CN1563377A - Method for obtaining target mDNA - Google Patents

Abstract

A method for obtaining target mRNA is to reform the target gene which introduces oligo(dT) sequence at its 3' end, then adds limited endoprotease identification sequence on 5' and 3' ends separately and combines with a carrier to be transferred into colibacillus competence cells to urge them to express highly and extract RNA of colibacillus then to be separated and purified with aoligo(dT) cellulose to get the required target mRNA.

Description

A kind of method that obtains purpose mRNA

Technical field

The present invention relates to a kind of method that obtains purpose mRNA, more specifically say so goal gene changed in the intestinal bacteria and express, extract colibacillary total RNA, by in addition separation and purification of affinity chromatography, finally obtain the mRNA that needs then.

Background technology

Messenger RNA(mRNA) (mRNA) is the product that DNA transcribes.The coded genetic information of DNA is transcribed into the mRNA sequence, and the mRNA sequence instructs proteinic synthetic on rrna, and this process is called translation.Therefore, if can detect protein expression, just can infer the existence of its specific mrna of coding.And in the ordinary course of things, expressing quantity is directly proportional with the quantity of this proteic mRNA of coding.But a certain proteinic mRNA that encodes is difficult to obtain separate, and this mainly is because the absolute magnitude of mRNA is less, and the sequence-specific of mRNA is very high, lack at present method in common in addition separation and purification.

Escherichia expression system is the most frequently used prokaryotic expression system, and many foreign genes have been realized high expression level in escherichia expression system.Compare with eukaryotic expression system, escherichia expression system has characteristics such as genetic background is thorough, simple to operate, cycle weak point, output height, is the first-selected expression system of expressing foreign protein.

At present the method that mRNA is carried out separation and purification mainly is to use the poly (A of mRNA end ⁺) sequence, can pass through A-T base complementrity principle, utilize business-like oligo (dT) Mierocrystalline cellulose to carry out separation and purification.

But do not transcribe back RNA tailing mechanism in the intestinal bacteria, the mRNA of himself does not all contain poly (A ⁺) tail, the transcribe back mRNA of external source goal gene in intestinal bacteria do not have poly (A yet ⁺).

So, need a kind of advantage that can effectively utilize colibacillary high expression level at present, help the technology of purpose mRNA separation and purification simultaneously again.

Summary of the invention

Technical problem to be solved by this invention is to provide a kind of improved goal gene transcribing in prokaryotic cell prokaryocyte, accurate translation, utilizes A-T base complementrity principle to obtain the method for purpose mRNA.Be difficult for obtaining mRNA to overcome in the prior art, and obtain do not have a specific shortcoming.

Because do not transcribe back RNA tailing mechanism in the intestinal bacteria, the mRNA of himself does not all contain poly (A ⁺) tail, after the external source goal gene entered intestinal bacteria by carrier, the mRNA that transcribes did not contain poly (A yet ⁺), key of the present invention just is: introduce oligo (dT) sequence artificially in the construction of expression vector process, and make it abduction delivering in exogenous gene sequence, then its mRNA that transcribes will contain poly (A ⁺) sequence, behind the total RNA in the extraction intestinal bacteria, because have only we needed mRNA to contain poly (A ⁺) sequence, just can utilize business-like oligo (dT) Mierocrystalline cellulose to carry out separation and purification.

Concrete scheme of the present invention:

(1) structure of the transformation of goal gene and expression vector:

(wherein n is 20-40, is preferably 20-30 to introduce oligo (dT) n sequence at 3 ' end of goal gene.), hold the recognition sequence that adds restriction enzyme (as BamHI, EcoRI, XhoI, NotI etc.) at 5 ' end and 3 ' respectively then, become improved goal gene.Insert improved goal gene in the multiple clone site of carrier, become the expression vector of reorganization.Goal gene of the present invention can be any gene fragment that the disease screening function is arranged, and with being example with 18159 to 18260 of sars coronavirus gene order in an embodiment, introduces the structure and the subsequent step of this expression vector.Wherein carrier can be carrier for expression of eukaryon, also can be prokaryotic expression carrier, as pGEX4T-1 plasmid, pPIC plasmid etc., preferably pGEX4T-1 plasmid.

(2) this expression vector is transformed into competent escherichia coli cell, by adding efficiently expressing of IPTG induction exogenous gene.The expression of exogenous gene situation detects with SDS proteins gel electrophoresis method.

(3) get the inoculum of inducing the back efficiently expressing exogenous gene, by the total RNA of extracting bacterium.The extracting of total RNA can be selected Trizol extraction process or guanidine isothiocyanate method for use.

(4) wherein contain poly (A ⁺) the purpose mRNA of foreign protein of sequence carries out affinity purification by oligo (dT) Mierocrystalline cellulose.With the RT-PCR method specific mrna that obtains is detected.

The invention has the advantages that:

(1) versatility: because intestinal bacteria itself do not possess RNA tailing mechanism, any one section foreign gene can use present method to obtain its coded mRNA after adding oligo (dT) sequence.

(2) be easy to detect: target gene fragment is the formal representation with fusion rotein, so its expression can detect with SDS proteins gel electrophoresis mode, make its on using easily and fast, reliably.

(3) purpose mRNA is easy to purifying: owing to introduce oligo (dT) sequence in the gene order of transcribing purpose mRNA, transcribe the purpose mRNA that obtains and contain poly (A ⁺) sequence, can use business-like oligo (dT) Mierocrystalline cellulose that it is carried out separation and purification.

(4) mRNA of Huo Deing can be used as the positive control that SARS virus is carried out the PCR detection kit.

Description of drawings

Fig. 1 is that PCR identifies gel electrophoresis figure

Fig. 2 is the SDS proteins gel electrophoresis analysis chart of fusion rotein GST-S abduction delivering

Fig. 3 is the RT-PCR detection figure behind the target mRNA purifying

Embodiment

Content of the present invention is further elaborated by following embodiment and accompanying drawing, obtains the method for the mRNA of sars coronavirus.

The structure of pGEX4T-S carrier system:

Obtain 18159 to 18268 (SEQ ID NO:1) of SARS coronavirus Sino3-11 (sars coronavirus) gene order from Genbank accession number:AY485278:

TA ATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGG

C

The S gene is by artificially introducing oligo (dT) at 3 ' end as SEQ ID NO:1 ₂₃Sequence obtains, and adds restriction enzyme BamHI and EcoRI sequence respectively at its 5 ' end and 3 ' end, and finally its complete genome sequence is (SEQ ID NO:2):

BamHI sense

GGATCCTA

ATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGG

CTTTTTTTTTTTTTTTTT

AntisenseTTTTTTT GAATTC

EcoRI

The abduction delivering of fusion rotein GST-S:

At first pGEX4T-1 plasmid and S gene DNA sequence are carried out the double digestion operation respectively, reclaim after the test kit rubber tapping reclaims, with the connection of spending the night of 14 ℃ of T4 dna ligases through rubber tapping with BamHI and EcoRI enzyme.Connect the direct transformed into escherichia coli DH5 of liquid α competent cell.DH5 α cell after the conversion is coated on 37 ℃ of incubated overnight on the solid LB substratum that contains 50 μ g/ml penbritins.Picking list bacterium colony from the substratum, with a pair of Auele Specific Primer at the S gene (sense5 ' ccaagtcaatggttacccta3 '; Antisense 5 ' catctctagttgcatgacagc3 ') the method detection recombinant plasmid pGEX4T-S with PCR successfully constructs (Fig. 1), and wherein 1-5 is the bacterium colony of selecting, 6 negative contrasts, and 7 positive contrasts, 8 is standard.

Picking list colony inoculation contains the LB liquid nutrient medium of 50 μ g/ml penbritins 37 ℃ and shakes bacterium and spend the night to 3ml from flat board.Ratio according to 1/100 is transferred to 100ml and contains in the LB substratum of 50 μ g/ml penbritins, and 37 ℃ are cultured to OD ₆₀₀After value reached 0.7, the adding final concentration was that the IPTG of 1mM induces.The exogenous gene expression situation detects (Fig. 2) by the SDS proteins gel electrophoresis, and wherein 1 is without the inductive tropina, the tropina of 2-4 for after IPTG induces, expressing, and 5 is protein standard.

The total RNA extracting of bacterium:

Get IPTG and induce the centrifugal collection thalline of bacterium liquid 2ml after 3 hours.After adding the broken bacterium of 1ml Trizol solution, room temperature left standstill 5 minutes.Add the 0.2ml chloroform, gentle vibration back room temperature left standstill 2 minutes, and 4 ℃ 10 then, 000g centrifugal layering in 10 minutes.Upper water solution after the layering is transferred in the clean test tube 0.5ml isopropanol precipitating of RNA wherein.Room temperature leaves standstill the centrifugal collection of RNA of 5 minutes postprecipitations.RNA cleans the centrifugal collection in back with 1ml ethanol.The RNA that finally obtains is dissolved in the water of RNA enzyme.RNA concentration is measured with spectrophotometer 260nm wavelength.

The purifying of target mRNA:

Weigh 1 gram Oligo (dT) Mierocrystalline cellulose in the centrifuge tube, add 1 * sample-loading buffer (0.5M LiCl, 10mM Tris-HCl, pH7.5,1mM EDTA, 0.1%SDS) 10ml suspension.

According to total RNA amount filling Oligo (dT) cellulose column (the total RNA/1ml bed volume of 10mg).Add the Mili-Q washing post of 10 times of volumes, the 0.1mol/L NaOH with 10 times of volumes washes post then, and the Milli-Q with 10 times of volumes washes post again, until effluent liquid pH=7.With 1 * elution buffer of 10 times of volumes (0.15M LiCl, 10mM Tris-HCl, pH7.5,1mM EDTA 0.1%SDS) washes post, uses 1 * sample-loading buffer of 10 times of volumes to wash post at last, so that the chromatography column balance.The RNA sample inserts rapidly in the ice-water bath then at 68 ℃ of sex change 3min, adds equal-volume 2 * sample-loading buffer and mixing.Subsequently total rna solution is splined on chromatography column, collects effluent liquid, go up the sample hanging column once more after the sex change, the effluent liquid of collection-20 ℃ freezing temporary transient preservation is treated to abandon after mRNA has detected.After all liquid drains off, wash post with 1 * sample-loading buffer of 10 times of volumes, until OD ₂₆₀Value near or be zero.

After washing post and finishing, add 1 * elution buffer wash-out mRNA of 3 times of column volumes, in the 1.5ml centrifuge tube, collect effluent liquid.Add the dehydrated alcohol of 2.5 times of volumes and the 3mol/LNaAc (pH5.2) of 0.1 volume ,-20 ℃ precipitate 2 hours behind the mixing.4 ℃ of centrifugal 20min of 14000rpm are to collect mRNA.Dry precipitation, heavily being dissolved in 100 μ l does not have in the TE damping fluid of RNA enzyme, OD ₂₆₀Quantitatively the back is detected as the template of RT-PCR.

RT-PCR detects the mRNA that obtains:

According to the RT-PCR test kit specification sheets of Promega company, in 0.5ml PCR thin-walled tube, add following component:

Remove nuclease water 28 μ l

AMV/Tfl5X reaction buffer 10 μ l

DNTP mixed solution 1 μ l

Each 1 μ l of primer

25mM?MgSO ₄ 2μl

AWV reversed transcriptive enzyme 1 μ l

Tfl archaeal dna polymerase 1 μ l

MRNA template 5 μ l

Said components is pressed following conditioned response on the PCR instrument behind thorough mixing:

48℃ 45min

94℃ 2min

4 ℃ of preservations

The result of RT-PCR agarose electrophoretic analysis (Fig. 3), 1 negative contrast, 2 for detecting sample, and 3 is protein standard.

Above result show among the embodiment S gene 3 ' terminal artificial introduce oligo (dT) sequence and vector construction hexose transport protein after, in escherichia expression system, obtained to efficiently express.Contain poly (A ⁺) the target mRNA of sequence successfully uses oligo (dT) Mierocrystalline cellulose to carry out purifying.

Sars coronavirus is a kind of RNA viruses, and the PCR test kit that detects at RNA viruses needs purified RNA fragment as positive control.Use method provided by the invention, can obtain highly purified required RNA fragment easily, be used for the exploitation of relevant PCR detection kit.

Sequence table

＜110〉East China University of Science

＜120〉a kind of method that obtains purpose mRNA

<130>SPI048144

<160>2

<170>Patent?In?Version?2.1

<210>1

<211>110

<212>DNA

＜213〉SARS virus (SARS coronavirus Sino3-11)

<220>

<221>CDS

<222>(18159)...(18268)

<400>1

taccaagtca?atggttaccc?taatatgttt?atcacccgcg?aagaagctat?tcgtcacgtt?60

cgtgcgtgga?ttggctttga?tgtagagggc?tgtcatgcaa?ctagagatgc 110

<210>2

<211>145

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial design is connected the sequence that enters host cell with carrier

<400>2

ggatcctacc?aagtcaatgg?ttaccctaat?atgtttatca?cccgcgaaga?agctattcgt?60

cacgttcgtg?cgtggattgg?ctttgatgta?gagggctgtc?atgcaactag?agatgctttt?120

tttttttttt?tttttttttg?aattc 145

Claims (9)

1. a method that obtains purpose mRNA is characterized in that this method comprises the steps:

1. introduce oligo (dT) sequence, construction of expression vector at 3 ' end of goal gene;

2. expression vector is transformed in the intestinal bacteria;

3. the total RNA of intestinal bacteria after transforming extracts;

4. the separation and purification of mRNA from total RNA;

Wherein the number of oligo (dT) is 20-40.

2. the method for claim 1, it is characterized in that described goal gene be any to disease diagnosis and screen significant gene order.

3. the method for claim 1, it is characterized in that after 3 ' the terminal oligo (dT) of introducing sequence of goal gene, hold the recognition sequence add restriction enzyme at 5 ' end and 3 ' respectively, restriction enzyme wherein is a kind of among BamHI, EcoRI, XhoI or the NotI.

4. the method for claim 1 is characterized in that described goal gene is SEQ IDNO:1.

5. method as claimed in claim 4, the number that it is characterized in that described oligo (dT) is 23.

6. one kind as each described method of claim 1-5, it is characterized in that improved gene order is SEQ ID NO:2.

7. one kind as each described method among the claim 1-5, it is characterized in that described carrier is the pGEX4T-1 plasmid.

8. the method for claim 1 is characterized in that described method for extracting total RNA is Trizol extraction process or guanidine isothiocyanate method.

9. the method for claim 1 is characterized in that the separation and purification of described mRNA from total RNA is with the cellulose column of total RNA by filling Oligo (dT), carries out wash-out.

Images