CN1598581A

CN1598581A - Method for testing SARS virus antigen

Info

Publication number: CN1598581A
Application number: CN 03146846
Authority: CN
Inventors: 李明; 吴英松; 宁云山; 程钢
Original assignee: Institute Of Tropical Diseases First Military Medical University; Guangzhou Darui Antibodies Engineering Technology Coltd
Current assignee: Institute Of Tropical Diseases First Military Medical University; Guangzhou Darui Antibodies Engineering Technology Coltd
Priority date: 2003-09-17
Filing date: 2003-09-17
Publication date: 2005-03-23

Abstract

The invention discloses a SARS virus detecting method, especially relates to time-lapse detecting SARS virus in clinic sample by high sensitivity time distinguishing fluorescence immunity detecting technology.

Description

Detect the method for SARS virus antigen

The affiliated field of invention

The present invention relates to detect the method for SARS virus, particularly relate to the method for using with SARS virus in hypersensitivity and the real-time monitoring of blood sample of specific time-resolved fluoroimmunoassay detection technique.

The background of invention

SARS (Severe Acute Respiratory Syndrome) (SARS) is a kind of new lethal infectious disease.At first find in Chinese Guangdong province some areas for the end of the year 2002, and promptly propagate into 25 countries and regions, the world and other many provinces and cities of China in three months very soon, accumulative total reported cases number reaches 8202 people.This viral infectivity is strong, and onset is anxious, and spreading rate height in the crowd causes epidemic situation outburst and mortality ratio higher (5-6%) easily.

Since the World Health Organization (WHO) sends the alarm of this infectious disease on March 12nd, 2003 to the whole world after, 13 breadboard scientists of 10 countries and regions such as China, Germany, Canada, France, the U.S. cooperate with the World Health Organization (WHO), and the pathogen of very fast definite this infectious disease is a sars coronavirus.Then mid-April, Canada and U.S. scientist etc. announce the genome sequence of SARS virus in succession.The success that the discovery of pathogen and whole genome sequence are measured makes scientist can concentrate research virus, for source, development SARS virus detectable, vaccine and the medicine of following the trail of coronavirus are laid a good foundation.

All is developing fast and the method for early detection SARS virus in many in the world laboratories at present, and the method for having set up mainly comprises enzyme linked immunosorbent assay (ELISA), immunofluorescence technique (FAT) and polymerase chain reaction method (PCR).Wherein, no matter ELISA method and FAT method are to detect antigen or antibody owing to be subjected to its sensitivity and specific restriction, all are difficult to satisfy the needs of early diagnosis.On the contrary, TR-FIA detection side rule has high sensitivity, specificity and selectivity, is SARS virus antigen and viral nucleic acid are carried out a kind of method for optimizing that many indexs detected and realized the early diagnosis of SARS.

Goal of the invention

An object of the present invention is to provide the method for the SARS virus that may exist in a kind of detection of biological humoral sample, this method comprises: (1) provides can be with the protein bound first antibody of SARS virus and with said antibody sandwich solid phase carrier; (2) in the coated solid phase of step (1), add biology humoral sample to be checked and control sample and under suitable condition, be incubated; (3) reaction back fully the said solid phase of washing and add appropriate amount lanthanide metal ion mark, can with protein bound second antibody of SARS virus and insulation once more; (4) the reaction back is fully washed said solid phase and is detected the lanthanide metal ion emitted fluorescence value that combines with second antibody; (5) the measured fluorescent value and the fluorescence of the parallel known quantity standard items that record are compared existing and relative quantity with SARS virus in definite sample.

Perhaps, also can finish above-mentioned detection according to the following steps based on competition inhibition method: (1) provides can be with the protein bound antibody of SARS virus and with said antibody sandwich solid phase carrier; (2) antigen that can combine of adding biology humoral sample to be checked and control sample, lanthanide metal ion mark in the coated solid phase of step (1) with the anti-SARS virus protein monoclonal antibody; (4) the reaction back is fully washed said solid phase and is detected the lanthanide metal ion emitted fluorescence value that combines with antigen; (5) the measured fluorescent value and the fluorescence of the parallel known quantity standard items that record are compared existing and relative quantity with SARS virus in definite sample.

According to a preferred embodiment of the invention, said first antibody and second antibody are can be respectively and the monoclonal antibody of the different epitope combinations of SARS virus albumen.

According to a preferred embodiment of the invention, wherein said lanthanide metal ion is an europium.

According to another preferred embodiment of the present invention, wherein said biology humoral sample is selected from blood plasma, whole blood, rinse liquid, throat swab, urine, ight soil and bronchus perfusate.

According to another preferred embodiment of the present invention, wherein said solid phase is the microtiter plate with enough immunoglobulin (Ig) adsorptive poweies.

According to another preferred embodiment of the present invention, wherein said detection is to use the time-resolved fluoroimmunoassay technology to finish.

Another object of the present invention provides the anti-SARS virus antibody that is used for detection method of the present invention, is characterised in that said antibody can combine with the specific antigen decision base region of SARS virus albumen, and can forms complex compound with lanthanide metal ion.

According to another preferred embodiment of the present invention, the antibody that is defined as above comprise can with first and second antibody of the different epitope specificity combination of SARS virus albumen.

According to another preferred embodiment of the present invention, the antibody that is defined as above is monoclonal antibody.

A further object of the present invention provides the kit of the time-resolved fluoroimmunoassay detection method that is used for detection of biological humoral sample SARS virus, comprising can be simultaneously and solid phase and the protein bound first antibody of SARS virus, and can with SARS virus protein combination and coupling the second antibody of lanthanide metal ion.

Brief Description Of Drawings

Fig. 1 is the electronic microscope image record of SARS virus.

Fig. 2 shows the indirect immunofluorescence testing result of the VeroE6 cell that SARS virus infects.Wherein employed antibody is the monoclonal antibody of anti-SARS virus.

Fig. 3 shows the hypotype analysis result of anti-SARS virus monoclonal antibody

Fig. 4 is polyacrylamide gel electrophoresis (SDS-PAGE) collection of illustrative plates of the anti-SARS virus monoclonal antibody of purifying: wherein A is 5B8, and B is 12D4.

Fig. 5 shows by the inventive method and detects the typical curve that the SARS virus of known viruse protein content obtains.

The detailed description of invention

The TR-FIA technology is to utilize the fluorescent chemicals that can launch long-life fluorescence as tracer, the mark quilt Inspection molecule (part or aglucon) also forms for example lanthanide metal ion complex compound of complex compound, and is anti-by immunology Should after disappearing, more short-life background fluorescence carry out the time to being labeled the fluorescence signal that thing sends having Resolved detection. Wherein being labeled thing can be to participate in reaction system (to mix such as antigen-antibody reaction, nucleic acid probe Hand over, the reaction of biotin Avidin and target cell pairing effect cell kill and wound reaction etc.) any part Or aglucon. The question response System forming and part takes place and the reaction of its aglucon after, the up time is differentiated fluorescence The fluorescence intensity of immunization method detection reaction bond. Based on fluorescence intensity and the known quantity to the reaction bonded thing The comparison of the relative intensity of fluorescence that analyte produces can utilize calibration curve to determine to analyze in the reaction system The concentration of thing.

In conventional fluoremetry, owing to contain multiple fluorescent component (for example from sample in the sample detection system The scattered light that colloidal solid in the product and solvent molecule cause, and Proteins in Serum is sent out with other compounds The non-specific fluorescence that goes out), causes background fluorescence excessive, thereby limited extensively making of fluorescence analysis method With. Different from the routine immunization fluorescent method, time-resolved fluoroimmunoassay detection technique (TR-FIA) then is base Can launch to have longer decay period in lanthanide element (particularly europium) and (be about 103 of conventional fluorescent-106 times) and the spy of big Stokes displacement (being more than 10 times of common fluorescein Stokes displacement) Different this character of fluorescence (the transmitted wave wavelength is 615nm) is with part or the aglucon of its mark formation detection architecture. Therefore, (wavelength is can almost completely to avoid excitation wave relevant with the protein of some type in the system 340nm) and the interference of instantaneous background fluorescence (wavelength is 350-600nm), thus can by time delay and Wavelength resolution improves accuracy and the sensitivity that detects greatly.

With radiommunoassay (RIA), EIA enzyme immunoassay (EIA) and the chemiluminescence generally used at present Immunoassay is compared with electrochemical luminescence immunoassay (ECLIA), and that the TR-FIA method has is highly sensitive, show The track thing is stablized, is not subjected to many-sided advantages such as the interference of sample natural fluorescence, no radioactivity pollute, is various lifes A kind of method for optimizing in thing medical research and the clinical ultramicron biochemical investigation means. Yet, although this technology Detect and cytology in pathogen detection, Endocrinological inspection, tumor examination, science of heredity inspection, hematology The many-sides such as inspection are widely used, but there is not yet so far the report that detects for SARS virus.

Therefore, an object of the present invention is to provide and to exist in a kind of detection of biological humoral sample The method of SARS virus, a kind of method are to adopt double antibody sandwich method to comprise: (1) provide can with the SARS disease The first antibody of poison coat protein combination is also with said antibody sandwich solid phase carrier; (2) to step (1) Coated solid phase in add biology humoral sample to be checked and control sample and under suitable condition, protect Temperature; (3) after the reaction fully the said solid phase of washing and add appropriate amount lanthanide metal ion mark, can with The protein bound SA of SARS virus and again insulation; (4) fully wash said solid phase also after the reaction Detect the fluorescent value of the lanthanide metal ion emission of being combined with SA; (5) with measured fluorescent value with The fluorescence of the parallel known quantity standard items that record compares to determine existing and relatively of SARS virus in the sample Amount.

Perhaps, also can based on A competitive inhibition method, finish according to the following steps said detection: (1) provide can with The protein bound antibody of SARS virus is also with said antibody sandwich solid phase carrier; (2) to step (1) Adding biology humoral sample to be checked and control sample, lanthanide metal ion mark can in the coated solid phase The antigen of being combined with the anti-SARS virus protein monoclonal antibody; (4) fully wash said solid phase after the reaction And the fluorescent value of the detection lanthanide metal ion emission of being combined with antigen; (5) with measured fluorescent value and flat The fluorescence of the known quantity standard items that record of row compares to determine existing and relatively of SARS virus in the sample Amount.

According to a preferred embodiment of the invention, said first antibody and SA be can be respectively with The not synantigen of SARS virus albumen is determined the monoclonal antibody of basic specific binding.

According to a preferred embodiment of the invention, wherein said lanthanide metal ion is europium ion.

According to another preferred embodiment of the present invention, wherein said biology humoral sample be selected from blood plasma, Whole blood, rinse liquid, throat swab, urine, ight soil and bronchus perfusate.

According to another preferred embodiment of the present invention, wherein said solid phase has enough immunoglobulin (Ig)s The microtiter plate of adsorption capacity.

According to the preferred embodiments of the invention, the immunoglobulin (Ig) adsorption capacity of microtiter plate is about 50-200ng/cm²。

In order to realize method of the present invention, at first in the supplying method required can with SARS virus and ginseng First and second antibody of being combined with other related components of detection architecture. For this reason, at first from patient's SARS corpse Separate in the inspection lung tissue sample and the evaluation SARS virus. Using Vero E6 host cell to go down to posterity cultivates and propagation After, observe and identifying virus (referring to accompanying drawing 1) with technology such as immuno-electron microscope, ESEM (negative staining) and PCR. In serum free medium large-scale cultivate and inactivation of viruses after, with resulting inactivation viral suspension as Immunogen immune animal (for example Balb/C mouse). After producing enough antibody in the immunized animal body, locate Dead animal also separates SPL, is used for the preparation of hybridoma and monoclonal antibody.

As a kind of alternative method, the bond that also can use a certain section peptide sequence of SARS virus albumen of synthetic or said peptide and other macromolecular carrier albumen is as the immunogen immune animal.Said peptide comprises but is not only limited to the peptide sequence of table 1:

Table 1: the peptide sequence of synthetic

Amino acid sequence source, region

170-188 LDVSEKSGNFKHLREFVFK spike protein (E2)

337-350 VYAWERKKISNCVA spike protein (E2)

387-400 FWKGDDVRQIAPG spike protein (E2)

751-766 GIAAEQDRNTREVFAQ spike protein (E2)

788-803 LPDPLKPTKRSFIEDL spike protein (E2)

963-979 LSRLDKVEAEVQIDRLI spike protein (E2)

1124-1138 QPELDSFKEELDKYF spike protein (E2)

154-168 LGRCDIKDLPKEIT memebrane protein (E1)

32-46 GRNGARPKQRRPQGL nucleocapsid protein (N)

89-105 RRATRRVRGGDGKMKEL nucleocapsid protein (N)

254-269 EASKKPRQKRTATKQY nucleocapsid protein (N)

335-350 HGAIKLDDKDPQFKDN nucleocapsid protein (N)

393-405 IETRLRKGGRTRC ORF1a polyprotein

787-800 GLMLLEIKDKEQYC ORF1a polyprotein

843-858 TFELDERVDKVLNEKC ORF1a polyprotein

3990-4005 YKQARSEDKRAKVTSA ORF1a polyprotein

187-200 GGYSEDRHSGVKDY agnoprotein

173-186 DGISTPKLKEDYQI agnoprotein

36-51 QHQNSKKTTKLVVILR agnoprotein

50-62 SELDDEEPMELDY agnoprotein

86-98 LFIRQEEVQQELY agnoprotein

81-93 KLATTEELPDEFV agnoprotein

The RNA polymerase that 53-68 CRFQEKDEEGNLLDS RNA relies on

The RNA polymerase that 731-745 LYRNRDVDHEFVDEF RNA relies on

456-471 YDNKLKAHKDKSAQC helicase

Being used to prepare the immunogenic carrier of synthetic can be keyhole limpet hemocyanin (KLH), bovine serum albumin(BSA) (BSA), poly-D-lysine (PLL) etc.For example, can be according to SARS complete sequence (the Genbank accession number of having announced: NC_004718), in conjunction with the computer software analysis result, what therefrom filter out the higher polypeptide (table 1) of amino hydrophilicity value and use said polypeptide and carrier protein molecule (for example KLH or BSA) is connected product as immunogene (referring to embodiment 1).

Exist down in polyglycol (PEG) then, the splenocyte of immunized animal and myeloma cell are merged.After the Fusion of Cells, use indirect elisa method to detect the culture supernatant that positive fused cell is cloned, and the positive colony that detects is carried out subclone with limiting dilution assay.Behind four subclones, filter out the hybridoma cell strain of 73 secretion anti-SARS virus albumen altogether.Through further paired experiment, obtain the hybridoma cell strain (5B8 and 12D4) of the monoclonal antibody that two secretions can combine with the different antibodies binding site or the epitope of SARS virus antigen.Experiment shows, cultivate the resulting culture supernatant of these cell lines all can with SARS virus generation specific reaction (referring to accompanying drawing 2), and tire that to be respectively be 1: 512 and 1: 256.With said hybridoma intraperitoneal inoculation animal, then tiring of gained ascites fluid is respectively 1: 25600 and 1: 12800.Further antibody typing experiment confirm, the antibody type of this two strains emiocytosis is IgGl (referring to accompanying drawing 3).

Then, purifying derives from the ascites fluid of inoculating the hybridoma animal and (for example uses Protein G Sepharose 4Fast Flow post, Amersham).Dialysis and concentrate after, with wherein antibody purification to electrophoresis pure (SDS-PAGE demonstrate the heavy chain of representing antibody molecule respectively and two bands of light chain) (referring to accompanying drawing 4).

In the presence of alkalescence (pH8.0-9.0) condition and metal chelating agent, use europium ion (Eu according to a conventional method ³⁺) (by EuCL ₃Provide) the monoclonal antibody 12D4 that as above obtains of mark.Purified and identify after, resulting marked product can be used for following time-resolved fluoroimmunoassay as second antibody and detect (TR-FIA).

Can use double antibody sandwich method to finish TR-FIA of the present invention and detect according to following steps.For this reason, at first wrap by 96 hole microtiter plates with the above-mentioned anti-SARS virus antibody 5B8 that in damping fluid, is diluted to debita spissitudo (5 μ g/ml), in the hole of pre-bag quilt, add the 1%FBSA sealing that contains 0.1% Tween-20 then respectively, sample to be checked (serum), the positive and the negative sample and the normative reference product that add appropriate amount after the washing, and insulation appropriate time.After washing unreacted reagent off, add the above-mentioned Eu of appropriate amount once more ³⁺The second antibody of mark (12D4), and be incubated appropriate time once more.Behind the cyclic washing, add enhancing liquid, differentiate the lanthanide series metal europium emitted fluorescence that fluorescence detection device detects and metering has combined with second antibody service time.By the typical curve (referring to accompanying drawing 5) of parallel detection known quantity standard items making, determine the existence and the amount (corresponding virus protein content) thereof of SARS virus in the sample then.

Perhaps, also can utilize to strive unexpectedly and finish above-mentioned detection, this method comprises: (1) provides can be with the protein bound antibody of SARS virus and with said antibody sandwich solid phase carrier; (2) antigen that can combine of adding biology humoral sample to be checked and control sample, lanthanide metal ion mark in the coated solid phase of step (1) with the anti-SARS virus protein monoclonal antibody; (4) the reaction back is fully washed said solid phase and is detected the lanthanide metal ion emitted fluorescence value that combines with antigen; (5) the measured fluorescent value and the fluorescence of the parallel known quantity standard items that record are compared existing and relative quantity with SARS virus in definite sample.

Use anti-SARS virus antibody provided by the invention and known time-resolved fluorescence detection technique, can be in the early stage existence that from the denier clinical sample, detects SARS virus exactly of disease generation.Therefore, based on height sensitivity, specificity and the selectivity of TR-FIA technology, the SARS virus detection method that the present invention sets up provides the important clinical basis for estimation for the early diagnosis that realizes SARS.

On the basis of laboratory study, we use method of the present invention to detect and derive from and comprise 89 examples totally 238 parts of clinical blood serum samples of confirmed cases, 56 routine suspected cases and 93 routine normal populations.The result shows, derives from the sample of 89 routine clinical patients, has 64 examples to be defined as the SARS virus positive (positive rate is 71.9%); Among the 56 routine patients suspected, there are 6 examples to detect and are the SARS virus positive (positive rate is 10.7%); The sample of 93 routine healthy premenopausal volunteers then all is the SARS virus feminine gender.If with all 89 routine clinical definite cases as the true positives case, and all 93 routine normal persons are decided to be true negative, the sensitivity that can calculate the inventive method thus is 78%, specificity is 100%, and the sensitivity very high (detectable virus protein concentration limit is below 0.2ng/ml) that detects.Therefore, method of the present invention can think that the early clinical diagnosis of SARS (Severe Acute Respiratory Syndrome) provides reliable clinical examination data completely.

Another object of the present invention provides the anti-SARS virus antibody of the detection method that is used for the invention described above, is characterised in that said antibody can combine with the specific antigen decision base region of SARS virus albumen, and can forms complex compound with lanthanide metal ion.Said antibody is with SARS virus that derives from the purifying in the SARS patient body or the artificial synthetic polypeptide immune animal that is connected with carrier molecule, the splenocyte that separates immunized animal prepares hybridoma then according to a conventional method and cultivates under proper condition that said hybridoma obtains.

A further object of the present invention provides the kit of finishing above-mentioned detection, be characterised in that comprising the first antibody that can combine simultaneously with solid phase and SARS virus, and can combine with SARS virus and coupling the second antibody of lanthanide metal ion.

According to a preferred embodiment of the invention, wherein said lanthanide metal ion is an europium ion.

Except that mentioned component, kit of the present invention also comprises the buffering agent of the pH that is used for the conditioned reaction system and is used to dilute the thinning agent of clinical sample and/or auxiliary reagent such as stabilizing agent.

In addition, what be also pointed out that is, though the second antibody that is used for the inventive method and kit is normally with mark in advance or combine lanthanide metal ion (for example europium), second antibody also can be discrete and interim together coupled when test sample with said lanthanide metal ion.

Embodiment

Embodiment 1

Present embodiment is described related material and preparation thereof in the SARS virus Detection of antigen method of the present invention for example.

(1) separation of SARS virus and propagation

From patient's postmortem lung tissue sample, separate and identify a strain sars coronavirus.Behind the Vero E6 cell (Chinese Academy of Sciences Shanghai cell institute cell bank) of resulting virus inoculation, under normal condition, cultivate infected cells as the host.Virus infection titer (TCID ₅₀/ ml) reach 10 ^6.5After above, SARS virus RNA copy number is about 10 in the fluorescence quantifying PCR method detection culture supernatant ¹²/ ml.Immune electron microscopy is about the virion (accompanying drawing 1) of 60-120nm to size.Use is to the special primer of coronavirus pol gene conserved region:

Primer 1:TAGGCGTACTGACATTAGATAATCA (SEQ ID NO:1)

Primer 2: ACAAAGTCTCTCTTCCGTAAAATCA (SEQ ID NO:2)

Reverse transcription primer: AATAAAGTCTAGCCTTACCCCATTT (SEQ ID NO:3)

Carry out RT-PCR and analyze, result's amplification obtains having the fragment of expection size (238bp).Then, use the resulting SARS virus of serum free medium large-scale culture.Use 0.4% formalin that gained virus is carried out inactivation treatment (24 hours), and after confirming that with the cytopathy political reform virus is lost deactivation fully, centrifugal (12000 rev/mins, 30 minutes) collect the culture supernatant (virus stock solution used) of inactivation of viruses, directly are used for immune animal as immunogene.

Perhaps, also can be according to SARS complete sequence (the Genbank accession number of having announced: NC_004718), in conjunction with the computer software analysis result, what therefrom filter out the higher polypeptide (table 1) of amino hydrophilicity value and use said polypeptide and carrier protein molecule (KLH or BSA) is connected product as immunogene.The connector that can prepare polypeptide and carrier molecule as follows: at first 300mg KLH (or BSA) is dissolved in the 15ml distilled water, stirs adding 400mg EDPC down, add 1ml 10% EDA after the dissolving again, regulate pH to 5.5 with 1M HCl then.Stirring under the gained potpourri room temperature is added 200mg EDPC after 2 hours again, regulate pH to 5.5 with 1M HCl equally, and with 4 ℃ of incubated overnight of potpourri.After 2 days, freeze-drying obtains EDA-KLH (or BSA) bond to PBS (7.2) dialysis.Then, the 5mg polypeptide is dissolved in the 0.08ml absolute ethyl alcohol also with the dilution of 0.32ml distilled water.This solution is mixed with water (0.4ml) solution of 20mg EDA-KLH (or BSA), and regulate pH to 5.0.Under continuing stirring, this solution is dropwise joined in the EDPC solution (1.32gEDPC is dissolved in the 1.5ml distilled water) then.Insulation is 5 hours under the room temperature, and reaction mixture to 0.1MNaCl dialysis 24 hours, is promptly obtained after the freeze-drying as immunogenic prepared product.

(2) preparation of anti-SARS virus antibody

The Balb/C mouse of using 19-21 age in week is as immunized animal, and with virus stock solution used as immunogene.At first use virus stock solution used (0.4ml) (TCID ₅₀≈ 6.5, and the viral RNA copy number is about 10 ¹²) add the emulsification of equal-volume complete Freund's adjuvant after, subcutaneous multi-point injection is to carry out fundamental immunity.After 2 weeks, carry out supplementary immunization with the same dosage virus of emulsification in different complete Freund's adjuvants.2 weeks behind the supplementary immunization are once more with virus stock solution used (0.4ml) lumbar injection that does not contain Freund, to carry out booster immunization.After the last immunity, tire from tail vein blood and the test antibody of animal.In case of necessity, can be in putting to death the animal separating Morr. cell preceding 3 days, booster immunization is once again.

After serum antibody titer reaches enough level, put to death animal and separating Morr. cell, will be incorporated in fusion under the PEG-4000 effect by the splenocyte of immune mouse and SP2/0 myeloma cell are mixed by proper proportion.

Suitably after the dilution SARS virus stoste, by microtiter plate, detect the hybridoma positive colony with indirect elisa method with gained dilution bag then, and the positive colony that detects is carried out subclone with limiting dilution assay.Behind four subclones, filter out the hybridoma cell strain of 73 strains secretion anti-SARS virus albumen altogether.Through further paired experiment, obtain two strains can with the monoclonal antibody (5B8 and 12D4) of different binding site combinations on the virus protein.

The ELISA test shows that under condition of in vitro culture, the antibody 5B8 and the tiring of 12D4 that derive from hybridoma culture supernatant are respectively 1: 512 and 1: 256.Under the condition of culture, the antibody titer that derives from the animal ascites fluid is 1: 25600 and 1: 12800 respectively in vivo.Immunofluorescence analysis shows, two strain antibodies all can with SARS virus albumen specific bond (accompanying drawing 2).Further the antibody typing experimental result shows, the antibody type of two strain of hybridoma secretion is IgG1 (accompanying drawing 3).To the morphological observation of two strain of hybridoma as seen, their chromosome number scope is between 92-110, and great majority are telocentric, and minority is inferior middle part and central kinetochore.

(3) purifying of anti-SARS virus antibody and Eu ³⁺Mark

With the mouse ascites liquid that obtains behind Protein G Sepharose 4 Fast Flow post (Amersham) the purifying intraperitoneal inoculation hybridomas (cell line 12D4), then under 4 ℃ of magnetic agitation to excessive Na ₂CO ₃Solution (pH9.3,50mmol/L) fully dialysis (12 hours).At last protein concentration is wherein adjusted to 5.0mg/ml.As seen SDS-PAGE analyzes, and the antibody behind the purifying is shown as two bands (light chain and heavy chain are seen accompanying drawing 5) on running gel.The ELISA testing result shows before antibody titer and the purifying basic identical.

In 1mg (200 μ L) monoclonal antibody 12D4 solution, add 0.5mg DTTA and adjust pH value to 8.5, then in 4 ℃ of insulations 4 hours.After the insulation solution more than 6 hours, is added EuCl to normal saline dialysis then ₃Solution (33mmol/L, 30 μ L), and under 4 ℃, continue insulation 10 hours, with labelled antibody protein.

After labeled reactant is finished, with Superdex 200 posts (Amersham) purifying resulting reaction solution, and with the Tris-HCl damping fluid that contains 0.9% NaCl (50mmol/L, pH7.6) eluent wash-out.

With reference to Eu ³⁺Standard items calculate the Eu of average each antibody protein molecule institute combination in the marked product ³⁺Ion populations.The marked product that so obtains with 0.22 μ m ultrafiltration membrance filter, and to add final concentration be 0.1% fetal bovine serum albumin (BSA), standby in-20 ℃ or-70 ℃ of preservations.

Embodiment 2

Present embodiment is described for example and is used anti-SARS virus antibody of the present invention, detects the method for SARS virus in the blood sample with double-antibody sandwich time-resolved fluorescence detection technique (TR-FIA).

The double antibody sandwich method of experiment employing standard is finished.Wherein employed normative reference product are the solution that the SARS virus albumen of following concentration is arranged respectively: 0,0.2,1,5,25 and 150ng/ml.Employed cleansing solution be the Tris-HCl damping fluid that contains 0.1% Tween-20 and 0.9% NaCl (50mmol/L, pH7.6).

Use Na ₂CO ₃/ NaHCO ₃(50mmol/L, pH9.6) as above anti-SARS antibody 5B8 (as the first antibody) protein concentration of method purifying is diluted to 5 μ g/ml to buffer solution, and adds in each hole of 96 hole microtiter plates by the volume of every hole 200 μ l, hatches 24 hours for 4 ℃ then.After hatching, with cleansing solution flushing 3 times, and each adds the 1%FBSA 250 μ l that contain 0.1% Tween-20 in every hole.After 37 ℃ of sealings are hatched 8 hours, wash 3 times with cleansing solution once more, the microtiter plate of monoclonal antibody bag quilt is promptly made in freeze-drying then.Preserve standby down in 4 ℃ or-20 ℃.

During actual detected, in antibody wraps the aperture of quilt in advance, add negative in order respectively and positive control sample, normative reference product and sample to be checked 100 μ l respectively.After the film sealing, incubated at room is 1 hour under slowly vibrating.

After hatching,, add the anti-SARS antibody 12D4 (100 μ l) (as second antibody) of above-mentioned europium mark in every then hole again with cleansing solution washing aperture 4 times and air-dry.Seal each aperture with film, and under slow jolting incubated at room 1 hour.Wash with cleansing solution after hatching, each adds every hole and strengthens liquid (Perkinelmer) 100 μ l, continues incubated at room 5 minutes under the gentle slow oscillation condition of sealing for 6 times and air-dry again.

Differentiate fluorescence detector (ANYTEST2000 type, Xin Bo biotech company in Shanghai produces) with the time then and detect fluorescent value (CPS).

According to the typical curve (accompanying drawing 5) of the normative reference product made of the known viruse protein concentration of parallel detection, calculate the concentration value of each sample automatically by computer program.The coefficient of variation (CV) between wherein same sample parallel hole should not be higher than 10%.The sample of protein concentration value 〉=0.2ng/ml is judged as the SARS virus positive, then is decided to be feminine gender less than the sample of 0.2ng/ml.

Above-mentioned experimental results show that, use provided by the invention respectively as two kinds of first and second antibody can with the antibody (5B8 and 12D4) of the different antigen binding site combinations of SARS virus, detect the SARS virus that may exist in the unknown clinical sample with the time-resolved fluorescence detection technique, it can detected minimum virus protein concentration can be low to moderate 0.2ng/ml.Statistical analysis shows that the sensitivity of this method is about 78%, and specificity reaches 100%.Therefore, the SARS virus detection method based on the time-resolved fluorescence detection technique of the present invention is a kind of detect that SARS virus in the clinical sample exists very accurate, sensitive and method efficiently.Promoting the use of of this method will be made contributions for the early diagnosis of SARS (Severe Acute Respiratory Syndrome).

Sequence table

＜110〉Guangzhou reaches auspicious antibody engineering technology company limited

＜120〉method of detection SARS virus antigen

<140>

<141>

<160>3

<210>1

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to the specific nucleotide sequence design, with primer as pcr amplification.

<400>1

TAGGCGTACT?GACATTAGAT?AATC

<210>2

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<400>2

ACAAAGTCTC?TCTTCCGTAA?AATCA

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to the specific nucleotide sequence design, to be used as the reverse transcription primer.

<400>2

AATAAAGTCT?AGCCTTACCC?CATTT

Claims

1, the method for the SARS virus in a kind of detection of biological humoral sample, a kind of method are to adopt double antibody sandwich method to comprise: (1) provides can be with the protein bound first antibody of SARS virus and with said antibody sandwich solid phase carrier; (2) in the coated solid phase of step (1), add biology humoral sample to be checked and control sample and under suitable condition, hatch the sufficiently long time; (3) reaction back fully the said solid phase of washing and add appropriate amount lanthanide metal ion mark, can and hatch once more with the protein bound second antibody of SARS virus; (4) the reaction back is fully washed said solid phase and is detected the lanthanide metal ion emitted fluorescence value that combines with second antibody; (5) the measured fluorescent value and the fluorescence of the parallel known quantity standard items that record are compared existing and relative quantity with SARS virus in definite sample.

2, according to the method for claim 1, said first antibody and second antibody are can be respectively and the monoclonal antibody of the different epitope specificity combination of SARS virus albumen.

3, according to the process of claim 1 wherein that said lanthanide metal ion is an europium.

4, according to the process of claim 1 wherein that said biology humoral sample is selected from blood plasma, whole blood, rinse liquid, throat swab, urine, ight soil and bronchus perfusate.

5, according to the process of claim 1 wherein that said solid phase is that the immunoglobulin (Ig) adsorptive power is about 50-200ng/cm ²Microtiter plate.

6, according to the process of claim 1 wherein that said detection is to use the time-resolved fluoroimmunoassay technology to finish.

7, the anti-SARS virus antibody that is used for the detection method of claim 1 is characterised in that said antibody can combine with the specific antigen decision base region of SARS virus albumen, and can forms complex compound with lanthanide metal ion.

8, according to the antibody of claim 7, said antibody prepares with SARS totivirus immune animal.

9, according to the antibody of claim 7, said antibody is to prepare with the peptide sequence of synthetic and macromolecular carrier bond immune animal.

10, according to the antibody of claim 1, the antibody that is defined as above comprise can with first and second antibody of the different epitope specificity combination of SARS virus albumen.

11, the kit that is used for the time-resolved fluoroimmunoassay detection method of detection of biological humoral sample SARS virus, comprising the first antibody that can combine simultaneously with solid phase and SARS virus, and can combine with SARS virus and coupling the second antibody of lanthanide metal ion.