CN1624119A - Enolase salt Du's algal enolase and its coding sequence - Google Patents

Abstract

A novel salt resistance associated protein-Du's halophitic alga enolase, the polynucleotide for coding it, the process for preparing said enolase by recombination, the application of said polynucleotide and the method for improving the salt resistance of plant by said enolase are disclosed.

Description

Dunaliella salina enolase and its coding sequence

Technical Field

The present invention belongs to the field of biology, and is especially polynucleotides encoding salt tolerance associated protein-enolase of Dunaliella salina (Dunaliella salina) and the polypeptide encoded by the polynucleotides. The present invention also relates to the application and preparation of the polynucleotides and polypeptides. Specifically, the polypeptide of the invention is a novel salt tolerance related protein.

Background

Currently, the world population is increasing, while the arable land is decreasing. However, there are many land resources on earth that cannot be effectively used due to salinization. In order to effectively utilize these salinized land resources, plant varieties that are suitable for growth and have high economic value have been sought. However, to date, there are no very suitable plant varieties.

Another method for developing saline-alkali tolerant plants is to improve existing plant species, especially those with higher economic value. However, traditional methods of plant improvement are time consuming, laborious, and lack of specificity.

In order to effectively and specifically improve the salt tolerance of plant varieties, the development of genes and proteins related to the salt tolerance is urgently needed in the field.

Disclosure of Invention

An object of the present invention is to provide a novel salt tolerance associated protein enolase of dunaliella salina, and fragments, analogues and derivatives thereof.

Another object of the present invention is to provide polynucleotides encoding these polypeptides.

Another object of the present invention is to provide methods for producing these polypeptides and the use of the polypeptides and coding sequences, particularly in enhancing salt tolerance in plants.

The Dunaliella salina (Dunaliella salina) belongs to Chlorophyta, Chlorophyceae, Volvocales, Chordariaceae and Dunaliella, and mainly grows in high salinity water body, the cell morphology is generally oval, and when the external osmotic pressure changes, the cell morphology can be changed into a sphere shape to a spindle shape, the Dunaliella salina has two flagella with equal length and a cup-shaped chloroplast, a large number of β -carotene droplets can be accumulated at the outer edge of the chloroplast, the cell is orange red, the cell has no cell wall and has a coating formed by glycoprotein, the Dunaliella salina has a close relationship with Chlamydomonas (Chlamydomonas).

In a first aspect of the invention, there is provided a novel isolated enolase enzyme derived from dunaliella salina comprising: has the sequence shown in SEQ ID NO: 2, or a conservative variant thereof, or an active fragment thereof, or an active derivative thereof.

Preferably, the enzyme is selected from the group consisting of:

(a) has the sequence shown in SEQ ID NO: 2 amino acid sequence of a polypeptide;

(b) converting SEQ ID NO: 2 through substitution, deletion or addition of one or more amino acid residues, and has enolase function.

More preferably, the enzyme is a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence.

In a second aspect of the invention, there is provided a polynucleotide encoding an isolated dunaliella salina enolase, the polynucleotide comprising a nucleotide sequence which is at least 70%, preferably at least 80%, more preferably at least 90% identical to a nucleotide sequence selected from the group consisting of: (a) a polynucleotide encoding the above-mentioned dunaliella salina enolase; and (b) a polynucleotide complementary to polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the sequence of SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) has the sequence shown in SEQ ID NO: 1-1437 of 1; (b) has the sequence shown in SEQ ID NO: 1-1440 in position 1.

In a third aspect of the invention, there is provided a vector comprising the polynucleotide as described above, and a host cell transformed or transduced with the vector or directly transformed or transduced with the polynucleotide as described above.

In a fourth aspect of the invention, there is provided a method of preparing a dunaliella salina enolase, the method comprising: (a) culturing the transformed or transduced host cell under conditions suitable for expression; (b) isolating the dunaliella salina enolase from the culture.

In a fifth aspect of the invention, there is provided an antibody that specifically binds to the dunaliella salina enolase described above. Also provided are nucleic acid molecules useful for detection, which comprise contiguous 15-1440 nucleotides of the above polynucleotides.

In a sixth aspect of the invention, compounds are provided that mimic, promote, antagonize the activity of the enzyme dunaliella salina enolase, and compounds that inhibit the expression of the enzyme dunaliella salina enolase. Methods of screening and/or preparing these compounds are also provided.

In a seventh aspect of the present invention, there is provided a method for detecting the presence or absence of enolase in a sample, comprising: the sample is contacted with an antibody specific for the enolase enzyme and the formation of an antibody complex is observed, indicating the presence of the enolase enzyme in the sample.

In an eighth aspect of the invention, the use of the polypeptides and coding sequences of the invention is provided. For example, the polypeptides of the invention may be used for screening agonists for promoting the activity ofthe enzyme Dunaliella salina enolase, or for screening antagonists for inhibiting the activity of the enzyme Dunaliella salina enolase, or for peptide fingerprinting. The coding sequence or its fragment of the dunaliella salina enolase of the invention can be used as a primer for PCR amplification reaction, or as a probe for hybridization reaction, or used for manufacturing gene chip or microarray.

In a ninth aspect of the present invention, there is provided a method for improving salt tolerance of a plant, comprising the steps of:

(1) providing agrobacterium carrying an expression vector, wherein the expression vector contains an enolase DNA coding sequence, and the enolase is selected from the following group:

(a) has the sequence shown in SEQ ID NO: 2 amino acid sequence of a polypeptide;

(b) converting SEQ ID NO: 2 through substitution, deletion or addition of one or more amino acid residues, and has enolase function.

(2) Contacting a plant cell or tissue or organ with the Agrobacterium of step (1) such that the enolase DNA coding sequence is transferred into the plant cell and integrated into the chromosome of the plant cell;

(3) selecting plant cells or tissues or organs which are transferred with the DNA coding sequence of the enolase;

(4) regenerating the plant cell or tissue or organ of step (3) into a plant.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure of the technology herein.

Detailed Description

In the present invention, the terms "enolase (enolase)", "enolase protein", "enolase polypeptide" or "salt tolerance-related protein enolase" are used interchangeably and refer to a protein or polypeptide having the amino acid sequence (SEQ ID NO: 2) of the salt tolerance-related protein enolase of Dunaliella salina. They include salt tolerance-related protein enolases with or without the initial methionine.

The enolase-catalyzed reaction is as follows:

as used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated enolase protein or polypeptide" means that the enolase is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify enolase using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogs of the dunaliella salina enolase. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity of a native dunaliella salina enolase of the present invention. A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with an antigenic IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

In the present invention, the term "dunaliella salina enolase" refers to a polypeptide having the sequence of SEQ ID No.2 having dunaliella salina enolase activity. The term also includes variants of the sequence of SEQ ID No.2 having the same function as the dunaliella salina enolase. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similarproperties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the dunaliella salina enolase.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to dunaliella salina enolase DNA under high or low stringency conditions, and polypeptides or proteins obtained using antisera against dunaliella salina enolase. The invention also provides other polypeptides, such as fusion proteins comprising a dunaliella salina enolase or a fragment thereof. In addition to almost full-length polypeptides, the invention also includes soluble fragments of the dunaliella salina enolase. Typically, the fragment has at least about 10 contiguous amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the sequence of the enolase of dunaliella salina.

The analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., β, gamma-amino acids), it being understood that the polypeptides of the invention are not limited to the representative polypeptides exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications in the synthesis and processingof the polypeptide or in further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or to optimize solubility.

In the present invention, "Dunaliella salina enolase conservative variant polypeptide" refers to a variant of the polypeptide shown in SEQ ID NO: 2, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids are replaced by amino acids with similar or similar properties to form a polypeptide. These conservative variant polypeptides are preferably generated by amino acid substitutions according to Table 1.

TABLE 1

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln

Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；S er	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to SEQ ID NO: 1, or a degenerate variant thereof. As used herein, "degenerate variant" means in the present invention a variant that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, but not identical to SEQ ID NO: 1, or a variant thereof.

Encoding the amino acid sequence of SEQ ID NO: 2 comprises: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptides. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more. And, the polypeptide encoded by the hybridizable polynucleotide is complementary to the polypeptide of SEQ ID NO: 2 have the same biological functions and activities.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides in length. The nucleic acid fragments can be used in nucleic acid amplification techniques (e.g., PCR) to determine and/or isolate polynucleotides encoding enolase.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequence or the fragment of the marine dunaliella salina enolase can be obtained by a PCR amplification method, a recombination method or an artificial synthesis method. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells transformed with the vectors or enolase-encoding sequences of the invention, and methods for producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant enolase by conventional recombinant DNA techniques (Science, 1984; 224: 1431). Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a dunaliella salina enolase, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In the present invention, the dunaliella salina enolase polynucleotide sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector well known in the art. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing dunaliella salina enolase-encoding DNA sequences and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Representative examples are: escherichia coli, Streptomyces, Agrobacterium; fungal cells such as yeast; a plant cell; insect cells, and the like.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, the transformation may also be carried outThe method is carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc. The transformed plant may also be transformed by Agrobacterium transformation or gene gun transformation, such as leaf disk method. The transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain plants with improved salt tolerance.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The recombinant dunaliella salina enolase or polypeptide has various uses. For example for screening for antibodies, polypeptides or other ligands that promote or antagonize enolase function. Screening of polypeptide libraries with expressed recombinant dunaliella salina enolase can be used to find valuable polypeptide molecules that inhibit or stimulate the function of dunaliella salina enolase.

In another aspect, the invention also includes polyclonal and monoclonal antibodies, particularly monoclonal antibodies, specific for the polypeptides encoded by the dunaliella salina enolase DNA or fragments thereof. Preferably, those antibodies that bind to the product or fragment of the Dunaliella salina enolase gene but do not recognize and bind to other unrelated antigenic molecules. Antibodies of the present invention include those molecules that bind to and inhibit the enolase enzyme of dunaliella salina, and also include those antibodies that do not affect the enolase function of dunaliella salina. The invention also includes those antibodies which bind to the enolase gene product of Dunaliella salina in modified or unmodified form.

The present invention includes not only intact monoclonal or polyclonal antibodies, but also immunologically active antibody fragments, or chimeric antibodies.

The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. For example, a purified dunaliella salina enolase gene product, or antigenic fragment thereof, can be administered to an animal to induce the production of polyclonal antibodies. Similarly, cells expressing dunaliella salina enolase or antigenic fragments thereof can be used to immunize animals to produce antibodies. Such monoclonal antibodies can be prepared using hybridoma technology. The antibodies of the invention can be obtained by conventional immunization techniques using fragments or functional regions of the gene products of the Dunaliella salina enolase. These fragments or functional regions can be prepared by recombinant methods or synthesized using a polypeptide synthesizer. Antibodies that bind to an unmodified form of a dunaliella salina enolase gene product can be produced by immunizing an animal with a gene product produced in a prokaryotic cell (e.g., e.coli); antibodies that bind to post-translationally modified forms (e.g., glycosylated or phosphorylated proteins or polypeptides) can be obtained by immunizing an animal with a gene product produced in a eukaryotic cell (e.g., a yeast or insect cell).

The antibody against the dunaliella salina enolase can be used for detecting the dunaliella salina enolase in a sample. For example, the salt concentration in the production environment of dunaliella salina can be determined by quantitatively detecting enolase of the dunaliella salina and utilizing the correlation between enolase and the salt concentration.

Polyclonal antibody can be produced by immunizing animals such as rabbit, mouse, and rat with Dunaliella salina enolase or polypeptide. Various adjuvants may be used to enhance the immune response, including but not limited to Freund's adjuvant and the like.

The invention also relates to a test method for quantitatively and positionally detecting the level of the enolase of the dunaliella salina. These assays are well known in the art and include FISH assays and radioimmunoassays. The level of the dunaliella salina enolase detected in the test can be used for explaining the importance of the dunaliella salina enolase in the aspect of salt tolerance.

One method for detecting the presence of enolase in a test sample is to use an antibody specific for enolase to perform the detection, which comprises: contacting the sample with an enolase-specific antibody; observing whether an antibody complex is formed, the formation of an antibody complex is indicative of the presence of enolase in the sample.

A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing the differential expression analysis of genes in tissues. The enolase transcript can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using enolase specific primers.

In one embodiment of the invention, an isolated polynucleotide is provided that encodes a polypeptide having the sequence of SEQ id no: 2. The polynucleotides of the invention are isolated from Dunaliella salina cDNA libraries. The sequence is shown as SEQ ID NO: 1 comprising a polynucleotide sequence of 1440 bases in full length with an open reading frame at position 1-1437 encoding a dunaliella salina enolase of 479 amino acids in full length (SEQ ID NO: 2). The enolase provides a new way for improving the salt tolerance of plants, thereby having great application prospect.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1

Cloning of Dunaliella salina enolase Gene

1. Collection of Dunaliella salina (Collection)

Dunaliella salina (Dunaliella salina) was purchased from the Wuhan institute for aquatic organisms algal bank.

2.Poly A⁺Isolation of RNA (Poly A)⁺RNA isolation)

Total RNA from Dunaliella salina was extracted using Trizol reagent (Gibco, NY, USA). And (3) identifying the quality of the total RNA by formaldehyde denatured gel electrophoresis. mRNA from Dunaliella salina was extracted using the kit instructions provided by Oligotex mRNA Kits (Qiagen).

3. Construction of Dunaliella salina cDNA library (Cloning of Full-length cDNA)

A cDNA phage Library of Dunaliella salina was constructed using lambda Triplex2 as a vector using Kit instructions provided by the Smart cDNA Library Construction Kit (ClonTech).

4. Cloning of the Full Length of the Gene (Cloning of Full-length cDNA)

By comparing enolases from a number of different species (including Chlamydomonas reinhardtii, yeast, E.coli, etc.), a partial amino acid conserved sequence was determined. Primers were designed accordingly, and the full-length cloning of cDNA was carried out by RACE method (Gibco kit, NY, USA) in three stages:

(1) using primers with Poly A⁺RT-PCR amplification with RNA as template

The ratio of the oligonucleotide: 5 'ATATCTGTCCCGGAGCGGCT 3' (SEQ ID NO: 3) is the forward primer; oligonucleotide: 5 'GCTCACCACAGCACTCAGCACA 3' (SEQ ID NO: 4) as a reverse primer and Poly A + RNA as a template, RT-PCR amplification was performed under conditions of 94 ℃ for 5 minutes, followed by 35 cycles of 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, and 72 ℃ for 1 minute, and finally extension at 72 ℃ for 5 minutes. The PCR amplification product was electrophoretically detected to obtain a fragment of about 0.45kb in length, and the recovered fragment was ligated to a commercially available T-easy vector, and sequenced on an ABI377 sequencer (Perkin-Elmer, USA) using SP6 or T7 as a universal primer using a method of terminating fluorescent labeling (Big-Dye, Perkin-Elmer, USA) to obtain a 443bp sequence.

The nucleotide and protein homology search of the sequence and the protein sequence coded by the sequence in a Non-redundant GenBank + EMBL + DDBJ + Swissprot + Superdate + PIR database by using a BLAST program shows that the sequence has higher homology with the enolase gene of Chlamydomonas reinhardtii, and the correctness of a primer is confirmed.

(2).RACE

Design based on the above sequence analysis

5' RACE primer: 5 'GCGATGAAGCAGTCCTCAGTCCACCAG 3' (SEQ ID NO: 5)

3' RACE primer: 5 'ATTCAGTTTACATTTCAGGCCCGAGCGG 3' (SEQ ID NO: 6)

Using SMART^TMRACE cDNA Amplification Kit (Clontech) was performed according to the manual to obtain the 5 'and 3' terminal sequences of the halophytic Dunaliella enolase gene.

(3) The coding region of the enolase gene was amplified by PCR (same procedure as in (1)).

On the basis of splicing to obtain a full length (including a complete open reading frame), primers are further designed: the ratio of the oligonucleotide: 5 'ATTCAGTTTACATTTCAGGCCCGAGCGG 3' (SEQ ID NO: 7) is a forward primer; oligonucleotide: 5 'TTCCACCAAGCAACATAAGTCTACTCC 3' (SEQ ID NO: 8) as reverse primer, using Dunaliella salina total RNA extracted by conventional method as template, performing RT-PCR amplification, and cloning and sequencing PCR amplification product by conventional method. The result verifies the correctness of the full-length coding sequence of the dunaliella salina enolase protein.

The full-length sequence of the halophytic Dunaliella enolase gene is shown as SEQ ID NO: 1, wherein the reading frame position is 1-1437.

atggccaccg tgcaggagta catcgacaag caccagctgc agaaaaagac ggaggacgtg 60

ctcaacatcg cggtgaagtc caagcccgat gagccactgt ccttcctggc caaggagctg 120

ctcaggatgg ctccatcaga gatcttgaag gttgtaggcc gtcagatcat tgactctcgc 180

ggcaacccca ctgtggaggc agacgtgcac acccataagg gcatgttccg tgctgctgtg 240

ccctccggtg cctccactgg catccacgag gcagttgagc tgcgtgatgg cgacaagacc 300

aagttcctgg gcaagggtgt gcagaaggct gtggagagca tcaacaccat catcagcccc 360

gccctgaagg gcatggaccc caagaaccag agcgaggtgg accagaagat gatcgacctt 420

gatggcactc ccaacaaggc caagctgggt gccaatgcaa ttctggccgt ctccctggcc 480

actgccaagg ctggtgctgc cgagaaggaa gtgcctctgt acaggcacat tgctgacctg 540

gccggcaacc ccaagctgta cttgcccgtg ccagcgttca acatcatcaa cggcggcagc 600

cacgcaggca acgcccttgc catgcaggag ttcatgatct tacccactgg agcatcatct 660

ttctctgagg ccatgcgcat gggcactgag gtgtaccaca cactgaaggg catcatcaag 720

gccaagtacg gccaggatgc taccaacgtt ggtgatgagg gtggctttgc ccccaacatc 780

caatccaatg atgatggtct gtccttggtc accgatgcca ttgagaaggc aggatacact 840

ggcaaggtca agatcggcat ggacgtggct gcgtcagagt tcattaccga ggacaagatg 900

tacgacctga acctcaagca gcagcccaac gatggctccc acaagaagac agctgcccaa 960

atgctggaga tgtacaagga gttctgcacc aagtaccccg tcatctccat cgaggatccc 1020

ttcgagcagg atgactggga gcctgccaag tccctgactg cagagaacat ctgccaggtg 1080

gttggcgatg acatgctggt gacgaacccc atccgcgtca agcgcggcat tgagcagaag 1140

gcagtcaact ccttgctcct gaaggtcaac cagattggct ccctgactga gtccatcgag 1200

gccgtgagga tgtccaagga ggcaggctgg ggtgtgatga ccagccacag gtctggtgag 1260

actgaggact gcttcatcgc agacttggca gttggcctgt ccacaggcca gatcaagact 1320

ggtgctcctt gccgctctga gcgcaatgct aagtacaacc agctgctccg cattgaggag 1380

gagcttggcg agaatgcagt gtacgctggt gagaagtggc gcttcattga gtggcagtga 1440

(SEQ ID NO：1)

The halophytic Dunaliella enolase gene codes enolase consisting of 479 amino acids, and the sequence of the enolase is shown as SEQ ID NO: 2, respectively.

MATVQEYIDK HQLQKKTEDV LNIAVKSKPD EPLSFLAKEL LRMAPSEILK VVGRQIIDSR 60

GNPTVEADVH THKGMFRAAV PSGASTGIHE AVELRDGDKT KFLGKGVQKA VESINTIISP 120

ALKGMDPKNQ SEVDQKMIDL DGTPNKAKLG ANAILAVSLA TAKAGAAEKE VPLYRHIADL 180

AGNPKLYLPV PAFNIINGGS HAGNALAMQE FMILPTGASS FSEAMRMGTE VYHTLKGIIK 240

AKYGQDATNV GDEGGFAPNI QSNDDGLSLV TDAIEKAGYT GKVKIGMDVA ASEFITEDKM 300

YDLNLKQQPN DGSHKKTAAQ MLEMYKEFCT KYPVISIEDP FEQDDWEPAK SLTAENICQV 360

VGDDMLVTNP IRVKRGIEQK AVNSLLLKVN QIGSLTESIE AVRMSKEAGW GVMTSHRSGE 420

TEDCFIADLA VGLSTGQIKT GAPCRSERNA KYNQLLRIEE ELGENAVYAG EKWRFIEWQ 479

(SEQ ID N0：2)

Example 2

Structure and function of enolase protein of dunaliella salina

The full-length sequence of the Dunaliella salina enolase gene and the protein coded by the gene are subjected to nucleotide and protein homology search in a Non-redundant GenBank + EMBL + DDBJ + PDB and a Non-redundant GenBank cdstranslations + PDB + SwissProt + PIR database by using a BLAST program, and as a result, the gene is found to have 83% identity with the enolase mRNA coding sequence (GenBank Accession No. X66412) of the caenorhabditis elegans (C.elegan) and 84% identity and 89% similarity with the enolase protein of Chlamydomonas reinhardii) at the amino acid level.

The amino acids of the enolase protein of Dunaliella salina were searched in the blocks database (http:// www.blocks.fhcrc.org) for the domains and the following modules of the enolase protein were found to be present in the amino acid sequence:

module position (bp)

IPB000941A 77-99

IPB000941B 133-178

IPB000941C 188-240

IPB000941D 248-279

IPB000941E 332-349

IPB000941F 358-388

IPB000941G 423-463

The functional module of the enolase protein is present in this amino acid sequence and is therefore expected to have the corresponding function of the enolase protein.

Example 3

Large-scale sequencing of Dunaliella salina cDNA Library and Construction of Expression profiling chip (High through put sequencing of cDNA Library and Construction of Expression Microarray)

And (3) carrying out sequence determination on the clone in the obtained Dunaliella salina cDNA library, and constructing an expression profile chip by using the determined target sequence. The clones obtained by sequencing were dissolved in 3 XSSC solution and processed according to the instructions provided by the company using a Cartesian 7500 sample applicator from Cartesian and a silanized slide from TeleChem. After sample application, the slide is hydrated, dried and UV crosslinked, then treated with SDS and water for 10 minutes respectively, and dried for standby.

Example 4

Screening of Dunaliella salina Expression profile chip (Screening of the Expression microarray)

After treating Dunaliella salina with NaCl solutions of 0.5mol/l, 1.5mol/l and 4.5mol/l for 2 hours, respectively, Dunaliella salina mRNAs treated with different salt concentrations were extracted, labeled with Cy3-dUTP and Cy5-dUTP, respectively, hybridized with an expression profiling chip, scanned with ScanArray 3000 from General Scanning company, and analyzed for fluorescence signal intensity with Genepix 3.01 software from Axon company.

The expression spectrum chip hybridization result shows that the expression quantity of a plurality of genes is highly related to the growth salt concentration of the dunaliella salina. Wherein, the enolase gene is one of the enolase genes. The specific data are divided into three groups: the first group is cy5(4M), cy3(1.5M) labeled; the second group is labeled cy5(4M), cy3 (0.5M); the third group was labeled cy5(1.5M), cy3 (0.5M). The mean value of the natural logarithm of the intensity of the fluorescence signals of the three groups of markers, ln (cy5/cy3), was 0.9, which indicates that the expression difference of the gene was around 2.5-fold as the salt concentration varied.

In conclusion, the enolase is a novel salt tolerance related protein which is not reported.

Example 5

Construction of expression vector of Dunaliella salina enolase gene

Primers (corresponding to the first 20bp and the last 20bp in SEQ ID NO: 1) of a complete coding reading frame are designed and amplified according to the full-length coding sequence of the dunaliella salina enolase gene, after PCR amplification, the dunaliella salina enolase gene cDNA is cloned to an intermediate vector pBluescript (purchased from Stratagene company) and further cloned to a binary expression vector pBI 121 (purchased from Clontech company), the good expression vector is identified on the premise of ensuring the reading frame, and the good expression vector is transferred into Agrobacterium tumefaciens (Agrobacterium tumefaciens) to obtain a positive clone for transforming the model plant tobacco.

Example 6

Tobacco transformation using leaf disk method

Tobacco transformation was carried out as follows:

(1) prepared as in example 5 on YEB selection plates picked with sterile toothpicksInoculating to 2M LYEB liquid (Sm)⁺，Kan⁺) Shaking and culturing at 28 deg.C and 200rpm for 24-36 hr;

(2) centrifugation at 4,000g for 10 minutes at room temperature;

(3) discarding supernatant, suspending the bacteria with 1/2MS liquid culture medium, diluting to 5-20 times of original volume to make OD of bacteria liquid₆₀₀At about 0.5;

(4) taking sterile leaf of tobacco growing for about two weeks, removing main veins, and cutting into about 1cm²Square lobules;

(5) putting the leaves into the prepared bacterial liquid, soaking for 2-5 minutes, and sucking the bacterial liquid on sterile filter paper;

(6) placing the infected leaves on an MS culture medium, and performing dark culture at 28 ℃ for 48 hours;

(7) transferring the leaves to a callus culture medium (MS +6-BA 1.0mg/L + NAA 0.1mg/L + Kan 50mg/L + carbenicillin 250mg/L), culturing at 25-28 deg.C under illumination, and allowing callus to form within 7-15 days;

(8) after about 20 days, differentiated buds grow out, cut off after the buds grow up, and put on a rooting culture medium (1/2MS + NAA 0.5mg/L + Kan 25mg/L) for rooting culture for about 2-7 days;

after the root system is developed, the plant is taken out, the attached solid culture medium is washed by sterile water, the solid culture medium is moved into soil, the plant is just covered by a glass cover for a few days, and the glass cover is taken down after the plant is strong and cultivated in a greenhouse.

Preliminary results show that the salt tolerance of the tobacco with the transferred dunaliella salina enolase gene is higher than that of the control tobacco.

Example 7

Expression of enolase

(1) Expression vector construction

Based on the full-length coding sequence (SEQ ID NO: 1) of the dunaliella salina enolase gene, a primer for amplifying a complete coding reading frame is designed

The forward primer is

5’ATTCAGTTTACATTTCAGGCCCGAGCGG 3’(SEQID NO：9)；

The reverse primer is:

5’TTCCACCAAGCAACATAAGTCTACTCC 3’(SEQ ID NO：10)

and BamH I and Xho I restriction sites are respectively introduced on the forward primer and the reverse primer. The full-length gene of the dunaliella salinaenolase gene was amplified by PCR, cloned into an expression vector pRS426-CUP (purchased from Clontech), and the expression vector was identified and transferred into the model organism Saccharomyces cerevisiae (Saccharomyces cerevisiae) under the premise of ensuring correct reading frame.

(2) Method for transforming saccharomyces cerevisiae by electric transformation method

A. A single colony of Saccharomyces cerevisiae from a YEPD plate was picked with a sterile toothpick into 2mL of liquid YEPD medium and cultured overnight at 28 ℃ with shaking at 200 rpm.

B. Transferring the obtained product into 200mLYEPD culture medium the next day at 28 deg.C, and performing shaking culture at 200rpm until OD600 is 1.0-1.3.

C. The cells were transferred to a 50mL centrifuge tube at 4000rpm, centrifuged at 4 ℃ for 10min, and the supernatant was discarded.

D. Adding equal volume of deionized water into the centrifuge tube, resuspending the cells, and centrifuging at 4000rpm and 4 ℃ for 10 min. The supernatant was discarded.

E. Half volume of deionized water was added to the centrifuge tube, the cells were resuspended, and centrifuged at 4000rpm for 10min at 4 ℃. The supernatant was discarded.

F. Half the volume of 1M sorbitol was added to the centrifuge tube, the cells were resuspended, and centrifuged at 4000rpm for 10min at 4 ℃. The supernatant was discarded.

G. Add 500. mu.L of 1M sorbitol to the centrifuge tube.

H. 100 u L competent yeast cells and 100ng plasmid DNA mixing, adding to 0.1cm electric shock cup ice bath for 20min, placed in BioRed electroporation instrument according to 25 u F, 1500V electric shock.

I. Then 1mL of 1M sorbitol is rapidly added, after uniform mixing, part of cells are coated on a selection plate (without uracil culture medium) and cultured for 3-6 days at 30 ℃, so that the yeast strain transformed with the enolase is obtained.

Cell lysates of yeast strains transformed with enolase had a significant enolase band corresponding to approximately 45 kDa.

Example 8

Separation and purification of marine dunaliella salina enolase and determination of enzyme activity

1. Purification of enzymes

All chromatographic procedures were carried out at room temperature (around 20 ℃) on a Pharmacia FPLC system (type III).

1.1 culture conditions

The culture of the dunaliella salina is divided into three stages: 0.17M NaCl: culturing with continuous light for 1 week; 0.5M NaCl: inoculating the first stage Dunaliella salina on new culture medium at an inoculation amount of 5% or 10%, culturing under the same conditions for 1 week; 1.0M NaCl: inoculating two-stage brine alga on 1.0M NaCl culture medium, continuously culturing for 5 days while shaking-culturing, with light: dark: 16: 8h and 150 umol.m light intensity^-2·s^-15% CO is introduced during the culture process₂. The total volume of the culture was about 6L. 1.2 crude extraction of the enzyme

The algae cultured for 1 week was collected by centrifugation at 4500 Xg, and the fresh weight was about 6 g. 100mL of A solution (TDG buffer (pH6.9) 100mM Tris, 1mM DTT, 2.5% (v/v) glycerol) was added. Performing ultrasonic disruption in ice bath with ultrasonic power of 200W, and performing action for 10 times at intervals of 30s for 8s each time. Centrifuging at 4 deg.C 40000 Xg for 30min, and collecting supernatant as crude extractive solution.

1.3PEG fractionation

Slowly adding 50% PEG8000 stock solution under stirring to final concentration of PEG of 15%, and standing for 30 min. 40000 Xg, centrifuging for 30min, collecting supernatant, adding MgCl₂Adding PEG stock solution until the final concentration is 25%, and standing for 60 min. All the above operations were carried out in an ice bath. Centrifuging at 4 deg.C 40000 Xg for 30min, and re-dissolving the precipitate in 60mL of solution A for DEAE ion exchange chromatography.

1.4DEAE ion exchange chromatography

A DEAE Sepharose Fast Flow column (10 cm. times.1.6 cm) was equilibrated with the solution A, and then the enzyme solution was added at a Flow rate of 1 mL/min. After the column is loaded, 40mL of solution A is used for washing off unadsorbed protein, and then 100mL of solution A is used for carrying out 0-1.0 mol/L NaCl linear gradient elution on 100mL of solution B (solution A +1.0mol/L NaCl), with the flow rate of 1.5 mL/min. The enolase active fraction eluted at about 0.24-0.3 mol/L NaCl.

1.5Blue Sepharose CL-6B pseudo-affinity chromatography

Collecting the enolase solution eluted from DEAE Sepharose Fast Flow column, adding MgCl at 4 deg.C under stirring₂When the concentration is 10mmol/L, PEG8000 stock solution is slowly added until the final concentration of PEG is 25%, and the mixture is kept stand for 60 min. The mixture was centrifuged at 40000 Xg for 30min at 4 ℃ and the precipitate was redissolved in 6mL of solution A. The enzyme solution was applied to a Blue Sepharose CL-6B column (2 cm. times.0.8 cm) equilibrated with solution A at a flow rate of 0. Then eluting with solution c (solution A +5mmol/L NADH) at 0.2 mL/min. Collecting the eluted enzyme solution.

1.6QHP column chromatography

All solutions were aspirated before loading on the column, filtered, and the QHP column was equilibrated with solution A. The enzyme solution collected by Blue Sepharose chromatography was centrifuged at 10000 Xg to remove insoluble matter and then applied to the column. The column is washed by 2mL of solution A, and then the solution A is used for carrying out linear gradient combined step-by-step elution on the solution B by 0-1.0 mol/L NaCl at the flow rate of 0.5 mL/min. The enolase eluted at approximately 0.33mol/L NaCl.

2. Determination of enzyme Activity

Isolation and purification and determination of enzyme activity were carried out according to the method of reference (Biotechnol. appl. biochem. (2000)31, 213-218). The results showed that the isolated enolase had the activity of converting 2-phosphoglycerate to phosphoenolpyruvate (phosphoenolpyruvate).

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110>Sichuan Dagao Yao bioengineering Co., Ltd

<120>dunaliella salina enolase and coding sequence thereof

<130>037216

<160>10

<170>PatentIn version 3.1

<210>1

<211>1440

<212>DNA

<213>Dunaliella salina (Dunaliella salina)

<400>1

atggccaccg tgcaggagta catcgacaag caccagctgc agaaaaagac ggaggacgtg 60

ctcaacatcg cggtgaagtc caagcccgat gagccactgt ccttcctggc caaggagctg 120

ctcaggatgg ctccatcaga gatcttgaag gttgtaggcc gtcagatcat tgactctcgc 180

ggcaacccca ctgtggaggc agacgtgcac acccataagg gcatgttccg tgctgctgtg 240

ccctccggtg cctccactgg catccacgag gcagttgagc tgcgtgatgg cgacaagacc 300

aagttcctgg gcaagggtgt gcagaaggct gtggagagca tcaacaccat catcagcccc 360

gccctgaagg gcatggaccc caagaaccag agcgaggtgg accagaagat gatcgacctt 420

gatggcactc ccaacaaggc caagctgggt gccaatgcaa ttctggccgt ctccctggcc 480

actgccaagg ctggtgctgc cgagaaggaa gtgcctctgt acaggcacat tgctgacctg 540

gccggcaacc ccaagctgta cttgcccgtg ccagcgttca acatcatcaa cggcggcagc 600

cacgcaggca acgcccttgc catgcaggag ttcatgatct tacccactgg agcatcatct 660

ttctctgagg ccatgcgcat gggcactgag gtgtaccaca cactgaaggg catcatcaag 720

gccaagtacg gccaggatgc taccaacgtt ggtgatgagg gtggctttgc ccccaacatc 780

caatccaatg atgatggtct gtccttggtc accgatgcca ttgagaaggc aggatacact 840

ggcaaggtca agatcggcat ggacgtggct gcgtcagagt tcattaccga ggacaagatg 900

tacgacctga acctcaagca gcagcccaac gatggctccc acaagaagac agctgcccaa 960

atgctggaga tgtacaagga gttctgcacc aagtaccccg tcatctccat cgaggatccc 1020

ttcgagcagg atgactggga gcctgccaag tccctgactg cagagaacat ctgccaggtg 1080

gttggcgatg acatgctggt gacgaacccc atccgcgtca agcgcggcat tgagcagaag 1140

gcagtcaact ccttgctcct gaaggtcaac cagattggct ccctgactga gtccatcgag 1200

gccgtgagga tgtccaagga ggcaggctgg ggtgtgatga ccagccacag gtctggtgag 1260

actgaggact gcttcatcgc agacttggca gttggcctgt ccacaggcca gatcaagact 1320

ggtgctcctt gccgctctga gcgcaatgct aagtacaacc agctgctccg cattgaggag 1380

gagcttggcg agaatgcagt gtacgctggt gagaagtggc gcttcattga gtggcagtga 1440

<210>2

<211>479

<212>PRT

<213>Dunaliella salina (Dunaliella salina)

<400>2

Met Ala Thr Val Gln Glu Tyr Ile Asp Lys His Gln Leu Gln Lys Lys

1 5 10 15

Thr Glu Asp Val Leu Asn Ile Ala Val Lys Ser Lys Pro Asp Glu Pro

20 25 30

Leu Ser Phe Leu Ala Lys Glu Leu Leu Arg Met Ala Pro Ser Glu Ile

35 40 45

Leu Lys Val Val Gly Arg Gln Ile Ile Asp Ser Arg Gly Asn Pro Thr

50 55 60

Val Glu Ala Asp Val His Thr His Lys Gly Met Phe Arg Ala Ala Val

65 70 75 80

Pro Ser Gly Ala Ser Thr Gly Ile His Glu Ala Val Glu Leu Arg Asp

85 90 95

Gly Asp Lys Thr Lys Phe Leu Gly Lys Gly Val Gln Lys Ala Val Glu

100 105 110

Ser Ile Asn Thr Ile Ile Ser Pro Ala Leu Lys Gly Met Asp Pro Lys

115 120 125

Asn Gln Ser Glu Val Asp Gln Lys Met Ile Asp Leu Asp Gly Thr Pro

130 135 140

Asn Lys Ala Lys Leu Gly Ala Asn Ala Ile Leu Ala Val Ser Leu Ala

145 150 155 160

Thr Ala Lys Ala Gly Ala Ala Glu Lys Glu Val Pro Leu Tyr Arg His

165 170 175

Ile Ala Asp Leu Ala Gly Asn Pro Lys Leu Tyr Leu Pro Val Pro Ala

180 185 190

Phe Asn Ile Ile Asn Gly Gly Ser His Ala Gly Asn Ala Leu Ala Met

195 200 205

Gln Glu Phe Met Ile Leu Pro Thr Gly Ala Ser Ser Phe Ser Glu Ala

210 215 220

Met Arg Met Gly Thr Glu Val Tyr His Thr Leu Lys Gly Ile Ile Lys

225 230 235 240

Ala Lys Tyr Gly Gln Asp Ala Thr Asn Val Gly Asp Glu Gly Gly Phe

245 250 255

Ala Pro Asn Ile Gln Ser Asn Asp Asp Gly Leu Ser Leu Val Thr Asp

260 265 270

Ala Ile Glu Lys Ala Gly Tyr Thr Gly Lys Val Lys Ile Gly Met Asp

275 280 285

Val Ala Ala Ser Glu Phe Ile Thr Glu Asp Lys Met Tyr Asp Leu Asn

290 295 300

Leu Lys Gln Gln Pro Asn Asp Gly Ser His Lys Lys Thr Ala Ala Gln

305 310 315 320

Met Leu Glu Met Tyr Lys Glu Phe Cys Thr Lys Tyr Pro Val Ile Ser

325 330 335

Ile Glu Asp Pro Phe Glu Gln Asp Asp Trp Glu Pro Ala Lys Ser Leu

340 345 350

Thr Ala Glu Asn Ile Cys Gln Val Val Gly Asp Asp Met Leu Val Thr

355 360 365

Asn Pro Ile Arg Val Lys Arg Gly Ile Glu Gln Lys Ala Val Asn Ser

370 375 380

Leu Leu Leu Lys Val Asn Gln Ile Gly Ser Leu Thr Glu Ser Ile Glu

385 390 395 400

Ala Val Arg Met Ser Lys Glu Ala Gly Trp Gly Val Met Thr Ser His

405 410 415

Arg Ser Gly Glu Thr Glu Asp Cys Phe Ile Ala Asp Leu Ala Val Gly

420 425 430

Leu Ser Thr Gly Gln Ile Lys Thr Gly Ala Pro Cys Arg Ser Glu Arg

435 440445

Asn Ala Lys Tyr Asn Gln Leu Leu Arg Ile Glu Glu Glu Leu Gly Glu

450 455 460

Asn Ala Val Tyr Ala Gly Glu Lys Trp Arg Phe Ile Glu Trp Gln

465 470 475

<210>3

<211>20

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>3

atatctgtcc cggagcggct 20

<210>4

<211>22

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>4

gctcaccaca gcactcagca ca 22

<210>5

<211>27

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>5

gcgatgaagc agtcctcagt ccaccag 27

<210>6

<211>28

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>6

attcagttta catttcaggc ccgagcgg 28

<210>7

<211>28

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>7

attcagttta catttcaggc ccgagcgg 28

<210>8

<211>27

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>8

ttccaccaag caacataagt ctactcc 27

<210>9

<211>28

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>9

attcagttta catttcaggc ccgagcgg 28

<210>10

<211>27

<212>DNA

<213>Artificial sequence

<220>

<221>misc_feature

<223>primer

<400>10

ttccaccaag caacataagt ctactcc 27

Claims (10)

1. An isolated dunaliella salina enolase, wherein the enzyme is selected from the group consisting of:

(a) has the sequence shown in SEQ ID NO: 2 amino acid sequence of a polypeptide;

(b) converting SEQ ID NO: 2 through substitution, deletion or addition of one or more amino acid residues, and has enolase function.

2. The enzyme of claim 1, which is a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence.

3. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(a) a polynucleotide encoding the dunaliella salina enolase of claim 1;

(b) a polynucleotide complementary to polynucleotide (a).

4. The polynucleotide of claim 3, wherein the polynucleotide encodes a polypeptide having the sequence of SEQ id no: 2.

5. The polynucleotide of claim 3, wherein the sequence of the polynucleotide is selected from one of the group consisting of SEQ ID NO:

(a) has the sequence shown in SEQ ID NO: 1-1437 of 1;

(b) has the sequenceshown in SEQ ID NO: 1-1440 in position 1.

6. A vector comprising the polynucleotide of claim 3.

7. A genetically engineered host cell comprising the vector of claim 6.

8. A method for producing a polypeptide, the method comprising:

(a) culturing the host cell of claim 7 under conditions suitable for expression;

(b) isolating the dunaliella salina enolase from the culture.

9. A method for improving salt tolerance in a plant, comprising the steps of:

(1) providing agrobacterium carrying an expression vector, wherein the expression vector contains an enolase DNA coding sequence, and the enolase is selected from the following group: (a) has the sequence shown in SEQ ID NO: 2 amino acid sequence of a polypeptide; (b) converting SEQ ID NO: 2 through substitution, deletion or addition of one or more amino acid residues, and has enolase function.

(2) Contacting a plant cell or tissue or organ with the Agrobacterium of step (1) such that the enolase DNA coding sequence is transferred into the plant cell and integrated into the chromosome of the plant cell;

(3) selecting plant cells or tissues or organs which are transferred with the DNA coding sequence of the enolase;

(4) regenerating the plant cell or tissue or organ of step (3) into a plant.

10. The method of claim 9, wherein the enzyme is a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence.