.Absorption value monitoring protein elutriant by 280nm; Determine to contain the fraction of TPO derivative and collect with SDS-PAGE.

After with Centriprep 10 (Amicon) TPO fraction (about 30ml) being concentrated to 2ml, by (3.9 * 150mm) reversed-phase HPLC (Waters) is further purified mutation T PO with μ Bondasphere C4 post.With linear gradient from H ₂0.05%TFA among the O is to containing 30%CH ₃The flow velocity that the 2-propyl alcohol of CN and 0.02%TFA divides with 0.5ml/ was through 40 minutes elute proteins.Under this condition, after about 30 minutes, wash-out goes out the TPO derivative.

In order to carry out biological detection, purified TPO sample was dialysed 2 times to 1L 10mM phosphate buffered saline buffer in 2 days.After being concentrated to about 0.1mg/ml with Centriprep 10 (Amicon), by aforementioned biological activity with M-07e detection system assessment derivative.Find that all mutant all have the h6T of being equal to (1-163), the activity of the reference sample of TPO (seeing Figure 33 and 34).

The preservation inventory

Escherichia?coli(pHT1-231/DH5)：

FERM BP-4564 and CCTCC-M95001

Escherichia?coli(pEF18S-A2α/DH5)：

FERM BP-4565 and CCTCC-M95002

Escherichia?coli(pHGT1/DH5)：

FERM BP-4616 and CCTCC-M95003

Escherichia?coli(pHTF1/DH5)：

FERM BP-4617 and CCTCC-M95004

Mouse-mouse hybridoma P 55:

FERM BP-4563 and CCTCC-C95001

CHO28/1/1/3-C6：

FERM BP-4988 and CCTCC-C95004

CHO163T-63-79-C1：

FERM BP-4989 and CCTCC-C95005

Sequence table

(1) general information:

(i) applicant: MIYAZAKI, Hiroshi

KATO，Takashi

OHGAMI，Kinya

IWAMATSU，Akihiro

AKAHORI，Hiromichi

KUROKI，Ryota

SHIMIZU，Toshiyuki

MUTO，Takanori

(ii) invention exercise question: have the active protein of TPO

(iii) sequence number: 197

(iv) appropriate address:

(A) addressee: Marshall, O ' Toole, Gerstein, Murray ﹠amp; Borun

(B) street: 6300 Sears Tower, 233 South Wacker Drive

(C) city: Chicago

(D) state: Illinois

(E) country: the U.S.

(F) postcode: 60606-6402

(v) computer-reader form:

(A) media type: Floppy disk

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, Version#1.25

(vi) application materials now:

(A) application number:

(B) applicant:

(C) classification number:

(vii) application materials formerly:

(A) application number: JP 39090/94

(B) applying date: 14-FEB-1994

(vii) application materials formerly:

(A) application number: JP 79842/94

(B) applying date: 25-MAR-1994

(vii) application materials formerly:

(A) application number: JP 155126/94

(B) applying date: 01-JUN-1994

(vii) application materials formerly:

(A) application number: JP 167328/94

(B) applying date: 15-JUN-1994

(vii) application materials formerly:

(A) application number: JP 227159/94

(B) applying date: 17-AUG-1994

(vii) application materials formerly:

(A) application number: JP 304167/94

(B) applying date: 01-NOV-1994

(vii) application materials formerly:

(A) application number: JP UNKNOWN

(B) applying date: 28-DEC-1994

(vii) application materials formerly:

(A) application number: JP 193169/94

(B) applying date: 17-AUG-1994

(vii) application materials formerly:

(A) application number: JP 298669/94

(B) applying date: 01-DEC-1994

(vii) application materials formerly:

(A) application number: JP 193916/94

(B) applying date: 18-AUG-1994

(vii) application materials formerly:

(A) application number: US 08/212,164

(B) applying date: 14-MAR-1994

(vii) application materials formerly:

(A) application number: US 08/221,020

(B) applying date: 01-APR-1994

(vii) application materials formerly:

(A) application number: US 08/278,083

(B) applying date: 20-JUL-1994

(vii) application materials formerly:

(A) application number: US 08/320,300

(B) applying date: 11-OCT-1994

(vii) application materials formerly:

(A) application number: US 08/361,811

(B) applying date: 22-DEC-1994

(vii) proxy/act on behalf of data:

(A) name: Borun, Michael F.

(B) registration number: 25,447

(C) document/summary number: 01017/32425

(ix) telecommunication data:

(A) phone: 312/474-6300

(B) fax: 312/474-0448

(2) data of SEQ ID NO:1:

(i) sequence signature:

(A) length: 261 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA is to mRNA

(vi) primary source:

(A) biology: Rattus norvegicus

(B) clone: McA-RH8994

(xi) sequence description: SEQ ID NO:1:

GGTGTACCTG?GGTCCTGAAG?CCCTTCTTCA?CCTGGATAGA?TTCCTTGGCC?CACCTGTCCC 60

CACCCCACTC?TGTGCAGAGG?TACAAAAGCT?CAAGCCGTCT?CCATGGCCCC?AGGAAAGATT 120

CAGGGGAGAG?GCCCCACACA?GGGAGCCACT?GCAGTCAGAC?ACCCTGGGCA?GA 172

ATG?GAG?CTG?ACT?GAT?TTG?CTC?CTG?GTG?GCC?ATA?CTT?CTC?CTC?ACC?GCA 220

Met?Glu?Leu?Thr?Asp?Leu?Leu?Leu?Val?Ala?Ile?Leu?Leu?Leu?Thr?Ala

1 5 10 15

AGA?CTA?ACT?CTG?TCC?AGC?CCA?GTT?CCT?CCC?GCC?TGT?GAC?CC 261

Arg?Leu?Thr?Leu?Ser?Ser?Pro?Val?Pro?Pro?Ala?Cys?Asp

20 25

(2) data of SEQ ID NO:2:

(i) sequence signature:

(A) length: 147 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:2:

Met?Glu?Leu?Thr?Asp?Leu?Leu?Leu?Val?Ala?Ile?Leu?Leu?Leu?Thr?Ala

-21?-20 -15 -10

Arg?Leu?Thr?Leu?Ser?Ser?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu

-5 1 5 10

Leu?Asn?Lys?Leu?Leu?Arg?Asp?Ser?Tyr?Leu?Leu?His?Ser?Arg?Leu?Ser

15 20 25

Gln?Cys?Pro?Asp?Val?Asn?Pro?Leu?Ser?Ile?Pro?Val?Leu?Leu?Pro?Ala

30 35 40

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Thr?Glu?Gln?Ser?Lys

45 50 55

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Ser?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

Ala?Ala?Arg?Gly?Gln?Leu?Glu?Pro?Ser?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Gly?Leu

95 100 105

Leu?Gly?Thr?Gln?Val?Ser?Pro?Gln?Thr?Tyr?Arg?Asn?Tyr?Pro?Leu?Thr

110 115 120

Gln?Phe?Leu

125

(2) data of SEQ ID NO:3:

(i) sequence signature:

(A) length: 580 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA is to mRNA

(vi) primary source:

(A) biology: Homo Sapiens

(F) types of organization: liver

(xi) sequence description: SEQ ID NO:3:

CTC?GTG?GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG?TCC?AGC?CCG 48

Leu?Val?Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu?Ser?Ser?Pro

1 5 10 15

GCT?CCT?CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?GAC 96

Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp

20 25 30

TCC?CAT?GTC?CTT?CAC?AGC?AGA?CTG?AGC?CAG?TGC?CCA?GAG?GTT?CAC?CCT 144

Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro

15 40 45

TTG?CCT?ACA?CCT?GTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC?TTG?GGA?GAA 192

Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu

50 55 60

TGG?AAA?ACC?CAG?ATG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT?CTG?GGA?GCA 240

Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala

65 70 75 80

GTG?ACC?CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA?CAA?CTG?GGA 288

Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly

85 90 95

CCC?ACT?TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA?CAG?GTC?CGT 336

Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg

100 105 110

CTC?CTC?CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG?NNN?NNN?NNN 384

Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Xaa?Xaa?Xaa

115 120 125

NNN?NNN?NNN?NCC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC?TTC?CTG?AGC 432

Xaa?Xaa?Xaa?Xaa?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser

130 135 140

TTC?CAA?CAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG?CTT?GTA?GGA 480

Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly

145 150 155 160

GGG?TCC?ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA?GCT?GTC?CCC 528

Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro

165 170 175

AGC?AGA?ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA?AAC?AGG?ACT 576

Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn?Arg?Thr

180 185 190

TCT?G 580

Ser

(2) data of SEQ ID NO:4:

(i) sequence signature:

(A) length: 253 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:4:

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val?Val?Met?Leu?Leu?Leu?Thr?Ala

-21?-20 -15 -10

Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val

-5 1 5 10

Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser

15 20 25

Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala

30 35 40

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys

45 50 55

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu

95 100 105

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp

110 115 120

Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val

125 130 135

Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala

140 145 150 155

Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu

160 165 170

Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr

175 180 185

Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly

190 195 200

Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu

205 210 215

Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu

220 225 230

(2) data of SEQ ID NO:5:

(i) sequence signature:

(A) length: 576 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA is to mRNA

(vi) primary source:

(A) biology: Homo Sapiens

(F) types of organization: liver

(xi) sequence description: SEQ ID NO:5:

AG?GGA?TTC?AGA?GCC?AAG?ATT?CCT?GGT?CTG?CTG?AAC?CAA?ACC?TCC?AGG 47

Gly?Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg

1 5 10 15

TCC?CTG?GAC?CAA?ATC?CCC?GGA?TAC?CTG?AAC?AGG?ATA?CAC?GAA?CTC?TTG 95

Ser?Leu?Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu

20 25 30

AAT?GGA?ACT?CGT?GGA?CTC?TTT?CCT?GGA?CCC?TCA?CGC?AGG?ACC?CTA?GGA 143

Asn?Gly?Thr?Arg?Gly?Leu?Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly

35 40 45

GCC?CCG?GAC?ATT?TCC?TCA?GGA?ACA?TCA?GAC?ACA?GGC?TCC?CTG?CCA?CCC 191

Ala?Pro?Asp?Ile?Ser?Ser?Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro

50 55 60

AAC?CTC?CAG?CCT?GGA?TAT?TCT?CCT?TCC?CCA?ACC?CAT?CCT?CCT?ACT?GGA 239

Asn?Leu?Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly

65 70 75

CAG?TAT?ACG?CTC?TTC?CCT?CTT?CCA?CCC?ACC?TTG?CCC?ACC?CCT?GTG?GTC 287

Gln?Tyr?Thr?Leu?Phe?Pro?Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val

80 85 90 95

CAG?CTC?CAC?CCC?CTG?CTT?CCT?GAC?CCT?TCT?GCT?CCA?ACG?CCC?ACC?CCT 335

Gln?Leu?His?Pro?Leu?Leu?Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro

100 105 110

ACC?AGC?CCT?CTT?CTA?AAC?ACA?TCC?TAC?ACC?CAC?TCC?CAG?AAT?CTG?TCT 383

Thr?Ser?Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser

115 120 125

CAG?GAA?GGG?TAAGGTTCTC?AGACACTGCC?GACATCAGCA?TTGTCTCATG 432

Gln?Glu?Gly

130

TACAGCTCCC?TTCCCTCCAG?GGCGCCCCTG?GGAGACAACT?GGACAAGATT?TCCTACTTTC 492

TCCTGAAACC?CAAAGCCCTG?GTAAAAGGGA?TACACAGGAC?TGAAAAGGGA?ATCATTTTTC 552

ACTGTACATT?ATAAACCTTC?AGAA 576

(2) data of SEQ ID NO:6:

(i) sequence signature:

(A) length: 353 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:6:

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val?Val?Met?Leu?Leu?Leu?Thr?Ala

-21?-20 -15 -10

Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val

-5 1 5 10

Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser

15 20 25

Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala

30 35 40

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys

45 50 55

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu

95 100 105

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp

110 115 120

Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val

125 130 135

Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala

140 145 150 155

Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu

160 165 170

Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr

175 180 185

Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly

190 195 200

Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu

205 210 215

Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly

220 225 230 235

Thr?Arg?Gly?Leu?Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro

240 245 250

Asp?Ile?Ser?Ser?Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu

255 260 265

Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr

270 275 280

Thr?Leu?Phe?Pro?Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu

285 290 295

His?Pro?Leu?Leu?Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser

300 305 310 315

Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu

320 325 330

Gly

(2) data of SEQ ID NO:7:

(i) sequence signature:

(A) length: 1721 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA is to mRNA

(vi) primary source:

(A) biology: Homo Sapiens

(F) types of organization: liver

(xi) sequence description: SEQ ID NO:7:

GCGGCACGAG?GGGGGTGTCT?GGCTGGCGTG?GCTCCCTGTT?TGGGGCCTCT?CCCCTGAATC 60

CTTCCTGGGG?CCATGGAGGC?CAGACAGACA?CCCCGGCCAG?A?ATG?GAG?CTG?ACT 113

Mer?Glu?Leu?Thr

-21?-20

GAA?TTG?CTC?CTC?GTG?GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG 161

Glu?Leu?Leu?Leu?Val?Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu

-15 -10 -5

TCC?AGC?CCG?GCT?CCT?CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG 209

Ser?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu

1 5 10 15

CTT?CGT?GAC?TCC?CAT?GTC?CTT?CAC?AGC?AGA?CTG?AGC?CAG?TGC?CCA?GAG 257

Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu

20 25 30

GTT?CAC?CCT?TTG?CCT?ACA?CCT?GTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC 305

Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser

35 40 45

TTG?GGA?GAA?TGG?AAA?ACC?CAG?ATG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT 353

Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile

50 55 60

CTG?GGA?GCA?GTG?ACC?CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA 401

Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Mer?Ala?Ala?Arg?Gly

65 70 75

CAA?CTG?GGA?CCC?ACT?TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA 449

Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly

80 85 90 95

CAG?GTC?CGT?CTC?CTC?CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG 497

Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln

100 105 110

CTT?CCT?CCA?CAG?GGC?AGG?ACC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC 545

Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile

115 120 125

TTC?CTG?AGC?TTC?CAA?CAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG 593

Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met

130 135 140

CTT?GTA?GGA?GGG?TCC?ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA 641

Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr

145 150 155

GCT?GTC?CCC?AGC?AGA?ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA 689

Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro

160 165 170 175

AAC?AGG?ACT?TCT?GGA?TTG?TTG?GAG?ACA?AAC?TTC?ACT?GCC?TCA?GCC?AGA 737

Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg

180 185 190

ACA?ACT?GGC?TCT?GGG?CTT?CTG?AAG?TGG?CAG?CAG?GGA?TTC?AGA?GCC?AAG 785

Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys

195 200 205

ATT?CCT?GGT?CTG?CTG?AAC?CAA?ACC?TCC?AGG?TCC?CTG?GAC?CAA?ATC?CCC 833

Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro

210 215 220

GGA?TAC?CTG?AAC?AGG?ATA?CAC?GAA?CTC?TTG?AAT?GGA?ACT?CGT?GGA?CTC 881

Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu

225 230 235

TTT?CCT?GGA?CCC?TCA?CGC?AGG?ACC?CTA?GGA?GCC?CCG?GAC?ATT?TCC?TCA 929

Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser

240 245 250 255

GGA?ACA?TCA?GAC?ACA?GGC?TCC?CTG?CCA?CCC?AAC?CTC?CAG?CCT?GGA?TAT 977

Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr

260 265 270

TCT?CCT?TCC?CCA?ACC?CAT?CCT?CCT?ACT?GGA?CAG?TAT?ACG?CTC?TTC?CCT 1025

Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro

275 280 285

CTT?CCA?CCC?ACC?TTG?CCC?ACC?CCT?GTG?GTC?CAG?CTC?CAC?CCC?CTG?CTT 1073

Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu

290 295 300

CCT?GAC?CCT?TCT?GCT?CCA?ACG?CCC?ACC?CCT?ACC?AGC?CCT?CTT?CTA?AAC 1121

Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn

305 310 315

ACA?TCC?TAC?ACC?CAC?TCC?CAG?AAT?CTG?TCT?CAG?GAA?GGG?TAAGGTTCTC 1170

Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

320 325 330

AGACACTGCC?GACATCAGCA?TTGTCTCGTG?TACAGCTCCC?TTCCCTGCAG?GGCGCCCCTG 1230

GGAGACAACT?GGACAAGATT?TCCTACTTTC?TCCTGAAACC?CAAAGCCCTG?GTAAAAGGGA 1290

TACACAGGAC?TGAAAAGGGA?ATCATTTTTC?ACTGTACATT?ATAAACCTTC?AGAAGCTATT 1350

TTTTTAAGCT?ATCAGCAATA?CTCATCAGAG?CAGCTAGCTC?TTTGGTCTAT?TTTCTGCAGA 1410

AATTTGCAAC?TCACTGATTC?TCTACATGCT?CTTTTTCTGT?GATAACTCTG?CAAAGGCCTG 1470

GGCTGGCCTG?GCAGTTGAAC?AGAGGGAGAG?ACTAACCTTG?AGTCAGAAAA?CAGAGAAAGG 1530

GTAATTTCCT?TTGCTTCAAA?TTCAAGGCCT?TCCAACGCCC?CCATCCCCTT?TACTATCATT 1590

CTCAGTGGGA?CTCTGATCCC?ATATTCTTAA?CAGATCTTTA?CTCTTGAGAA?ATGAATAAGC 1650

TTTCTCTCAG?AAATGCTGTC?CCTATACACT?AGACAAAACT?GAAAAAAAAA?AAAAAAAAAA 1710

AAAAAAAAAA?A 1721

(2) data of SEQ ID NO:8:

(i) sequence signature:

(A) length: 4506 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: genomic dna

(vi) primary source:

(A) biology: Homo Sapiens

(C) types of organization: peripheral leukocytes

(xi) sequence description: SEQ ID NO:8:

GAATTCAGGG?CTTTGGCAGT?TCCAGGCTGG?TCAGCATCTC?AAGCCCTCCC?CAGCATCTGT 60

TCACCCTGCC?AGGCAGTCTC?TTCCTAGAAA?CTTGGTTAAA?TGTTCACTCT?TCTTGCTACT 120

TTCAGGATAG?ATTCCTCACC?CTTGGCCCGC?CTTTGCCCCA?CCCTACTCTG?CCCAGAAGTG 180

CAAGAGCCTA?AGCCGCCTCC?ATGGCCCCAG?GAAGGATTCA?GGGGAGAGGC?CCCAAACAGG 240

GAGCCACGCC?AGCCAGACAC?CCCGGCCAGA?ATG?GAG?CTG?ACT G?GTGAGAACAC 293

Met?Glu?Leu?Thr

-21?-20

ACCTGAGGGG?CTAGGGCCAT?ATGGAAACAT?GACAGAAGGG?GAGAGAGAAA?GGAGACACGC 353

TGCAGGGGGC?AGGAAGCTGG?GGGAACCCAT?TCTCCCAAAA?ATAAGGGGTC?TGAGGGGTGG 413

ATTCCCTGGG?TTTCAGGTCT?GGGTCCTGAA?TGGGAATTCC?TGGAATACCA?GCTGACAATG 473

ATTTCCTCCT?CATCTTTCAA?CCTCACCTCT?CCTCATCTAA?G AA?TTG?CTC?CTC 525

Glu?Leu?Leu?Leu

-15

GTG?GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG?TCC?AGC?CCG?GCT 573

Val?Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala

-10 -5 1

CCT?CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?CAC?TCC 621

Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser

5 10 15

CAT?GTC?CTT?CAC?AGC?AGA?CTG?GTGAGAACTC?CCAACATTAT?CCCCTTTATC 672

His?Val?Leu?His?Ser?Arg?Leu

20 25

CGCGTAACTG?GTAAGACACC?CATACTCCCA?GGAAGACACC?ATCACTTCCT?CTAACTCCTT 732

GACCCAATGA?CTATTCTTCC?CATATTGTCC?CCACCTACTG?ATCACACTCT?CTGACAAGGA 792

TTATTCTTCA?CAATACAGCC?CCCATTTAAA?AGCTCTCGTC?TAGAGATAGT?ACTCATGGAG 852

GACTAGCCTG?CTTATTAGGC?TACCATAGCT?CTCTCTATTT?CAGCTCCCTT?CTCCCCCCAC 912

CAATCTTTTT?CAACAG?AGC?CAG?TGC?CCA?GAG?GTT?CAC?CCT?TTG?CCT?ACA 961

Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr

30 35

CCT?GTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC?TTG?GGA?GAA?TGG?AAA?ACC 1009

Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr

40 45 50

CAG?ATG?GTAAGAAAGC?CATCCCTAAC?CTTGGCTTCC?CTAAGTCCTG?TCTTCAGTTT 1065

Gln?Met

55

CCCACTGCTT?CCCATGGATT?CTCCAACATT?CTTGAGCTTT?TTAAAAATAT?CTCACCTTCA 1125

GCTTGGCCAC?CCTAACCCAA?TCTACATTCA?CCTATGATGA?TAGCCTGTGG?ATAAGATGAT 1185

GGCTTGCAGG?TCCAATATGT?GAATAGATTT?GAAGCTGAAC?ACCATGAAAA?GCTGGAGAGA 1245

AATCGCTCAT?GGCCATGCCT?TTGACCTATT?CCTGTTCAGT?CTTCTTAAAT?TGGCATGAAG 1305

AAGCAAGACT?CATATGTCAT?CCACAGATGA?CACAAAGCTG?GGAAGTACCA?CTAAAATAAC 1365

AAAAGACTGA?ATCAAGATTC?AAATCACTGA?AAGACTAGGT?CAAAAACAAG?GTGAAACAAC 1425

AGAGATATAA?ACTTCTACAT?GTGGGCCGGG?GGCTCACGCC?TGTAATCCCA?GCACTTTGGG 1485

AGGCCGAGGC?AGGCAGATCA?CCTGAGGGCA?GGAGTTTGAG?AGCAGCCTGG?CCAACATGGC 1545

GAAACCCCGT?CTCTACTAAG?AATACAAAAT?TAGCCGGGCA?TGGTAGTGCA?TGCCTGTAAT 1605

CCCAGCTACT?TGGAAGGCTG?AAGCAGGAGA?ATCCCTTGAA?CCCAGGAGGT?GGAGGTTGTA 1665

GTGAGCTGAG?ATCATGCCAA?TGCACTCCAG?CCTGGGTGAC?AAGAGCAAAA?CTCCGTCTCA 1725

AAAAGAAAAA?AAAATTCTAC?ATGTGTAAAT?TAATGAGTAA?AGTCCTATTC?CAGCTTTCAG 1785

GCCACAATGC?CCTGCTTCCA?TCATTTAAGC?CTCTGGCCCT?AGCACTTCCT?ACGAAAAGGA 1845

TCTGAGAGAA?TTAAATTGCC?CCCAAACTTA?CCATGTAACA?TTACTGAAGC?TGCTATTCTT 1905

AAAGCTAGTA?ATTCTTGTCT?GTTTGATGTT?TAGCATCCCC?ATTGTGGAAA?TGCTCGTACA 1965

GAACTCTATT?CCGAGTGGAC?TACACTTAAA?TATACTGGCC?TGAACACCGG?ACATCCCCCT 2025

GAAGACATAT?GCTAATTTAT?TAAGAGGGAC?CATATTAAAC?TAACATGTGT?CTAGAAAGCA 2085

GCAGCCTGAA?CAGAAAGAGA?CTAGAAGCAT?GTTTTATGGG?CAATAGTTTA?AAAAACTAAA 2145

ATCTATCCTC?AAGAACCCTA?GCGTCCCTTC?TTCCTTCAGG?ACTGAGTCAG?GGAAGAAGGG 2205

CAGTTCCTAT?GGGTCCCTTC?TAGTCCTTTC?TTTTCATCCT?TATGATCATT?ATGGTAGAGT 2265

CTCATACCTA?CATTTAGTTT?ATTTATTATT?ATTATTTGAG?ACGGAGTCTC?ACTGTATCCC 2325

CCAGGCTGGA?GTGCAGTGGC?ATGATCTCAA?CTCACTGCAA?CCTCAGCCTC?CCGGATTCAA 2385

GCGATTCTCC?TGCCTCAGTC?TCCCAAGTAG?CTGGGATTAC?AGGTGCCCAC?CGCCATGCCC 2445

AGCTAATTTT?TGTATTTTTG?GTAGAGATGG?GGTTTCACCA?TGTTGGCCAG?GCTGATCTTG 2505

AACTCCTGAC?CTCAGGTGAT?CCACCTGCCT?CAGCCTCCCA?AAGTGCTGGG?ATTACAGGCG 2565

TGAGCCACTG?CACCCAGCCT?TCATTCAGTT?TAAAAATCAA?ATGATCCTAA?GGTTTTGCAG 2625

CAGAAAGAGT?AAATTTGCAG?CACTAGAACC?AAGAGGTAAA?AGCTGTAACA?GGGCAGATTT 2685

CAGCAACGTA?AGAAAAAAGG?AGCTCTTCTC?ACTGAAACCA?AGTGTAAGAC?CAGGCTGGAC 2745

TAGAGGACAC?GGGAGTTTTT?GAAGCAGAGG?CTGATGACCA?GCTGTCGGGA?GACTGTGAAG 2805

GAATTCCTGC?CCTGGGTGGG?ACCTTGGTCC?TGTCCAGTTC?TCAGCCTGTA?TGATTCACTC 2865

TGCTGGCTAC?TCCTAAGGCT?CCCCACCCGC?TTTTAGTGTG?CCCTTTGAGG?CAGTGCGCTT 2925

CTCTCTTCCA?TCTCTTTCTC?AG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT?CTG?GGA 2977

Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly

60 65

GCA?GTG?ACC?CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA?CAA?CTG 3025

Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu

70 75 80

GGA?CCC?ACT?TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA?CAG?GTC 3073

Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val

85 90 95

CGT?CTC?CTC?CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG 3115

Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln

100 105 110

GTAAGTCCCC?AGTCAAGGGA?TCTGTAGAAA?CTGTTCTTTT?CTGACTCAGT?CCCCCTAGAA 3175

GACCTGAGGG?AAGAAGGGCT?CTTCCAGGGA?GCTCAAGGGC?AGAAGAGCTG?ATCTACTAAG 3235

AGTGCTCCCT?GCCAGCCACA?ATGCCTGGGT?ACTGGCATCC?TGTCTTTCCT?ACTTAGACAA 3295

GGGAGGCCTG?AGATCTGGCC?CTCGTGTTTG?GCCTCAGGAC?CATCCTCTGC?CCTCAG 3351

CTT?CCT?CCA?CAG?GGC?AGG?ACC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC 3399

Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile

115 120 125

TTC?CTG?AGC?TTC?CAA?CAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG 3447

Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met

130 135 140

CTT?GTA?GGA?GGG?TCC?ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA 3495

Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr

145 150 155

GCT?GTC?CCC?AGC?AGA?ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA 3543

Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro

160 165 170 175

AAC?AGG?ACT?TCT?GGA?TTG?TTG?GAG?ACA?AAC?TTC?ACT?GCC?TCA?GCC?AGA 3591

Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg

180 185 190

ACT?ACT?GGC?TCT?GGG?CTT?CTG?AAG?TGG?CAG?CAG?GGA?TTC?AGA?GCC?AAG 3639

Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys

195 200 205

ATT?CCT?GGT?CTG?CTG?AAC?CAA?ACC?TCC?AGG?TCC?CTG?GAC?CAA?ATC?CCC 3687

Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro

210 215 220

GGA?TAC?CTG?AAC?AGG?ATA?CAC?GAA?CTC?TTG?AAT?GGA?ACT?CGT?GGA?CTC 3735

Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu

225 230 235

TTT?CCT?GGA?CCC?TCA?CGC?AGG?ACC?CTA?GGA?GCC?CCG?GAC?ATT?TCC?TCA 3783

Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser

240 245 250 255

GGA?ACA?TCA?GAC?ACA?GGC?TCC?CTG?CCA?CCC?AAC?CTC?CAG?CCT?GGA?TAT 3831

Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr

260 265 270

TCT?CCT?TCC?CCA?ACC?CAT?CCT?CCT?ACT?GGA?CAG?TAT?ACG?CTC?TTC?CCT 3879

Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro

275 280 285

CTT?CCA?CCC?ACC?TTG?CCC?ACC?CCT?GTG?GTC?CAG?CTC?CAC?CCC?CTG?CTT 3927

Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu

290 295 300

CCT?GAC?CCT?TCT?GCT?CCA?ACG?CCC?ACC?CCT?ACC?AGC?CCT?CTT?CTA?AAC 3975

Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn

305 310 315

ACA?TCC?TAC?ACC?CAC?TCC?CAG?AAT?CTG?TCT?CAG?GAA?GGG?TAAGGTTCTC 4024

Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

320 325 330

AGACACTGCC?GACATCAGCA?TTGTCTCATG?TACAGCTCCC?TTCCCTGCAG?GGCGCCCCTG 4084

GGAGACAACT?GGACAAGATT?TCCTACTTTC?TCCTGAAACC?CAAAGCCCTG?GTAAAAGGGA 4144

TACACAGGAC?TGAAAAGGGA?ATCATTTTTC?ACTGTACATT?ATAAACCTTC?AGAAGCTATT 4204

TTTTTAAGCT?ATCAGCAATA?CTCATCAGAG?CAGCTAGCTC?TTTGGTCTAT?TTTCTGCAGA 4264

AATTTGCAAC?TCACTGATTC?TCTACATGCT?CTTTTTCTGT?GATAACTCTG?CAAAGGCCTG 4324

GGCTGGCCTG?GCAGTTGAAC?AGAGGGAGAG?ACTAACCTTG?AGTCAGAAAA?CAGAGAAAGG 4384

GTAATTTCCT?TTGCTTCAAA?TTCAAGGCCT?TCCAACGCCC?CCATCCCCTT?TACTATCATT 4444

CTCAGTGGGA?CTCTGATCCC?ATATTCTTAA?CAGATCTTTA?CTCTTGAGAA?ATGAATAAGC 4504

TT 4506

(2) data of SEQ ID NO:9:

(i) sequence signature:

(A) length: 416 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: synthetic DNA

(xi) sequence description: SEQ ID NO:9:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAGCCCGGCT?CCGCCAGCTT?GTGACCTTCG 60

TGTTCTGTCT?AAACTGCTTC?GCGACTCTCA?CGTGCTGCAC?TCTCGTCTGT?CCCAGTGCCC 120

GGAAGTTCAC?CCGCTGCCGA?CCCCGGTTCT?GCTTCCGGCT?GTCGACTTCT?CCCTGGGTGA 180

ATGGAAAACC?CAGATGGAAG?AGACCAAAGC?TCAGGACATC?CTGGGTGCAG?TAACTCTGCT 240

TCTGGAAGGC?GTTATGGCTG?CACGTGGCCA?GCTTGGCCCG?ACCTGCCTGT?CTTCCCTGCT 300

TGGCCAGCTG?TCTGGCCAGG?TTCGTCTGCT?GCTCGGCGCT?CTGCAGTCTC?TGCTTGGCAC 360

CCAGCTGCCG?CCACAGGGCC?GTACCACTGC?TCACAAGGAT?CCGAACGCTA?TCTTCC 416

(2) data of SEQ ID NO:10:

(i) sequence signature:

(A) length: 179 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: protein

(xi) sequence description: SEQ ID NO:10:

Leu?Val?Pro?Arg?Gly?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val

-5 1 5 10

Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser

15 20 25

Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala

30 35 40

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys

45 50 55

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu

95 100 105

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp

110 115 120

Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val

125 130 135

Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala

140 145 150 155

Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu

160 165 170

Asn?Glu?Leu

(2) data of SEQ ID NO:11:

(i) sequence signature:

(A) length: 535 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: synthetic DNA

(vi) primary source:

(A) biology: Homo Sapieng

(xi) sequence description: SEQ ID NO:11:

CTAGAAAAAA?CCAAGGAGGT?AATAAATA?ATG?AAA?GCA?CCT?GTA?CCA?CCT?GCA 52

Met?Lys?Ala?Pro?Val?Pro?Pro?Ala

-2 1 5

TGT?GAT?TTA?CGG?GTC?CTG?TCT?AAA?CTG?CTG?CGC?GAC?TCT?CAC?GTG?CTG 100

Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu

10 15 20

CAC?TCT?CGT?CTG?TCC?CAG?TGC?CCG?GAA?GTT?CAC?CCG?CTG?CCG?ACC?CCG 148

His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro

25 30 35

GTT?CTG?CTT?CCG?GCT?GTC?GAC?TTC?TCC?CTG?GGT?GAA?TGG?AAA?ACC?CAG 196

Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln

40 45 50

ATG?GAA?GAG?ACC?AAA?GCT?CAG?GAC?ATC?CTG?GGT?GCA?GTA?ACT?CTG?CTT 244

Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu

55 60 65 70

CTG?GAA?GGC?GTT?ATG?GCT?GCA?CGT?GGC?CAG?CTT?GGC?CCG?ACC?TGC?CTG 292

Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu

75 80 85

TCT?TCC?CTG?CTT?GGC?CAG?CTG?TCT?GGC?CAG?GTT?CGT?CTG?CTG?CTC?GGC 340

Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly

90 95 100

GCT?CTG?CAG?TCT?CTG?CTT?GGC?ACC?CAG?CTG?CCG?CCA?CAG?GGC?CGT?ACC 388

Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr

105 110 115

ACT?GCT?CAC?AAG?GAT?CCG?AAC?GCT?ATC?TTC?CTG?TCT?TTC?CAG?CAC?CTG 436

Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu

120 125 130

CTG?CGT?GGC?AAA?GTT?CGT?TTC?CTG?ATG?CTG?GTT?GGC?GGT?TCT?ACC?CTG 484

Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu

135 140 145 150

TGC?GTT?CGT?CGG?GCG?CCG?CCA?ACC?ACT?GCT?GTT?CCG?TCT?TAATGAAAGC 533

Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser

155 160

TT 535

(2) data of SEQ ID NO:12:

(i) sequence signature:

(A) length: 535 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: synthetic DNA

(vi) primary source:

(A) biology: Homo Sapieng

(xi) sequence description: SEQ ID NO:12:

CTAGAAAAAA?CCAAGGAGGT?AATAAATA?ATG?AAA?TCT?CCT?GCA?CCA?CCT?GCA 52

Met?Lys?Ser?Pro?Ala?Pro?Pro?Ala

-2 1 5

TGT?GAT?TTA?CGG?GTC?CTG?TCT?AAA?CTG?CTG?CGC?GAC?TCT?CAC?GTG?CTG 100

Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu

10 15 20

CAC?TCT?CGT?CTG?TCC?CAG?TGC?CCG?GAA?GTT?CAC?CCG?CTG?CCG?ACC?CCG 148

His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro

25 30 35

GTT?CTG?CTT?CCG?GCT?GTC?GAC?TTC?TCC?CTG?GGT?GAA?TGG?AAA?ACC?CAG 196

Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln

40 45 50

ATG?GAA?GAG?ACC?AAA?GCT?CAG?GAC?ATC?CTG?GGT?GCA?GTA?ACT?CTG?CTT 244

Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu

55 60 65 70

CTG?GAA?GGC?GTT?ATG?GCT?GCA?CGT?GGC?CAG?CTT?GGC?CCG?ACC?TGC?CTG 292

Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu

75 80 85

TCT?TCC?CTG?CTT?GGC?CAG?CTG?TCT?GGC?CAG?GTT?CGT?CTG?CTG?CTC?GGC 340

Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly

90 95 100

GCT?CTG?CAG?TCT?CTG?CTT?GGC?ACC?CAG?CTG?CCG?CCA?CAG?GGC?CGT?ACC 388

Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr

105 110 115

ACT?GCT?CAC?AAG?GAT?CCG?AAC?GCT?ATC?TTC?CTG?TCT?TTC?CAG?CAC?CTG 436

Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu

120 125 130

CTG?CGT?GGC?AAA?GTT?CGT?TTC?CTG?ATG?CTG?GTT?GGC?GGT?TCT?ACC?CTG 484

Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu

135 140 145 150

TGC?GTT?CGT?CGG?GCG?CCG?CCA?ACC?ACT?GCT?GTT?CCG?TCT?TAATGAAAGC 533

Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser

155 160

TT 535

(2) data of SEQ ID NO:13:

(i) sequence signature:

(A) length: 555 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA is to mRNA

(vi) primary source:

(A) biology: Homo Sapiens

(F) types of organization: liver

(xi) sequence description: SEQ ID NO:13:

ATG?GAG?CTG?ACT?GAA?TTG?CTC?CTC?GTG?GTC?ATG?CTT?CTC?CTA?ACT?GCA 48

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val?Val?Met?Leu?Leu?Leu?Thr?Ala

-21?-20 -15 -10

AGG?CTA?ACG?CTG?TCC?AGC?CCG?GCT?CCT?CCT?GCT?TGT?GAC?CTC?CGA?GTC 96

Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val

-5 1 5 10

CTC?AGT?AAA?CTG?CTT?CGT?GAC?TCC?CAT?GTC?CTT?CAC?AGC?AGA?CTG?AGC 144

Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser

15 20 25

CAG?TGC?CCA?GAG?GTT?CAC?CCT?TTG?CCT?ACA?CCT?GTC?CTG?CTG?CCT?GCT 192

Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala

30 35 40

GTG?GAC?TTT?AGC?TTG?GGA?GAA?TGG?AAA?ACC?CAG?ATG?GAG?GAG?ACC?AAG 240

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys

45 50 55

GCA?CAG?GAC?ATT?CTG?GGA?CCA?GTG?ACC?CTT?CTG?CTG?GAG?GGA?GTG?ATG 288

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

GCA?GCA?CGG?GGA?CAA?CTG?GGA?CCC?ACT?TGC?CTC?TCA?TCC?CTC?CTG?GGG 336

Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

CAG?CTT?TCT?GGA?CAG?GTC?CGT?CTC?CTC?CTT?GGG?GCC?CTG?CAG?AGC?CTC 384

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu

95 100 105

CTT?GGA?ACC?CAG?CTT?CCT?CCA?CAG?GGC?AGG?ACC?ACA?GCT?CAC?AAG?GAT 432

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp

110 115 120

CCC?AAT?GCC?ATC?TTC?CTG?AGC?TTC?CAA?CAC?CTG?CTC?CGA?GGA?AAG?GTG 480

Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val

125 130 135

CGT?TTC?CTG?ATG?CTT?GTA?GGA?GGG?TCC?ACC?CTC?TGC?GTC?AGG?CGG?GCC 528

Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala

140 145 150 155

CCA?CCC?ACC?ACA?GCT?GTC?CCC?AGC?TGA 555

Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser

160

(2) data of SEQ ID NO:14:

(i) sequence signature:

(A) length: 1043 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: synthetic DNA

(vi) primary source:

(A) biology: Homo Sapiens

(xi) sequence description: SEQ ID NO:14:

CTAGAAAAAA?CCAAGGAGGT?AATAAATA?ATG?AAA?AGT?CCT?GCA?CCA?CCT?GCA 52

Met?Lys?Ser?Pro?Ala?Pro?Pro?Ala

-2 1 5

TGT?GAT?TTA?CGG?GTC?CTG?TCT?AAA?CTG?CTG?CGC?GAC?TCT?CAC?GTG?CTG 100

Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu

10 15 20

CAC?TCT?CGT?CTG?TCC?CAG?TGC?CCG?GAA?GTT?CAC?CCG?CTG?CCG?ACC?CCG 145

His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro

25 30 35

GTT?CTG?CTT?CCG?GCT?GTC?GAC?TTC?TCC?CTG?GGT?GAA?TGG?AAA?ACC?CAG 196

Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln

40 45 50

ATG?GAA?GAG?ACC?AAA?GCT?CAG?GAC?ATC?CTG?GGT?GCA?GTA?ACT?CTG?CTT 244

Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu

55 60 65 70

CTG?GAA?GGC?GTT?ATG?GCT?GCA?CGT?GGC?CAG?CTT?GGC?CCG?ACC?TGC?CTG 292

Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu

75 80 85

TCT?TCC?CTG?CTT?GCC?CAG?CTG?TCT?GGC?CAG?GTT?CGT?CTG?CTG?CTC?GGC 340

Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly

90 95 100

GCT?CTG?CAG?TCT?CTG?CTT?GGC?ACC?CAG?CTG?CCG?CCA?CAG?GGC?GGT?ACC 388

Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr

105 110 115

ACT?GCT?CAC?AAG?GAT?CCG?AAC?GCT?ATC?TTC?CTG?TCT?TTC?CAG?CAC?CTG 436

Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu

120 125 130

CTG?CGT?GGC?AAA?GTT?CGT?TTC?CTG?ATG?CTG?GTT?GGC?GGT?TCT?ACC?CTG 484

Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu

135 140 145 150

TGC?GTT?CGT?CGG?GCG?CCG?CCA?ACC?ACT?GCT?GTT?CCG?TCT?CGT?ACC?TCT 532

Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser

155 160 165

CTG?GTT?CTG?ACC?CTG?AAC?GAG?CTC?CCG?AAC?CGT?ACC?AGC?GGC?CTG?CTG 580

Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu

170 175 180

GAA?ACC?AAC?TTT?ACC?GCG?AGC?GCG?CGT?ACC?ACC?GGC?AGC?GGC?CTG?CTG 628

Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly?Leu?Leu

185 190 195

AAA?TGG?CAG?CAG?GGC?TTT?CGT?GCG?AAA?ATC?CCG?GGC?CTG?CTG?AAC?CAG 676

Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln

200 205 210

ACC?AGC?CGT?AGC?CTG?GAT?CAG?ATC?CCG?GGC?TAT?CTG?AAC?CGT?ATC?CAT 724

Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His

215 220 225 230

GAA?CTG?CTG?AAC?GGC?ACC?CGT?GGC?CTG?TTT?CCG?GGC?CCG?AGC?CGT?CGC 772

Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu?Phe?Pro?Gly?Pro?Ser?Arg?Arg

235 240 245

ACC?CTG?GGC?GCG?CCG?GAT?ATC?AGC?TCT?GGC?ACC?AGC?GAT?ACC?GGC?AGC 820

Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser?Gly?Thr?Ser?Asp?Thr?Gly?Ser

250 255 260

CTG?CCG?CCG?AAC?CTG?CAG?CCG?GGC?TAT?AGC?CCG?AGC?CCG?ACC?CAT?CCG 858

Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro

265 270 275

CCG?ACC?GGC?CAG?TAT?ACC?CTG?TTT?CCG?CTG?CCG?CCG?ACC?CTG?CCG?ACC 916

Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro?Leu?Pro?Pro?Thr?Leu?Pro?Thr

290 295 290

CCG?GTG?GTT?CAG?CTG?CAT?CCG?CTG?CTG?CCG?GAT?CCG?AGC?GCG?CCG?ACC 964

Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu?Pro?Asp?Pro?Ser?Ala?Pro?Thr

295 300 305 310

CCG?ACC?CCG?ACC?AGC?CCG?CTG?CTG?AAC?ACC?AGC?TAT?ACC?CAT?AGC?CAG 1012

Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln

315 320 325

AAC?CTG?AGC?CAG?GAA?GGC?TAATGAAGCT?TGA 1043

Asn?Leu?Ser?Gln?Glu?Gly

330

(2) data of SEQ ID NO:15:

(i) sequence signature:

(A) length: 45 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:15:

AACTGGAAGA?ATTCGCGGCC?GCAGGAATTT?TTTTTTTTTT?TTTTT 45

(2) data of SEQ ID NO:16:

(i) sequence signature:

(A) length: 13 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:16:

AATTCGGCAC?GAG 13

(2) data of SEQ ID NO:17:

(i) sequence signature:

(A) length: 9 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:17:

CTCGTGCCG 9

(2) data of SEQ ID NO:18:

(i) sequence signature:

(A) length: 12 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:18:

Ile?pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu

1 5 10

(2) data of SEQ ID NO:19:

(i) sequence signature:

(A) length: 12 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:19:

Thr?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu

1 5 10

(2) data of SEQ ID NO:20:

(i) sequence signature:

(A) length: 12 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:20:

Ser?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu

1 5 10

(2) data of SEQ ID NO:21:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(ix) feature:

(A) title/keyword: modification _ base

(B) position: 12﹠amp; 15

(D) other data :/modify _ base=i

(xi) sequence description: SEQ ID NO:21:

ACGCTGGGGG?CNGANGA 17

(2) data of SEQ ID NO:22:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(ix) feature:

(A) title/keyword: modification _ base

(B) position: 12﹠amp; 15

(D) other data :/modify _ base=i

(xi) sequence description: SEQ ID NO:22:

ACACTAGGAT?CNAANAA 17

(2) data of SEQ ID NO:23:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(ix) feature:

(A) title/keyword: modification _ base

(B) position: 12﹠amp; 15

(D) other data :/modify _ base=i

(xi) sequence description: SEQ ID NO:23:

ACGCTGGGTG?CNGANGA 17

(2) data of SEQ ID NO:24:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(ix) feature:

(A) title/keyword: modification _ base

(B) position: 12﹠amp; 15

(D) other data :/modify _ base=i

(xi) sequence description: SEQ ID NO:24:

ACGCTGGGCG?CNGANGA 17

(2) data of SEQ ID NO:25:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:25:

GGGGGGCGGA?CGCTGGG 17

(2) data of SEQ ID NO:26:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:26:

GGAGGACGAA?CACTAGG 17

(2) data of SEQ ID NO:27:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:27:

GGTGGTCGTA?CGCTGGG 17

(2) data of SEQ ID NO:28:

(i) sequence signature:

(A) length: 17 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:28:

GGCGGCCGCA?CGCTGGG 17

(2) data of SEQ ID NO:29:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:29:

GGATCTTGGT?TCATTCTCAA?G 21

(2) data of SEQ ID NO:30:

(i) sequence signature:

(A) length: 20 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:30:

CCTCAGACAG?TGGTTCAAAG 20

(2) data of SEQ ID NO:31:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:31:

CGAGGGTGTA?CCTGGGTCCT?G 21

(2) data of SEQ ID NO:32:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:32:

CAGAGTTAGT?CTTGCGGTGA?G 21

(2) data of SEQ ID NO:33:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:33:

CCTGTCCTGC?TGCCTGCTGT?G 21

(2) data of SEQ ID NO:34:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:34:

TGAAGTTCGT?CTCCAACAAT?C 21

(2) data of SEQ ID NO:35:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:35:

ATGGAGCTGA?CTGATTTGCT?C 21

(2) data of SEQ ID NO:36:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:36:

TGAAGTTCGT?CTCCAACAAT?C 21

(2) data of SEQ ID NO:37:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:37:

TTGTGACCTC?CGAGTCCTCA?G 21

(2) data of SEQ ID NO:38:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:38:

TGACGCAGAG?GGTGGACCCT?C 21

(2) data of SEQ ID NO:39:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:39:

AGCAGAACCT?CTCTAGTCCT?C 21

(2) data of SEQ ID NO:40:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:40:

ACACTGAACG?AGCTCCCAAA?C 21

(2) data of SEQ ID NO:41:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:41:

AACTACTGGC?TCTGGGCTTC?T 21

(2) data of SEQ ID NO:42:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:42:

AGGGATTCAG?AGCCAAGATT?C 21

(2) data of SEQ ID NO:43:

(i) sequence signature:

(A) length: 31 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:43:

TAGCGGCCGC?TTTTTTTTTT?TTTTTTTGGG?G 31

(2) data of SEQ ID NO:44:

(i) sequence signature:

(A) length: 31 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:44:

TAGCGGCCGC?TTTTTTTTTT?TTTTTTTAAA?A 31

(2) data of SEQ ID NO:45:

(i) sequence signature:

(A) length: 31 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:45:

TAGCGGCCGC?TTTTTTTTTT?TTTTTTTCTT?T 31

(2) data of SEQ ID NO:46:

(i) sequence signature:

(A) length: 31 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:46:

TAGCGGCCGC?TTTTTTTTTT?TTTTTTTGCC?C 31

(2) data of SEQ ID NO:47:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:47:

TAGCGGCCGC?TTTTTTTTTT?T 21

(2) data of SEQ ID NO:48:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:48:

TTGTGACCTC?CGAGTCCTCA?G 21

(2) data of SEQ ID NO:49:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:49:

AGGATGGGTT?GGGGAAGGAG?A 21

(2) data of SEQ ID NO:50:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:50:

TTGTGACCTC?CGAGTCCTCA?G 21

(2) data of SEQ ID NO:51:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:51:

AGGGAAGAGC?GTATACTGTC?C 21

(2) data of SEQ ID NO:52:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:52:

GGCCAGCCAG?ACACCCCGGC?C 21

(2) data of SEQ ID NO:53:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:53:

ATGGGAGTCA?CGAAGCAGTT?T 21

(2) data of SEQ ID NO:54:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:54:

TGCGTTTCCT?GATGCTTGTA?G 21

(2) data of SEQ ID NO:55:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:55:

AACCTTACCC?TTCCTGAGAC?A 21

(2) data of SEQ ID NO:56:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:56:

TTTGAATTCG?GCCAGCCAGA?CACCCCGGCC 30

(2) data of SEQ ID NO:57:

(i) sequence signature:

(A) length: 39 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:57:

TTTGCGGCCG?CTCATTAGCT?GGGGACAGCT?GTGGTGGGT 39

(2) data of SEQ ID NO:58:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:58:

TTTGCGGCCG?CTCATTACAG?TGTGAGGACT?AGAGAGGTTC?TG 42

(2) data of SEQ ID NO:59:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:59:

TTTGCGGCCG?CTCATTATCT?GGCTGAGGCA?GTGAAGTTTG?TC 42

(2) data of SEQ ID NO:60:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:60:

TTTGCGGCCG?CTCATTACAG?ACCAGGAATC?TTGGCTCTGAA?T 42

(2) data of SEQ ID NO:61:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:61:

TTTGAATTCG?GCCAGCCAGA?CACCCCGGCC 30

(2) data of SEQ ID NO:62:

(i) sequence signature:

(A) length: 41 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:62:

TTTGCGGCCG?CTCATTAGAG?GGTGGACCCT?CCTACAAGCA?T 41

(2) data of SEQ ID NO:63:

(i) sequence signature:

(A) length: 40 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:63:

TTTGCGGCCG?CTCATTAGCA?GAGGGTGGAC?CCTCCTACAA 40

(2) data of SEQ ID NO:64:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:64:

TTTGCGGCCG?CTCATTACCT?GACGCAGAGG?GTGGACCC 38

(2) data of SEQ ID NO:65:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:65:

TTTGCGGCCG?CTCATTACCG?CCTGACGCAG?AGGGTGGA 38

(2) data of SEQ ID NO:66:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:66:

TTTGCGGCCG?CTCATTAGGC?CCGCCTGACG?CAGAGGGT 38

(2) data of SEQ ID NO:67:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:67:

TTTGCGGCCG?CTCATTATGG?GGCCCGCCTG?ACGCAGAG 38

(2) data of SEQ ID NO:68:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:68:

TTTGCGGCCG?CTCATTAGGG?TGGGGCCCGC?CTGACGCA 38

(2) data of SEQ ID NO:69:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:69:

TTTGAATTCG?GCCAGCCAGA?CACCCCGGCC 30

(2) data of SEQ ID NO:70:

(i) sequence signature:

(A) length: 41 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:70:

TTTGCGGCCG?CTCATTATTC?GTGTATCCTG?TTCAGGTATC?C 41

(2) data of SEQ ID NO:71:

(i) sequence signature:

(A) length: 39 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:71:

TTTGCGGCCG?CTCATTAGCT?GGGGACAGCT?GTGGTGGGT 39

(2) data of SEQ ID NO:72:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:72:

AGTAAACTGC?TTCGTGACTC?CCATGTCCTT?CACAGCAGAC?TGAGCCAGTG 50

(2) data of SEQ ID NO:73:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:73:

CATGGGAGTC?ACGAAGCAGT?TTACTGGACA?GCGTTAGCCT?TGCAGTTAG 49

(2) data of SEQ ID NO:74:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:74:

TGTGACCTCC?GAGTCCTCAG?TAAACTGCTT?CGTGACTCCC?ATGTCCTTC 49

(2) data of SEQ ID NO:75:

(i) sequence signature:

(A) length: 48 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:75:

TTTACTGAGG?ACTCGGAGGT?CACAGGACAG?CGTTAGCCTT?GCAGTTAC 48

(2) data of SEQ ID NO:76:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:76:

GACCTCCGAG?TCCTCAGTAA?ACTGCTTCGT?GACTCCCATG?TCCTTCACA 49

(2) data of SEQ ID NO:77:

(i) sequence signature:

(A) length: 48 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:77:

CAGTTTACTG?AGGACTCGGA?GGTCGGACAG?CGTTAGCCTT?GCAGTTAG 48

(2) data of SEQ ID NO:78:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:78:

TTGTGACCTC?CGAGTCCTCA?G 21

(2) data of SEQ ID NO:79:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:79:

CAGGTATCCG?GGGATTTGGT?C 21

(2) data of SEQ ID NO:80:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:80:

TGCGTTTCCT?GATGCTTGTA?G 21

(2) data of SEQ ID NO:81:

(i) sequence signature:

(A) length: 35 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:81:

GAGAGAGCGG?CCGCTTACCC?TTCCTGAGAC?AGATT 35

(2) data of SEQ ID NO:82:

(i) sequence signature:

(A) length: 6 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:82:

GAGAGA 6

(2) data of SEQ ID NO:83:

(i) sequence signature:

(A) length: 70 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:83:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAGCCCGGCT?CCGCCAGCTT?GTGACCTTCG 60

TGTTCTGTCT 70

(2) data of SEQ ID NO:84:

(i) sequence signature:

(A) length: 72 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:84:

CAGTTTAGAC?AGAACACGAA?GGTCACAAGC?TGGCGGAGCC?GGGCTCATTA?TTTATTACCT 60

CCTTGGTTTT?TT 72

(2) data of SEQ ID NO:85:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:85:

AAACTGCTTC?GCGACTCTCA?CGTGCTGCAC?TCTCGTCTGT?CCCAGTGCCC?GGAAGTTCAC 60

CCGCTGCCG 69

(2) data of SEQ ID NO:86:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:86:

CGGGGTCGGC?AGCGGGTGAA?CTTCCGGGCA?CTGGGACAGA?CGAGAGTGCA?GCACGTGAGA 60

GTCGCGAAG 69

(2) data of SEQ ID NO:87:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:87:

ACCCCGGTTC?TGCTTCCGGCTGTCGACTTC?TCCCTGGGTG?AATGGAAAAAC?CCAGATGGAA 60

GAGACCAAA 69

(2) data of SEQ ID NO:88:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:88:

CTGAGCTTTG?GTCTCTTCCA?TCTGGGTTTT?CCATTCACCC?AGGGAGAAGT?CGACAGCCGG 60

AAGCAGAAC 69

(2) data of SEQ ID NO:89:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:89:

GCTCAGGACA?TCCTGGGTGC?AGTAACTCTG?CTTCTGGAAG?GCGTTATGGC?TGCACGTGGC 60

CAGCTTGGC 69

(2) data of SEQ ID NO:90:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:90:

GGTCGGGCCA?AGCTGGCCAC?GTGCAGCCAT?AACGCCTTCC?AGAAGCAGAG?TTACTGCACC 60

CAGGATGTC 69

(2) data of SEQ ID NO:91:

(i) sequence signature:

(A) length: 69 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:91:

CCGACCTGCC?TGTCTTCCCT?GCTTGGCCAG?CTGTCTGGCC?AGGTTCGTCT?GCTGCTCGGC 60

GCTCTGCAG 69

(2) data of SEQ ID NO:92:

(i) sequence signature:

(A) length: 66 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:92:

CAGAGACTGC?AGAGCGCCGA?GCAGACGAAC?CTGGCCAGAC?AGCTGGCCAA?GCAGGGAAGA 60

CAGGCA 66

(2) data of SEQ ID NO:93:

(i) sequence signature:

(A) length: 70 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:93:

TCTCTGCTTG?GCACCCAGCT?GCCGCCACAG?GGCCGTACCA?CTGCTCACAA?GGATCCGAAC 60

GCTATCTTCC 70

(2) data of SEQ ID NO:94:

(i) sequence signature:

(A) length: 70 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:94:

AAGACAGGAA?GATAGCGTTC?GGATCCTTGT?GAGCAGTGGT?ACGGCCCTGT?GGCGGCAGCT 60

GGGTGCCAAG 70

(2) data of SEQ ID NO:95:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:95:

GGAGGAGACC?AAGGCACAGG?A 21

(2) data of SEQ ID NO:96:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:96:

CCGGAATTCT?TACCCTTCCT?GAGACAGATT 30

(2) data of SEQ ID NO:97:

(i) sequence signature:

(A) length: 8 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:97:

CTAATGAG 8

(2) data of SEQ ID NO:98:

(i) sequence signature:

(A) length: 16 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:98:

AATTCTCATT?AGAGCT 16

(2) data of SEQ ID NO:99:

(i) sequence signature:

(A) length: 8 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:99:

CTAATGAG 8

(2) data of SEQ ID NO:100:

(i) sequence signature:

(A) length: 16 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:100:

AATTCTCATT?AGAGCT 16

(2) data of SEQ ID NO:101:

(i) sequence signature:

(A) length: 25 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:101:

ATCGCCGGCT?CCGCCAGCTT?GTGAC 25

(2) data of SEQ ID NO:102:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:102:

GCCGAATTCT?CATTAGAGCT?CGTTCAGTGT 30

(2) data of SEQ ID NO:103:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:103:

GATCCGAACG?CTATCTTCCT?GTCTTTCCAG?CACCTGCTGC?GT 42

(2) data of SEQ ID NO:104:

(i) sequence signature:

(A) length: 44 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:104:

TTTGCCACGC?AGCAGGTGCT?GGAAAGACAG?GAAGATAGCG?TTCG 44

(2) data of SEQ ID NO:105:

(i) sequence signature:

(A) length: 42 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:105:

GGCAAAGTTC?GTTTCCTGAT?GCTGGTTGGC?GGTTCTACCC?TG 42

(2) data of SEQ ID NO:106:

(i) sequence signature:

(A) length: 41 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:106:

ACGCACAGGG?TAGAACCGCC?AACCAGCATC?AGGAAACGAA?C 41

(2) data of SEQ ID NO:107:

(i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:107:

TGCGTTCGTC?GGGCGCCGCC?AACCACTGCT?GTTCCGTCTT?AATGAA 46

(2) data of SEQ ID NO:108:

(i) sequence signature:

(A) length: 45 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:108:

AGCTTTCATT?AAGACGGAAC?AGCAGTGGTT?GGCGGCGCCC?GACGA 45

(2) data of SEQ ID NO:109:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:109:

AAGGATCCGA?ACGCTATCTT?CCTG 24

(2) data of SEQ ID NO:110:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:110:

AGAAGCTTTC?ATTAAGACGG?AACA 24

(2) data of SEQ ID NO:111:

(i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:111:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAAGCACCT?GTACCA 46

(2) data of SEQ ID NO:112:

(i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:112:

CAGGTGGTAC?AGGTGCTTTC?ATTATTTATT?ACCTCCTTGG?TTTTTT 46

(2) data of SEQ ID NO:113:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:113:

CCTGCATGTG?ATTTACGGGT?CCTGTCTAAA?CTGCTGCG 38

(2) data of SEQ ID NO:114:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:114:

CGCAGCAGTT?TAGACAGGAC?CCGTAAATCA?CATG 34

(2) data of SEQ ID NO:115:

(i) sequence signature:

(A) length: 84 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:115:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAAGCACCT?GTACCACCTG?CATGTGATTT 60

ACGGGTCCTG?TCTAAACTGC?TGCG 84

(2) data of SEQ ID NO:116:

(i) sequence signature:

(A) length: 20 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:116:

Pro?Arg?Leu?Leu?Asn?lys?Leu?Leu?Arg?Asp?Ser?Tyr?Leu?Leu?His?Arg?Arg?Leu?Ser?Gln

1 5 10 15 20

(2) data of SEQ ID NO:117:

(i) sequence signature:

(A) length: 21 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:117:

Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Thr?Glu?Gln?Ser?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala

1 5 10 15 20

(2) data of SEQ ID NO:118:

(i) sequence signature:

(A) length: 18 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:118:

Ser?Arg?Thr?Ser?Gln?Leu?Leu?Thr?Leu?Asn?Lys?Phe?Pro?Asn?Arg?Leu?Leu?Asp

1 5 10 15

(2) data of SEQ ID NO:119:

(i) sequence signature:

(A) length: 21 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:119:

Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser?Gln

1 5 10 15 20

(2) data of SEQ ID NO:120:

(i) sequence signature:

(A) length: 16 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:120:

Ser?leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp

1 5 10 15

(2) data of SEQ ID NO:121:

(i) sequence signature:

(A) length: 19 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:121:

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala

1 5 10 15

(2) data of SEQ ID NO:122:

(i) sequence signature:

(A) length: 19 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:122:

Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala

1 5 10 15

(2) data of SEQ ID NO:123:

(i) sequence signature:

(A) length: 23 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:123:

Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr

1 5 10 15 20

(2) data of SEQ ID NO:124:

(i) sequence signature:

(A) length: 27 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:124:

Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln?Ash?Leu?Ser

1 5 10 15 20

Gln?Glu?Gly

25

(2) data of SEQ ID NO:125:

(i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:125:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAATCTCCT?GCACCA 46

(2) data of SEQ ID NO:126:

(i) sequence signature:

(A) length: 46 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:126:

CAGGTGGTGC?AGGAGATTTC?ATTATTTATT?ACCTCCTTGG?TTTTTT 46

(2) data of SEQ ID NO:127:

(i) sequence signature:

(A) length: 38 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:127:

CCTGCATGTG?ATTTACGGGT?CCTGTCTAAA?CTGCTGCG 38

(2) data of SEQ ID NO:128:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:128:

CGCAGCAGTT?TAGACAGGAC?CCGTAAATCA?CATG 34

(2) data of SEQ ID NO:129:

(i) sequence signature:

(A) length: 84 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:129:

CTAGAAAAAA?CCAAGGAGGT?AATAAATAAT?GAAATCTCCT?GCACCACCTG?CATGTGATTT 60

ACGGGTCCTG?TCTAAACTGC?TGCG 84

(2) data of SEQ ID NO:130:

(i) sequence signature:

(A) length: 47 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:130:

CTCCCGAACC?GTACCAGCGG?CCTGCTGGAA?ACCAACTTTA?CCGCGAG 47

(2) data of SEQ ID NO:131:

(i) sequence signature:

(A) length: 47 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:131:

GGTAAAGTTG?GTTTCCAGCA?GGCCGCTGGT?ACGGTTCGGG?AGCTCGT 47

(2) data of SEQ ID NO:132:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:132:

CGCGCGTACC?ACCGGCAGCG?GCCTGCTGAA?ATGGCAGCAG?GGCTTTCGT 49

(2) data of SEQ ID NO:133:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:133:

AGCCCTGCTG?CCATTTCAGC?AGGCCGCTGC?CGGTGGTACG?CGCGCTCGC 49

(2) data of SEQ ID NO:134:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:134:

CGCAAAATCC?CGGGCCTGCT?GAACCAGACC?AGCCGTAGCC?TGGATCAGAT 50

(2) data of SEQ ID NO:135:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:135:

ATCCAGGCTA?CGGCTGGTCT?GGTTCAGCAG?GCCCGGGATT?TTCGCACGAA 50

(2) data of SEQ ID NO:136:

(i) sequence signature:

(A) length: 47 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:136:

CCCGGGCTAT?CTGAACCGTA?TCCATGAACT?GCTGAACGGC?ACCCGTG 47

(2) data of SEQ ID NO:137:

(i) sequence signature:

(A) length: 47 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:137:

GTGCCGTTCA?GCAGTTCATG?GATACGGTTC?AGATAGCCCG?GGATCTG 47

(2) data of SEQ ID NO:138:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:138:

GCCTGTTTCC?GGCCCGAGC?CGTCGCACCC?TGGGCGCGCC?GGATATCAG 49

(2) data of SEQ ID NO:139:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:139:

ATCCGGCGCG?CCCAGGGTGC?GACGGCTCGG?GCCCGGAAAC?AGGCCACGG 49

(2) data of SEQ ID NO:140:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:140:

ATCAGCTCTG?GCACCAGCGA?TACCGGCAGC?CTGCCGCCGA?ACCTGCAGCC 50

(2) data of SEQ ID NO:141:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:141:

CAGGTTCGGC?GGCAGGCTGC?CGGTATCGCT?GGTGCCAGAG?CTGATATCCG 50

(2) data of SEQ ID NO:142:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:142:

GGGCTATAGC?CCGAGCCCGA?CCCATCCGCC?GACCGGCCAG?TATACCCTGT?T 51

(2) data of SEQ ID NO:143:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:143:

GGTATACTGG?CCGGTCGGCG?GATGGGTCGG?GCTCGGGCTA?TAGCCCGGCT?G 51

(2) data of SEQ ID NO:144:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:144:

TCCGCTGCCG?CCGACCCTGC?CGACCCCGGT?GGTTCAGCTG?CATCCGCTGC 50

(2) data of SEQ ID NO:145:

(i) sequence signature:

(A) length: 50 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:145:

GGATGCAGCT?GAACCACCGG?GGTCGGCAGG?GTCGGCGGCA?GCGGAAACAG 50

(2) data of SEQ ID NO:146:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:146:

TGCCGGATCC?GAGCGCGCCG?ACCCCGACCC?CGACCAGCCC?GCTGCTGAAC?A 51

(2) data of SEQ ID NO:147:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:147:

AGCAGCGGGC?TGGTCGGGGT?CGGGGTCGGC?GCGCTCGGAT?CCGGCAGCAG?C 51

(2) data of SEQ ID NO:148:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:148:

CCAGCTATAC?CCATAGCCAG?AACCTGAGCC?AGGAAGGCTA?ATGAAGCTTG?A 51

(2) data of SEQ ID NO:149:

(i) sequence signature:

(A) length: 51 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:149:

CTTCATTAGC?CTTCCTGGCT?CAGGTTCTGG?CTATGGGTAT?AGCTGGTGTT?C 51

(2) data of SEQ ID NO:150:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:150:

ACGAGCTCCC?GAACCGTACC?A 21

(2) data of SEQ ID NO:151:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:151:

CTGATATCCG?GCGCGCCCAG?G 21

(2) data of SEQ ID NO:152:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:152:

CGGATATCAG?CTCTGGCACC?A 21

(2) data of SEQ ID NO:153:

(i) sequence signature:

(A) length: 21 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:153:

TCAAGCTTCA?TTAGCCTTCC?T 21

(2) data of SEQ ID NO:154:

(i) sequence signature:

(A) length: 490 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:154:

CTC?CCG?AAC?CGT?ACC?AGC?GGC?CTG?CTG?GAA?ACC?AAC?TTT?ACC?GCG?AGC 48

Leu?Pro?Asn?Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser

1 5 10 15

GCG?CGT?ACC?ACC?GGC?AGC?GGC?CTG?CTG?AAA?TGG?CAG?CAG?GGC?TTT?CGT 96

Ala?Arg?Thr?Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg

20 25 30

GCG?AAA?ATC?CCG?GGC?CTG?CTG?AAC?CAG?ACC?AGC?CGT?AGC?CTG?GAT?CAG 144

Ala?Lys?Ile?Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln

35 40 45

ATC?CCG?GGC?TAT?CTG?AAC?CGT?ATC?CAT?GAA?CTG?CTG?AAC?GGC?ACC?CGT 192

Ile?Pro?Gly?Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg

50 55 60

GGC?CTG?TTT?CCG?GGC?CCG?AGC?CGT?CGC?ACC?CTG?GGC?GCG?CCG?GAT?ATC 240

Gly?Leu?Phe?Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile

65 70 75 80

AGC?TCT?GGC?ACC?AGC?GAT?ACC?GGC?AGC?CTG?CCG?CCG?AAC?CTG?CAG?CCG 288

Ser?Ser?Gly?Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro

85 90 95

GGC?TAT?AGC?CCG?AGC?CCG?ACC?CAT?CCG?CCG?ACC?GGC?CAG?TAT?ACC?CTG 336

Gly?Tyr?Ser?Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu

100 105 110

TTT?CCG?CTG?CCG?CCG?ACC?CTG?CCG?ACC?CCG?GTG?GTT?CAG?CTG?CAT?CCG 384

Phe?Pro?Leu?Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro

115 120 125

CTG?CTG?CCG?GAT?CCG?AGC?GCG?CCG?ACC?CCG?ACC?CCG?ACC?AGC?CCG?CTG 432

Leu?Leu?Pro?Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu

130 135 140

CTG?AAC?ACC?AGC?TAT?ACC?CAT?AGC?CAG?AAC?CTG?AGC?CAG?GAA?GGC?TAA 480

Leu?Asn?Thr?Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

l45 145 150

TGAAGCTTGA 490

(2) data of SEQ ID NO:155:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:155:

AAGGATCCGA?ACGCTATCTT?CCTG 24

(2) data of SEQ ID NO:156:

(i) sequence signature:

(A) length: 56 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:156:

GGGAGCTCGT?TCAGGGTCAG?AACCAGAGAG?GTACGAGACG?GAACAGCAGT?GGTTGG 56

(2) data of SEQ ID NO:157:

(i) sequence signature:

(A) length: 157 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:157:

G?GAT?CCG?AAC?GCT?ATC?TTC?CTG?TCT?TTC?CAG?CAC?CTG?CTG?CGT?GGC 46

Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly

1 5 10 15

AAA?GTT?CGT?TTC?CTG?ATG?CTG?GTT?GGC?GGT?TCT?ACC?CTG?TGC?GTT?CGT 94

Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg

20 25 30

CGG?GCG?CCG?CCA?ACC?ACT?GCT?GTT?CCG?TCT?CGT?ACC?TCT?CTG?GTT?CTG 142

Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu

35 40 45

ACC?CTG?AAC?GAG?CTC 167

Thr?Leu?Asn?Glu?Leu

50

(2) data of SEQ ID NO:158:

(i) sequence signature:

(A) length: 100 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:158:

CCTCGAGGAA?TTCCTGCAGC?CCGGGACTAG?TATCGGCTAC?CCCTACGACG?TCCCCGACTA 60

CGCCGGCGTC?CATCACCATC?ACCATCACTG?AGCGGCCGCC 100

(2) data of SEQ ID NO:159:

(i) sequence signature:

(A) length: 108 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:159:

AATTGGCGGC?CGCTCAGTGA?TGGTGATGGT?GATGAGCGCC?GGCGTAGTCG?GGGACGTCGT 60

AGGGGTAGCC?GATACTAGTC?CCGGGCTGCA?GGAATTCCTC?GAGGGTAC 108

(2) data of SEQ ID NO:160:

(i) sequence signature:

(A) length: 70 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:160:

AATTCCAAGA?TCTCACACTT?GCTTTTGACA?CAACTGTGTT?TACTTGCAAT?CCCCCAAAAC 60

AGACAGACCC 70

(2) data of SEQ ID NO:161:

(i) sequence signature:

(A) length: 66 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:161:

GGGTCTGTCT?GTTTTGGGGG?ATTGCAAGTA?AACACAGTTG?TGTCAAAAGC?AAGTGTGAGA 60

TCTTGG 66

(2) data of SEQ ID NO:162:

(i) sequence signature:

(A) length: 29 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:162:

GGCCCGGGAT?GGAGCTGACT?GAATTGCTC 29

(2) data of SEQ ID NO:163:

(i) sequence signature:

(A) length: 35 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:163:

TCAAGCTTAC?TAGTCCCTTC?CTGAGACAGA?TTCTG 35

(2) data of SEQ ID NO:164:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:164:

TAATACGACT?CACTATAGGG?CG 22

(2) data of SEQ ID NO:165:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:165:

AATTCCAAGA?TCACACACTT?GC 22

(2) data of SEQ ID NO:166:

(i) sequence signature:

(A) length: 35 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:166:

TCAAGCTTAC?TAGTCCCTTC?CTGAGACAGA?TTCTG 35

(2) data of SEQ ID NO:167:

(i) sequence signature:

(A) length: 35 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:167:

TGGGCACTGG?CTCAGGTTGC?TGTGAAGGAC?ATGGG 35

(2) data of SEQ ID NO:168:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:168:

TGTAGGCAAA?GGGGTAACCT?CTGGGCA 27

(2) data of SEQ ID NO:169:

(i) sequence signature:

(A) length: 21 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:169:

Thr?Ser?Ile?Gly?Tyr?Pro?Tyr?Asp?Val?Pro?Asp?Tyr?Ala?Gly?Val?His?Xaa?Xaa?Xaa?Xaa?Xaa

1 5 10 15 20

(2) data of SEQ ID NO:170:

(i) sequence signature:

(A) length: 30 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:170:

TTTGAATTCG?GCCAGCCAGA?CACCCCGGCC 30

(2) data of SEQ ID NO:171:

(i) sequence signature:

(A) length: 41 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:171:

TTTGCGGCCG?CTCATTATTC?GTGTATCCTG?TTCAGGTATC?C 41

(2) data of SEQ ID NO:172:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:172:

TGTAGGCAAA?GGAACCTCTG?GGCA 24

(2) data of SEQ ID NO:173:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:173:

TGTAGGCAAA?GCAGTGTGAA?CCTCTGG 27

(2) data of SEQ ID NO:174:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:174:

TGTAGGCAAA?GGAGCGTGAA?CCTCTGG 27

(2) data of SEQ ID NO:175:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:175:

TGTAGGCAAA?GGTCCGTGAA?CCTCTGG 27

(2) data of SEQ ID NO:176:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:176:

AGCTGTGGTC?CTCTGTGGAG?GAAG 24

(2) data of SEQ ID NO:177:

(i) sequence signature:

(A) length: 24 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:177:

GTGAGCTGTG?GTGCCCTGTG?GAGG 24

(2) data of SEQ ID NO:178:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:178:

AGCTGTGGTC?CTGTTGCCCT?GTGGAGG 27

(2) data of SEQ ID NO:179:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:179:

AGCTGTGGTC?CTAGCGCCCT?GTGGAGG 27

(2) data of SEQ ID NO:180:

(i) sequence signature:

(A) length: 27 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:180:

AGCTGTGGTC?CTTCCGCCCT?GTGGAGG 27

(2) data of SEQ ID NO:181:

(i) sequence signature:

(A) length: 26 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:181:

CGGGCTGCAG?GATATCCAAG?ATCTCA 26

(2) data of SEQ ID NO:182:

(i) sequence signature:

(A) length: 22 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:182:

TAATACGACT?CACTATAGGG?CG 22

(2) data of SEQ ID NO:183:

(i) sequence signature:

(A) length: 34 base pairs

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: other nucleic acid

(xi) sequence description: SEQ ID NO:183:

GGGCGGCCGC?TCAGCTGGGG?ACAGCTGTGG?TGGG 34

(2) data of SEQ ID NO:184:

(i) sequence signature:

(A) length: 7 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(ix) feature:

(A) title/keyword: misc_ feature

(D) other data:

/ note=" 2 amino acid is Ala, Ser, Gly, Met

Or Gln "

(ix) feature:

(A) title/keyword: misc_ feature

(D) other data:

/ note=" 7 amino acid is Glu or Lys "

(xi) sequence description: SEQ ID NO:184:

Lys?Xaa?Tyr?Tyr?Glu?Ser?Xaa

1 5

(2) data of SEQ ID NO:185:

(i) sequence signature:

(A) length: 6 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(ix) feature:

(A) title/keyword: misc_ feature

(D) other data:

/ note=" amino acid on 6 is Glu or Asp "

(xi) sequence description: SEQ ID NO:185:

Lys?Glx?Arg?Ala?Ala?Xaa

1 5

(2) data of SEQ ID NO:186:

(i) sequence signature:

(A) length: 7 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:186:

Lys?Ala?Gly?Xaa?Cys?Ser?Gly

1 5

(2) data of SEQ ID NO:187:

(i) sequence signature:

(A) length: 13 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(ix) feature:

(A) title/keyword: misc_ feature

(D) other data:

/ note=" amino acid on 2 is Ile, Thr or Ser "

(xi) sequence description: SEQ ID NO:187:

Lys?Xaa?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu

1 5 10

(2) data of SEQ ID NO:188:

(i) sequence signature:

(A) length: 9 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:188:

Lys?Asp?Ser?Phe?Leu?Ala?Asp?Val?Lys

1 5

(2) data of SEQ ID NO:189:

(i) sequence signature:

(A) length: 9 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(ix) feature:

(A) title/keyword: misc_ feature

(D) other data:

/ note=" amino acid on 1 is Lys or Arg "

(xi) sequence description: SEQ ID NO:189:

Xaa?Thr?Leu?Pro?Thr?Xaa?Ala?Val?Pro

1 5

(2) data of SEQ ID NO:190:

(i) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(C) chain:

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:190:

Lys?Asp?Ser?Phe?Leu?Ala?Asp?Val?Lys?Gln?Tyr?Tyr?Glu?Ser?Glu

1 5 10 15

(2) data of SEQ ID NO:191:

(i) sequence signature:

(A) length: 332 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: protein

(vi) originate:

(A) organism: Homo Sapiens

(xi) sequence description: SEQ ID NO:191:

Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu

1 5 10 15

Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val

20 25 30

His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu

35 40 45

Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu

50 55 60

Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln

65 70 75 80

Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln

85 90 95

Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu

100 105 110

Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe

115 120 125

Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu

130 135 140

Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala

145 150 155 160

Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn

165 170 175

Arg?Thr?Ser?Gly?Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg?Thr

180 185 190

Thr?Gly?Ser?Gly?Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys?Ile

195 200 205

Pro?Gly?Leu?Leu?Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro?Gly

210 215 220

Tyr?Leu?Asn?Arg?Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu?Phe

225 230 235 240

Pro?Gly?Pro?Ser?Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser?Gly

245 250 255

Thr?Ser?Asp?Thr?Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr?Ser

260 265 270

Pro?Ser?Pro?Thr?His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro?Leu

275 280 285

Pro?Pro?Thr?Leu?Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu?Pro

290 295 300

Asp?Pro?Ser?Ala?Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn?Thr

305 310 315 320

Ser?Tyr?Thr?His?Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

325 330

(2) data of SEQ ID NO:192:

(i) sequence signature:

(A) length: 1086 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA → mRNA

(vi) originate:

(A) organism: Homo Sapiens

(xi) sequence description: SEQ ID NO:192:

GGCCAGCCAG?ACACCCCGGC?CAGA?ATG?GAG?CTG?ACT?GAA?TTG?CTC?CTC?GTG 51

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val

-21?-20 -15

GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG?TCC?AGC?CCG?GCT?CCT 99

Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro

-10 -5 1

CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?GAC?TCC?CAT 147

Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His

5 10 15 20

GTC?CTT?CAC?AGC?AGA?CTG?AGC?CAG?TGC?CCA?GAG?GTT?CAC?CCT?TTG?CCT 195

Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro

25 30 35

ACA?CCT?CTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC?TTG?GGA?GAA?TGG?AAA 243

Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys

40 45 50

ACC?CAG?ATG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT?CTC?GGA?GCA?GTG?ACC 291

Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr

55 60 65

CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA?CAA?CTG?GGA?CCC?ACT 339

Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr

70 75 80

TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA?CAG?GTC?CGT?CTC?CTC 387

Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu

85 90 95 100

CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG?CTT?CCT?CCA?CAG?GGC 435

Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly

105 110 115

AGG?ACC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC?TTC?CTG?AGC?TTC?CAA 483

Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln

120 125 130

GAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG?CTT?GTA?GGA?GGG?TCC 531

His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser

135 140 145

ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA?GCT?GTC?CCC?AGC?AGA 579

Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg

150 155 160

ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA?AAC?AGG?ACT?TCT?GGA 627

Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly

165 170 175 180

TTG?TTG?GAG?ACA?AAC?TTC?ACT?GCC?TCA?GCC?AGA?ACT?ACT?GGC?TCT?GGG 675

Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly

185 190 195

CTT?CTG?AAG?TGG?CAG?CAG?GGA?TTC?AGA?GCC?AAG?ATT?CCT?GGT?CTG?CTG 723

Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu

200 205 210

AAC?CAA?ACC?TCC?AGG?TCC?CTG?GAC?CAA?ATC?CCC?GGA?TAC?CTC?AAC?AGG 771

Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg

215 220 225

ATA?CAC?GAA?CTC?TTG?AAT?GGA?ACT?CGT?GGA?CTC?TTT?CCT?GGA?CCC?TCA 819

Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu?Phe?Pro?Gly?Pro?Ser

230 235 240

CGC?AGG?ACC?CTA?GGA?GCC?CCG?GAC?ATT?TCC?TCA?GGA?ACA?TCA?GAC?ACA 867

Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser?Gly?Thr?Ser?Asp?Thr

245 250 255 260

GGC?TCC?CTG?CCA?CCC?AAC?CTC?CAG?CCT?GGA?TAT?TCT?CCT?TCC?CCA?ACC 915

Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr

265 270 275

CAT?CCT?CCT?ACT?GGA?CAG?TAT?ACG?CTC?TTC?CCT?CTT?CCA?CCC?ACC?TTG 963

His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro?Leu?Pro?Pro?Thr?Leu

280 285 290

CCC?ACC?CCT?GTG?GTC?CAC?CTC?CAC?CCC?CTG?CTT?CCT?GAC?CCT?TCT?GCT 1011

Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu?Pro?Asp?Pro?Ser?Ala

295 300 305

CCA?ACG?CCC?ACC?CCT?ACC?AGC?CCT?CTT?CTA?AAC?ACA?TCC?TAC?ACC?CAC 1059

Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His

510 315 320

TCC?CAG?AAT?CTG?TCT?CAG?GAA?GGG?TAA 1085

Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

325 330

(2) data of SEQ ID NO:193:

(i) sequence signature:

(A) length: 7 amino acid

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: peptide

(xi) sequence description: SEQ ID NO:193:

Lys?Gln?Tyr?Tyr?Glu?Ser?Glu

1 5

(2) data of SEQ ID NO:194:

(i) sequence signature:

(A) length: 1663 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA → mRNA

(vi) originate:

(A) organism: Rattus norvegicus

(H) clone: McA-RH8994

(xi) sequence description: SEQ ID NO:194:

GGTGTACCTG?GGTCCTGAAG?CCCTTCTTCA?CCTGGATAGA?TTCCTTGGCC?CACCTGTCCC 60

CACCCCACTC?TGTGCAGAGG?TACAAAAGCT?CAAGCCGTCT?CCATGGCCCC?AGGAAAGATT 120

CAGGGGAGAG?GCCCCACACA?GGGAGCCACT?GCAGTCAGAC?ACCCTGGGCA?GA?ATG 175

Met

-21

GAG?CTG?ACT?GAT?TTG?CTC?CTG?GTG?GCC?ATA?CTT?CTC?CTC?ACC?GCA?AGA 223

Glu?Leu?Thr?Asp?Leu?Leu?Leu?Val?Ala?Ile?Leu?Leu?Leu?Thr?Ala?Arg

-20 -15 -10 -5

CTA?ACT?CTG?TCC?AGC?CCA?GTT?CCT?CCC?GCC?TGT?GAC?CCC?AGA?CTC?CTA 271

Leu?Thr?Leu?Ser?Ser?Pro?Val?Pro?Pro?Ala?Cys?Asp?Pro?Arg?Leu?Leu

1 5 10

AAT?AAA?CTG?CTT?CGT?GAC?TCC?TAC?CTC?CTT?CAC?AGC?CGA?CTG?AGT?CAG 319

Asn?Lys?Leu?Leu?Arg?Asp?Ser?Tyr?Leu?Leu?His?Ser?Arg?Leu?Ser?Gln

15 20 25

TGT?CCT?GAC?GTC?AAC?CCT?TTG?TCT?ATC?CCT?GTC?CTG?CTG?CCT?GCT?GTG 367

Cys?Pro?Asp?Val?Asn?Pro?Leu?Ser?Ile?Pro?Val?Leu?Leu?Pro?Ala?Val

30 35 40

GAC?TTT?AGC?CTG?GGA?GAA?TGG?AAA?ACC?CAG?ACG?GAA?CAG?AGC?AAG?GCA 415

Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Thr?Glu?Gln?Ser?Lys?Ala

45 50 55 60

CAG?GAC?ATT?CTA?GGG?GCA?GTG?TCC?CTT?CTA?CTG?GAG?GGG?GTG?ATG?GCA 463

Gln?Asp?Ile?Leu?Gly?Ala?Val?Ser?Leu?Leu?Leu?Glu?Gly?Val?Met?Ala

65 70 75

GCA?CGA?GGA?CAG?TTG?GAA?CCC?TCC?TGC?CTC?TCA?TCC?CTC?CTG?GGA?CAG 511

Ala?Arg?Gly?Gln?Leu?Glu?Pro?Ser?Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln

80 85 90

CTT?TCT?GGT?CAG?GTT?CGC?CTC?CTC?TTG?GGA?GCC?CTG?CAG?GGC?CTC?CTA 559

Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Gly?Leu?Leu

95 100 105

GGA?ACC?CAG?GTA?AGT?CCC?CAG?ACC?TAT?AGA?AAC?TAC?CCT?CTT?ACT?CAG 607

Gly?Thr?Gln?Val?Ser?Pro?Gln?Thr?Tyr?Arg?Asn?Tyr?Pro?Leu?Thr?Gln

110 115 120

TTC?CTC?TAAGGACCTG?GGAAAAGACA?AGGGATTCTA?GATTCTAGGT?GTCTTCAGTG 663

Phe?Leu

125

TATGAAAGCT?GGTCTATACG?GAGTGATGCT?TCTCAGCCAC?AATACCTGGG?TGCTGGCACT 723

AAATCTTTCC?ACCTTAGTGA?GAAGAGGCCT?GATATGTGGG?CCAACTCACT?GGCCTCAGGC 732

CCATCCTCTG?CCTTCAGCTT?CCTCCACAGG?GCAGGACCAC?AGCTCACAAG?GACCCCAGTC 841

CCCTCTTCTT?GAGCTTGCAA?CAACTGCTTC?GGGGAAAGGT?GCGCTTCCTG?CTGCTGGTAG 903

AAGGTCCCGC?CCTCTGTGTC?AGACGGACCC?TTCCCACCAC?AGCTGTCCCA?AGCAGAACCT 963

CTCAACTCCT?CACACTAAAC?AAGTTCCCAA?ACAGACTTCT?GGATTCTTGG?AGACGAACTT 1023

CAGTGTTGTA?GCCAGAACTG?CTGGCCCTGG?ACTTCTGAAC?AGGCTTCAAG?GATTCAGAGC 1083

CAAGATTATT?CCTGGTCAGC?TAAATCAAAC?CTCCGGGTCC?TTAGACCAAA?TCCCTGGATA 1142

CCTGAACCGG?ACACACGAAC?CTGTGAATGG?AACTCATGGG?CTCTTTGCTG?GGACCTCACT 1203

ACAGACCCTG?GAAGCCCCAG?ACGTTGTGCC?AGGAGCTTTC?AACAAAGGCT?CCTTGCCACT 1263

CAACCTCCAG?AGTGGACTTC?CTCCTATCCC?AAGCCTTGCT?GCTGATGGAT?ACACACTTTT 1323

CCCTCCTTCA?CCTACCTTCC?CCACCCCTGG?GTCTCCACCC?CAGCTCCCCC?CCGTTTCCTG 1383

ACCCCTCCAC?CACCATACCT?AACTCTACCA?ACCCTCATCC?AGGACTTGGT?CTCAGTAAGC 1443

GTCCCGTGCA?CTGGCACGGA?GCGCGATCGT?CTGCAACATC?TCTCAGGGGC?AAGCTTCCTC 1503

AGGAAGGCTC?TGAGGCAGCT?CACTAGACAT?CCTGCTCTCG?CCTAACGGGC?CCTGGGAAAG 1563

GGATACACAG?GCCAGGACAC?TGTACAACCT?TAGGAGCGAT?TTTTTTCTTA?ACCTATCAAC 1623

AATATTCATC?AGAGCAAAAA?AAAAAAAAAA?AAAAAAAAAA 1663

(2) data of SEQ ID NO:195:

(i) sequence signature:

(A) length: 861 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA → mRNA

(vi) originate:

(A) organism: Homo Sapiens

(H) types of organization: liver

(xi) sequence description: SEQ ID NO:195:

GGCCAGCCAG?ACACCCCGGC?CAGA?ATG?GAG?CTG?ACT?GAA?TTG?CTC?CTC?GTG 51

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val

-21?-20 -15

GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG?TCC?AGC?CCG?GCT?CCT 99

Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro

-10 -5 1

CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?GAC?TCC?CAT 147

Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His

5 10 15 20

GTC?CTT?CAC?AGC?AGA?CTG?AGC?CAG?TGC?CCA?GAG?GTT?CAC?CCT?TTG?CCT 195

Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro

25 30 35

ACA?CCT?GTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC?TTG?GGA?GAA?TGG AAA 243

Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys

40 45 50

ACC?CAG?ATG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT?CTG?GGA?GCA?GTG?ACC 291

Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr

55 60 65

CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA?CAA?CTG?GGA?CCC?ACT 339

Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr

70 75 80

TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA?CAG?GTC?CGT?CTC?CTC 387

Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu

85 90 95 100

CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG?CTT?CCT?CCA?CAG?GGC 435

Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly

105 110 115

AGG?ACC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC?TTC?CTG?AGC?TTC?CAA 483

Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln

120 125 130

CAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG?CTT?GTA?GGA?GGG?TCC 531

His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser

135 140 145

ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA?GCT?GTC?CCC?AGC?AGA 579

Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg

150 155 160

ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA?AAC?AGG?ACT?TCT?GGA 627

Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly

165 170 175 180

TTG?TTG?GAG?ACA?AAC?TTC?ACT?GCC?TCA?GCC?AGA?ACT?ACT?GGC?TCT?GGG 675

Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly

185 190 195

CTT?CTG?AAG?TGG?CAG?CAG?GGA?TTC?AGA?GCC?AAG?ATT?CCT?GGT?CTG?CTG 723

Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu

200 205 210

AAC?CAA?ACC?TCC?AGG?TCC?CTG?GAC?CAA?ATC?CCC?GGA?TAC?CTG?AAC?AGG 771

Asn?Gln?Thr?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg

215 220 225

ATA?CAC?GAA?CTC?TTAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA 823

Ile?His?Glu?Leu

230

AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAAAAAAA 861

(2) data of SEQ ID NO:196:

(i) sequence signature:

(A) length: 1267 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA → mRNA

(vi) originate:

(A) organism: Homo Sapiens

(H) types of organization: liver

(xi) sequence description: SEQ ID NO:196:

GGCGAGCCAG?ACACCCCGGC?CAGA?ATG?GAG?CTG?ACT?GAA?TTG?CTC?CTC?GTG 51

Met?Glu?Leu?Thr?Glu?Leu?Leu?Leu?Val

-21?-20 -15

GTC?ATG?CTT?CTC?CTA?ACT?GCA?AGG?CTA?ACG?CTG?TCC?AGC?CCG?GCT?CCT 99

Val?Met?Leu?Leu?Leu?Thr?Ala?Arg?Leu?Thr?Leu?Ser?Ser?Pro?Ala?Pro

-10 -5 1

CCT?GCT?TGT?GAC?CTC?CGA?GTC?CTC?AGT?AAA?CTG?CTT?CGT?GAC?TCC?CAT 147

Pro?Ala?Cys?Asp?Leu?Arg?Val?Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His

5 10 15 20

GTC?CTT?CAC?AGC?AGA?CTG?AGC?CAG?TGC?CCA?GAG?GTT?CAC?CCT?TTG?CCT 195

Val?Leu?His?Ser?Arg?Leu?Ser?Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro

25 30 35

ACA?CCT?GTC?CTG?CTG?CCT?GCT?GTG?GAC?TTT?AGC?TTG?GGA?GAA?TGG?AAA 243

Thr?Pro?Val?Leu?Leu?Pro?Ala?Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys

40 45 50

ACC?CAG?ATG?GAG?GAG?ACC?AAG?GCA?CAG?GAC?ATT?CTG?GGA?GCA?GTG?ACC 291

Thr?Gln?Met?Glu?Glu?Thr?Lys?Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr

55 60 65

CTT?CTG?CTG?GAG?GGA?GTG?ATG?GCA?GCA?CGG?GGA?CAA?CTG?GGA?CCC?ACT 339

Leu?Leu?Leu?Glu?Gly?Val?Met?Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr

70 75 80

TGC?CTC?TCA?TCC?CTC?CTG?GGG?CAG?CTT?TCT?GGA?CAG?GTC?CGT?CTC?CTC 387

Cys?Leu?Ser?Ser?Leu?Leu?Gly?Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu

85 90 95 100

CTT?GGG?GCC?CTG?CAG?AGC?CTC?CTT?GGA?ACC?CAG?CTT?CCT?CCA?CAG?GGC 435

Leu?Gly?Ala?Leu?Gln?Ser?Leu?Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly

105 110 115

AGG?ACC?ACA?GCT?CAC?AAG?GAT?CCC?AAT?GCC?ATC?TTC?CTG?AGC?TTC?CAA 483

Arg?Thr?Thr?Ala?His?Lys?Asp?Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln

120 125 130

CAC?CTG?CTC?CGA?GGA?AAG?GTG?CGT?TTC?CTG?ATG?CTT?GTA?GGA?GGG?TCC 531

His?Leu?Leu?Arg?Gly?Lys?Val?Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser

135 140 145

ACC?CTC?TGC?GTC?AGG?CGG?GCC?CCA?CCC?ACC?ACA?GCT?GTC?CCC?AGC?AGA 579

Thr?Leu?Cys?Val?Arg?Arg?Ala?Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg

150 155 160

ACC?TCT?CTA?GTC?CTC?ACA?CTG?AAC?GAG?CTC?CCA?AAC?AGG?ACT?TCT?GGA 627

Thr?Ser?Leu?Val?Leu?Thr?Leu?Asn?Glu?Leu?Pro?Asn?Arg?Thr?Ser?Gly

155 170 175 180

TTG?TTG?GAG?ACA?AAC?TTC?ACT?GCC?TCA?GCC?AGA?ACT?ACT?GGC?TCT?GGG 675

Leu?Leu?Glu?Thr?Asn?Phe?Thr?Ala?Ser?Ala?Arg?Thr?Thr?Gly?Ser?Gly

185 190 195

CTT?CTG?AAG?TGG?CAG?CAG?GGA?TTC?AGA?GCC?AAG?ATT?CCT?GGT?CTG?CTG 723

Leu?Leu?Lys?Trp?Gln?Gln?Gly?Phe?Arg?Ala?Lys?Ile?Pro?Gly?Leu?Leu

200 205 210

AAC?CAA?ACC?TCC?AGG?TCC?CTG?GAC?CAA?ATC?CCC?GGA?TAC?CTG?AAC?AGG 771

Asn?Gln?Ths?Ser?Arg?Ser?Leu?Asp?Gln?Ile?Pro?Gly?Tyr?Leu?Asn?Arg

215 220 225

ATA?CAC?GAA?CTC?TTG?AAT?GGA?ACT?CGT?GGA?CTC?TTT?CCT?GGA?CCC?TCA 819

Ile?His?Glu?Leu?Leu?Asn?Gly?Thr?Arg?Gly?Leu?Phe?Pro?Gly?Pro?Ser

230 235 240

CGC?AGG?ACC?CTA?GGA?GCC?CCG?GAC?ATT?TCC?TCA?GGA?ACA?TCA?GAC?ACA 867

Arg?Arg?Thr?Leu?Gly?Ala?Pro?Asp?Ile?Ser?Ser?Gly?Thr?Ser?Asp?Thr

245 250 255 260

GGC?TCC?CTG?CCA?CCC?AAC?CTC?CAG?CCT?GGA?TAT?TCT?CCT?TCC?CCA?ACC 915

Gly?Ser?Leu?Pro?Pro?Asn?Leu?Gln?Pro?Gly?Tyr?Ser?Pro?Ser?Pro?Thr

265 270 275

CAT?CCT?CCT?ACT?GGA?CAG?TAT?ACG?CTC?TTC?CCT?CTT?CCA?CCC?ACC?TTG 963

His?Pro?Pro?Thr?Gly?Gln?Tyr?Thr?Leu?Phe?Pro?Leu?Pro?Pro?Thr?Leu

280 285 290

CCC?ACC?CCT?GTG?GTC?CAG?CTC?CAC?CCC?CTG?CTT?CCT?GAC?CCT?TCT?GCT 1011

Pro?Thr?Pro?Val?Val?Gln?Leu?His?Pro?Leu?Leu?Pro?Asp?Pro?Ser?Ala

295 300 305

CCA?ACG?CCC?ACC?CCT?ACC?AGC?CCT?CTT?CTA?AAC?ACA?TCC?TAC?ACC?CAC 1059

Pro?Thr?Pro?Thr?Pro?Thr?Ser?Pro?Leu?Leu?Asn?Thr?Ser?Tyr?Thr?His

310 315 320

TCC?CAG?AAT?CTG?TCT?CAG?GAA?GGG?TAAGGTTCTC?AGACACTGCC?GACATCAGCA 1113

Ser?Gln?Asn?Leu?Ser?Gln?Glu?Gly

325 330

TTGTCTCATG?TACAGCTCCC?TTCCCTGCAG?GGCGCCCCTG?GGAGACAACT?GGACAAGATT 1173

TCCTACTTTC?TCCTGAAACC?CAAAGCCCTG?GTAAAAGGGA?TACACAGGAC?TGAAAAGGGA 1233

ATCATTTTTC?ACTGTACATT?ATAAACCTTC?AGAA 1267

(2) data of SEQ ID NO:197:

(i) sequence signature:

(A) length: 549 base pairs

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: synthetic DNA

(xi) sequence description: SEQ ID NO:197:

CTG?GTT?CCG?CGT?GGA?TCC?CCG?GCT?CCG?CCA?GCT?TGT?GAC?CTT?CGT?GTT 48

Leu?Val?Pro?Arg?Gly?Ser?Pro?Ala?Pro?Pro?Ala?Cys?Asp?Leu?Arg?Val

-5 1 5 10

CTG?TCT?AAA?CTG?CTT?CGC?GAC?TCT?CAC?GTG?CTG?CAC?TCT?CGT?CTG?TCC 95

Leu?Ser?Lys?Leu?Leu?Arg?Asp?Ser?His?Val?Leu?His?Ser?Arg?Leu?Ser

15 20 25

CAG?TGC?CCG?GAA?GTT?CAC?CCG?CTG?CCG?ACC?CCG?GTT?CTG?CTT?CCG?GCT 144

Gln?Cys?Pro?Glu?Val?His?Pro?Leu?Pro?Thr?Pro?Val?Leu?Leu?Pre?Ala

30 35 40

GTC?GAC?TTC?TCC?CTG?GGT?GAA?TGG?AAA?ACC?GAG?ATG?GAA?GAG?ACC?AAA 192

Val?Asp?Phe?Ser?Leu?Gly?Glu?Trp?Lys?Thr?Gln?Met?Glu?Glu?Thr?Lys

45 50 55

GCT?CAG?GAC?ATC?CTG?GGT?GCA?GTA?ACT?CTG?CTT?CTG?GAA?GGC?GTT?ATG 240

Ala?Gln?Asp?Ile?Leu?Gly?Ala?Val?Thr?Leu?Leu?Leu?Glu?Gly?Val?Met

60 65 70 75

GCT?GCA?CGT?GGC?CAG?CTT?GGC?CCG?ACC?TGC?CTG?TCT?TCC?CTG?CTT?GGC 266

Ala?Ala?Arg?Gly?Gln?Leu?Gly?Pro?Thr?Cys?Leu?Ser?Ser?Leu?Leu?Gly

80 85 90

CAG?CTG?TCT?GGC?CAG?GTT?CGT?CTG?CTG?CTC?GGC?GCT?CTG?CAG?TCT?CTG 336

Gln?Leu?Ser?Gly?Gln?Val?Arg?Leu?Leu?Leu?Gly?Ala?Leu?Gln?Ser?Leu

95 100 105

CTT?GGC?ACC?CAG?CTG?CCG?CCA?CAG?GGC?CGT?ACC?ACT?GCT?CAC?AAG?GAT 384

Leu?Gly?Thr?Gln?Leu?Pro?Pro?Gln?Gly?Arg?Thr?Thr?Ala?His?Lys?Asp

110 115 120

CCC?AAT?GCC?ATC?TTC?CTG?AGC?TTC?CAA?CAC?CTG?CTC?CGA?GGA?AAG?GTG 432

Pro?Asn?Ala?Ile?Phe?Leu?Ser?Phe?Gln?His?Leu?Leu?Arg?Gly?Lys?Val

125 130 135

CGT?TTC?CTG?ATG?CTT?GTA?GGA?GGG?TCC?ACC?CTC?TGC?GTC?AGG?CGG?GCC 480

Arg?Phe?Leu?Met?Leu?Val?Gly?Gly?Ser?Thr?Leu?Cys?Val?Arg?Arg?Ala

140 145 150 155

CCA?CCC?ACC?ACA?GCT?GTC?CCC?AGC?AGA?ACC?TCT?CTA?GTC?CTC?ACA?CTG 528

Pro?Pro?Thr?Thr?Ala?Val?Pro?Ser?Arg?Thr?Ser?Leu?Val?Leu?Thr?Leu

160 165 170

AAC?GAG?CTC?TAATGAGAAT?TC 549

Asn?Glu?Leu

Claims (34)

1. one kind has the active method for producing protein of TPO, and this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-332 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-332 shown in the SEQ ID NO:191 and

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell.

2. the process of claim 1 wherein that described replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

3. the process of claim 1 wherein that described replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

4. one kind has the active method for producing protein of TPO, and this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-231 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-231 shown in the SEQ ID NO:191 and

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell.

5. the method for claim 4, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

6. the method for claim 4, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

7. one kind has the active method for producing protein of TPO, and this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-163 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-163 shown in the SEQ ID NO:191 and

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell.

8. the method for claim 7, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

9. the method for claim 8, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

10. claim 1,4 or 7 method, wherein said protein in its aminoacid sequence, contain at least one following (a) to (amino acid mutation v) shown in any one:

(a) in the position 1 Ser residue and in the position 3 Ala residue is replaced by Ala and Val residue respectively;

(b) 25 Arg is replaced by the Asn residue in the position;

(c) 33 His residue is replaced by the Thr residue in the position;

(d) in the position 25 Arg residue and in the position 231 Glu residue is replaced by Asn and Lys residue respectively;

(e) disappearance in the position 33 His residue;

(f) disappearance in the position 116 Gly residue;

(g) disappearance in the position 117 Arg residue;

(h) the Thr residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(i) the Ala residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(j) the Gly residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(k) the Gly residue is inserted between the Pro residue of the His residue of position 33 and position 34, and 38 Pro residue is replaced by the Ser residue in the position;

(l) the Asn residue is inserted between the Arg of the Gly of position 116 and position 117;

(m) the Ala residue is inserted between the Arg of the Gly of position 116 and position 117;

(n) the Gly residue is inserted between the Arg of the Gly of position 116 and position 117;

(o) 129 Leu residue is replaced by the Arg residue in the position;

(p) 133 His residue is replaced by the Arg residue in the position;

(q) 143 Met residue is replaced by the Arg residue in the position;

(r) 82 Gly residue is replaced by the Leu residue in the position;

(s) 146 Gly residue is replaced by the Leu residue in the position;

(t) 148 Ser residue is replaced by the Pro residue in the position;

(u) 59 Lys residue is replaced by the Arg residue in the position;

(v) 115 Gln residue is replaced by the Arg residue in the position;

11. the method for any one in the claim 1 to 10 is wherein at the terminal polypeptide that further adds of described proteinic C-: Thr Ser Ile Gly Thr Pro Tyr Asp Val Pro Asp TyrAla Gly Val His His His His His His.

12. the method for any one in the claim 1 to 11 is wherein further added Met and Lys residue respectively in described proteinic position-2 and-1 place.

13. the method for any one in the claim 1 to 12 is wherein further added the Met residue at place, described proteinic position-1.

14. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding is by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-332 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-332 shown in the SEQ ID NO:191

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell and

C) separation and purification is described has the active protein of TPO.

15. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding is by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-231 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-231 shown in the SEQ ID NO:191

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell and

C) separation and purification is described has the active protein of TPO.

16. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) transform prokaryotic cell prokaryocyte or eukaryotic cell with DNA, described dna encoding is by the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of position 1-163 shown in the SEQ ID NO:191 or the aminoacid sequence by position 1-163 shown in the SEQ ID NO:191

B) cultivate described prokaryotic cell prokaryocyte or eukaryotic cell and

C) separation and purification is described has the active protein of TPO.

17. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) express a kind of protein, the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein by position 1-332 shown in the aminoacid sequence of position 1-332 shown in the SEQ ID NO:191 or the SEQ ID NO:191 form and

B) separate described protein.

18. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) express a kind of protein, the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein by position 1-231 shown in the aminoacid sequence of position 1-231 shown in the SEQ ID NO:191 or the SEQ ID NO:191 form and

B) separate described protein.

19. one kind has the active method for producing protein of TPO, this method may further comprise the steps:

A) express a kind of protein, the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein by position 1-163 shown in the aminoacid sequence of position 1-163 shown in the SEQ ID NO:191 or the SEQ ID NO:191 form and

B) separate described protein.

20. carrier, described carrier comprises coding and has an active protein DNA of TPO, and the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein with position 1-332 shown in the aminoacid sequence of position 1-332 shown in the SEQ ID NO:191 or the SEQ ID NO:191 is represented.

21. the carrier of claim 20, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

22. the carrier of claim 21, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

23. carrier, described carrier comprises coding and has an active protein DNA of TPO, and the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein with position 1-231 shown in the aminoacid sequence of position 1-231 shown in the SEQ ID NO:191 or the SEQ ID NO:191 is represented.

24. the carrier of claim 23, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

25. the carrier of claim 23, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

26. carrier, described carrier comprises coding and has an active protein DNA of TPO, and the aminoacid sequence that contains one or more amino acid whose replacements, disappearance, insertion and/or interpolation in the aminoacid sequence of described protein with position 1-163 shown in the aminoacid sequence of position 1-163 shown in the SEQ ID NO:191 or the SEQ ID NO:191 is represented.

27. the carrier of claim 26, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 or 2 amino acid.

28. the carrier of claim 27, wherein said replacement, disappearance, insertion and/or interpolation relate to 1 amino acid.

29. claim 20,23 or 26 carrier, wherein said protein in its aminoacid sequence, contain at least one following (a) to (amino acid mutation v) shown in any one:

(a) in the position 1 Ser residue and in the position 3 Ala residue is replaced by Ala and Val residue respectively;

(b) 25 Arg is replaced by the Asn residue in the position;

(c) 33 His residue is replaced by the Thr residue in the position;

(d) in the position 25 Arg residue and in the position 231 Glu residue is replaced by Asn and Lys residue respectively;

(e) disappearance in the position 33 His residue;

(f) disappearance in the position 116 Gly residue;

(g) disappearance in the position 117 Arg residue;

(h) the Thr residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(i) the Ala residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(j) the Gly residue is inserted between the Pro residue of the His residue of position 33 and position 34;

(k) the Gly residue is inserted between the Pro residue of the His residue of position 33 and position 34, and 38 Pro residue is replaced by the Ser residue in the position;

(l) the Asn residue is inserted between the Arg of the Gly of position 116 and position 117;

(m) the Ala residue is inserted between the Arg of the Gly of position 116 and position 117;

(n) the Gly residue is inserted between the Arg of the Gly of position 116 and position 117;

(o) 129 Leu residue is replaced by the Arg residue in the position;

(p) 133 His residue is replaced by the Arg residue in the position;

(q) 143 Met residue is replaced by the Arg residue in the position;

(r) 82 Gly residue is replaced by the Leu residue in the position;

(s) 146 Gly residue is replaced by the Leu residue in the position;

(t) 148 Ser residue is replaced by the Pro residue in the position;

(u) 59 Lys residue is replaced by the Arg residue in the position;

(v) 115 Gln residue is replaced by the Arg residue in the position;

30. the carrier of any one in the claim 20 to 29 is wherein at the terminal polypeptide that further adds of described proteinic C-: Thr Ser Ile Gly Thr Pro Tyr Asp Val Pro Asp TyrAla Gly Val His His His His His His.

31. the carrier of any one in the claim 20 to 30 wherein further adds Met and Lys residue respectively in described proteinic position-2 and-1 place.

32. the carrier of any one in the claim 20 to 31 wherein further adds the Met residue at place, described proteinic position-1.

33. the carrier of any one in the claim 20 to 32, wherein said carrier also have the promotor of expressing usefulness for described DNA.

34. the carrier of any one in the claim 20 to 33, wherein said carrier also has selective marker.

Images