CN1566156A - Recombinant target fusion protein GnRH-TNFam and its antitumor use - Google Patents

Abstract

The invention provides a novel recombination targeting fusion protein GnRH-TNF alpham which is integrated from gonadotrophin releasing hormone (GnRH-A) and recombinant mutant human tumor necrosis factor alpha (TNF alpha), the targeting fusion protein has destroying action to the tumor cells endured by the prototype TNF alpha. The invention also provides the DNA sequence of the recombinant target fusion protein GnRH-TNFam and its expression recombinants.

Description

Recombination targent fused protein GnRH-TNF α m and anticancer usage thereof

Technical field

The present invention relates to the engineered protein pharmaceutical field, more specifically, the present invention relates to encoding novel recombinant target anti-cancer agent fusion rotein GnRH-TNF α m gene, comprise described expression of gene type recombinant chou, comprise the engineering bacteria of described expression type recombinant chou, engineering bacterium expression and isolating targent fused protein GnRH-TNF α m and this targent fused protein be to the specific killing effect of a class malignant cell thus.

Background technology

Although the technology and the means of aspects such as the early diagnosis of malignant tumour, operation and chemicotherapy have all had significant progress and progress in recent years, early stage malignant tumor patient is undergone surgery and the chemicotherapy combined utilization also can obtain good effect, but concerning the late malignant tumour patient of those nothing operation indications, they not only will bear the serious toxic side effect that chemicotherapy brings, and can't cure the risk that it suffers from malignant tumour but also will bear present chemicotherapy measure.In fact, the basic reason that causes the whole world to still have the people more than 10,000,000 to lose one's life because of malignant tumour the present every year just is to lack real effective antitumour medicine.

Gland cancer (adenocarcinoma) is one of the most refractory malignant tumour clinically.According to statistics, the gland cancer that betides colon, mammary gland and lung is 3 kinds of common clinically main tumours, if the gland cancer that comes from histoorgans such as ovary, uterine endometrium, prostate gland, pancreas, kidney and liver is also taken into account, so, dying from the number of gland cancer will be above 1/2 of the total number of persons of dying from tumour.In view of this, be urgent to the new drug that is suitable for gland cancer treatment or the demand of other treatment means.

(gonadotropin-releasing hormone GnRH) is a kind of mainly synthetic and excretory nerve polypeptide hormone by hypothalamus to the gonad-stimulating hormone release peptide.It realizes the purpose that reproductive physiology is regulated by " hypothalamus → hypophysis → gonad axis ".Discover, except that hypophysis, the gland cancer that GnRH and acceptor GnRHR thereof also are expressed in tissues such as brain, mammary gland, ovary, uterine endometrium, testis, suprarenal gland, prostate gland and placenta and come from histoorgans such as mammary gland, ovary, uterine endometrium, prostate gland, pancreas, colon, lung, kidney and liver.Test confirms that GnRH and analogue thereof all have certain restraining effect to the propagation of tumour cell, so they have been subjected to extensive concern in fields such as gynaecology and tumours.Often GnRH and analogue thereof are used for sexual gland underactivity, sterile and treatment of diseases such as tumour that gonad-stimulating hormone relies on clinically.It seems that in view of the above GnRHR can be used as one of special pharmaceutically-active target of relevant gland cancer.

TNF α is found in 1975, because it all has tangible lethal effect to the kinds of tumor cells system that comprises neurofibroma, lung cancer, mammary cancer, myosarcoma and lymphoma etc., so United States Government has just ratified to treat with TNF α the clinical trial application of malignant tumour as far back as 1985.Limited application but the toxicity when TNF α uses because of its system is too big.But consider the anti-tumor activity the strongest fact of TNF α in known cytokine, people are making great efforts its application potential of exploitation always.Such as, because The experimental results all confirms, when methods such as employing limbs or organ isolated organ perfusion or intralesional direct injection, significantly improve its curative effect owing to can obviously improve the partial concn of TNF α and alleviate its toxic side effect, so the limbs isolated organ perfusion method of TNF α has been approved for the clinical treatment of the pernicious evil melanoma of limbs and the soft-tissue tumor of deep tissue etc. in Europe.

For the partial concn that improves certain toxin or cytokine with improve curative effect, inconvenient defective is gone up in operation when more overcoming regional perfusion or injection, and people often realize this purpose by making up targent fused protein.

Because GnRHR has the potentiality as gland cancer targeted therapy target, so, occurred by GnRH and common targent fused protein GnRH-PE66 and the GnRH-PAP that constitutes such as microbial toxin (pseudomonal toxin PE) or plant poison (Pokeweed antiviral protein PAP).In the research of cell levels, GnRH-PE66 not only has significant cytotoxicity to the reactive gland cell system of many tool sexual hormoue, the adenocarcinoma cell that comes from colon, lung, liver and kidney and other organs is also shown very strong lethal effect, and effective too to the former thing of being commissioned to train of the gland cancer that comes from the patient.On the other hand, for no other reason than that the existence of the target territory GnRH that forms by 10 amino acid, fusion toxin GnRH-PE66 just only kills and wounds the primary culture that those come from patient's canceration ovary or colon, and does not influence the growth of the cell of the normal ovarian that comes from same patient or colon.Moreover GnRH-PE66 can obviously suppress the growth of tumour transplatation thing in animal body, and does not have obvious toxic and side effects.All these results illustrate, are that the fusion toxin in target territory has very strong specificity with GnRH.

In the tumor research field,, really might be used for clinical few although people have made up a large amount of antineoplastic target fusion proteins.Its key is the immunogenicity of these antineoplastic target fusion proteins.Because in these antineoplastic target fusion proteins, it all is the variable region that comes from heterozoic complete antibody or antibody that its target territory has many, and mostly its anti-tumour effect territory is that some come from the toxin protein of animal, plant or microorganism.Therefore, these antineoplastic target fusion proteins often make repeated use invalid because can stimulate the patient to produce neutralizing antibody.

Think that to sum up (1) TNF α has good Application and Development potentiality---be the strongest cytokine of known anti-tumor activity, but can't use greatly because of poor specificity, toxic side effect.(2) gland cancer is that very important target disease---patient group is huge, and utmost point refractory is treated.(3) the GnRH acceptor is the desirable target that the special medicine of gland cancer is attacked---most adenocarcinoma cells surface all has the GnRH acceptor to exist, and GnRH itself is just inhibited to the propagation of adenocarcinoma cell.In view of this, we have made up a kind of targent fused protein GnRH-TNF α m that is made of the normal component GnRH and the TNF α of human body fully, in the hope of the toxic side effect that overcomes prototype TNF α with a kind of medicine of efficient, nontoxic or low toxicity is provided for late malignant tumour patient especially gland cancer patient.

Summary of the invention

Since content of the present invention relate generally to the recombination targent fused protein GnRH-TNF α m of encoding novel gene, comprise described expression of gene type recombinant chou, comprise the engineering bacteria of described expression type recombinant chou, engineering bacterium expression and isolating targent fused protein GnRH-TNF α m and this targent fused protein be to the aspects such as specific killing effect of malignant cell thus, therefore, purpose of the present invention mainly contains the following aspects:

The most important purpose of the present invention is to provide a kind of anti-cancer agent targent fused protein GnRH-TNF α m.This targent fused protein is a kind of brand-new molecule, and it is made of jointly people GnRH and human TNF alpha derivative, and it has the aminoacid sequence of SEQ ID NO:2.When making up this fusion rotein, before the 1st amino acids of its GnRH part, increase by 1 amino acid (Met), after before the 1st amino acids of its TNF α part, increased by 6 (Glu Phe Pro Pro Pro Ala) and 3 amino acid (Arg Gly Pro).Because the existence of GnRH and and the GnRH acceptor between interaction, this targent fused protein has been endowed new feature, promptly both had prototype TNF α sample activity, have relative specificity again, have more the not available activity of prototype TNF α (to the lethal effect of the tumour cell of prototype TNF α tolerance itself).That is to say, compare that recombination targent fused protein GnRH-TNF α m of the present invention has the better application prospect with the prototype TNF α that can't be applied to clinical therapy of tumor because toxic side effect is excessive.

Second purpose of the present invention is to provide the gene GnRH-TNF α m of a kind of anti-cancer agent targent fused protein GnRH-TNF α m that encodes, and it has the nucleotide sequence of SEQ ID NO:1.

The expression type recombinant chou pLEGTI and the pLT30GTI that provide two kinds to comprise described gene GnRH-TNF α m respectively is provided the 3rd purpose of the present invention.

The engineering bacteria pLTEGTI/DH5 α and the pLT30GTI/BL21/DE3 that provide two kinds to comprise described expression type recombinant chou respectively is provided the 4th purpose of the present invention.

The 5th purpose of the present invention is to provide targent fused protein GnRH-TNF α m malignant cell to be had the experimental evidence of specific killing effect.

Description of drawings

Fig. 1 shows the recombinant chou pLT9KGITNF α m that carries human TNF alpha cDNA

Fig. 2 shows sequencing vector pBluescript II SK

Fig. 3 shows the order-checking recombinant chou pYYSKTNF α m that carries mutant TNF α cDNA (TNFm)

Fig. 4 shows the order-checking recombinant chou that carries antigen-4 fusion protein gene GnRH-TNF α m

Fig. 5 shows the temperature-regulated expression type recombinant chou pLTEGTI that carries antigen-4 fusion protein gene GnRH-TNF α m

Fig. 6 shows the IPTG inducible expression type recombinant chou pLT30GTI that carries antigen-4 fusion protein gene GnRH-TNF α m

Fig. 7 shows the expression of results of the temperature-regulated expression type recombinant chou pLTEGTI of antigen-4 fusion protein gene GnRH-TNF α m, wherein the empty bacterium of swimming lane 1:DH5/induce; Swimming lane 2: albumen Marker (from top to bottom: 97,66,43,31,20,14.4kD; But 31kD is with unclear); Swimming lane 3:pLTEGTI/DH5/ does not induce; Induce for swimming lane 4:pLTEGTI/DH5/42 ℃.

Fig. 8 shows the expression of results of the IPTG inducible expression type recombinant chou pLT30GTI of GnRH-TNF α m, and wherein swimming lane 1: engineering bacteria BL21 (DE3)/pLT30GTI (5h); Swimming lane 1: engineering bacteria BL21 (DE3)/pLT30GTI (3h); Swimming lane 3: the molecular weight of albumen mark (be from top to bottom: 97,66,43,31,20,14.4kD)

Fig. 9 shows fusion rotein GnRH-TNF α m and the prototype TNF α result to L929 cytosis 24h

Figure 10 shows GnRH-TNF α m and the prototype TNF α comparison to the L929 cell killing effect before and after the Act D activation

Figure 11 shows fusion rotein GnRH-TNF α m and the prototype TNF α exercising result to liver cancer cell HepG2

Figure 12 shows fusion rotein GnRH-TNF α m and the prototype TNF α exercising result to breast cancer cell MCF-7

Figure 13 shows fusion rotein GnRH-TNF α m and the prototype TNF α exercising result to cervical cancer cell HeLa

Figure 14 shows fusion rotein GnRH-TNF α m and the prototype TNF α exercising result to pancreatic cancer cell SW1990

Figure 15 show GnRH-TNF α m and TNF α respectively with Act D combined utilization in the result of liver cancer cell HepG2

Figure 16 show GnRH-TNF α m and TNF α respectively with Act D combined utilization in the result of breast cancer cell MCF-7

Figure 17 shows fusion rotein GnRH-TNF α m and chemotherapeutic combined utilization in the result of breast cancer cell MCF-7

Figure 18 show GnRH-TNF α m and TNF α respectively with Act D combined utilization in the result of cervical cancer cell HeLa

Figure 19 shows fusion rotein GnRH-TNF α m and chemotherapeutic combined utilization in the result of cervical cancer cell HeLa

Figure 20 show GnRH-TNF α m and TNF α respectively with Act D combined utilization in the result of pancreatic cancer cell SW1990

Figure 21 shows fusion rotein GnRH-TNF α m and chemotherapeutic combined utilization in the result of pancreatic cancer cell SW1990

Specific embodiments

The present invention utilizes the cDNA of this laboratory clone's human TNF alpha to be template, it is carried out pcr amplification 2 times, with realize to the sudden change transformation of TNF cDNA and with the fusion of GnRH cDNA, obtain the fusion gene GnRH-TNF α m of coding recombination targent fused protein GnRH-TNF α m.Meet expected sequence fully through dna sequence analysis proof fusion gene GnRH-TNF α m.

Fusion gene GnRH-TNF α m is cloned respectively among coli expression carrier pCW111 or the pET-30a, obtain expression type recombinant chou pLTEGTI and pLT30GTI.The expression type recombinant chou is transformed respectively among bacillus coli DH 5 alpha or the BL21/DE3, obtain high expression engineering through screening.In engineering bacteria pLTEGTI/DH5 α and pLT30GTI/BL21/DE3, the expression amount of recombination fusion protein GnRH-TNF α m reaches about 12% and 30% of total protein of cell respectively.

Recombination targent fused protein GnRH-TNF α m of the present invention has been carried out a large amount of cell in vitro experimental studies, the result confirms, compare with standard substance TNF α, recombination targent fused protein GnRH-TNF α m has the suitable active while of TNF α sample of degree, lethal effect to l cell obviously reduces, tumour cell to tolerant T NF α has significant lethal effect, and and chemotherapeutics commonly used between synergy obviously improve.These results suggest are compared with the prototype TNF α that can't be applied to oncotherapy because toxic side effect is excessive, and recombination targent fused protein GnRH-TNF α m provided by the invention has good application prospects aspect tumor treatment.

Describe the present invention in detail hereinafter with reference to drawings and Examples.

The acquisition of the gene GnRH-TNF α m of embodiment 1. coding recombination targent fused proteins

1.PCR primer and sequence thereof

pvt3：5’-TTA GAATTCCCGCCACCGGCCGTACCGGGTCCAAGATCA-3’

EcoRI

Pvt4：5’-TAT GGATCC? TTATCACAGGGCAATGAT-3’

BamHI?Stop?codons

Pgt1：5’-AAA CATATGCAGCACTGGTCCTATGGTCTGCGCCCTGGC GAATTCCCGCCACCG-3’

NdeI EcoRI

Pgt2：5’-AAA CATATGCAGCACTGGTCCCATGGTTGGTGTCCGGGC GAATTCCCGCCACCG-3’

NdeI EcoRI

2. the acquisition of mutant TNF α cDNA (TNF α m)

Utilize PCR primer pvt3 and pvt4 that the TNF α cDNA among the recombinant plasmid pLT9KGITNF α m (Fig. 1) of this laboratory structure is carried out specific amplified, obtain the cDNA (TNF α m) of mutant TNF α.Consequently the 5 ' end of TNF α cDNA introduce 1 EcoRI site ( GAA TTC) and the codon of several additional amino acids GAA TTC CCG CCA CCG GCCGTA CCG GGT CCAThe AGA TCA boldface type of underscore (wherein with).This section encoding sequence corresponding amino acid sequence is: Glu Phe Pro Pro Pro AlaVal Arg Gly ProArg Ser.Simultaneously, also its 3 ' end introduce 2 terminator codons ( UAA UGA) and 1 BamHI site ( GGA TCC).For the conclusive evidence dna fragmentation that obtains is the TNF α m of expection, it is carried out the EcoRI/BamHI double digestion, and with link to each other through the same sequencing vector pBluescript II SK (Fig. 2) that handles, obtain the recombinant chou pYYSKTNF α m (Fig. 3) that checks order.Its enzyme cuts qualification result and The sequencing results all meets expection fully.

3. the acquisition of fusion gene GnRH-TNF α m

For obtain expection can with the targent fused protein GnRH-TNF α mm of the tumour cell specific combination of GnRH receptor positive, utilize PCR primer " pgt1/pvt4 " that the TNF α m among the template pYYSKTNF α m is carried out specific amplified.Consequently in 5 ' end introducing 1 the NdeI site (CAT ATG) of TNF α m cDNA and the coding region (CAGCACTGGTCCTATGGTCTGCG CCCTGGC) of GnRH.The other parts no change of TNFm cDNA, 3 ' end still is 2 terminator codons (UAA UGA) and 1 BamHI site (GGA TCC).Be the fusion gene GnRH-TNF α m of expection for the conclusive evidence dna fragmentation that obtains, it is carried out BamHI single endonuclease digestion (its 5 ' end is treated as flush end), and link to each other with sequencing vector pBluescript II SK (XbaI recovery) through XbaI (mend flat)/BamHI double digestion, obtain order-checking recombinant chou pLTSKGTI (Fig. 4), its restriction enzyme mapping qualification result and The sequencing results all meet expection.

The structure of embodiment 2. fusion gene GnRH-TNF α m temperature-regulated expression type recombinant chou pLTEGTI

In order in E.coli, fusion gene GnRH-TNF α m to be expressed as fusion rotein GnRH-TNF α m, it to be cloned between the NdeI/BamHI of the E.coli expression vector pCW111 that this laboratory into makes up, thereby its expression is placed temperature control promotor P _RP _LControl under.Its building process is: pLTSKGTI is carried out the NdeI/BamHI double digestion, reclaim fusion gene GnRH-TNF α m fragment, expression vector pCW111 with the same processing of warp links to each other then, thereby obtains the temperature-regulated expression type recombinant chou pLTEGTI (Fig. 5) of fusion gene GnRH-TNF α m.Its restriction enzyme mapping qualification result conforms to expection.

The structure of the IPTG inducible expression vector pLT30GTI of embodiment 3. fusion gene GnRH-TNF α m

The building process of pLT30GTI is: pLTSKGTI is carried out the NdeI/BamHI double digestion, reclaim fusion gene GnRH-TNF α m fragment, expression vector pET30 with the same processing of warp links to each other then, thereby obtains the IPTG inducible expression type recombinant chou pLT30GTI (Fig. 6) of fusion gene GnRH-TNF α m.Its restriction enzyme mapping qualification result conforms to expection.

The abduction delivering of embodiment 4. recombination targent fused protein GnRH-TNF α m

1. the temperature control abduction delivering of recombination targent fused protein GnRH-TNF α m

Behind the temperature-regulated expression type recombinant chou pLTEGTI that has obtained fusion gene GnRH-TNF α m, respectively its a plurality of engineering strain pLTEGTI/DH5 α 30～32 ℃ of activation amplifications and 42 ℃ of abduction deliverings have been carried out.Fig. 7 is the fusion rotein GnRH-TNF α m expression level SDS-PAGE electrophoresis result of the expression product of high bacterial strain.This glue is through laser scanning analysis and integral and calculating, and two kinds of Expression of Fusion Protein amounts reach more than 12% with the ratio of bacterial protein.

2. the IPTG abduction delivering of recombination targent fused protein GnRH-TNF α m

For improving the expression level of target protein, again engineering bacteria pLT30GTI/BL21 (DE3) has been carried out IPTG (final concentration of IPTG is 1mM) abduction delivering.Fig. 8 is the fusion rotein GnRH-TNF α m expression level SDS-PAGE electrophoresis result of the expression product of high bacterial strain.This glue is through laser scanning analysis and integral and calculating, and expression level soprano's fusion rotein has all reached 30% of bacterial protein in two kinds of engineering bacterias.

The fask oscillating method of embodiment 5. recombination targent fused protein GnRH-TNF α m is expressed and separation and purification

1. the fask oscillating method of recombinant target Protein G nRH-TNF α m is expressed

For obtaining a certain amount of fusion rotein, the highest engineering bacteria pLT30GTI/BL21/DE3 of expression level has been carried out fask oscillating method cultivated and the IPTG abduction delivering for activity research usefulness.

(1) activation of engineering bacteria: choose single colony inoculation (the kantlex final concentration is 50mg/L) in 5ml LB nutrient solution, 37 ℃ of 200rpm cultivate 8～12h.

(2) amplification of engineering bacteria: activatory bacterium liquid is transferred among the 20ml LB, and 37 ℃ of 200rpm cultivate 8～12h.

(3) IPTG induces: the immigration of 20ml bacterium liquid is contained among the 1000ml LB of kantlex 37 ℃ of 200rpm 4h.Add 40% D/W 25ml and IPTG (final concentration is 1mM), 37 ℃ of 200rpm abduction delivering 5h.Centrifugal then collection thalline.

2. cut glue method separation and purification recombinant target Protein G nRH-TNF α m

(1) collects and wash thalline: 8000rpm and collected bacterium in 5 minutes, claim the thalline weight in wet base.With containing 40ml 3%Triton X-100, the solution of 50mM Tris-HCl and 2mM EDTA (consumption of following each lavation buffer solution is 30～50ml damping fluid/g wet thallus) washing thalline stirred evenly on the agitator 10～30 minutes.8000rpm collected thalline in 5 minutes.

(2) broken thalline: use lysis buffer (50mM Tris-HCl, pH8.5～9.0,2mM EDTA, 100mM NaCl, 5%Triton X-100,0.5mg/ml N,O-Diacetylmuramidase) with cell suspension.For guaranteeing the action effect of N,O-Diacetylmuramidase, the suitable height of the pH value of lysate should not be low.With stirring half an hour under the agitator room temperature, make the complete mixing of thalline and solution, again with it in 37 ℃ of 200rpm 4h, so that suspension is because the effect of N,O-Diacetylmuramidase and thickness.

(3) supersound process and collect inclusion body: each ultrasonic 10 seconds, 15 seconds at interval, about 90～100 times, until bacterium liquid thickness no longer.8000rpm collected inclusion body in 7 minutes then.

Annotate: ultrasonicly in ice-water bath, carry out, to prevent the albumen charing.Ultrasonic power should not excessive (general 75～150W gets final product), otherwise also can cause the albumen charing.Container during supersound process is good with glass beaker.Ultrasonic probe to be positioned under the liquid level about 3cm and the above 2cm of beaker bottom for well.

(4) washing inclusion body: with washings (5%Triton X-100,50mM Tris-HCl, pH8.0,2mM EDTA, pH8.0) abundant suspension precipitation, 8000rpm collection in 10 minutes inclusion body after fully stirring.

(5) SDS-PAGE electrophoretic separation and electroelution: behind the capable SDS-PAGE electrophoresis of gained inclusion body, gel is put into 1%KCl solution, dyeing is 15 minutes under the room temperature.Downcut target protein place part, gel is smashed to pieces, put into dialysis tubing, the Tris-glycine solution that adds 5～10ml simultaneously in the dialysis tubing carries out electroelution (electrophoretic buffer also is the Tris-glycine solution).Under the 10mA after 8～10 hours, reverse voltage electrophoresis 5 minutes.

(6) dialysis: the liquid of collecting in the dialysis tubing is also centrifugal, changes supernatant liquor over to another dialysis tubing, puts in the distilled water and dialyses more than 24 hours in 4 ℃.Changed distilled water once in per 4 hours.

(7) precipitate: with PEG-10000 dialysis tubing being dewatered, (4 ℃ 4～5h), extremely liquid measure is 4～5ml (few more good more) in the bag.Liquid in the dialysis tubing is poured in the centrifuge tube, added acid acetone (sample: acid acetone=1: 5), freezing 12 hours behind the mixing in-20 ℃.With frozen sample concussion back centrifugal 15 minutes in 12000rpm.Supernatant is abandoned in suction, adds the acid acetone of 10ml again, and similarity condition is centrifugal again 1 time behind the mixing.Supernatant is abandoned in suction, and the centrifuge tube at precipitation place is put-20 ℃ of refrigeration chamber freeze-drying.

(8) lyophilize: add an amount of dissolved in distilled water in every lyophilized products, the protein soln branch packed into (0.5ml/ props up) in the Eppendorf pipe, in-70 ℃ freezing more than 2 hours, insert lyophilizer suction freeze-drying then.Dried frozen aquatic products is placed-70 ℃ of preservations standby.

2. inclusion body washing method separation and purification recombinant target Protein G nRH-TNF α m

In the method, " collection of thalline and washing ", " fragmentation of thalline " and " the preliminary supersound process of thalline " are equal to above-mentioned " cutting the glue method ", so do not give unnecessary details.

(1) washing of inclusion body and cracking again: with washings (5%Triton X-100,50mMTris-HCl, pH8.0,2mM EDTA, pH8.0) fully suspend and wash the inclusion body that obtains (stirring behind 1～2h 8000rpm 10 minutes) 2 times in 4 ℃ after, use ultrasonication again 50 times (10 seconds/time) after treating fully to suspend, last 8000rpm collected inclusion body in 10 minutes.

(2) dissolving of inclusion body and renaturation: usefulness sex change damping fluid (the 6mol/L Guanidinium hydrochloride, 0.1mol/Ltris-HCl, PH8.6,1mmol/L EDTA, 0.05mmol/L NaCl 10mmol/LDDT) dissolves inclusion body (as far as possible reducing the volume of solution) in ice bath.10 minutes centrifugal inclusion body solution of 12000rpm, 1 volume supernatant is added 100 volume protein renaturation liquid (50mmol/L Tris-HCl, PH8.0,1mmol/L EDTA, 0.25mol/L NaCl, 0.25mol/L L-arginine, 5mmol/L DDT) in, stir 48 hours gently so that protein renaturation in 4 ℃.

(6) dialysis: the protein solution after the renaturation is moved into dialysis tubing, put in the distilled water and dialysed 24 hours.It is freezing that protein solution after the dialysis is put-70 ℃ of refrigerators, waits to freeze real back row vacuum lyophilization, and-70 ℃ standby.

The active detection of TNF α sample of embodiment 6. recombination targent fused protein GnRH-TNF α m

Whether also have related activity and the active relative intensity thereof of prototype TNF α for understanding targent fused protein GnRH-TNF α m, become fiber (knurl) cell L929 (measuring the classical clone of TNF α cytotoxic activity) that the reactivity of targent fused protein GnRH-TNF α m and standard substance TNF α is compared research with regard to the mouse of Act D sensitization.

With RPMI 1640 basic culture solution that do not contain calf serum (containing the Sleep-promoting factor B of 1mmol/L and the reduced glutathion of 4mmol/L) dissolving targent fused protein GnRH-TNF α m, 4 ℃ of the filter filtration sterilization postposition of 0.22 μ m are standby.

Collect the L929 cell of logarithmic phase, it is diluted to 1 * 10 with RPMI 1640 complete culture solutions that contain 10% calf serum ⁵Cell/ml.By 2 * 10 ⁴The amount in cell/ hole adds the L929 cell in 96 orifice plates, 37 ℃ of 5%CO ₂Overnight incubation under the condition.

With the RPMI1640 complete culture solution sample is done suitable dilution: with targent fused protein GnRH-TNF α m in 0.3: 1: 3: 10: 30: 100 ratio is divided into 6 dosage groups respectively, and final concentration is respectively 0.045 μ g/ml, 0.15 μ g/ml, 0.45 μ g/ml, 1.5 μ g/ml, 4.5 μ g/ml and 15 μ g/ml.With standard substance TNF α in 1: 3: 10: 30: 100: 300 ratio also is divided into 6 dosage groups, and ultimate density is respectively 1IU/ml, 3IU/ml, 10IU/ml, 30IU/ml, 100IU/ml and 300IU/ml.Other establishes 1 common " 0 " dosage group.Each dosage group is all established 3 parallel holes.

Add Act D in the above-mentioned nutrient solution that contains sample, making final concentration is 1 μ g/ml.The old nutrient solution in the cell cultures hole is abandoned in suction, adds the new nutrient solution that contains sample by the amount in 0.2ml/ hole, continues to cultivate 24 hours.

By final concentration is the dosage adding MTT (every hole adds the MTT stoste 20 μ l of 5mg/ml) of 500 μ g/ml, 37 ℃ of 5%CO ₂Continue to cultivate (dyeing) 4 hours under the condition.

Inhale the old nutrient solution of abandoning in (using up) hole respectively, every hole adds DMSO 180 μ l, slowly shakes colour developing 15 minutes under the room temperature, surveys OD with microplate reader _570nm

Calculate according to formula: cell survival rate=test group OD value/the moon is to OD value * 100%

Cell killing rate=(1-cell survival rate) * 100%

Result: as can be seen from Figure 9, after in used dosage range, acting on 24h, except that the lowest dose level group, the GnRH-TNF α m of other each group and standard substance TNF α are to all having significant lethal effect (P＜0.05 or P＜0.01) through Act D activatory L929 cell, the kill rate of the two is respectively: GnRH-TNF α m---and 7.3%, 30.6%, 69.5%, 77.5%, 78.7% and 81.5%, standard substance TNF α---18.6%, 22.7%, 47.8%, 64.4%, 76.0% and 74.2%.Illustrate that recombination targent fused protein GnRH-TNF α m has kept the activity of prototype TNF α preferably.

Avidity between embodiment 7. recombination targent fused protein GnRH-TNF α m and the TNF α acceptor

Because l cell L929 surface has a large amount of TNF α acceptor and very sensitive to TNF α, so the fragmentation test of this cell often is used to detect the biologic activity of TNF α and derivative thereof.We test by means of this, and the avidity between targent fused protein GnRH-TNF α m and prototype TNF α and the TNF α acceptor is compared research (the dosage setting is identical with " embodiment 6. "), found that (referring to Figure 10):

(1) concerning without Act D activatory L929 cell, in used dosage range, all apparently higher than each group of GnRH-TNF α m of correspondence, the average kill rate of the two is respectively 55.6% and 25.8% to the lethal effect intensity of each dosage group of TNF α.The cell killing effect of supposing TNF α is depended on fully and it is present in interaction between the TNF α acceptor on target cell surface, so, the avidity of GnRH-TNF α m and TNF α acceptor have only avidity between TNF α and the TNF α acceptor 46.4%.

(2) for through Act D activatory L929 cell, then be the lethal effect intensity of each dosage group of GnRH-TNF α m each group of TNF α apparently higher than correspondence, the average kill rate of the two is respectively 86.6% and 77.8%.The average kill rate that is GnRH-TNF α m is 111% of TNF α.

(3) Act D can make GnRH-TNF α m that the average kill rate of L929 cell is improved 60.8% (86.6%-25.8%), and makes TNF α that the average kill rate of L929 cell is improved 22.2% (77.8%-55.6%) only.That is to say that the synergy intensity between GnRH-TNF α m and the Act D is 2.74 times (60.8%/22.2%) between TNF α and the Act D.

Above presentation of results the problem of two aspects, promptly compare with prototype TNF α, the introducing of target territory GnRH has reduced the avidity between fusion rotein GnRH-TNF α m and the TNF α acceptor; The existence of target territory GnRH has strengthened between fusion rotein GnRH-TNF α m and the chemotherapeutics Synergistic killing effect to tumour cell.

People know, cause TNF α toxicity serious and can't be used for extensive distribution (the histocyte specificity is low) that clinical major cause is TNF α acceptor and the high-affinity between TNF α and its acceptor.And after we introduce target territory GnRH, both reduced the avidity between GnRH-TNF α m and the TNF α acceptor, strengthened between GnRH-TNF α m and the chemotherapeutics acting synergistically again.That is to say that not only the toxic side effect of targent fused protein GnRH-TNF α m itself has alleviated, but also can further alleviate its presumable toxic side effect by mode with the chemotherapy drugs in combination application.

Embodiment 8. recombination targent fused protein GnRH-TNF α m are to the lethal effect of the tumour cell of tolerant T NF α

Though recombination targent fused protein GnRH-TNF α m has kept the activity of prototype TNF α preferably,, the two is incomplete same after all aspect composition---in the former, introduced GnRH as the target territory.As previously mentioned, why we play a role GnRH as TNF α target territory, mainly be because: (1) TNF α has good development prospect---be the strongest cytokine of known anti-tumor activity, but because its poor specificity (because the tissue specificity that TNF α acceptor distributes is poor), toxic side effect is big and can't use.(2) gland cancer is that very important target disease---patient group is huge, and utmost point refractory is treated.(3) the GnRH acceptor is the desirable target that the special medicine of gland cancer is attacked---most adenocarcinoma cells surface all has the GnRH acceptor to exist, and GnRH itself is just inhibited to the propagation of adenocarcinoma cell.Its final purpose is in order to obtain a kind of anti-tumor medicine of efficient, nontoxic or low toxicity.

For studying existence itself that just propagation of tumour cell is had certain inhibiting target territory GnRH the activity of GnRH-TNF α m is had or not influence actually, or any influence arranged, and compare with prototype TNF α, the active characteristics of tumor cytotoxicity of GnRH-TNF α m, the inventor compares research with regard to recombination targent fused protein GnRH-TNF α m to the cell killing activity of liver cancer cell HepG2, breast cancer cell MCF-7, cervical cancer cell HeLa and the pancreatic cancer cell SW1990 etc. that are known as prototype TNF α resistance.

Among the result that will address from below as can be seen, in used dosage range (the dosage setting is identical with " embodiment 6. "), though the standard substance TNF α of nearly all concentration does not all have tangible lethal effect in 3 action times such as 24h, 48h and 72h to above-mentioned 4 kinds of tumour cells, but the fusion rotein GnRH-TNF α m of higher concentration to the lethal effect of these tumour cells but clearly.

1. fusion rotein GnRH-TNF α m is to the lethal effect of liver cancer cell HepG2

The result as shown in figure 11, behind 37 ℃ of effect 24h, 48h and 72h, fusion rotein GnRH-TNF α m has shown tangible lethal effect to liver cancer cell HepG2 when 15 μ g/ml, kill rate reaches 56.4%, 83.8% and 82.2% (3 times are P＜0.001) respectively.And standard substance TNF α does not only have lethal effect under 3 action times and all concentration conditions, and also has certain growth promoting function.

2. fusion rotein GnRH-TNF α m is to the lethal effect of breast cancer cell MCF-7

The result behind 37 ℃ of effect 24h, has only the fusion rotein GnRH-TNF α m of 15 μ g/ml that breast cancer cell MCF-7 has been shown strong lethal effect as shown in figure 12, and kill rate is 47.7% (P＜0.001).During to 48h, 1.5 μ g/ml, 4.5 μ g/ml and 15 μ g/ml group have the kill rate of 11.0% (P＜0.05), 18.7% (P＜0.01) and 66.1% (P＜0.001) respectively.During to 72h, 4.5 μ g/ml and 15 μ g/ml group have the kill rate of 25.1% (P＜0.01) and 64.3% (P＜0.001) respectively.But standard substance TNF α does not all have lethal effect to this tumour cell under 3 action times and all concentration conditions.

3. fusion rotein GnRH-TNF α m is to the lethal effect of cervical cancer cell HeLa

The result as shown in figure 13, fusion rotein GnRH-TNF α m to the lethal effect of cervical cancer cell HeLa relatively a little less than, behind effect 24h and 48h, have only 15 μ g/ml group that the kill rate of 19.1% (P＜0.01) and 42.0% (P＜0.001) is arranged, during to 72h, the kill rate of 4.5 μ g/ml and 15 μ g/ml group is respectively 11.0% (P＜0.01) and 69.4% (P＜0.001).And standard substance TNF α has only shown slight lethal effect when 24h.

4. fusion rotein GnRH-TNF α m is to the lethal effect of pancreatic cancer cell SW1990

The result as shown in figure 14, fusion rotein GnRH-TNF α m is stronger relatively to the lethal effect of pancreatic cancer cell SW1990, behind effect 24h, 4.5 μ g/ml and 15 μ g/ml group has the kill rate of 15.1% (P＜0.05) and 48.6% (P＜0.01) respectively.During to 48h and 72h, all dosage groups have all shown significant lethal effect to this tumour cell, and the High Fragmentation rate of these two times is respectively 63.3% (P＜0.001) and 71.1% (P＜0.001).

Standard substance TNF α is an exception to the exercising result of SW1990, because in all test group, have only standard substance kill rate to tumour cell when 48h and 72h of lowest dose level group (1IU/ml) to surpass 10%, be respectively 11.8% and 12.0% (P＜0.05).

Synergy between embodiment 9. recombination targent fused protein GnRH-TNF α m and the tumor chemotherapeutic drug

The toxic side effect of Chang Yinwei antitumor drug and have a strong impact on curative effect and patient's prognosis clinically.If have synergy between targent fused protein GnRH-TNF α m and the chemotherapeutics commonly used, then can the method for consumption reduces toxic side effect by reducing each other.Therefore, we are after having confirmed that recombination targent fused protein GnRH-TNF α m is tried tumour cell to the liver cancer cell HepG2 that is known as prototype TNF α resistance and other and all has tangible lethal effect, and (----Cis, amine methopterin--MTX and 5 FU 5 fluorouracil--synergy between 5-FU) compares research for Act D, cis-platinum as dactinomycin to this fusion rotein and prototype TNF α and chemotherapeutics commonly used clinically again.

If can draw such conclusion from this test, i.e. " result when using with chemotherapy drugs in combination with prototype TNF α compares; when fusion rotein GnRH-TNF α m and chemotherapy drugs in combination are used tumour cell is had stronger Synergistic killing effect ", so, in process of clinical application, just can and further reduce under the situation of its toxic side effect, obtain better result of treatment at the using dosage that reduces fusion rotein GnRH-TNF α m and chemotherapeutics.

From following result as can be seen, compare, have stronger synergistic action effect really between fusion rotein GnRH-TNF α m and the used chemotherapeutics with prototype TNF α.

1. when fusion rotein GnRH-TNF α m and chemotherapy drugs in combination are used to the Synergistic killing effect of liver cancer cell HepG2

(1) fusion rotein GnRH-TNF α m and ActD combined utilization are in the result of HepG2

As can be seen from Figure 15, behind the combined utilization 24h, Act D can make tumour cell HepG2 that the susceptibility of fusion rotein GnRH-TNF α m and standard substance TNF α is all obviously strengthened (P＜0.05 or＜0.01), that is unites with the two and all to have the obvious synergistic effect when using.

On the other hand, compare with the standard substance TNF α group that two dosage is higher, the synergy between fusion rotein GnRH-TNF α m and the Act D is stronger, and kill rate is higher, is respectively 76.2%vs 65.1% and 88.2%vs 66.9%.

(2) fusion rotein GnRH-TNF α m and Cis, MTX or 5-FU combined utilization are in HepG2 result

Result when using separately with fusion rotein GnRH-TNF α m compares, and the combined utilization of fusion rotein GnRH-TNF α m and Cis, MTX or 5-FU does not make the mortality ratio of liver cancer cell HepG2 obviously raise.Prompting in used dosage range, does not have obviously synergy between the fusion rotein GnRH-TNF α m of used dosage and these chemotherapeutics.

2. when fusion rotein GnRH-TNF α m and chemotherapy drugs in combination are used to the Synergistic killing effect of breast cancer cell MCF-7

(1) fusion rotein GnRH-TNF α m and Act D combined utilization are in the result of MCF-7

As can be seen from Figure 16, behind the combined utilization 24h, Act D can make tumour cell MCF-7 that the susceptibility of fusion rotein GnRH-TNF α m and standard substance TNF α is all obviously strengthened (P＜0.05 or＜0.01), that is unites with the two and all to have the obvious synergistic effect when using.

On the other hand, compare with standard substance TNF α, when dosage was higher, the synergy between fusion rotein GnRH-TNF α m and the Act D was stronger, kill rate higher (77.0%vs55.5%).

(2) fusion rotein GnRH-TNF α m and Cis, MTX or 5-FU combined utilization are in the result of MCF-7

As can be seen from Figure 17, though when fusion rotein GnRH-TNF α m uses separately MCF-7 is just had significantly (except that the lowest dose level group) lethal effect (cell mortality minimum 7.5%, the highest by 64.9%, average 25.5%), but, the combined utilization of Cis and GnRH-TNF α m does not make the mortality ratio (minimum 17.9%, the highest by 64.9%, average 28.4%) of MCF-7 obviously raise.This results suggest in used dosage range, does not have obviously synergy to each other.

During the share of GnRH-TNF α m and MTX, then there is the mortality ratio (minimum 25.7%, the highest by 67.6%, average 36.9%) of part dosage group cell obviously to raise (P＜0.05 or＜0.01).Prompting in used dosage range, has certain synergy to each other.

When GnRH-TNF α m and 5-FU combined utilization, except that lowest dose level group (cell mortality 9.9%), the cytotoxicity of other each test group all obviously strengthens (P＜0.05 or＜0.01), cell mortality between 30.2%～70.0%, average 38.5%.Prompting, in used dosage range, the two has the obvious synergistic effect.

Compare with the result of " GnRH-TNF α m/Cis " group, except that two low dose group, the cell killing effect of " GnRH-TNF α m/5-FU " group more increases (P＜0.05 or＜0.01).

Compare the effect of two higher dosage groups of " GnRH-TNF α m/5-FU " group also stronger (P＜0.05 or＜0.01) with " GnRH-TNF α m/MTX " group.

This results suggest, in used dosage range, in the cell toxicity test based on breast cancer cell MCF-7, the synergy when 5-FU and GnRH-TNF α m combined utilization is the strongest.

3. when fusion rotein GnRH-TNF α m and chemotherapy drugs in combination are used to the Synergistic killing effect of cervical cancer cell HeLa

(1) fusion rotein GnRH-TNF α m and Act D combined utilization are in the result of HeLa

As can be seen from Figure 18, behind the combined utilization 24h, Act D can make tumour cell HeLa that the susceptibility of fusion rotein GnRH-TNF α m and standard substance TNF α is all obviously strengthened (P＜0.05 or＜0.01), that is unites with the two and all to have the obvious synergistic effect when using.

On the other hand, when high dosage, the synergy between fusion rotein GnRH-TNF α m and the Act D is stronger, kill rate higher (72.6%vs.41.7%).

(2) fusion rotein GnRH-TNF α m and Cis, MTX or 5-FU combined utilization are in HeLa result

As can be seen from Figure 19, when Cis and fusion rotein GnRH-TNF α m combined utilization, have only the kill rate of maximum dose level group obviously to raise (36.7%, P＜0.05).Prompting has certain synergy to each other

When GnRH-TNF α m and MTX combined utilization, the cytotoxicity of each test group obviously strengthens (P＜0.05 or＜0.01), and the kill rate scope is between 8.0%～26.9%.Point out the two that synergy is arranged.

When GnRH-TNF α m and 5-FU combined utilization, the cytotoxicity of each test group all obviously strengthens (P＜0.05 or＜0.01) kill rate scope between 19.3%～58.7%.Point out the two that the obvious synergistic effect is arranged.

Comparatively speaking, in used dosage range, concerning the HeLa cell, the synergy when 5-FU and GnRH-TNF α m combined utilization is the strongest.

4. when fusion rotein GnRH-TNF α m and chemotherapy drugs in combination are used to the Synergistic killing effect of pancreatic cancer cell SW1990

(1) fusion rotein GnRH-TNF α m and Act D combined utilization are in the result of SW1990

As can be seen from Figure 20, behind the combined utilization 24h, Act D can make tumour cell SW1990 that the susceptibility of fusion rotein GnRH-TNF α m and standard substance TNF α is all obviously strengthened (P＜0.05 or＜0.01), that is unites with the two and all to have the obvious synergistic effect when using.

On the other hand, when higher dosage, fusion rotein GnRH-TNF α m is relative stronger with synergy between the Act D, kill rate higher (71.3%vs.55.9%).

(2) fusion rotein GnRH-TNF α m and Cis, MTX or 5-FU combined utilization are in SW1990 result

As can be seen from Figure 21, when Cis and fusion rotein GnRH-TNF α m combined utilization, when using separately with GnRH-TNF α m, the cell killing rate of each test group compares no considerable change.Prompting does not have obviously synergy to each other

Except that 1 the highest group of dosage, the cytotoxicity when GnRH-TNF α m and MTX combined utilization obviously strengthens (P＜0.05), and the kill rate scope is between 24.2%～40.3%.Point out the two that certain synergy is arranged.

When GnRH-TNF α m and 5-FU combined utilization, the cytotoxicity of each test group all obviously strengthens (P＜0.05), and the kill rate scope is between 18.9%～53.3%.Point out the two that very strong synergy is arranged.

Comparatively speaking, in used dosage range, concerning the HeLa cell, 5-FU and the synergy of GnRH-TNF α m combined utilization when SW1990 are the strongest.

Sequence table

＜110〉Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences

＜120〉recombination targent fused protein GnRH-TNF α m and anticancer usage thereof

<130>I20031302CB

<160>2

<170>PatentIn?version?3.1

<210>1

<211>531

<212>DNA

＜213〉artificial sequence

<400>1

atgcagcact?ggtcctatgg?tctgcgccct?ggcgaattcc?cgccaccggc?cgtacgcggt 60

ccaagatcat?cttctaaaac?cccgagtgac?aagcctgtag?cccatgttgt?agcaaaccct 120

caagctgagg?ggcagctcca?gtggctgaac?cgccgggcca?atgccctcct?ggccaatggc 180

gtggagctga?gagataacca?gctggtggtg?ccatcagagg?gcctgtacct?catctactcc 240

caggtcctct?tcaagggcca?aggctgcccc?tccacccatg?tgctcctcac?ccacaccatc 300

agccgcatcg?ccgtctccta?ccagaccaag?gtcaacctcc?tctctgccat?caagagcccc 360

tgccagaggg?agaccccaga?gggggctgag?gccaagccct?ggtatgagcc?catctatctg 420

ggaggggtct?tccagctgga?gaagggtgac?cgactcagcg?ctgagatcaa?tcggcccgac 480

tatctcgact?ttgccgagtc?tgggcaggtc?tactttggga?tcattgccct?g 531

<210>2

<211>177

<212>PRT

＜213〉artificial sequence

<400>2

Met?Gln?His?Trp?Ser?Tyr?Gly?Leu?Arg?Pro?Gly?Glu?Phe?Pro?Pro?Pro

1 5 10 15

Ala?Val?Arg?Gly?Pro?Arg?Ser?Ser?Ser?Lys?Thr?Pro?Ser?Asp?Lys?Pro

20 25 30

Val?Ala?His?Val?Val?Ala?Asn?Pro?Gln?Ala?Glu?Gly?Gln?Leu?Gln?Trp

35 40 45

Leu?Asn?Arg?Arg?Ala?Asn?Ala?Leu?Leu?Ala?Asn?Gly?Val?Glu?Leu?Arg

50 55 60

Asp?Asn?Gln?Leu?Val?Val?Pro?Ser?Glu?Gly?Leu?Tyr?Leu?Ile?Tyr?Ser

65 70 75 80

Gln?Val?Leu?Phe?Lys?Gly?Gln?Gly?Cys?Pro?Ser?Thr?His?Val?Leu?Leu

85 90 95

Thr?His?Thr?Ile?Ser?Arg?Ile?Ala?Val?Ser?Tyr?Gln?Thr?Lys?Val?Asn

100 105 110

Leu?Leu?Ser?Ala?Ile?Lys?Ser?Pro?Cys?Gln?Arg?Glu?Thr?Pro?Glu?Gly

115 120 125

Ala?Glu?Ala?Lys?Pro?Trp?Tyr?Glu?Pro?Ile?Tyr?Leu?Gly?Gly?Val?Phe

130 135 140

Gln?Leu?Glu?Lys?Gly?Asp?Arg?Leu?Ser?Ala?Glu?Ile?Asn?Arg?Pro?Asp

145 150 155 160

Tyr?Leu?Asp?Phe?Ala?Glu?Ser?Gly?Gln?Val?Tyr?Phe?Gly?Ile?Ile?Ala

165 170 175

Leu

Claims (14)

1. recombination fusion protein GnRH-TNF α m, it is made up of human gonadotropin's release peptide (GnRH) and huamn tumor necrosis factory alpha (TNF α), and it has the aminoacid sequence of SEQ ID NO:2.

2. the fusion gene GnRH-TNF α m of coding recombination targent fused protein GnRH-TNF α m, it has the dna sequence dna of SEQ ID NO:1.

3. the expression type recombinant chou that includes the described fusion gene of claim 2.

4. expression type recombinant chou as claimed in claim 3, it is temperature-induced type expression recombinant, the expression of described fusion gene GnRH-TNF α m realizes based on temperature-induced.

5. expression type recombinant chou as claimed in claim 4, it is pLTEGTI, collection of illustrative plates is seen Fig. 5.

6. expression type recombinant chou as claimed in claim 3, it is an IPTG inducible expression recombinant chou, the expression of described fusion gene GnRH-TNF α m is induced based on IPTG and is realized.

7. expression type recombinant chou as claimed in claim 6, it is pLT30GTI, collection of illustrative plates is seen Fig. 6.

8. by each the conversion of expression type recombinant chou, transfection or the engineering bacteria that obtains of transduction of claim 3-7.

9. engineering bacteria as claimed in claim 8, it is engineering bacteria pLTEGTI/DH5 α, it is characterized in that, it is by the described expression type recombinant chou of claim 5 pLTEGTI transformed into escherichia coli DH5 α gained.

10. engineering bacteria as claimed in claim 8, it is engineering bacteria pLT30GTI/BL21/DE3, it is characterized in that, it is by the described expression type recombinant chou of claim 7 pLT30GTI transformed into escherichia coli BL21/DE3 gained.

11. a method of producing recombination targent fused protein GnRH-TNF α m is included in and cultivates each engineering bacteria of claim 8-10 under the condition of suitable expression, and separation and the described fusion rotein of purifying.

12. the recombination targent fused protein GnRH-TNF α m of claim 1 kills and wounds the application in the medicine of malignant cells such as liver cancer cell HepG2, breast cancer cell MCF-7, cervical cancer cell HeLa and pancreatic cancer cell SW1990 in preparation.

13. the application of the recombination targent fused protein GnRH-TNF α m of claim 1 in the medicine of the malignant tumour of preparation treatment GnRH receptor positive, described malignant tumour is selected from the gland cancer that betides in colon, mammary gland, lung, ovary, uterine endometrium, prostate gland, pancreas, kidney and the liver.

14. a pharmaceutical composition, the tumor chemotherapeutic drug that it comprises the recombination targent fused protein GnRH-TNF α m of claim 1 and is selected from dactinomycin, cis-platinum, amine methopterin or 5 FU 5 fluorouracil.

Images