CN1618974A - Improved bacteriophage expression carrrier - Google Patents
Improved bacteriophage expression carrrier Download PDFInfo
- Publication number
- CN1618974A CN1618974A CN 200310108759 CN200310108759A CN1618974A CN 1618974 A CN1618974 A CN 1618974A CN 200310108759 CN200310108759 CN 200310108759 CN 200310108759 A CN200310108759 A CN 200310108759A CN 1618974 A CN1618974 A CN 1618974A
- Authority
- CN
- China
- Prior art keywords
- antibody
- restriction enzyme
- site
- expression vector
- enzyme site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An improved expression carrier pHEN2 used to screen the phagemid in single-chain antibody by phage display method features that the enzyme severing site ApaL1 in its multiple enzyme severing sites is removed or replaced by BssH II, so more products coded by the light-chain gene of human immunoglobulin can be effectively inserted in single-chain antibody library to ensure its diversity and high volume.
Description
Technical field
The present invention relates to fields such as molecular biology and antibody engineering.More specifically, the phagemid expression vector that is used for phage display method screening single-chain antibody that relates to a kind of improvement.
Background technology
Antibody is as the existing developing history that goes up a century of the preparation of disease prevention, diagnosis and treatment.The early stage method for preparing antibody be with certain natural antigen through various approach immune animals, after sophisticated B cell clone is subjected to antigenic stimulation, with antibody-secreting in serum and body fluid.
In fact the antibody in the serum is the mixture of multiple monoclonal antibody, therefore is referred to as polyclonal antibody.Polyclonal antibody is that the mankind have purpose to utilize the antibody the first step.The unhomogeneity of polyclonal antibody has limited the further research and the application of antagonist 26S Proteasome Structure and Function.
The birth of hybridoma technology is considered to the qualitative leap first time of antibody engineering development, also is a milestone of modern biotechnology development.Utilize the monoclonal antibody of this technology preparation in medical diagnosis on disease, treatment and scientific research, to be widely used.Mostly this monoclonal antibody is by mouse B cell and rat bone marrow tumour cell to have mouse source property through the hybridoma excretory that cytogamy forms, and enters the people and knows from experience the rejection that causes body; The molecular weight of complete antibody molecule is bigger, and the ability that penetrates blood vessel in vivo is relatively poor; Production cost is too high, is not suitable for large-scale industrial production.At the beginning of the eighties, the achievement in research of antibody gene 26S Proteasome Structure and Function combines with recombinant DNA technology, has produced the genetic engineering antibody technology.
The development of antibody engineering technology is about to the mouse resource monoclonal antibody and transform humanized antibody as, perhaps directly produces human antibody, significantly reduces side effect that mouse source antibody brings such as human antimouse antibody reaction etc., helps clinical application.At present, three kinds of methods are mainly adopted in the generation of humanization or human antibody:
(1) mouse source antibody is transformed: Fc section and part Fab with human antibodies replace mouse source antibody fragment, reduce the fragment in mouse source, to alleviate the untoward reaction of human antagonist;
(2) transgenic method: human antibody gene is transferred to mouse, produces human antibodies behind the immune animal;
(3) display technique of bacteriophage: the novel method that is developed recently, utilize the characteristic screening antibody of phage can directly screen human antibody, this method utilizes human immunoglobulin gene to make up the combinatorial library that contains VH and VL, with phage surface indicating system screening antigen-specific human antibody.It has replaced the B cell clone with bacterial clone, is described as the revolutionary character progress of antibody technique.
Above-mentioned three kinds of methods cut both ways.The first two kind method can be screened high-affinity antibody, but expense is big, and is not easy to operate, and the third method is easy and simple to handle, cost is few, but avidity is lower sometimes.
Adopt phage antibody library technique screening antibody needn't carry out animal immune, be easy to prepare antibody, screening total man's endogenous antibody and the high-affinity antibody of private antigen.Phage antibody library technique is one of breakthrough of life science, also the research of antibody engineering has been guessed a new climax simultaneously.
The phage system of selection is all unrestricted for the separation of antibody or small peptide, and be applicable to the molecular studies of other biologically active, conjugated protein as cytokine, acceptor, enzyme substrates, enzyme inhibitors, abzyme, DNA, make up receptor domain with specific binding molecules and cellulose binding domain etc.It is reported, the support difference of antibody can be formed for the suitable binding partner of all kinds molecule, and many examples can illustrate, host's support can hold many some suitable metathetical zones of effectively can regulating, (can put the storehouse of preparation localized variation according to this), these supports comprise: beta sheet albumen, alpha-helix bundle protein, these two proteic combinations and green fluorescent protein (GFP) and cellulose binding domain etc.
Being usually used in making up the used phagemid expression vector in phage display single-chain antibody library, people source at present is pHEN-2.Yet the light chain gene coded product that this carrier in use usually has the human normal immunoglobulin of significant proportion can't insert single-chain antibody library effectively because of all X factors.
Therefore, this area presses for the new phagemid expression vector that exploitation can more effectively be used to make up phage display single-chain antibody library, people source.
Summary of the invention
Purpose of the present invention just provides a kind of new phagemid expression vector that can more effectively be used to make up phage display single-chain antibody library, people source.
In a first aspect of the present invention, a kind of phagemid expression vector is provided, it is the pHEN2 carrier of improvement, wherein the ApaL1 restriction enzyme site that multienzyme is cut in the site among the pHEN2 is removed or is replaced by BssH II restriction enzyme site.
In another preference, the ApaL1 restriction enzyme site that multienzyme is cut in the site among the pHEN2 is replaced by BssH II restriction enzyme site.Wherein, described ApaL1 restriction enzyme site is GTGCAC, and described BssH II restriction enzyme site is GCGCGC.
In another preference, the multienzyme of described expression vector is cut the sequence in site shown in SEQ ID NO:1.
In a second aspect of the present invention, the purposes of phagemid expression vector of the pHEN2 of the above-mentioned improvement of a kind of the present invention is provided, it is used to by phage display method screening single-chain antibody.
Description of drawings
Fig. 1 has shown that phagemid expression vector pHEN2 multienzyme cuts the site collection of illustrative plates.
Fig. 2 has shown ApaL1 restriction enzyme site BssH II restriction enzyme site metathetical synoptic diagram.
Embodiment
The inventor is through discovering, the major cause that the light chain gene coded product that pHEN-2 phagemid carrier in use usually has a human normal immunoglobulin of significant proportion can't insert single-chain antibody library effectively is to have the ApaL1 restriction enzyme site.By eliminating the ApaL1 restriction enzyme site, the light chain gene coded product that just can significantly improve human normal immunoglobulin inserts the efficient of single-chain antibody library.
According to the statistics to known immune globulin variable region gene sequence, the inventor finds part variable region of light chain V
LIn have restriction enzyme site ApaL I, the frequency of occurrences 4/162=6.45% (table 1) of this site in colony.
The function fragment number that table 1 is cut
| The sum of functional fragment | |||||||||
| Restriction enzyme | The sequence of cutting | ??VH(51) | ??VK(40) | ??VL(31) | ?D(25) | ?JH(6) | ?JK(5) | ?JK(4) | Amount to (162) |
| ApaL?I | ?GTGCAC | ??2 | ??0 | ??2 | ?0 | ?0 | ?0 | ?0 | ?4 |
| Asc?I | ?GGCGCGCC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| BamH?I | ?GGATCC | ??14 | ??0 | ??15 | ?0 | ?0 | ?0 | ?0 | ?29 |
| Bgl?II | ?AGATCT | ??12 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?12 |
| BssH?II | ?GCGCGC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| BstE?II | ?GGTNACC | ??4 | ??0 | ??8 | ?0 | ?5 | ?0 | ?1 | ?18 |
| Cla?I | ?ATCGAT | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Eag?I | ?CGGCCG | ??23 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?23 |
| EcoR?I | ?GAATTC | ??0 | ??4 | ??0 | ?0 | ?0 | ?0 | ?0 | ?4 |
| EcoR?V | ?GATATC | ??1 | ??0 | ??0 | ?0 | ?1 | ?1 | ?0 | ?3 |
| Hae?III | ?(AG)GCGC(CT) | ??3 | ??4 | ??3 | ?0 | ?0 | ?0 | ?0 | ?10 |
| Hind?III | ?AAGCTT | ??1 | ??0 | ??2 | ?0 | ?0 | ?0 | ?0 | ?3 |
| Kpn?I | ?GGTACC | ??0 | ??18 | ??23 | ?0 | ?0 | ?0 | ?0 | ?41 |
| Nco?I | ?CCATGG | ??0 | ??0 | ??1 | ?0 | ?0 | ?0 | ?0 | ?1 |
| Nde?I | ?CATATG | ??4 | ??0 | ??3 | ?0 | ?0 | ?0 | ?0 | ?7 |
| Nhe?I | ?GCTAGC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Not?I | ?GCGGCCGC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Pst?I | ?CTGCAG | ??14 | ??33 | ??4 | ?0 | ?0 | ?0 | ?0 | ?51 |
| Pvu?I | ?CGATCG | ??0 | ??0 | ??1 | ?0 | ?0 | ?0 | ?0 | ?1 |
| Sac?I | ?GAGCTC | ??11 | ??1 | ??1 | ?0 | ?0 | ?0 | ?0 | ?13 |
| Sac?II | ?CCGCGG | ??8 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?8 |
| Sal?I | ?GTCGAC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Sma?I | ?CCCGGG | ??2 | ??1 | ??4 | ?0 | ?0 | ?0 | ?0 | ?7 |
| Spe?I | ?ACTAGT | ??2 | ??0 | ??1 | ?0 | ?0 | ?0 | ?0 | ?3 |
| Sph?I | ?GCATGC | ??3 | ??9 | ??1 | ?0 | ?0 | ?0 | ?0 | ?13 |
| Sfi?I | ?GGCCNNNNNGGCC | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Xba?I | ?TCTAGA | ??0 | ??0 | ??0 | ?0 | ?0 | ?0 | ?0 | ?0 |
| Xho?I | ?CTCGAG | ??0 | ??3 | ??0 | ?0 | ?0 | ?0 | ?0 | ?3 |
Statistics finds, and a kind of enzyme of ApaL I to be some people have a preference for use.If use ApaL I enzyme just can inevitably destroy part of V in clone's process in light chain library
LThe integrity of gene order, thus cause part RT-PCR human normal immunoglobulin light chain gene coded product can't insert single-chain antibody library, whole storage capacity is descended to some extent.
A kind of method that pHEN-2 phagemid carrier is transformed is to eliminate ApaL I enzyme.
In another preference, the method that pHEN-2 phagemid carrier is transformed is to replace the restriction enzyme site of ApaL I enzyme with restriction enzyme site BssH II.The inventor transforms the existing phagemid expression vector pHEN-2 that is used to make up phage display single-chain antibody library, utilize the swing of the 3rd bit codon, guaranteeing under the prerequisite that coded amino acid does not change, introduce the rite-directed mutagenesis of two bases by the PCR primer, thereby restriction enzyme site ApaL I is changed to the restriction enzyme site BssH II (Fig. 2) that in the immunoglobulin (Ig) database, does not see appearance, thereby the clone and the evaluation condition in light chain library have further been optimized, thereby guaranteed the diversity in constructed single-chain antibody library as far as possible, improved the actual library capacity.
Can be used for site-directed mutagenesis technique of the present invention is a kind of technology very conventional in this area, has many documents that site-directed mutagenesis technique is had description.
Major advantage of the present invention is, can make the light chain gene coded product of more human normal immunoglobulin insert single-chain antibody library effectively, thereby guarantee the diversity in constructed single-chain antibody library as far as possible, has improved the actual library capacity.The inventor successfully utilize this transform plasmid construction titre be 10
9Non-immune human single chain variable fragments antibody library.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
Transformation to the restriction enzyme site of pHEN-2
Phagemid expression vector pHEN2 is a kind of phagemid expression vector commonly used in this area (available from univ cambridge uk MRC center), and its multienzyme is cut the site collection of illustrative plates shown in Fig. 1 and SEQ ID NO:1.
Test method:
Synthetic following primer:
Forward：GCTGCAGGTCGACCTCGAGTG(SEQ?ID?NO：3)
Reverse：ATCGAGCTCCTGCAGTTGGACCTGCGCGCTACCGCCAGAGCCACCTC(SEQ?ID?NO：4)
With pHEN2 is template, transform the pHEN-2 restriction enzyme site as BssH II restriction enzyme site in order to following method.
Utilize above-mentioned primer to carry out PCR, the PCR product that obtained and pHEN2 plasmid are carried out enzyme with restriction enzyme Sac I and Nco I respectively to be cut, after both were connected conversion, the extracting plasmid verified that through dna sequencing the Apa I site in the former pHEN2 plasmid has been transformed into BssH II site.
The result:
By the method for rite-directed mutagenesis, the restriction enzyme site (GTGCAC) that has obtained pHEN-2 transform the phagemid expression vector of the improvement of BssH II restriction enzyme site (GCGCGC) as, and wherein the transformation of restriction enzyme site does not have influence to amino acid sequence coded.The multienzyme of transforming is cut the sequence in site shown in SEQ ID NO:2.
Embodiment 2
Make up the human single chain variable fragments antibody library
Synthesize the PCR primer of more than 50 can be used for increasing human antibody heavy chain and variable region of light chain with ordinary method, extracted the mRNA of the peripheral blood lymphocyte of four people's tire livers and tire spleen and a human bone marrow cell and 15 health adults; Adopt the RT-PCR method, with the primer at the different families of immunoglobulin (Ig), heavy chain of antibody and chain variable region gene therefrom increase respectively; Successively be cloned in the phagemid expression vector of transformation, transform, made up the human single chain variable fragments antibody library, wherein adopt the pHEN-2 of the improvement of preparation among pHEN-2 (contrast) and the embodiment 1 respectively through hundreds of electricity.Then, the gradient dilution phage antibody library also infects the E.coli TG1 bacterium liquid of logarithmic phase, is coated with LB ammonia benzyl flat board, and 37 ℃ are spent the night, and utilize the colony count method to measure the titre in library.
The result shows, is 10 with the titre in the non-immune human single chain variable fragments antibody library of the pHEN-2 plasmid construction of transforming
9, be 5 * 10 and contrast (the not pHEN-2 of Gai Zaoing)
6
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Research Center of Shanghai Human Genome
＜120〉Gai Liang phagemid expression vector
<130>036339
<160>4
<170>PatentIn?version?3.1
<210>1
<211>369
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉multienzyme of pHEN-2 is cut the site
<400>1
ttcacacagg?aaacagctat?gaccatgatt?acgccaagct?tgcatgcaaa?ttctatttca?????60
aggagacagt?cataatgaaa?tacctattgc?ctacggcagc?cgctggattg?ttattactcg????120
cggcccagcc?ggccatggcc?caggtgcagc?tgcaggtcga?cctcgagtgg?tggaggcggt????180
tcaggcggag?gtggctctgg?cggtagtgca?caggtccaac?tgcaggagct?cgatatcaaa????240
cgggcggccg?cacatcatca?tcaccatcac?ggggccgcag?aacaaaaact?catctcagaa????300
gaggatctga?atggggccgc?atagactgtt?gaaagttgtt?tagcaaaacc?tcatacagaa????360
aattcattt????????????????????????????????????????????????????????????369
<210>2
<211>369
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉multienzyme of the pHEN-2 of Gai Zaoing is cut the site
<400>2
ttcacacagg?aaacagctat?gaccatgatt?acgccaagct?tgcatgcaaa?ttctatttca?????60
aggagacagt?cataatgaaa?tacctattgc?ctacggcagc?cgctggattg?ttattactcg????120
cggcccagcc?ggccatggcc?caggtgcagc?tgcaggtcga?cctcgagtgg?tggaggcggt????180
tcaggcggag?gtggctctgg?cggtagcgcg?caggtccaac?tgcaggagct?cgatatcaaa????240
cgggcggccg?cacatcatca?tcaccatcac?ggggccgcag?aacaaaaact?catctcagaa????300
gaggatctga?atggggccgc?atagactgtt?gaaagttgtt?tagcaaaacc?tcatacagaa????360
aattcattt????????????????????????????????????????????????????????????369
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
gctgcaggtc?gacctcgagt?g???????????????????????????????????????????????21
<210>4
<211>47
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
atcgagctcc?tgcagttgga?cctgcgcgct?accgccagag?ccacctc???????????????????47
Claims (4)
1. a phagemid expression vector is characterized in that, it is the pHEN2 carrier of improvement, and wherein the ApaL1 restriction enzyme site that multienzyme is cut in the site among the pHEN2 is removed or is replaced by BssH II restriction enzyme site.
2. expression vector as claimed in claim 1 is characterized in that, the ApaL1 restriction enzyme site that multienzyme is cut in the site among the pHEN2 is replaced by BssH II restriction enzyme site, and wherein said ApaL1 restriction enzyme site is GTGCAC, and described BssH II restriction enzyme site is GCGCGC.
3. expression vector as claimed in claim 1 is characterized in that, the multienzyme of described expression vector is cut the sequence in site shown in SEQ ID NO:1.
4. the purposes of phagemid expression vector as claimed in claim 1 is characterized in that, is used for by phage display method screening single-chain antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108759 CN1618974A (en) | 2003-11-21 | 2003-11-21 | Improved bacteriophage expression carrrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108759 CN1618974A (en) | 2003-11-21 | 2003-11-21 | Improved bacteriophage expression carrrier |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1618974A true CN1618974A (en) | 2005-05-25 |
Family
ID=34758707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310108759 Pending CN1618974A (en) | 2003-11-21 | 2003-11-21 | Improved bacteriophage expression carrrier |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1618974A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102453093A (en) * | 2010-10-28 | 2012-05-16 | 华中农业大学 | Screening and application of single-chain antibody against fumonisin |
| CN110540998A (en) * | 2018-05-28 | 2019-12-06 | 深圳华大生命科学研究院 | Method and reagent for quickly constructing multivalent antibody expression vector |
-
2003
- 2003-11-21 CN CN 200310108759 patent/CN1618974A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102453093A (en) * | 2010-10-28 | 2012-05-16 | 华中农业大学 | Screening and application of single-chain antibody against fumonisin |
| CN102453093B (en) * | 2010-10-28 | 2013-10-30 | 华中农业大学 | Screening and application of single-chain antibody against fumonisin |
| CN110540998A (en) * | 2018-05-28 | 2019-12-06 | 深圳华大生命科学研究院 | Method and reagent for quickly constructing multivalent antibody expression vector |
| CN110540998B (en) * | 2018-05-28 | 2024-01-05 | 深圳华大生命科学研究院 | Method and reagent for quickly constructing multivalent antibody expression vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peng et al. | High-throughput identification of novel conotoxins from the Chinese tubular cone snail (Conus betulinus) by multi-transcriptome sequencing | |
| JP5460097B2 (en) | Protein backbone for antibody mimics and other binding proteins | |
| AU2018201328A1 (en) | Generation of binding molecules | |
| RU2013153592A (en) | ANTI-MIF ANTIBODIES | |
| IE914504A1 (en) | Optimization of binding proteins | |
| CN107090031A (en) | The method for integrating the performance of antibody/albumen and the screening and evolution of expression simultaneously in production host | |
| EP2977386A1 (en) | Method for producing antibody molecules having inter-species, intra-target cross-reactivity | |
| CN111848797B (en) | Single-chain antibody targeting c-Met, chimeric antigen receptor, recombinant vector, CAR-T cell and application | |
| CN105801701A (en) | Heavy chain and light chain variable regions of PCSK9 antibody and application of heavy chain and light chain variable regions | |
| CN109897110B (en) | Nano antibody and preparation method thereof | |
| WO2009135518A1 (en) | Chimeric fusion proteins and virus like particles from birnavirus vp2 | |
| CN1618974A (en) | Improved bacteriophage expression carrrier | |
| CN1733916A (en) | siRNA for suppressing Stat3 gene expression and its preparation method | |
| CN1911963A (en) | SARS neutralization antibody and application | |
| CN1150331C (en) | A group of efficient expression carriers for humanized antibody of mammal cell | |
| CN1683409A (en) | Single strand double specificity anti-body resisting human B cell leucoma | |
| CN104341501A (en) | Anti-IL-1beta humanized monoclonal antibody, preparation method and application thereof | |
| CN1613874A (en) | Human tumour necrosin antibody, its preparation and medicinal composition | |
| CN1847397A (en) | EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application | |
| CN109355309A (en) | A kind of construction method of CD3E gene modification humanized animal's model | |
| CN113308491B (en) | Recombinant plasmid and recombinant cell for co-expressing NFAT and human DNAM-1 protein, and construction method and application thereof | |
| CN113201069B (en) | mCherry or mEOS nano antibody and preparation method and application thereof | |
| CN1721531A (en) | Recombinant human antibody expression vector and its use | |
| CN1594361A (en) | Human source anti- tetanus exotoxin antibody and preparation method and use thereof | |
| CN1827777A (en) | Application of osteopontin inhibitor in rheumatoid arthritis treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |