CN1562354A - Method for controlling mammal to give birth of female mammal based on H-Y antigen - Google Patents
Method for controlling mammal to give birth of female mammal based on H-Y antigen Download PDFInfo
- Publication number
- CN1562354A CN1562354A CN 200410033199 CN200410033199A CN1562354A CN 1562354 A CN1562354 A CN 1562354A CN 200410033199 CN200410033199 CN 200410033199 CN 200410033199 A CN200410033199 A CN 200410033199A CN 1562354 A CN1562354 A CN 1562354A
- Authority
- CN
- China
- Prior art keywords
- smcy
- antigen
- albumen
- uty
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
A method based on H-Y antigen for controlling the mammal to give birth to female cub features that the protein for forming the H-Y antigen epitope is used as the antigen to prepare vaccine, and the vaccine is then used to immunize the femal mammal for killing or damage the male embryo.
Description
Technical field
The invention belongs to mammal sex controll technical field.Being particularly related to the protein that forms the h y antigen epi-position is antigen preparation vaccine and immune jenny; Or be that antigen carries out immunity to animal with the protein that forms the h y antigen epi-position, obtain can specific recognition h y antigen epi-position immune material, in external or body, handle the embryo.
Background technology
In agricultural biological technical field, the sex controll problem is one of bioscience man key subjects of being devoted to study for a long time always, and has huge economic.Sex-controlled method is a lot, but can classify as two big technical fields substantially: a class is by to X type sperm and separating of Y type sperm reaching sex-controlled purpose, thus another kind of be to reach sex-controlled purpose by body early embryo being carried out carry out embryo transfer after the sex identification.Through long term studies and development, many method and technology in this two classes technical field, have been formed with application value realistic.
At the sperm separation technology field, the appearance of modified model flow cytometer makes the precise and high efficiency separated sperm become possible (GeorgeE.Seidel, Reproduction (2002) 124,733-743), and having entered the commercial applications field in 2000 in the Britain and the U.S. rapidly, this indicates that the sperm isolation technics has obtained substantial success.Although the flow cell sorter technology is more successful, this method can't resemble also that people are pre-to produce the property control sperm that satisfies the artificial insemination requirement interim, and this equipment price is very expensive, has directly limited its range of application.Simultaneously in the sperm separation operation process, some step also can produce detrimental effect to sperm, as the fluorescent dye of high concentration, laser irradiation, high flow velocity, highly diluted multiple and centrifugal force etc., wherein handles the infringement maximum that causes with freezing preservation.Therefore; in the modernized aquaculture of current scale day by day, instrument saw with becoming originally with regard to the separating rate of this technology that this technology only can be used for external fertilization; adopt the test-tube cost of freeze and separate seminal fluid still too high, also need to improve further and reduce cost so really be used for producing.
Embryo gender authenticate technology field in early days, through long-run development and application, basic development is sophisticated at present is PCR mirror technology, it to the effect that utilizes sry gene core sequence or its 5 ' end non-coding area sequence in the round pcr amplification cattle embryonic cell, by the analysis of amplified production is identified embryo gender.In this respect, the Herr CM of the U.S. etc. at first successful Application round pcr sex (Herr CM, Theriogenology, 1991,35 (1): 45-54) of identifying cattle and sheep embryo.Thereafter, along with the Industry Promotion of embryo transfer technology, the growing maturation of this technology has become both at home and abroad the most frequently used sex controll technology at present.The situation of this aspect is known by the insider, no longer describes in detail herein.Though it is a kind of good sex-control method that the embryo is carried out sex identification, the design philosophy of this technology itself just exists many difficulties that are difficult to overcome and problem.At first, it can only be applied to embryo transfer; Secondly, shift the embryo repeatedly, the embryo's of Yi Zhiing survival rate reduces again; Once more, carry out embryo's sex identification come what may, according to the male and female embryo's that theory produced of ecological balance ratio always 1: 1, when transplanting, we embryo of needed sex is retained, and second half is thrown away because of useless, causes embryo's waste.In animal husbandry, if the large-scale breed, this is the way of not only arduous but also very waste of manpower, material resources and financial resources.
In sum, this two classes technology respectively has its weak point, mainly show cost height, big, the technology implementation process complexity of operation easier, in reality is produced, these deficiencies have directly limited their application scale and future development, researcheres are attempting to set up a kind of new technological system always, try hard to make sex controll to become a kind of simple to operate, with low cost, respond well, technology with universal implementary value.And want to realize sex controll, especially mode realization property control to act in the body, what most possibly make breakthroughs is exactly reproductive immunology achievement in research and The Application of Technology.The function Characteristics of h y antigen exactly meets this requirement.
H y antigen (Male spenific minor histocompatibility Y) is the most found as transplantation antigen when carrying out allos organ transplantation research by Eichald etc. early than nineteen fifty-five, is characterized in causing in inbred mouse the rejection of female Mus to the male Corium Mus skin of its homology.1971, Goldberg etc. detected male specific antibody (Goldberg EH, Nature.1971 Aug 13 first in having transplanted the female Mus serum of male Corium Mus skin; 232 (5311): 478-80).Bennett etc. used the seminal fluid of handling through anti-H-Y antiserum to carry out artificial insemination early than 1973 to mice, found that its offspring produces the phenomenon that female rate raises.1984, Shelton etc. are to discovering that the 8 cell stage embryos of mice carry out, under the combined effect of anti-H-Y antibody and complement, dissolving and dead has taken place in nearly 50% embryo, 50% embryo does not then change in addition, and the latter's 82% growing and be female mice (Shelton JA, Transplantation.1984 Jan wherein after transplanting; 37 (1): 7-8.).From then on, h y antigen begins to become an important tool in the animal sex Control Study, is widely used in the evaluation and the research that separates the aspect of embryo gender evaluation and X, y sperm.
Aspect embryo's research, usefulness newborn mice testis tissues such as Utsumi are that the female Mus of antigen immune prepares anti-H-Y antibody, when cultivating the morula embryos of mice, rabbit, goat, cattle with the culture fluid that contains antibody, can cause the embryo to produce tangible metamorphosis and divide into quantity two monoids about equally, wherein a class embryo growth is unaffected, then stasi of another kind of embryo then can recover in the culture fluid of no antibody to grow but they are changed over to.In the embryo who not influenced by antibody, its cell caryogram of the embryo of 80-90% is XX, and in the embryo who influenced by antibody, nearly its cell caryogram of 80% embryo is XY (UtsumiK, Mol Reprod Dev.1993 Jan; 34 (1): 25-32.).White etc. have designed the embryo gender authentication method based on the indirect immuno fluorescent detection technique of h y antigen, 8 cell stage embryos are carried out sex identification, by to embryonic cell karyotyping verify, its accuracy rate is respectively cattle 79%, pig 78%, sheep 88%, horse 82%, and after removing antibody, the embryo that anti-H-Y antibody treatment is crossed still can recover to grow, it transplants pregnancy rate and offspring's development there is no abnormal conditions (White KL, Biol Reprod.1987 Nov; 37 (4): 867-73; Gamete Res.1987 Jun; 17 (2): 107-13; J Reprod Immunol.1987 Jan; 10 (1): 27-32; Anim Genet.1988,19 (4): 373-378.).These results prove absolutely: h y antigen mainly is present in male embryo, and anti-H-Y antibody not only can be discerned male embryo, can also block its growth, and also can produce lethal effect when complement exists.Take this as a foundation, Cao Wen extensively waits the people to invent the effect that utilizes anti-H-Y monoclonal antibody and complement in 1992 and kills male embryo in animal body and give birth to the method for female control and (see people's disclosed [a kind of control method of breeding female progeny for mammals] such as Cao Wenguang for details, publication number CN 1062460A), they are antigen immune homology female mice with the splenocyte of male C57BL/6 mice, get female mice spleen cell and myeloma cell and merge the anti-H-Y monoclonal antibody of preparation, then the cornua uteri of this monoclonal antibody and complement input pregnant animal is killed male embryo in vivo, its result of the test shows that this method can make the female percentage rate of offspring reach more than 84%.But up to now, do not find that this method is applied to the report of production practices.
Aspect sperm research, based on h y antigen be the special product of y sperm this be familiar with substantially, people have at first been developed the technical method that utilizes anti-H-Y monoclonal antibody to separate X, y sperm, and in zoopery, obtained definite results, but separation efficiency and so high unlike people expection, anti-H-Y monoclonal antibody is to the recognition efficiency of y sperm only (HendriksenPJ, Mol Reprod Dev.1993 Jun between 20-50%; 35 (2): 89-96.).By deep research, Hendriksen etc. think that at least for pig and cattle, HY antigen is not y sperm specifically expressing product.And studies show that people's sperm such as Sills, in the sperm that can detect h y antigen, have only 54.1% to be y sperm, there is quite most X sperm also to contain h y antigen simultaneously, therefore this method is not suitable for separation (Sills ES, the Am J Reprod Immunol.1998Jul that carries out people's sperm fully; 40 (1): 43-7.).More subsequently result of study has this viewpoint of y sperm specificity to h y antigen and has proposed to doubt, wherein, methods such as usefulness labelled with radioisotope, SDS-PAGE such as Howes are carried out the analysis of protein ingredient to X sperm and y sperm respectively, conclusion is not find the difference of protein ingredient between X sperm and y sperm, thereby the proof h y antigen does not have y sperm specificity (Howes E A, J Reprod Fertil.1997 Jul; 110 (2): 195-204.).But simultaneously also beyond all doubt is that the expression of h y antigen and regulation and control are to be undertaken by the gene on the Y chromosome really.In the research work that this contradiction is analyzed, Hendriksen thinks: in theory, expression of gene can cause the differentiation of protein component in the two class spermatids on the Y chromosome, but because the existence of cell bridge (intercellular bridges) between the spermatid, the part of these gene expression products (or overwhelming majority) is to be shared by each spermatid, therefore, though some proteic expression has the specificity of sperm type, but developing soon, this species specificity becomes the non-specific of expression product distributed areas after expression is finished, so in fact may not have the special protein of sperm type (Hendriksen PJ, Theriogenology.1999Dec; 52 (8): 1295-307.).
Comprehensive above-mentioned in the sex controll research field to the result of study of h y antigen, we can draw as drawing a conclusion:
(1) the antigenic antibody of anti-X-Y is very low and uncertain to the recognition accuracy of y sperm, and also can identification division X type sperm, though its reason is that h y antigen obtains to express in Y type sperm, they can be shared by X type sperm by cell bridge.
(2) the antigenic antibody of anti-X-Y also has same characteristics in the performance aspect the identification male embryo sex, but accuracy rate is higher than the recognition accuracy to y sperm.As for its reason, previous research does not provide corresponding explanation.
According to above experimental phenomena and analysis conclusion, as if illustrated based on the property control research of h y antigen and will do nothing, therefore since the mid-90 in 20th century, along with based on the embryo gender authenticate technology of sry gene with based on the development of the sperm sorting technology of flow cytometer, the research in this field has been lowered the temperature greatly.Because aforesaid SRY mirror technology and the fluidic cell sorting technology that carries out in external mode all exists the defective that is difficult to overcome, researcheres are still to placing on great expectations based on h y antigen in the potentiality of property control research field but in fact.Especially people generally believe, want to realize sex controll, especially mode realization property control to act in the body, and what most possibly make breakthroughs is exactly reproductive immunology achievement in research and The Application of Technology, and the function Characteristics of h y antigen exactly meets this requirement.But seek out new development and make breakthroughs, just must stand on the new height and re-recognize former achievements, in the hope of opening up new development space from new angle.
The nineties in 20th century middle and late, along with the development of molecular biology and genomics, and the new development that research obtains to h y antigen in filed of organ transplantation, relevant new knowledge has constantly replenished again.It is found that, h y antigen is actually a class causes the polypeptide of allos tissue rejection as isoantigen general name, they are coded by 2-5 on the Y chromosome different locus, character is different, and combine with main histocompatibility complex and to form polymer, and be presented to cell surface by this complex and form h y antigen epi-position (King TR, Genomics.1994 Nov 1; 24 (1): 159-68.).For example, in mice, its h y antigen epi-position has 4 at least by inference, and these epi-position character are different, can be discerned by corresponding special T lymphocyte clone.The candidate of these 4 epi-positions is respectively: H-YK
k, H-YD
k, H-YA
bAnd H-YD
b, confirmed that wherein H-YKk and H-YDb are the h y antigen epi-positions (Simpson, E, Annu.Rev.Immunol.15,39-61 (1997) .) of mice.Result of study proves, H-YK
kEpi-position is made of 8 peptide TENSGKDI, and its source is Smcy gene expression product (Scott DM, Nature.1995 Aug 24; 376 (6542): 695-8.), H-YD
bEpi-position is made of 9 peptide WMHHNMDLI, and its source is Uty gene expression product (Andy Greenfield, Nat.Genet.14 (4), 474-478 (1996) .).
Based on these achievements in research, we can re-recognize the conclusion of above-mentioned h y antigen control research from the angle of h y antigen epitope analysis now.
At first analyze conclusion (1), can find, because y sperm is the expresser of the multiple composition of h y antigen, and the X sperm is the sharer, therefore the h y antigen epi-position is not only shared by the X sperm too, and also the same with y sperm, has the multiformity of epi-position kind and quantity at its cell surface.Consider that in aforesaid research work the method that researcheres prepare anti-H-Y antibody all is to be that antigen carries out immunity to mice with splenocyte of male Mus or testicular cell, therefore prepared multi-resistance can be discerned all epi-positions again.Therefore we think, have caused the low and always unrepeatable phenomenon of experimental result of recognition accuracy of antibody when carrying out the sperm evaluation just because of these two reasons.And for prepared monoclonal antibody, because the corresponding relation between monoclonal antibody and epi-position is uncertain, simultaneously the X sperm also has no way of learning to the sharing degree of each epi-position (the X sperm that promptly carries certain epi-position accounts for the ratio of X sperm sum), therefore with H-Y monoclonal antibody separated sperm the time, also always obtain uncertain result, and the result is also always not reproducible.
And when analyzing conclusion (2), we can think at first that those may be transferred to the embryonic cell surface by fertilization process by the shared epi-position that X type sperm carries, also can form epi-position kind and quantity multiformity.Simultaneously, different with the situation in the sperm, that works by the continuous h y antigen composition that obtains new source of cell bridge because the XX embryo can't resemble the X sperm, and the h y antigen composition that these are brought into also may because in born of the same parents processed processing or because of the relation of space-time restriction do not have or over a period to come by submission to the embryonic cell surface, the therefore phenomenon that also exists epi-position to have or do not have on the female embryo surface.This accuracy rate of also just having explained H-Y monoclonal antibody identification XY embryo why for high, but also exists specificity not high simultaneously than sperm, the unrepeatable phenomenon of experimental result.
For the X sperm, since its kind of shared epi-position and result's (suppose herein and between them, do not have interaction) that the quantity multiformity is all independent epi-position additions, if be immune target only with a kind of epi-position, then the specificity of antibody effect will probably be higher than aforesaid antibody, and its big young pathbreaker who improves degree is depended on the sharing degree size of X sperm to this epi-position: in the interaction in vitro process, the X sperm has determined the specificity of antibody to the sharing degree of certain epi-position, the X sperm is big more to the sharing degree of certain epi-position, to special antibody specific recognition y sperm of this epi-position and XY type embryo ability just weak more, otherwise then opposite; And in vivo in the mechanism, the X sperm has then determined immunity to jenny reproductive performance effect to the sharing degree of certain epi-position, sharing degree is high more, cause the probability of jenny immunological infertility just big more (this probability obtains to confirm in the infertile research of mice study and human immunity), otherwise it is then just more little, when the influence of jenny reproductive performance aspect and sex controll effect being reached between these two or be higher than equilibrium point, then just possessed and carried out sex-controlled value at the immunity of this epi-position with economic implications.Generally speaking, the X sperm is more little to the sharing degree of certain epi-position, and the meaning of this epi-position aspect sex controll is just big more, otherwise then more little.Therefore, when carrying out based on the property control of h y antigen research, when especially studying in carrying out body, in order to realize best property control effect, a possible art designs is exactly: the h y antigen epi-position of selecting a sharing degree minimum in the X sperm is as immune target.And further be contemplated to be, on the basis that h y antigen epi-position achievement in research is greatly accumulated, reduce the method that the sharing degree elimination is shared even design.
Summary of the invention
Based on the present situation of above-mentioned current property control research field with to the theory analysis of h y antigen, the invention provides with the method for h y antigen immunity mammal is carried out sex-controlled technical scheme, and preparation method, production method and the using method of vaccine are provided.
Technical scheme of the present invention is to reach by following measure:
A kind of mammal based on h y antigen gives birth to female control method, it is characterized in that: with the protein that forms the h y antigen epi-position is antigen preparation vaccine and immune jenny; Or be that antigen carries out immunity to animal with the protein that forms the h y antigen epi-position, obtain can the specific recognition h y antigen immune material of epi-position not, in external or body, handle the embryo.
The protein of above-mentioned formation h y antigen epi-position is meant the Smcy albumen (being designated hereinafter simply as Smcy) that forms h y antigen H-YKk epi-position, form the Uty albumen (being designated hereinafter simply as Uty) of h y antigen H-YDb epi-position and the protein (being designated hereinafter simply as other albumen) of other h y antigen epi-position of formation that will find.
The above-mentioned method of handling the embryo in external or body is, use with Smcy, Uty or other albumen nucleic acid vaccine or protein vaccine immune animal as target antigen, obtain anti-Smcy, Uty or other proteic antiserum or immune materials such as antibody or monoclonal antibody, it is added in embryo medium and acts on the embryo, or it is inserted in the jenny uterus act on the embryo.
Above-mentioned mammal is carried out sex-controlled nucleic acid vaccine be meant with the carrier for expression of eukaryon to be basic framework, contain certain mammiferous Smcy, Uty or other proteic code cDNA simultaneously.
Above-mentioned nucleic acid vaccine obtains by the following method: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two and obtain recombiant plasmid in the eukaryon expression plasmid and be transformed in the escherichia coli, confirm that with the method for eukaryotic cell transient expression this recombiant plasmid can express Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, after cultivating amplification, escherichia coli extract plasmid, be dissolved in normal saline behind the purification or contain in the normal saline of different adjuvants, obtain needed H-Y nucleic acid vaccine.
The production method of above-mentioned nucleic acid vaccine is: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two and obtain recombiant plasmid in the eukaryon expression plasmid and be transformed in the escherichia coli, confirm that with the method for eukaryotic cell transient expression this recombiant plasmid can express Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, after cultivating amplification, escherichia coli extract plasmid, be dissolved in normal saline behind the purification or contain in the normal saline of different adjuvants, obtain needed H-Y nucleic acid vaccine.
A kind of mammal is carried out sex-controlled protein vaccine, it is characterized in that this vaccine by one of certain mammiferous Smcy, Uty of purification or other albumen or form with adjuvant more than two or two.
Above-mentioned protein vaccine obtains one of by the following method:
Method one: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two in protokaryon or the eukaryon expression plasmid, with this recombinant plasmid transformed protokaryon to prokaryotic cell or transfection in eukaryotic cell, with in the cell or excretory formal representation Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, collect expressed albumen and carry out purification with biochemical method, be dissolved in normal saline then or contain in the normal saline of different adjuvants, obtain needed H-Y protein vaccine.
Method two: from the boar tissue, directly separate with biochemical method.
The production method of above-mentioned protein vaccine is:
Method one: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two in protokaryon or the eukaryon expression plasmid, with this recombinant plasmid transformed protokaryon to prokaryotic cell or transfection in eukaryotic cell, with in the cell or excretory formal representation Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, collect expressed albumen and carry out purification with biochemical method, be dissolved in normal saline then or contain in the normal saline of different adjuvants, obtain needed H-Y protein vaccine.
Method two: from the boar tissue, directly separate with biochemical method.
The using method of above-mentioned nucleic acid vaccine and protein vaccine is: make above-mentioned vaccine enter body with injection, injection, oral mode per nasal, eye, reproductive tract, intestinal by the method for infiltration, absorption, physics or chemistry mediation; Or: above-mentioned vaccine wrapped up by other material or mix after enter body.
The specific embodiment
By following examples the present invention is further described.
Below these embodiment be exemplary, rather than restrictive, can determine concrete embodiment according to the technical scheme and the reagent situation of foregoing invention.
One, the preparation of mice H-Y nucleic acid vaccine and immunity
1, materials and methods
Bacterial strain and plasmid: bacillus coli DH 5 alpha and HB101, plasmid pVAX1 and pSecTag are Invitrogen company product, and the pMD18-T plasmid is a Takara company product.
The BALB/C mice in age in laboratory animal: 6-8 week, heavy 18-20g is available from Beijing Experimental Animal Center.
Main agents: various restricted enzyme, dna modification enzyme, mRNA extract test kit, RT-PCR test kit all available from Takara company, cationic-liposome transfection reagent box is available from Invitrogen company, and sheep anti-mouse igg-HRP, BSA, SDS, elisa plate are all available from magnificent company.
2, the structure of expression vector pVAX-HY and evaluation
1), obtains Smcy cDNA
MRNA extracts: draw neck to put to death and the taking-up liver male BALB/C mice, cut the portion of tissue piece, extract test kit operation requirement by mRNA and operate, obtain mRNA.
Synthetic and the amplification of cDNA: design following primer (forward primer: 5 ' atgaagccaggatctgacgactttctaccgccgcc3 ', downstream primer 5 ' ttatcctttttgctgatgaaaataagataggtgta3 '), operate by RT-PCR test kit operation requirement, obtaining length is the Smcy cDNA of 4647bp, and it is cloned in the pMD18-T plasmid, obtain cloning vehicle pMD-Smcy.
2), the structure of plasmid pVAX-Smcy
Enzyme action pMD-Smcy:, separate and purification Smcy cDNA with restriction endonuclease PstI and XbaI double digestion plasmid pMD-Smcy.
Enzyme action pVAX1: with restriction endonuclease PstI and XbaI double digestion plasmid pVAX1 and purification.
Coupled reaction: the enzyme reaction system that connects, Smcy cDNA is cloned among the plasmid pVAX1.
Transform and the screening recon: recon is transformed among the competent E.coli DH5 α, obtains positive colony, and carry out enzyme action and identify with the kanamycin screening.
3, the transient expression of recombiant plasmid pVAX-HY in eukaryotic cell
Recovery Hela cell with the cultivation of going down to posterity of RPM1640-20% FBS culture fluid, is adjusted into 4 * 10 with cell concentration
5/ ml, plasmid pVAX-Smcy that purification is good be with liposome transfection method transfection Hela cell, continue to cultivate 32 hours after changing culture fluid, and harvesting then, immunoblotting (Western blotting) method is observed and whether has been expressed Smcy albumen routinely.
4, the preparation of HY nucleic acid vaccine and animal immune
According to a conventional method plasmid is cultivated and extracted to the bacterial strain that contains plasmid pVAX-Smcy in a large number, dissolve in the normal saline, measure OD
260And OD
280Value is calculated by 1OD=50 μ gDNA/ml, plasmid solution concentration is set up be 1mg/ml.
25 female BALB/C mice are divided into four groups: pVAX1 intramuscular injection group, pVAX-Smcy intramuscular injection group, pVAX1 vagina group, pVAX-Smcy vagina group, negative control group, carry out immunity respectively, 5 every group.Wherein for the intramuscular injection group, each immunity was injected 0.25% procaine, 50 μ l in preceding 24 hours in the back leg quadriceps femoris, and injection plasmid solution 50 μ l during immunity are thereafter in just exempting from the 3rd week of back and the 7th all each booster immunizations once.For the vagina group, drip plasmid solution 50 μ l to intravaginal during immunity, thereafter in just exempting from the 3rd week of back and the 7th all each booster immunizations once.To 1st, 3,4,7,9 whens week of each group before immunity and behind the initial immunity by eye socket venous blood collection separation of serum, adopt tiring of the ELISA method detection anti-Smcy antibody of serum.
5, the checking of fertility experiment and sex controll effect
In each group mouse cage, put into the male Mus that grows up respectively, check after female Mus the moon is fastened appearance and shift out male Mus, treat that female Mus produces the back and checks the filial mice sex, and compare with negative control group.
Two, the preparation of mice H-Y protein vaccine and immunity
1, Smcy protein Preparation
1), the structure of plasmid pSecTag-Smcy
Enzyme action pMD-Smcy:, separate and purification SmcycDNA with restriction endonuclease Ecor I and Not I double digestion plasmid pMD-Smcy.
Enzyme action pVAX1: with restriction endonuclease Ecor I and Not I double digestion plasmid pSecTag and purification.
Coupled reaction: the enzyme reaction system that connects, Smcy cDNA is cloned among the plasmid pSecTag.
Transform and the screening recon: recon is transformed among the competent E.coli DH5 α, obtains positive colony, and carry out enzyme action and identify with the ampicillin screening.
2), the proteic expression of Smcy and recovery and purification
Recovery SKBR-3 cell through the cultivation of going down to posterity of 5 generations, is adjusted into 2 * 10 with cell concentration
6/ ml, the plasmid pSecTag-Smcy that purification is good continues to cultivate 96 hours with liposome transfection method transfection SKBR-3 cell, with medium centrifugal, reclaims supernatant, at high pressure liquid chromatography (HPLC) (HPLC) upper prop eluting, collects the 186kDa protein peak.
2, animal immune
1) this SmcY albumen is fully mixed with Freund's complete adjuvant, emulsifying is standby.
2) divide three liang of groups with 15 female BALB/C mice: subcutaneous injection group, vagina dropping group, negative control group, carry out immunity respectively, 5 every group.Two groups all in just exempting from the 3rd week of back and the 7th all each booster immunizations once.To 1st, 3,4,7,9 whens week of each group before immunity and behind the initial immunity by eye socket venous blood collection separation of serum, adopt tiring of the ELISA method detection anti-h y antigen of serum.
3, the checking of fertility experiment and sex controll effect
In each group mouse cage, put into the male Mus that grows up respectively, check after female Mus the moon is fastened appearance and shift out male Mus, treat that female Mus produces the back and checks the filial mice sex, and compare with negative control group.
Claims (10)
1, a kind of mammal based on h y antigen gives birth to female control method, it is characterized in that: with the protein that forms the h y antigen epi-position is antigen preparation vaccine and immune jenny; Or be that antigen carries out immunity to animal with the protein that forms the h y antigen epi-position, obtain can specific recognition h y antigen epi-position immune material, in external or body, handle the embryo.
2,, it is characterized in that the protein of described formation h y antigen epi-position is meant formation h y antigen H-YK as claim 1 described method
kThe Smcy albumen (being designated hereinafter simply as Smcy) of epi-position, formation h y antigen H-YD
bThe protein (being designated hereinafter simply as other albumen) of the Uty albumen (being designated hereinafter simply as Uty) of epi-position and other h y antigen epi-position of formation that will find.
3, as claim 1 or 2 described methods, it is characterized in that using with certain mammiferous Smcy, Uty or other albumen nucleic acid vaccine or this kind of protein vaccine immunity animal as target antigen, obtain anti-Smcy, Uty or other proteic antiserum or immune materials such as antibody or monoclonal antibody, it is added the embryo who acts on this kind animal in embryo medium, or it is inserted in this kind jenny uterus act on the embryo.
4, a kind ofly described mammal is carried out sex-controlled nucleic acid vaccine, it is characterized in that this vaccine is basic framework with the carrier for expression of eukaryon, contain certain mammiferous Smcy, Uty or other proteic code cDNA simultaneously as claim 1 or 2 or 3.
5, as claim 4 described nucleic acid vaccines, it is characterized in that this vaccine obtains by the following method: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two and obtain recombiant plasmid in the eukaryon expression plasmid and be transformed in the escherichia coli, confirm that with the method for eukaryotic cell transient expression this recombiant plasmid can express Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, after cultivating amplification, escherichia coli extract plasmid, be dissolved in normal saline behind the purification or contain in the normal saline of different adjuvants, obtain needed H-Y nucleic acid vaccine.
6, a kind of production method as claim 4 or 5 described nucleic acid vaccines, it is characterized in that this production method is: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two and obtain recombiant plasmid in the eukaryon expression plasmid and be transformed in the escherichia coli, confirm that with the method for eukaryotic cell transient expression this recombiant plasmid can express Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, after cultivating amplification, escherichia coli extract plasmid, be dissolved in normal saline behind the purification or contain in the normal saline of different adjuvants, obtain needed H-Y nucleic acid vaccine.
7, a kind ofly described mammal is carried out sex-controlled protein vaccine as claim 1 or 2, it is characterized in that this vaccine by one of certain mammiferous Smcy, Uty of purification or other albumen or form with adjuvant more than two or two.
8,, it is characterized in that this vaccine obtains one of by the following method as claim 7 described protein vaccines:
Method one: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two in protokaryon or the eukaryon expression plasmid, with this recombinant plasmid transformed protokaryon to prokaryotic cell or transfection in eukaryotic cell, with in the cell or excretory formal representation Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, collect expressed albumen and carry out purification with biochemical method, be dissolved in normal saline then or contain in the normal saline of different adjuvants, obtain needed H-Y protein vaccine.
Method two: from the boar tissue, directly separate with biochemical method.
9, a kind of production method as claim 7 or 8 described protein vaccines is characterized in that this production method is:
Method one: the method by molecular cloning obtains certain mammiferous Smcy, Uty or other proteic code cDNA, with one of them or be inserted into more than two or two in protokaryon or the eukaryon expression plasmid, with this recombinant plasmid transformed protokaryon to prokaryotic cell or transfection in eukaryotic cell, with in the cell or excretory formal representation Smcy, the a plurality of albumen of one of Uty or other albumen or amalgamation and expression, collect expressed albumen and carry out purification with biochemical method, be dissolved in normal saline then or contain in the normal saline of different adjuvants, obtain needed H-Y protein vaccine.
Method two: from the boar tissue, directly separate with biochemical method.
10, a kind of using method as claim 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 described vaccines is characterized in that this using method is: make above-mentioned vaccine enter body with injection, injection, oral mode per nasal, eye, reproductive tract, intestinal by the method for infiltration, absorption, physics or chemistry mediation; Or: above-mentioned vaccine wrapped up by other material or mix after enter body.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410033199 CN1562354A (en) | 2004-04-07 | 2004-04-07 | Method for controlling mammal to give birth of female mammal based on H-Y antigen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410033199 CN1562354A (en) | 2004-04-07 | 2004-04-07 | Method for controlling mammal to give birth of female mammal based on H-Y antigen |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1562354A true CN1562354A (en) | 2005-01-12 |
Family
ID=34481328
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410033199 Pending CN1562354A (en) | 2004-04-07 | 2004-04-07 | Method for controlling mammal to give birth of female mammal based on H-Y antigen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1562354A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100368541C (en) * | 2006-01-26 | 2008-02-13 | 上海交通大学 | Immune magnetic bead negtive-sieve method for sorting cow X sperm based on H-Y antigen |
| CN103114079A (en) * | 2013-01-25 | 2013-05-22 | 湖南农业大学 | Preparation of serologic H-Y antigen gene DBY antibody and XY sperm immune sorting method thereof |
| CN105646707A (en) * | 2016-02-26 | 2016-06-08 | 西北农林科技大学 | Preparation method and application of UTY antibody nano-particles for fast separation of X/Y sperms of cattle and sheep |
| CN106397603A (en) * | 2016-08-25 | 2017-02-15 | 上海市刑事科学技术研究院 | SMCY (Selected mouse cDNA on Y) sex specific fusion antigen and antibody and application thereof |
| CN111349158A (en) * | 2020-03-06 | 2020-06-30 | 西北农林科技大学 | Preparation method of sex-controlled semen of milk goat |
-
2004
- 2004-04-07 CN CN 200410033199 patent/CN1562354A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100368541C (en) * | 2006-01-26 | 2008-02-13 | 上海交通大学 | Immune magnetic bead negtive-sieve method for sorting cow X sperm based on H-Y antigen |
| CN103114079A (en) * | 2013-01-25 | 2013-05-22 | 湖南农业大学 | Preparation of serologic H-Y antigen gene DBY antibody and XY sperm immune sorting method thereof |
| CN103114079B (en) * | 2013-01-25 | 2014-06-11 | 湖南农业大学 | Preparation of serologic H-Y antigen gene DBY antibody and XY sperm immune sorting method thereof |
| CN105646707A (en) * | 2016-02-26 | 2016-06-08 | 西北农林科技大学 | Preparation method and application of UTY antibody nano-particles for fast separation of X/Y sperms of cattle and sheep |
| CN105646707B (en) * | 2016-02-26 | 2019-01-22 | 西北农林科技大学 | For ox, the preparation method and application of the UTY antibody nanoparticles of sheep X/Y sperm quick separating |
| CN106397603A (en) * | 2016-08-25 | 2017-02-15 | 上海市刑事科学技术研究院 | SMCY (Selected mouse cDNA on Y) sex specific fusion antigen and antibody and application thereof |
| CN111349158A (en) * | 2020-03-06 | 2020-06-30 | 西北农林科技大学 | Preparation method of sex-controlled semen of milk goat |
| CN111349158B (en) * | 2020-03-06 | 2022-11-08 | 西北农林科技大学 | Preparation method of sex-controlled semen of milk goat |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US4568639A (en) | Method for the commercial production of helminths antigens | |
| US4085205A (en) | Control of sex ratio in mammalian offspring | |
| Chaves-Pozo et al. | Viral hemorrhagic septicemia and infectious pancreatic necrosis viruses replicate differently in rainbow trout gonad and induce different chemokine transcription profiles | |
| BAVISTER et al. | Refractoriness of rhesus monkeys to repeated ovarian stimulation by exogenous gonadotropins is caused by nonprecipitating antibodies | |
| Warner et al. | Why aren’t embryos immunologically rejected by their mothers? | |
| JPH04507040A (en) | Sex-associated membrane proteins and methods for increasing the probability that offspring will have the desired sex | |
| Kishimoto et al. | An effective microinjection method for genome editing of marine aquaculture fish: tiger pufferfish Takifugu rubripes and red sea bream Pagrus major | |
| CN1331700A (en) | Generation of antibodies using polynucleotide vaccination in avian species | |
| US20020115055A1 (en) | Gender differentiation of bovine sperm cells | |
| CN1181761A (en) | Antigen compsn. against mycoplasma | |
| CN100339388C (en) | New assays for preimplantation factor and preimplantation factor peptides | |
| CN1562354A (en) | Method for controlling mammal to give birth of female mammal based on H-Y antigen | |
| Bhattacharya et al. | An attempt to predetermine the sex of calves by artificial insemination with spermatozoa separated by sedimentation | |
| Yang et al. | Tentative identification of sex-specific antibodies and their application for screening bovine sperm proteins for sex-specificity | |
| Coombs et al. | Species-characterizing antigens of ‘L’and ‘ERK’cells | |
| US4756908A (en) | Method for the commercial production of helminths antigens | |
| CN1432067A (en) | Sperm-DNA complexes for genetically modifying non-human animals | |
| CA2568512A1 (en) | Gender selection with the use of antibodies | |
| CN1623604A (en) | Process for controlling birth female of mammal based on SRY gene | |
| Moiseykina et al. | Allele pool of different zonal types of Kalmyk cattle | |
| CN104388560B (en) | Method for marking Y chromosome and application thereof | |
| CN109593765B (en) | CpG oligodeoxynucleotide, immune composition and application thereof | |
| Majewska et al. | Axenic isolation of Giardia strains from primates and rodents | |
| CN1352523A (en) | MSH 5 ablated mice and usest therefor | |
| Figueroa et al. | Identification of a coronin‐like protein in Babesia species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |