CN1640241A - Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process - Google Patents
Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process Download PDFInfo
- Publication number
- CN1640241A CN1640241A CN 200410084694 CN200410084694A CN1640241A CN 1640241 A CN1640241 A CN 1640241A CN 200410084694 CN200410084694 CN 200410084694 CN 200410084694 A CN200410084694 A CN 200410084694A CN 1640241 A CN1640241 A CN 1640241A
- Authority
- CN
- China
- Prior art keywords
- pollen
- gene
- transformant
- plant
- osmosis process
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention discloses a transgenic method for transforming plant potten by utilizing agrobacterium vacuum infiltration process. It is characterized by that it utilzies Agrobacterium tumefaciens to infect plant pollen in pollen culture medium, and adds the vacuum-puming treatment to raise infection effect, then the transformed pollen can be pollinated on the pistillate stigma of the variety to be improved so as to obtain transformed seed and its plant. The transformant can be undergone the processes of antibiotic screening and detection and verification of GUS expression, PCR amplification and Southern and Northern hybridization.
Description
Technical field
The present invention relates to plant genetics and breeding, relate in particular to a kind of transgenic method of transforming plant pollen by agricultural bacillus vacuum osmosis process.
Background technology
Any gene transformation method all should select competent cell as acceptor, and the efficient of genetic transformation is increased.Existing research thinks that the aperture of an acellular wall is arranged at the pollen tube top of sprouting, and allogenic material can be absorbed thus, has the characteristics of competent cell.Therefore, when ripe pollen germination initial period mixed mutually with exogenous genetic material DNA, foreign DNA was easily absorbed by pollen grain, thereby became the andro gamete that is transformed by foreign gene.After andro gamete after transforming and oogamete merged, the fertilized egg cell formed the transgenosis embryo by differentiation and growth course.
Since many germination of pollen tube hole is arranged on the plant flowers powder, the pollen germination culture fluid that adopts suitable Premeabilisation of cells to press, and the pollen that makes firm initial sprouting is easily by agroinfection.Again because most pollen grains have a lot of intensive thorn-like projections, add the Tween-20 surfactant and vacuumize processing, can break through the surface tension of hydrone between the thorn-like projection in the culture fluid, promote that Agrobacterium contacts with pollen germination pore place pollen tube, improve transformation efficiency
It is present method more clearly and comparatively ripe technically on transformation mechanism that agriculture bacillus mediated plant gene transforms.Therefore, utilizing the agriculture bacillus mediated pollen with firm initial sprouting is the gene transformation method of recipient cell, can obtain to transform pollen, and it is pollinated on pistil stigma, utilizes pollen natural insemination process, obtains transformed the seed.Technology path according to this, on the one hand can omit the desired tissue culture procedures of traditional gene transformation method, problem, the problem includes: the chimerism problem between conversion and non-transformed cell when the pollen that has unicellular characteristic on the other hand can avoid the agroinfection many cells to organize as the recipient cell that transforms.And that this method had was simple to operation, and expense is lower, and the advantage that directly obtains transformed the seed etc., makes with pollen very tempting as the application prospect of transformed acceptor cell.
Summary of the invention
The transgenic method that the purpose of this invention is to provide a kind of transforming plant pollen by agricultural bacillus vacuum osmosis process.The step of method is as follows:
1), adopt the artificial method of sprouting of pollen, the pollen of gathering is cultivated in the pollen germination liquid nutrient medium,, regulate osmotic pressure and make pollen germination as the conditioning agent of regulating pollen osmotic pressure with sucrose;
2), the pollen of gathering is cultivated in containing the pollen germination culture fluid of Agrobacterium, add the surfactant of Tween-20, and vacuumize;
3), will invest on the pistil stigma of having castrated through pollen and culture fluid that agroinfection is handled, bagging is isolated the pollution prevent other pollen, obtains transformed the seed and plant thereof.
The present invention can obtain to have the conversion pollen of vigor with the method for Agrobacterium tumefaciems infection plant's pollen in the pollen germination medium, and it is invested pistil stigma, finish fertilization, bear normal seed, through resistance screening, Molecular Detection and gene expression checking, obtain transfer-gen plant again.The acceptor of this method is the pollen with unicellular characteristic, there are not the conversion of many cells (tissue) acceptor appearance when transforming and the chimerism between non-transformed cell, omitted the desired tissue culture procedures of traditional gene transformation method, also avoided such as the problem of perception of pollen tube passage method on transformation mechanism, method for transformation is more simple and efficient.
Embodiment
The Agrobacterium tumefaciems infection plant's pollen in the pollen culture fluid that contains hygromycin gene, gus gene and external source genes of interest, add and vacuumize processing, the conversion pollen that obtains is invested on the pistil stigma, by fertilization nature knot seed, transformant is screened through the moisture resistance mycin again, and GUS expression, pcr amplification, Sothern and Northern hybridization detection and checking, acquisition at last contains the plant transgenic method of external source genes of interest.
The concrete steps of the transgenic method of transforming plant pollen by agricultural bacillus vacuum osmosis process are as follows:
1, the preparation of Agrobacterium tumefaciems: picking has single bacterium colony of the agrobacterium strains of double base plasmid vector (containing hygromycin gene, gus gene and external source genes of interest) from the fresh flat board, access contains in the LB bacteria culture media of gentamicin 50mg/L and kanamycin 50mg/L, in insulating box, shake overnight incubation (28 ℃, 200r/min, about 17～18h), next day, the ratio with 1: 10 inserted continuation cultivation 5-6h in the freshly prepared LB liquid nutrient medium, was ready for use on conversion.
2, pollen culture medium preparation: adopt the pollen germination liquid nutrient medium, contain 0.1%H
3BO
3, 0.3%Ca (NO
3)
2-4H
2O, 0.2%MgSO
4-7H
2O, 0.1%KNO
3And sucrose, wherein sucrose is as the conditioning agent of regulating pollen osmotic pressure, and the suitableeest sucrose concentration of pollen germination is 45%-50%.
3, agroinfection pollen: cultured Agrobacterium in the centrifugal 10min of 3000rpm, is collected thalline, be resuspended in the above-mentioned pollen germination culture fluid of preparing, and add a surfactant (Tween-20, concentration is about 1 ‰); The fresh pollen and the Agrobacterium of collecting are cultivated altogether, and vacuumize (pressure :-80Pa, time: 20min-30min), pollinate then and castrate at dusk on the column cap of bagging isolation the previous day.
4, the acquisition of transformed the seed: the plant column cap is after above-mentioned pollen pollination, and pollen is sprouted on column cap, and pollen tube stretches in style, and spermiovum merges, and ovary is expanded into fruit, ripe back results transformed the seed wherein.
5, the screening of transformant, detection and checking:
1), screen transformant with antibiotic: transformed the seed is behind sulfuric acid lint and mercuric chloride sterilization, place and sprout on the MS solid culture medium that contains the 50mg/L hygromycin and growth, with non-transformed the seed is contrast, moisture resistance mycin situation when observing seed germination and growth, eliminate non-resistance seedling, keep resistance seedling (positive transformant).For further eliminating the false positive seedling, can smear the plant spire with 500mg/L hygromycin solution again, according to the resistance reaction of being smeared spire, eliminate the seedling of resistance difference after 5-8 days, keep the seedling of resistance.
2), detect the expression of gus gene in the transformant: the transformant after the hygromycin resistance screening with tissue reaction, get its tissue, they are placed the Eppendorf pipe, add 2 times to the GUS of tissue volume dyeing liquor, vacuumize, 37 ℃ of incubated overnight, till being organized in after the dyeing decoloured in the FAA destainer and presented white to non-transformant (contrast) material, observe transformant and organize the GUS reaction, or make paraffin section and observe, the positive transformant histocyte shows blue reaction.
3), detect the integration of genes of interest in the transformant: be used for the transformant DNA CTAB method extraction that PCR detects with pcr amplification; The pcr amplification primer is the distinguished sequence P1 (upstream) and the P2 (downstream) of external source genes of interest, and reaction system contains 2 * GC buffer I, 12.5 μ l, dNTP (concentration is 2.5mmol) 4 μ l, each 1 μ l of P1 and P2 (concentration is 10mmol), TaqaLA 0.2 μ l, template DNA 1 μ l adds ddH
2O to 25 μ l; Response procedures is 95 ℃ of pre-sex change 5min, 30 circulations of 94 ℃ of 30s, 55 ℃ of 1min and 72 ℃ of 2min, and 72 ℃ of 10min extend and 4 ℃ of preservations then.With non-transformant is contrast, and the PCR test of resistant plants Seven product is carried out electrophoretic separation, and the PCR product of positive transformant contains the dna sequencing fragment of foreign gene.
4), detect the integration of genes of interest in the transformant: from transformant, extract DNA with Southern hybridization, with non-transformant is contrast, behind the DNA digestion with restriction enzyme, in Ago-Gel, separate, dna fragmentation after the separation is needed on the nylon membrane,, hybridizes with the DNA on the nylon membrane as probe with isotope-labeled external source genes of interest, through the autoradiograph of X-ray sheet, positive transformant demonstrates the hybridization signal band because of containing genes of interest.
5), detect the expression of genes of interest in the transformant: from the transformant cell or tissue of external source destination gene expression, extract RNA with Northern hybridization, with non-transformant is contrast, RNA separates in the denaturing formaldehyde Ago-Gel, RNA after the separation is needed on the nylon membrane, with isotope-labeled external source genes of interest as probe, with the RNA hybridization on the nylon membrane, through the autoradiograph of X-ray sheet, positive transformant demonstrates the hybridization signal band because of the expression of genes of interest.
Embodiment:
Example below in conjunction with the cotton transgenic breeding elaborates to the present invention:
1, transforms required stock
1), plant: the male sterile recovery system of cotton cells matter " G007 ", it is brown that fiber is.
2), pollen: take from bloomed the same day pollen grain in the fresh flower pesticide of flower of restoring line of cotton " G007 ".
3), agrobacterium strains: the GV3101 Agrobacterium tumefaciems that has binary vector pCAMBIA1301, this carrier has the T-DNA left and right arms, contain 1 reporter gene (gus gene), 1 selectable marker gene (hygromycin gene between left and right arms, hpt) and 2 external source genes of interest [the cellulose synzyme of Acetobacter xylinum (cellulose synthetase in Acetobacter xylinum) gene, acsA+acsB] sequence; Gene expression is by the CaMV35s promoters driven, and gus gene also contains intron, can only express in eucaryote.
4), Agrobacterium medium: the LB bacteria culture media that contains gentamicin 50mg/L and kanamycin 50mg/L.
5), pollen germination medium: contain 0.1%H
3BO
3, 0.3%Ca (NO
3)
2-4H
2O, 0.2%MgSO
4-7H
2O, 0.1%KNO
3Liquid nutrient medium with 45% sucrose.Wherein sucrose is as the conditioning agent of pollen grain osmotic pressure, and debita spissitudo sucrose can make pollen grain be in the complete sum activated state.
2, the method for Zhuan Huaing
1), agroinfection pollen: the single bacterium colony of picking Agrobacterium from the solid plate, in Agrobacterium liquid medium, cultivate, as the OD of bacterium liquid
600When value was 0.5-0.8, centrifugal (3000rpm 10min) collected thalline, in the pollen germination medium that is resuspended in, adds a surfactant (Tween-20, concentration is about 1 ‰); Fresh pollen and Agrobacterium are cultivated altogether, and vacuumize (pressure :-80Pa), duration 30min obtains the cotton pollen that transforms.
There are a lot of intensive thorn-like projections on cotton pollen grain surface, add the Tween-20 surfactant and vacuumize processing, can break through the surface tension of hydrone between the thorn-like projection in the culture fluid, promote that Agrobacterium contacts with pollen germination pore place pollen tube, improve transformation efficiency.
Whether the pollen after the conversion has vitality, identifies with three kinds of methods.One, with benzidine-alpha naphthol decoration method, all dark the and normal pollen of form is viable pollen by benzidine-alpha naphthol dyeing, shallow, the colourless or paramorph pollen that dyes is weak vitality and previable pollen; They are two years old, with cotton indigo plant-lactic acid-phenol method, pollen is sprouted after investing column cap, grows pollen tube and stretches to blastular, the style of getting at this moment dyes through cotton indigo plant-lactic acid-phenol, and great-hearted pollen demonstrates dyes Regulation and Blue Flowers tube cell (other histocyte is colourless or faint yellow) normal extension in style; Its three, after viable pollen is invested column cap, can impel ovary to expand, bear normal seed.
2), transform the pollination of pollen: the cotton pollen after the above-mentioned processing is invested on the column cap of castrating the bagging isolation, continued bagging and isolate, to prevent the pollution of other pollen; For improving bolling rate, the gibberellin of available 100ppm is smeared the ovary after the pollination; Simultaneously the flower of handling of not pollinating on the same cotton plant is carried out selfing, as negative control; Be mark and flower that the differentiation pollination is handled and selfing is handled and the cotton boll of tying later on thereof, on anthocaulus, hang with the plate of record.
3), the results of transformed the seed:, from the blow-of-cottons cotton boll that pollination is handled and selfing is handled, gather in the crops seed respectively according to the record of plate; Wherein, the seed of gathering in the crops from the cotton boll that pollination is handled is a transformed the seed, and the seed of gathering in the crops from the cotton boll that selfing is handled is selfed seed (non-transformed the seed, contrast); It is standby that seed dries the back.
3, the screening of transformant
1) during seed germination to the screening of hygromycin resistance: transformed the seed is behind sulfuric acid lint and mercuric chloride sterilization, place and sprout on the MS solid culture medium that contains the 50mg/L hygromycin and growth, with non-transformed the seed is contrast, when observing seed germination and growth to the situation of hygromycin resistance, eliminate non-resistance seedling, keep the resistance seedling; The resistance transplantation of seedlings is to soil.
2) resistance screening of transplanting back transformant:, smear spire with 500mg/L hygromycin solution again and carry out the resistance screening second time for further eliminating the false positive transformant; With non-transformant is contrast, and 3 leaves that fall of transformant cotton plant are smeared with hygromycin solution, according to the resistance reaction of being smeared spire, eliminates the plant of resistance difference, the plant that keeps resistance after 5-8 days.The plant of resistance is ready for use on the DAN Molecular Detection and the checking of transformant.
4, the DAN Molecular Detection and the checking of transformant
1), detects the expression of gus gene in the transformant: the transformant after the hygromycin resistance screening with tissue reaction, get its bloom back ovule and fiber thereof of 5-10 days, they are placed the Eppendorf pipe, add 2 times to the GUS of tissue volume dyeing liquor, vacuumize, 37 ℃ of incubated overnight, till being organized in after the dyeing decoloured in the FAA destainer and presented white to non-transformant (contrast) material, observe transformant and organize the GUS reaction, or make paraffin section and observe, the positive transformant histocyte shows blue reaction.
2), detect the integration of genes of interest in the transformant with pcr amplification: the transformant DNA that is used for the PCR detection extracts from cotton leaf with the CTAB method; The pcr amplification primer is the distinguished sequence P1 (upstream) and the P2 (downstream) of external source genes of interest (acsA+acsB), wherein:
AcsA gene P1:5 ' GCGCGGATCCGAACCGTGAAAATGGTTTCG3 ',
P2：5‘CCCCAAGCTTTCGTTTATGGGTCACGACTT3’；
AcsB gene P1:5 ' GCGCGGATCCGAACCGTGAAAATGGTTTCG3 ',
P2：5‘CCCCAAGCTTTCGTTTATGGGTCACGACTT3’。
Reaction system contains 2 * GC buffer I, 12.5 μ l, dNTP (concentration is 2.5mmol) 4 μ l, and each 1 μ l of P1 and P2 (concentration is 10mmol), TaqaLA 0.2 μ l, template DNA 1 μ l adds ddH
2O to 25 μ l; Response procedures is 95 ℃ of pre-sex change 5min, 30 circulations of 94 ℃ of 30s, 55 ℃ of 1min and 72 ℃ of 2min, and 72 ℃ of 10min extend and 4 ℃ of preservations then.With non-transformant is contrast, and the PCR test of resistant plants Seven product is carried out electrophoretic separation, and the PCR product of positive transformant contains the dna sequencing fragment of foreign gene.
3) hybridize the integration that detects genes of interest in the transformant with Southern: from transformant, extract DNA, with non-transformant is contrast, getting 10 μ g DNA cuts in 37 ℃ of enzymes with HindIII and BamHI respectively and spends the night, DNA after enzyme is cut separates in 0.9% Ago-Gel, and be needed on the nylon membrane, with the genes of interest (acsA or acsB) of isotope 32P mark as probe, with the DNA hybridization on the nylon membrane, through the autoradiograph of X-ray sheet, positive transformant demonstrates the hybridization signal band because of containing genes of interest.
4) hybridize the expression that detects genes of interest in the transformant with Northern: from transformant is bloomed back 10 days ovule, extract total RNA, with non-transformant is contrast, RNA separates in the Ago-Gel of 1.2% denaturing formaldehyde, and the RNA after the separation is needed on the nylon membrane, with isotope
32The genes of interest of P mark (acsA or acsB) is as probe, and with the RNA hybridization on the nylon membrane, after the autoradiograph of X-ray sheet, positive transformant demonstrates the hybridization signal band because of the expression of genes of interest.
The fiber quality index of table 1 transgene cotton strain system
The fiber quality index
(from generation to generation) length specific strength mic value cellulose contains the fraction of the year of genotype
(mm) (gf/tex) (μ g/in) measures (%)
2001(T
1) 28.3±1.1 24.29±0.5 3.5±0.2 87.6±2.1
Transgenic line 2002 (T
2) 29.4 ± 1.4 24.05 ± 0.8 4.0 ± 0.2 89.2 ± 3.0
Average 28.85 24.17 3.75 88.40
2001 24.6±0.8 21.04±0.4 4.4±0.2 80.02±1.2
(contrast) 2,002 25.5 ± 1.1 20.14 ± 0.5 4.1 ± 0.3 85.12 ± 1.3 of non-transgenic strain system
Average 25.05 20.59 4.25 82.57
Difference 3.80
*3.58
*-0.50 5.83
*
Comparison is according to increase and decrease (%) 15.17 17.38-11.76 7.06
*Be illustrated in the significant difference on 0.05 probability level
Through above-mentioned to enforcement of the present invention, cellulose synthase gene acsA and acsB with Acetobacter xylinum, infect the pollen of brown restoring line of cotton by the Agrobacterium vacuum infiltration method, metainfective pollen is pollinated on the cotton column cap, obtain transformed the seed, through antibiotic screening, and the detection and the checking of GUS expression, pcr amplification and Southern hybridization etc., finally obtained the transgene cotton (table 1) that fiber quality is improved to some extent, this shows that this method is a feasibility.
Claims (4)
1, a kind of transgenic method of transforming plant pollen by agricultural bacillus vacuum osmosis process, the step of method is as follows:
1) in-vitro pollen is cultivated
The pollen of gathering is cultivated in the pollen germination culture fluid, as the conditioning agent of regulating pollen osmotic pressure, regulated osmotic pressure and make pollen germination with sucrose;
2) agroinfection pollen is handled
To in the pollen germination culture fluid, cultivate altogether through the pollen and the Agrobacterium of cultured in vitro, and add the surfactant of Tween-20, and vacuumize;
3) pollination
To invest on the pistil stigma of having castrated through the pollen that agroinfection is handled, bagging is isolated, and obtains transformed the seed and plant thereof.
2, the transgenic method of a kind of transforming plant pollen by agricultural bacillus vacuum osmosis process according to claim 1 is characterized in that the percentage by weight of said pollen germination culture fluid is: 0.1%～0.12%H
3BO
3, 0.3%～0.4%Ca (NO
3)
2-4H
2O, 0.2%～0.23%MgSO
4-7H
2O, 0.1%～0.12%KNO
3, 45%～50% sucrose, all the other are water.
3, the transgenic method of a kind of transforming plant pollen by agricultural bacillus vacuum osmosis process according to claim 1, it is characterized in that said Agrobacterium is the engineering Agrobacterium tumefaciems that has the Ti-plasmids carrier, carrier has gus gene (β-glucuronidase gene), hygromycin gene (Hygromycin phosphotransferase (HPT) gene) and external source genes of interest; Gene expression is by the CaMV35s promoters driven; Gus gene contains intron, can express in eukaryotic cells.
4, the transgenic method of a kind of transforming plant pollen by agricultural bacillus vacuum osmosis process according to claim 1 is characterized in that the concentration of said Tween-20 is about 1～2 ‰, the pressure that is vacuumized is-70～-80Pa, the time is 20min～30min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410084694 CN1640241A (en) | 2004-11-23 | 2004-11-23 | Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410084694 CN1640241A (en) | 2004-11-23 | 2004-11-23 | Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1640241A true CN1640241A (en) | 2005-07-20 |
Family
ID=34869252
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410084694 Pending CN1640241A (en) | 2004-11-23 | 2004-11-23 | Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1640241A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457235B (en) * | 2008-08-05 | 2011-04-27 | 山东省林业科学研究院 | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation |
| CN102212552A (en) * | 2011-05-06 | 2011-10-12 | 西南大学 | Method for transforming genes by using efficient living body of chemical male sterilant |
| CN102392045A (en) * | 2011-11-24 | 2012-03-28 | 西南大学 | Mulberry pollen mediated transgenic method |
| CN102864168A (en) * | 2012-10-23 | 2013-01-09 | 吉林农业大学 | Improved method for converting plant pollen tube |
-
2004
- 2004-11-23 CN CN 200410084694 patent/CN1640241A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457235B (en) * | 2008-08-05 | 2011-04-27 | 山东省林业科学研究院 | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation |
| CN102212552A (en) * | 2011-05-06 | 2011-10-12 | 西南大学 | Method for transforming genes by using efficient living body of chemical male sterilant |
| CN102392045A (en) * | 2011-11-24 | 2012-03-28 | 西南大学 | Mulberry pollen mediated transgenic method |
| CN102392045B (en) * | 2011-11-24 | 2013-09-18 | 西南大学 | Mulberry pollen mediated transgenic method |
| CN102864168A (en) * | 2012-10-23 | 2013-01-09 | 吉林农业大学 | Improved method for converting plant pollen tube |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102127567B (en) | Ultrasonic-assisted pollen mediated plant genetic transformation method | |
| CN102154364A (en) | Method for agrobacterium tumefaciens-mediated genetic transformation of sugarcane | |
| CN1884518B (en) | Directional gene transfer method of cabbage type rape C chromosome set | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN101186926B (en) | Modified method for transforming gramineous crop by agrobacterium mediated flower-dipping method | |
| JP2000510325A (en) | Method for propagation and / or selection of plant material | |
| CN110946050A (en) | Method for enriching jujube witches broom phytoplasma by using catharanthus roseus | |
| CN101691583A (en) | Agrobacterium-mediated cotton transgenic method independent of tissue culture | |
| CN105039353A (en) | Gene CaMS1 related to chili pollen development and application thereof | |
| CN113355245B (en) | Application of endophytic fungus FO-R20 in prevention and treatment of rice panicle blast | |
| CN101928724A (en) | Mechanical hybrid rice seed production method utilizing transgenic technology of chloroplasts | |
| CN101186910B (en) | Transgene method for peanut | |
| CN110331167B (en) | Corn genotype-independent DNA introduction method | |
| CN1640241A (en) | Transgenic method for transforming plant pollen by agricultural bacillus vacuum osmosis process | |
| CN108588002B (en) | Method for obtaining embryogenic callus of millet for genetic transformation and genetic transformation | |
| CN115261237B (en) | Strain for promoting germination of azalea seeds and application thereof | |
| US20230132082A1 (en) | Agrobacterium-mediated genetic transformation method for sea barleygrass | |
| CN1233833C (en) | Method for breeding salt-resistant tomato utilizing atriplex hortensis BADH gene transfer | |
| CN114292759B (en) | Fusarium oxysporum with function of preventing and treating tobacco continuous cropping obstacle | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN113151258B (en) | Flanking sequence of exogenous insertion fragment of insect-resistant transgenic maize AM63 insertion site and application thereof | |
| CN102676576A (en) | Method for improving moisture resistance of cabbage type rape | |
| CN1291024C (en) | Agrobacterium mediated transformation system for obtaining perennial rye-grass transgenic plant in high efficiently and its use | |
| CN101451149B (en) | Tumefaciens mediated high efficiency corn genetic transformation method | |
| Ozyigit et al. | Efficient shoot and root formation from cotton shoot apices |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |