CN104388560B - Method for marking Y chromosome and application thereof - Google Patents
Method for marking Y chromosome and application thereof Download PDFInfo
- Publication number
- CN104388560B CN104388560B CN201410646040.3A CN201410646040A CN104388560B CN 104388560 B CN104388560 B CN 104388560B CN 201410646040 A CN201410646040 A CN 201410646040A CN 104388560 B CN104388560 B CN 104388560B
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- chromosome
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for marking a Y chromosome and application thereof. According to the method, the Y chromosome of an isolated animal somatic cell is specifically marked by utilizing a TALEN method. By adopting the method disclosed by the invention, convenient, simple, effective, safe and accurate early identification on the animal gender can be realized, and a basis is laid for selectively culturing animals with a specific gender and improving the breeding efficiency.
Description
Technical field
The present invention relates to a kind of Y chromosome labeling method and its application, belong to biological technical field.
Background technology
Sex controll refers to the technology by artificially intervening or operating the offspring for making animal reproduction go out particular sex.Suckling
Animal Sex control is the important content in herding research, and its achievement in research is for Animal Genetics, diseases prevention and treatment and poultry
Herd production and be respectively provided with significance：First, the economic benefit of animal husbandry can be greatly improved.Different sexes in Animal husbandry production
Domestic animal has different purposes, therefore this technology can be used to improve the quantity of a large amount of female individuals such as milch cows, hen, and can save
About male is in the food consumption in breeding year, and contrary male beef cattle, the weightening such as sheep and pig is fast, meat also excellent feature
Also can be by this technical controlling fecund male offspring.Second, realizing the sex controll of animal can eliminate undesirable recessiveness
Shape, accelerates the genetic progress of domestic animal, accelerates the renewal of drove.
At present sex-controlled common method mainly includes：X, the separation of y sperm, the identification of embryo gender and environmental Kuznets Curves
Etc. method.
First, X, the separation of y sperm
Principle：According to X, y sperm is in physics (volume, density, electric charge, mobility) and chemical (DNA content, surface antigen)
Etc. aspect difference, set up the various methods that sorted to sperm, including sedimentation, electrophoresis method, centrifuging and its at present should
With relatively more fluidic cell partition methods, immunology and FISH technology authentication method.
Fluidic cell partition method：Main Basiss are the content differences of X, y sperm DNA.In general, X sperms contain than y sperm
There is more DNA, so when being dyeed with dye Hoechst 33342, the dyestuff that X sperms absorb is more, the fluorescence for sending is also strong,
X and y sperm can be told with regard to this, then recycles the computer controls X sperms that make fluorescence strong to become positively charged lotus, y sperm band
Upper negative charge, is just deflected to different direction when by high voltage electric field, so as to reach separation purpose, resolution up to 90%,
But during with fluidic cell separator separated sperm, sperm needs to pass through one by one, must thus dilute seminal fluid, and this will result in
The motor capacity of sperm declines, and fluorescent dye, to the toxic effect of sperm, in addition the too low instrument price of efficiency is expensive, is awarding
The situation for also having litter size and pregnancy rate to decline after essence, is also not used to production practices.
Immunological method：With immunologic development it is found that including y sperm in male tissue, there are H-Y and resist
It is former.Male tissue immunization. Female animal produces H-Y antibody, and only y sperm could express H-Y antigens, thus using H-Y
H-Y antigens present on antibody test plasmalemmae of sperms, then X, y sperm are obtained by immunity or separation method.Nineteen eighty-two, research
Person Zavos injects female rabbit intravaginal H-Y antiserums, and semen deposition after 15 minutes, produced female rabbit accounts for 74.2%.H-Y resists
Serum is obtained using after immunization. Female animal, but H-Y antigens itself are a kind of poor antigens, in addition animal individual itself
Difference to immunoreation, it is difficult to play preferable immune effect, and separated sperm vigor decline also can affect conception rate and
Litter size.There is extensive research to H-Y clonal antibodies both at home and abroad at present, it may be desirable that following immunological method can be in control
It is applied in sex.
FISH technology identification method：Fluorescence in situ hybridization technique (is a kind of miscellaneous to original position using inactive fluorescence signal
The technology for handing over sample to be detected).FISH is directly perceived due to it, and quickly, sensitivity is high and convenient, flexible increasingly obtains widely
Using.Ultimate principle is：It is glimmering by observing by the single stranded DNA (probe) that marked fluorescence and the DNA anneals being complementary to
Optical signal position on chromosome is reflecting the situation of corresponding gene.I.e. using on Y chromosome specific nucleic acid probe and sperm
Specific sequence hybridization, then demarcate fluorescent material, X sperms and y sperm are directly observed and distinguished under fluorescence microscope.Should
Method is particularly well-suited to X sperms and y sperm DNA content difference is very small, and weight analysis are it cannot be guaranteed that the situation of accuracy.Initially transport
Result with FISH on Niu Jingzi is the sperm that can understand identification 79%.But the defect of the method is that the consuming time is long, and
The price of reagent is higher
Second：The identification of embryo gender
Principle：In period of embryo, using karyotyping method, Immunological Method and SRY-PCR identification methods its female or hero are detected
Property, so as to select purpose sex embryo to carry out subsequent operation.
Karyotyping method：The property of embryo is identified by finding out the sex chromosome type of embryonic cell for XX types and XY types
Not.Operating process is：Take a small amount of embryonic cell Jing Colchicines and process fixed dyeing, sex chromosome is checked, according to chromosome
Carry out Sex estimation in the size and form of the different bands of a spectrum of metaphase in cell division and Y chromosome, this method accuracy rate is almost reachable
It is to 100% but cumbersome, it is difficult to apply aborning.It is mainly used at present verify the accuracy rate of other sex appraisal methods.
Immunological Method：It is first by the embryo of 8 cell morula stages and H-Y antibody response 30min then glimmering with isothiocyanate
The Immunoglobulin IgM antibody response of light element (FITC) labelling, then checks whether embryo carries fluorescence under fluorescence microscope
Element, is judged to H-Y+ embryos if having, and it is then H-Y- embryos not show fluorescence.There are 89% female identification accuracy rate, pig in cattle
There is 81% identification accuracy rate, sheep has 85% identification accuracy rate.
SRY-PCR methods：It is a kind of side that embryo gender is identified using male specific gene probe and PCR amplification techniques
Method, the principle of the method：A pair of specific primers are designed and synthesized in the both sides of sry gene core sequence, expansion is complementary to respectively
Two chains of increasing sequence, under conditions of Taq DNA polymerase and embryonic cell DNA are present, Jing is high-temperature denatured, process annealing and
Three steps of chain extension carry out DNA cloning, and by target sequence amplification to more than up to a million times, Jing electrophoresis detection amplifications can expand
Increase SRY sequences for male, otherwise for female.Herr etc. successfully establishes first beef embryo sex identification in nineteen ninety
PCR methods.It is used as primer by synthesizing the partial sequence of specific fragment on sry gene or other Y chromosomes, in certain condition
It is male embryo that lower pcr amplification reaction can amplify the embryo of target fragment, is otherwise female embryo.Y dyeing is expanded by PCR
Body DNA can greatly increase sensitivity, improve accuracy rate, and the embryo of Jing living tissues sampling does not have very big damage and is difficult to be sticked
Sperm pollution in being attached to embryonic surface or zona pellucida, is also hopeful further freezing, by the living cells Jing PCR for taking amplifications,
Amplified production Jing sepharose electrophoresis, dyeing is observable whether there is specific fragment, and the accuracy rate of the Identification of embryo expanded with PCR can
It is one of Embryo sexing method ideal so far up to more than 90%.Just because of this method is extensive
Apply in domestic animal, particularly cattle, the sex identification of sheep embryo.But this method has very big damage, and this point to embryo
Analysis needs the long period, and embryo's time in vitro and embryo move into acceptor time and be severely restricted, if in the time
On can not be synchronous, transplanting efficiency will be made to be affected.In order to solve this problem, the embryo that people have to performing PCR analysis is entered
The temporary transient freezen protective of tire gets up, after PCR results out after thawed again, so considerably increase the difficulty of operation, and to embryo
Tire produces further injury.In a word, these current methods can not meet production application, be badly in need of new method.
Animal Transgenic Technology is the study hotspot of biological technical field, the artificial nucleic acid enzyme of particularly current latest development
The accurately genome editing technique of mediation, its range of application has penetrated into many necks such as basic research, agricultural, medicine
Domain.1997, the report that the first somatic cell clone sheep " Dolly " is born caused the strong interest of various circles of society, while
A kind of new technology-mammal body-cell neucleus transplanting technology for indicating biological field is successfully established.The head of the same year report
It is true that the birth of the Transgenic Sheep " Polly " that example is cultivated using somatic cell nuclear transfer technique is only Animal Transgenic research field
Positive milestone, it has raised somatic cell nuclear transfer technique for producing the new page of the big domestic animal of transgenic.Body-cell neucleus transplanting
Technology is integrated as production transgenic animal and opens an effective way with somatic cell gene transfer techniques.The technology path
Maximum feature is mainly reflected in and for gene transfer procedures to advance to the Somatic Cell Culture stage.Cytogene transfer is referred to is worn by electricity
The transfection methods such as hole, liposome, calcium phosphate precipitation and microinjection, make external source target gene be integrated in cellular genome,
And using specific selection markers, a large amount of amplifications, enrichment transgenic cell, so as to obtain transgenosis cell strain.Directly utilize this
The cloned animal that kind fixed somatic cell for being integrated with genes of interest is cultivated for nuclear donor must all transgenic it is dynamic
Thing.By the advantage of somatic cell nuclear transfer technique production breeding transgenic livestock clearly：First, the method is drawn materials simplicity, and ovum is female
Cell can be obtained from slaughterhouse, and animal somatic cell source is even more abundant.Secondly as the produced animal overwhelming majority is dynamic for transgenic
Thing, so as to significantly have compressed the quantity of foster mother, reduces production cost.Obtaining for primary transgenic animal can be shortened
Obtain forming the time of the system of the transgenic animal group with production capacity；It is more valuable, can also obtain base using the technology
Because of the big domestic animal of pointed decoration.Under the present conditions, this is that other transgenic methods are beyond one's reach.Meanwhile, occur recently
" artificial nucleic acid zymotechnic " include ZFN, TALEN and cas9 system, accurate base can be carried out in many cell lines and species
Because of modification, for transgenic technology stronger, more accurate instrument is provided.
Sry gene is the sex controlled gene of most of mammals, in the sex growth course of mammal, Y dyes
The presence of colour solid determines it to patrogenesis.The gene for playing a decisive role in this course is the Sry of Y linkage, it
It is the unique TDF of mammal.The gene is directly related with sex generation on mammal Y chromosome
Gene, the presence or absence of the gene and whether be mutated the sex phenotype for directly determining mammal.Genotype is XX with SRY
The individual cognition of gene exists with male phenotype, and the mutation of sry gene also can to a certain extent cause sex reversal or sexual abnormality,
Research worker report sry gene knocks out mice within 2013, loses male characteristic, is changed into female.SRY albumen belongs to containing HMG boxes
(High mobility group) and specific bond in a subclass of DNA sequence albumen, the subclass include various transcriptions because
Son, can activate the expression of many male related genes in downstream, so as to control patrogenesis.
The content of the invention
It is an object of the invention to provide a kind of Y chromosome labeling method and its application.
The present invention provides a kind of animal Y chromosome labeling method, is in vitro animal somatic cell using TALEN methods
Y chromosome carries out specific marker；
The specific marker is marked on the sex determining gene SRY of Y chromosome；
The somatic cell and sexual cell of the animal that the labelling is located to it does not produce harm；
The gene of the labelling is the encoding gene of the albumen of itself luminous or catalytic substrate colour developing；
The TALEN methods are that Y chromosome specific target sequence is mutated using TALE albumen, while by marker gene
Homologous recombination is to target sequence location；
The gene of the labelling is specially fluorescence protein gene, beta-galactosidase gene, luciferase gene or β-Portugal
Grape alditol phytase gene.
In said method, the method that the Y chromosome in vitro animal somatic cell carries out specific marker is：Make
TALE albumen-I and TALE albumen-II are expressed in the in vitro somatic cell of buck A, are obtained target sequence on Y chromosome and are occurred
The somatic cell of mutation；Simultaneously by marker gene homologous recombination to target sequence location, realize marker gene in the in vitro of buck A
Site-directed integration on somatic cell Y chromosome at target sequence；
The aminoacid sequence of the TALE albumen-I is as shown in SEQ ID No.3；
The aminoacid sequence of the TALE albumen-II is as shown in SEQ ID No.5；
The target sequence is as shown in SEQ ID No.1；
The target sequence is located on the sry gene of Y chromosome；
The TALE albumen-I and TALE albumen-II can respectively with SEQ ID No.1 in the 4th to the 18th from 5 ' ends
Position, the 35th to the 48th nucleotide sequence specific bond, the Fok I functional domain shapes in TALE albumen-I and TALE albumen-II
Into dimer, non-specific endonuclease activity is played so that TALE albumen-I and TALE albumen-II are specifically tied respectively with target sequence
The sequence closed between site is undergone mutation；
The marker gene enters rower to the sex determining gene SRY of the buck A and its Y chromosome of offspring
Note, i.e., do not destroy sry gene, and can track the expression for indicating endogenous sry gene.
In any of the above-described described method, the in vitro body for making TALE albumen-I and TALE albumen-II in buck A
The method of expression is in cell：Recombinant expression plasmid respectively containing TALE albumen-I and the encoding gene of TALE albumen-II is led
In entering the in vitro somatic cell of the buck A；
The coding gene sequence of the TALE albumen-I is as shown in SEQ ID No.2；
The coding gene sequence of the TALE albumen-II is as shown in SEQ ID No.4；
The method by marker gene homologous recombination to target sequence location is by linearizing by the marker gene
Homologous recombination vector is incorporated into the target sequence location；
There is the homologous left arm of target sequence-homologous right arm of marker gene-target sequence on the linearizing homologous recombination vector
Fragment.
In any of the above-described described method, from 5 ' ends in the sequence such as SEQ ID No.12 of the homologous left arm of the target sequence
Rise shown in the 664th to the 1498th nucleotide；
In the sequence such as SEQ ID No.12 of the homologous right arm of the target sequence the 4068th to the 4991st from 5 ' ends
Shown in nucleotide.
In any of the above-described described method, the marker gene is green fluorescence protein gene；
In the concrete such as SEQ ID No.12 of the green fluorescence protein gene the 1573rd to the 2271st from 5 ' ends
Shown in nucleotide；
The sequence such as SEQ ID No.12 of the fragment of the homologous left arm-homologous right arm of marker gene-target sequence of the target sequence
In from 5 ' ends shown in the 664th to the 4991st nucleotide.
In any of the above-described described method, the nucleotide sequence of the homologous recombination vector is as shown in SEQ ID No.12；
The linearisation is restricted enzyme AhdI linearisations；
The animal is cattle.
A kind of identification or system of selection of Animal Sex falls within protection scope of the present invention, is using any of the above-described described
Method the Y chromosome in the in vitro somatic cell of buck A is marked, obtain with markd transgenic cell；With
Transgenic cell is nuclear donor cell, and by somatic cell clone technique somatic cell clone buck B is obtained；In somatic cell clone
In the offspring embryo of buck B, it is male embryo to have markd embryo, does not have markd embryo for female embryo；
The animal is specially cattle.
A kind of test kit falls within protection scope of the present invention, and the test kit contains following 1) -4) at least one material：
1) it is thin containing the DNA molecular of the encoding gene of albumen, recombinant vector, expression cassette, transgenic shown in SEQ ID No.3
Born of the same parents system or recombinant bacterium；
2) it is thin containing the DNA molecular of the encoding gene of albumen, recombinant vector, expression cassette, transgenic shown in SEQ ID No.5
Born of the same parents system or recombinant bacterium；
3) DNA molecular shown in SEQ ID No.12 or transgenic cell line or recombinant bacterium containing the molecule；
4) containing the DNA molecular in SEQ ID No.12 from 5 ' ends shown in the 664th to the 4991st nucleotide, weight
Group carrier, expression cassette, transgenic cell line or recombinant bacterium；
The encoding gene of the albumen shown in the SEQ ID No.3 is concrete as shown in SEQ ID No.2；
The encoding gene of the albumen shown in the SEQ ID No.5 is concrete as shown in SEQ ID No.4.
DNA molecular shown in SEQ ID No.12 falls within protection scope of the present invention；
And/or,
Also belong to containing the DNA molecular in SEQ ID No.12 from 5 ' ends shown in the 664th to the 4991st nucleotide
In protection scope of the present invention；
And/or,
DNA molecular shown in SEQ ID No.2 falls within protection scope of the present invention；
And/or,
DNA molecular shown in SEQ ID No.4 falls within protection scope of the present invention.
The application of mentioned reagent box or above-mentioned DNA molecular in the product for preparing the in vitro somatic cell Y chromosome of labelling animal
Fall within protection scope of the present invention；
Or,
Mentioned reagent box or above-mentioned DNA molecular answering in the product for preparing the markd buck of Y chromosome upper band
With falling within protection scope of the present invention；
Or,
Mentioned reagent box or above-mentioned DNA molecular are in the product for preparing the markd buck cell of Y chromosome upper band
Application fall within protection scope of the present invention；
The labelling is specially labeled with green fluorescent protein gene, is particularly located on the sry gene of Y chromosome；
In the concrete such as SEQ ID No.12 of the sequence of the labeled with green fluorescent protein gene the 1573rd from 5 ' ends
To the 2271st nucleotide shown in；
Or,
The application of mentioned reagent box or above-mentioned DNA molecular in the product for identification or the selection of Animal Sex is prepared
Belong to protection scope of the present invention；
Or,
The application of mentioned reagent box or above-mentioned DNA molecular in animal breeds falls within protection scope of the present invention；
The animal is specially cattle.
The principle of the present invention is to be carried out by the sex determining gene SRY to the somatic Y chromosomes of buck A first
Marker gene is modified, while not destroying sry gene, as nuclear donor cell, then obtains body by somatic cell clone technique
Cell clone buck B；In the offspring embryo of somatic cell clone buck B, it is male embryo to have markd embryo,
Do not have markd embryo for female embryo.
The method that the present invention is provided is one kind by accurate genetic modification labelling boar somatic cell, and then is realized
The method of the purpose of identification and/or selection particular sex animal.
The method provided using the present invention, it is possible to achieve the convenience to Animal Sex, simple, efficient, safe and accurate morning
Phase is identified, is that animal, the raising breeding efficiency of selectivity cultivation particular sex lays the foundation.
Description of the drawings
Fig. 1 is pSRY-TALEN-F and pSRY-TALEN-R Vector maps.
Fig. 2 is the linearized vector collection of illustrative plates of homologous recombination donor vehicle pSRY2A-EGFP.
Fig. 3 is the PCR qualification results of cell clone.
Fig. 4 is the PCR qualification results of clened cows.
Fig. 5 is the PCR qualification results of embryo's sry gene.
Specific embodiment
Experimental technique used in following embodiments if no special instructions, is conventional method.
Material used, reagent etc. in following embodiments, if no special instructions, commercially obtain.
DMEM/F12+10%FBS culture medium is prepared as follows：The culture medium is by DMEM/F12 and hyclone
(FBS) mix and form, the volume ratio of FBS and DMEM/F12 is 1：9.
PGKloxPneo2 is purchased from addgene companies, and catalog number is 13443.
PEGFP-N1 is purchased from Clontech companies, and catalog number is 6085-1.
The preparation method of ripe liquid is as follows：By M199 culture medium and hyclone (FBS) according to volume ratio 9:1 mixes, and obtains
To mixed liquor, 0.01U/mL bFSH (follicle-stimulating growth hormone), 0.01U/mL bLH is added (to promote corpus luteum to generate in mixed liquor
Element) and 1 μ g/mL estradiol.
The preparation method of operation liquid is as follows：By M199 culture medium and hyclone (FBS) according to volume ratio 9:1 mixes, and obtains
To mixed liquor, 7.5 μ g/mL cytochalasin Bs are added in mixed liquor.
Zimmerman liquid is prepared as follows：Containing 0.3M Mannitol, 0.1M MgSO4、0.05M CaCl2、
The aqueous solution of 0.5mM HEPES, 0.05g/100mL BSA, pH7.2, with 0.22 μm of membrane filtration.
A23187 liquid is purchased from sigma, and article No. is C9275.
CR1aa culture fluid is prepared as follows：114mM Sodium Chloride, 3.1mM potassium chloride, 26.2mM sodium bicarbonate,
The aqueous solution of 20.4mM Sodium Pyruvates, pH7.2 uses 0.22um membrane filtrations.
The preparation of BO liquid：
(1) A liquid (100ml)
Ultra-pure water 100ml constant volumes.
(2) B liquid (100ml)
NaHCO3 1.1552g
Ultra-pure water 100ml constant volumes.
A, B liquid is equal standby Jing after high-temperature sterilization.
(3) BO liquid (100ml)
A liquid 80ml
B liquid 20ml
Sodium Pyruvate 0.0138g
Penicillin 3.1mg
Streptomycin 3.1mg
Heparin sodium 3mg
Embodiment 1, Enhanced green fluorescent protein gene accurately modifies the breeding oxen body of Y chromosome sex controlled gene SRY
The preparation of cell
First, the foundation of breeding oxen fibroblast
The ear skin tissue of holstein cow breeding oxen is taken, will be with volumn concentration after ear's lower edge dorsal part unhairing
70% ethanol water is cleaned up, then picks that to take area be 1cm from ear's lower edge dorsal part with blade2The skin of left and right, is placed in 0
DEG C DMEM/F12 culture medium in transport laboratory back as early as possible, with the cleaning of ethanol water that PBS and volumn concentration are 70%
Shred into 1mm afterwards several times3The fritter of left and right, DMEM/F12 plants block in containing 1mLDMEM/F12+10%FBS in batches after cleaning 2 times
25cm2Culture bottle in, DMEM/F12+10%FBS to 6mL is added again after tissue block adherent is firm, in 37 DEG C, 5%CO2Training
Foster case culture 6-7d, liquid 1 time is changed per 2d, after cell growth is converged, is passed on 2-3 time with 0.25% trypsinization, in batches
It is frozen with cells frozen storing liquid.So, the operation of the In vitro culture such as Jing original cuitures, Secondary Culture, freezing, establishes breeding oxen into fibre
Dimension cell line.
2nd, the determination of target sequence
Selected target sequence is inside sry gene, and sequence is as follows：
5’-ctTTCTTGTGCTTATTTTCAATATTGACTTCCTTACTCTCGCTAACAAag-3’(SEQ ID No.1)
In SEQ ID No.1 the 4th to the 18th from 5 ' ends, the 35th to the 48th nucleotides sequence is classified as can quilt
The part of the combined function domain specific bond in TALENs albumen, binding site mid portion is in the Fok I of TALENs albumen
Cut nucleic acid cleavage recognition site.
3rd, the TALEN for acting on sry gene is built
The schematic diagram of pSRY-TALEN-F and pSRY-TALEN-R carriers is as shown in Figure 1.
The coding gene sequence of SRY-F is as shown in SEQ ID No.2 in pSRY-TALEN-F, the aminoacid sequence of SRY-F
As shown in SEQ ID No.3, SRY-F is TALE albumen-I.
The coding gene sequence of SRY-R is as shown in SEQ ID No.4 in pSRY-TALEN-R, the aminoacid sequence of SRY-R
As shown in SEQ ID No.5, SRY-R is TALE albumen-II.
TALE albumen-I and TALE albumen-II can respectively with SEQ ID No.1 in the 4th to the 18th from 5 ' ends,
35th to the 48th nucleotide sequence specific bond, the Fok I functional domains in TALE albumen-I and TALE albumen-II form two
Aggressiveness, plays non-specific endonuclease activity so that TALE albumen-I and TALE albumen-II respectively with target sequence specific bond position
Sequence between point is undergone mutation；If TALENs protein exhibits dissections, cell can start own healing mechanism, in cutting
Site occurs the deletion or insertion of small fragment, and sequencing result peak figure is heterozygosis peak figure.
4th, homologous recombination donor vehicle pSRY2A-EGFP is built
1st, with pEGFP-N1 as template, B 195 and B196 is primer, enters performing PCR amplification, obtains pcr amplification product,
B195:5’-AAGGATGCAAGCGGCCGCGGCAGCGGCGAGGGCAGGGGCAGCCTGCTGACCTGCGGCGACG
TGGAGGAGAACCCCGGCCCC ATGGTGAGCAAGGGCGAGGAG-3’；(SEQ ID No.6)
B196：5’-ATGCAAGTGCGCGGCCGC TTACTTGTACAGCTCGTCCAT-3’。(SEQ ID No.7)
(sequence shown in underscore is NotI enzyme action recognition sites)
The pcr amplification product is 820bp, is denoted as pcr amplification product 1.
2nd, NotI single endonuclease digestions pcr amplification product 1, obtains genetic fragment；NotI single endonuclease digestion plasmid PGKloxPneo2, obtain
The carrier large fragment of 6.3kb；Genetic fragment is connected with carrier large fragment, recombiant plasmid is obtained, is named as
PPGKloxPneo2-2AEGFP, send sequencing, as a result correctly by pPGKloxPneo2-2AEGFP.
3rd, the fibroblastic genomic DNA of the breeding oxen of extraction step one, with it as template, with primer B202 and B203
For primer, enter performing PCR amplification, obtain pcr amplification product.
B202：5’-ATGCAA ccaccgcggtgg GCGGAGAAATAAATATTTCAC-3’；(SEQ ID No.8)
B203：5’-AAGTGCccaccgcggtgg AG ATATTGAAAATAAGCACAAGA-3’.(SEQ ID No.9)
(sequence shown in underscore is BstxI enzyme action recognition sites)
The pcr amplification product is 858bp, is denoted as pcr amplification product 2.
Pcr amplification product 2 is as homology arm sequence.
4th, with BstxI single endonuclease digestions pcr amplification product 2, genetic fragment is obtained；With BstxI single endonuclease digestion carriers
PPGKloxPneo2-2AEGFP, obtains the carrier large fragment of 7.1kb；Genetic fragment is connected with carrier large fragment, is recombinated
Plasmid, is named as pPGKloxPneo2-2AEGFP-5HR, send sequencing by pPGKloxPneo2-2AEGFP-5HR, as a result just
Really.
5th, the fibroblastic genomic DNA of the breeding oxen of extraction step one, with it as template, with primer B171 and B172
For primer, enter performing PCR amplification, obtain pcr amplification product.
B171：5’-AAGGATGCAAGCTAGCCTTCCTTACTCTCGCTAACAA-3’；(SEQ ID No.10)
(sequence shown in underscore is NheI enzyme action recognition sites)
B172：5’-ATGCAAGTGCGTCGACATCAGATTAATCAGACAGGAT-3’。(SEQ ID No.11)
(sequence shown in underscore is SalI enzyme action recognition sites)
The pcr amplification product is 943bp, is denoted as pcr amplification product 3.
Pcr amplification product 3 is as homology arm sequence.
6th, with NheI and SalI double digestions pcr amplification product 3, genetic fragment is obtained；With NheI and SalI double digestions
PPGKloxPneo2-2AEGFP-5HR, obtains the carrier large fragment of 7944bp；Genetic fragment is connected with carrier large fragment, is obtained
To recombiant plasmid, pSRY2A-EGFP is named as, is sent sequencing by pSRY2A-EGFP, as a result correctly.
The sequence of pSRY2A-EGFP is as shown in SEQ ID No.12.
In SEQ ID No.12 from 5 ' ends the 664th to the 1498th be the homologous left arm of target sequence, the 1573rd extremely
2271st be EGFP gene sequence, the 4068th to the 4991st be the homologous right arm of target sequence.
5th, pSRY2A-EGFP vector linearizations
With AhdI single endonuclease digestion pSRY2A-EGFP carriers, linearized fragment is obtained, and purify recovery linearly with dehydrated alcohol method
Change fragment, for transfecting breeding oxen fibroblast.
Linearized vector structure is as shown in Figure 2.
In Fig. 2,5HR and 3HR represents the position of homologous recombination, and T2A represents the shearing peptide that foot and mouth disease viruses are originated, and EGFP is
Green fluorescent protein fusion vector, PGK be phosphoglycerokinase strong promoter, NeorRepresent neomycin resistance gene, polyA tables
Show transcription stop signalses.
Neomycin resistance gene is set by the screening for the ease of follow-up transgenic cell.
6th, gene transfection
The cell cotransfection of pSRY2A-EGFP and TALENs plasmids：By the pSRY2A-EGFP of 3ug AhdI linearization for enzyme restriction
And the breeding oxen for preparing of each 1.5ug cotransfections step one of 3ug TALENs plasmids (pSRY-TALEN-F and pSRY-TALEN-R) into
Fibrocyte (cell number about 1x106) obtain transgenic cell.
TALE albumen-I that pSRY-TALEN-F and pSRY-TALEN-R are separately encoded and TALE albumen-II can respectively with kind
In SEQ ID No.1 on bull fibroblast genome the 4th to the 18th from 5 ' ends, the 35th to the 48th core
Nucleotide sequence specific bond, the Fok I functional domains in TALE albumen-I and TALE albumen-II form dimer, play non-specific
Property endonuclease activity so that TALE albumen-I and TALE albumen-II respectively with the sequence between target sequence specific binding site send out
Raw mutation；After simultaneously the linearisation pSRY2A-EGFP of the AhdI enzyme action with exogenous gene is imported, donor vehicle is by homologous
Recombination and integration realizes the enhanced greens of Y chromosome sex controlled gene SRY in breeding oxen fibroblast to target sequence location
Fluorescence protein gene EGFP is accurately modified.
7th, PCR identifications green fluorescent protein knocks in successful positive transgenic cell
Genomic DNA with transgenic cell, with KOD2-F and KOD2-R as primer, enters performing PCR amplification as template, obtains
Pcr amplification product, if fragment of the pcr amplification product for 2kb, shows that transgenic cell is positive transgenic cell, while with
ddH2O is template, above-mentioned experiment is carried out, as control.
KOD2-F：5’-tgctcctgccgagaaagtat-3’；(SEQ ID No.13)
KOD2-R：5’-AAACAGTCTGTGAAGTTACCT-3’.(SEQ ID No.14)
As a result it is as shown in Figure 3.
Fig. 3 shows that the transgenic cell clone identification for being numbered 3,12 is positive transgenic cell clone, and PCR is expanded
Volume increase thing is sequenced, as a result correctly.Using positive transgenic cell as somatic cell clone nuclear donor cell, in following embodiments
Transgenic cell be positive transgenic cell.
Embodiment 2, the kind public affairs that Y chromosome sex controlled gene SRY is accurately modified using Enhanced green fluorescent protein gene
Bovine somatic cells cultivate somatic cell clone breeding oxen
First, the maturation culture of oocyte
The ovary of Adult Bovine is collected from slaughterhouse, 30 DEG C of normal saline is placed in, laboratory is sent in 4h, ovary is existed
After cleaning three times in 37 DEG C of PBS liquid, with the follicle that a diameter of 0.7mm syringe needles extract a diameter of 2-8mm, reclaim form it is uniform,
The cumulus oocytes complesxes (COCs) of compact structure, are washed twice with ripe liquid, are then combined cumulus-oocyte
Body is put into 4 orifice plates containing ripe liquid with 50-60 piece/hole, in 38.5 DEG C, 5%CO2In incubator after maturation culture 18-20h, obtain
To ripe cell, ripe cell is put in the pipe for filling the hyaluronidase containing volumn concentration 0.1% and vibrates 2-
After 3min, then gently blown and beaten with glass tubing, cumulus cell is completely disengaged from oocyte, select form complete, Cytoplasm is equal
Even and with first polar body oocyte is nuclear receptor cell.
2nd, the acquisition of somatic cell clone breeding oxen
1st, the oocyte with first polar body is moved in operation liquid, with glass needle in polar body under 200 power microscopes
Zona pellucida is cut an osculum by top, then with the glass tubing that internal diameter is 20 μm oocyte by first polar body and below
Chromosome is absorbed in the lump, is placed into after washing three times in the M199 solution containing volumn concentration 20%FBS, obtains the ovum of enucleation
Blast cell, is placed on standby in incubator.
2nd, the transgenic cell (nuclear donor cell) for preparing the embodiment 1 of serum starvation 2-4d uses 0.25% trypsin
(trypsin) 2-4min is digested, a diameter of 10-12 μm of transgenic cell is moved into into step 1 with 20 μ m diameter glass tubings and is prepared
Non-nucleus egg mother cell zona pellucida in, then put it in Zimmerman liquid balance (matching while using) 3-5 minutes after put
To enter rotate in integration slot ovum makes nuclear donor cell contact with non-nucleus egg mother cell and vertical with electric field, while being in field intensity
In the DC pulse field of 2.5kV/cm, the burst length be 10 μ s, pulse number be 2 times, the pulse spacing be 1s under conditions of melt
After closing (ECM-2001 that fusion instrument is BTX companies), reconstructed embryo is obtained, it is moved into rapidly containing volumn concentration 10%
After cultivating a few hours in the M199 of FBS, select fusion embryo and (specifically select the reconstruct that donorcellses and oocyte merge completely
Embryo) enter line activating process.Embryo activation liquid (cell containing 5ug/ml is changed to after fusion embryo is put into 5 minutes in 5mM A23187 liquid
The M199 culture fluid of relaxins B, 10ug/ml cycloheximide) in 5 hours, change to containing volume basis after indusium to be fused activation
In the CR1aa of the FBS of content 5%, in 38.5 DEG C, 5%CO2The capsule of observation fusion embryo after cultivating 7 days in culture fluid in incubator
Embryonic development rate, as a result shows that cloned blastocysts developmental rate is 20%-60%.
3rd, embryo transfer and gestation detection
In the cornua uteri of the recipient cattle that the cloned blastocysts of the excellent 7d of form are moved into estrus synchronization.After the transfer
30d carries out B ultrasonic to receptor cow and detects to determine fertilization situation, and 60d respectively after the transfer and 90d carry out rectum inspection
Survey to determine pregnancy rate, pregnancy rate is 40%.
4th, to cow in calf, routinely method for breeding is raised, and through 280 days, cow in calf normal labor obtained body
Cell clone breeding oxen.
3rd, the identification of breeding oxen
Collection somatic cell clone breeding oxen otic tissues sample, extracts its genomic DNA, with genomic DNA as template, with
KOD2-F and KOD2-R is primer, enters performing PCR amplification, pcr amplification product is obtained, while with ddH2O is template, carries out above-mentioned reality
Test, as control.
PCR response procedures：94℃5min；94 DEG C of 30sec, 62 DEG C of 30sec, 72 DEG C of 120sec, 30 circulations；72℃
7min。
If pcr amplification product is the fragment of 2kb, show gene knock-in success.
As a result show to have 6 individualities, PCR amplifies the positive fragment of 2kb, as shown in Figure 4.Further PCR is expanded
Volume increase thing is sequenced, as a result correctly.Confirmation step two successfully obtains somatic cell clone breeding oxen, the somatic cell clone breeding oxen
The enhanced green fluorescence protein genes of Y chromosome sex controlled gene SRY accurately modify.
Embodiment 3, embryo is sorted by green fluorescent label
First, sort after internal fertilization
1st, the somatic cell clone for accurately modifying the enhanced green fluorescence protein genes of Y chromosome sex controlled gene SRY
Breeding oxen is copulationed with the cow of estrus synchronization, reclaims the embryo in cow body after four to seven days, is placed in fluorescence microscope
Under observed, by send out have the embryo of green fluorescence and the embryo without green fluorescence to choose respectively.
2nd, the genomic DNA with embryo, with special PCR primer SRY-F of sry gene and SRY-R as primer, enters as template
Performing PCR is expanded, and pcr amplification product is obtained, while with ddH2O is template, above-mentioned experiment is carried out, as control.
Primer sequence is as follows：
SRY-F:5’-AACGACGATGTTTACAGTCCA-3’；(SEQ ID No.15)
SRY-R:5’-GCCCGGGTATTTGTCTCGGT-3’。(SEQ ID No.16)
PCR response procedures：94℃5min；94 DEG C of 30sec, 62 DEG C of 30sec, 72 DEG C of 120sec, 30 circulations；72℃
7min。
If pcr amplification product is 340bp fragments, embryo is male.
As a result it is as shown in Figure 5.
In Fig. 5, the embryo for being numbered 1,2,3,4,5 is the embryo without green fluorescence, is numbered 6,7,8,9,10 to send out
The embryo of green fluorescence.
Fig. 5 shows that being numbered 1,2,3,4,5 embryo does not have purpose band, is that sry gene is negative；Be numbered 6,7,8,
9th, the purposeful band of 10 embryo, is that sry gene is positive.
As a result prove, the embryo of all green fluorescences is male embryo, otherwise is then female embryo.
2nd, sort after external fertilization
Take the seminal fluid of somatic cell clone breeding oxen, be added to containing heparin (50ug/ml), caffeine (0.01nmol/ml),
Twice of dilution washing (with 1800 revs/min, being centrifuged 8 minutes), goes after supernatant to add 1ml in the BO liquid of BSA (3.0mg/ml)
Identical contains after the BO liquid mix homogeneously of heparin (50ug/ml), caffeine (0.01nmol/ml), BSA (3.0mg/ml), takes
50ul be added to 50ul containing 20-30 piece of bovine oocyte by the seminal fluid BO liquid of non-fatty acids (BSA containing 10mg/ml)
After co-culturing 5 hours, germ cell is obtained, be transferred in In vitro culture liquid CR1aa and continue to cultivate 5 to 7 days, treat that germ cell is sent out
Educate Fructus Mori to be observed with fluorescence microscope to blastula stage, the embryo containing green fluorescence shows that the embryo contains Y chromosome,
It is male embryo, otherwise for female embryo.
Claims (13)
1. a kind of animal Y chromosome labeling method, is that the Y chromosome of in vitro animal somatic cell is carried out using TALEN methods
Specific marker；
The specific marker is marked on the sex determining gene SRY of Y chromosome；
The somatic cell and sexual cell of the animal that the labelling is located to it does not produce harm；
The gene of the labelling is the encoding gene of the albumen of itself luminous or catalytic substrate colour developing；
The method that the Y chromosome in vitro animal somatic cell carries out specific marker is：Make TALE albumen-I and TALE
Albumen-II is expressed in the in vitro somatic cell of buck A, obtains the somatic cell that target sequence on Y chromosome is undergone mutation；Simultaneously
By marker gene homologous recombination to target sequence location, marker gene target on the in vitro somatic cell Y chromosome of buck A is realized
Site-directed integration at sequence；
The aminoacid sequence of the TALE albumen-I is as shown in SEQ ID No.3；
The aminoacid sequence of the TALE albumen-II is as shown in SEQ ID No.5；
The target sequence is as shown in SEQ ID No.1；
The method for making TALE albumen-I and TALE albumen-II express in the in vitro somatic cell of buck A is：Will be respectively
The in vitro body that recombinant expression plasmid containing TALE albumen-I and the encoding gene of TALE albumen-II imports the buck A is thin
In born of the same parents；
The coding gene sequence of the TALE albumen-I is as shown in SEQ ID No.2；
The coding gene sequence of the TALE albumen-II is as shown in SEQ ID No.4；
The method by marker gene homologous recombination to target sequence location is by linearizing homologous by the marker gene
Recombinant vector is incorporated into the target sequence location；
Piece with the homologous left arm of target sequence-homologous right arm of marker gene-target sequence on the linearizing homologous recombination vector
Section；
In the sequence such as SEQ ID No.12 of the homologous left arm of the target sequence from 5 ' ends the 664th to the 1498th nucleotide
It is shown；
In the sequence such as SEQ ID No.12 of the homologous right arm of the target sequence from 5 ' ends the 4068th to the 4991st nucleoside
Shown in sour.
2. method according to claim 1, it is characterised in that：The marker gene is green fluorescence protein gene；
In the green fluorescence protein gene such as SEQ ID No.12 from 5 ' ends the 1573rd to the 2271st nucleotide institute
Show；
In the sequence such as SEQ ID No.12 of the fragment of the homologous left arm-homologous right arm of marker gene-target sequence of the target sequence from
Rise shown in the 664th to the 4991st nucleotide 5 ' ends.
3. method according to claim 1 and 2, it is characterised in that：The nucleotide sequence of the homologous recombination vector such as SEQ
Shown in ID No.12；
The linearisation is restricted enzyme AhdI linearisations.
4. the identification or system of selection of a kind of Animal Sex, is to buck A using the arbitrary described method of claim 1-3
In vitro somatic cell in Y chromosome be marked, obtain with markd transgenic cell；With transgenic cell as nuclear donor
Cell, by somatic cell clone technique somatic cell clone buck B is obtained；In offspring's embryo of somatic cell clone buck B
In tire, it is male embryo to have markd embryo, does not have markd embryo for female embryo.
5. a kind of test kit, the test kit includes following A1) or A2)：
A1) the DNA molecular shown in SEQ ID No.12；
A2) A1 is contained) recombinant bacterium of the DNA molecular.
6. a kind of test kit, the test kit includes following B1)-B4) in any one material：
B1) containing the DNA molecular in SEQ ID No.12 from 5 ' ends shown in the 664th to the 4991st nucleotide；
B2) B1 is contained) recombinant vector of the DNA molecular；
B3) B1 is contained) expression cassette of the DNA molecular；
B4) B1 is contained) recombinant bacterium of the DNA molecular.
DNA molecular shown in 7.SEQ ID No.12.
8. containing the DNA molecular in SEQ ID No.12 from 5 ' ends shown in the 664th to the 4991st nucleotide.
9. the DNA molecular described in the test kit or claim 7 or 8 described in claim 5 or 6 is preparing the in vitro body of labelling animal
Application in the product of cell Y chromosome.
10. the DNA molecular described in the test kit or claim 7 or 8 described in claim 5 or 6 is carried on Y chromosome is prepared
Application in the product of the buck of labelling.
The DNA molecular described in test kit or claim 7 or 8 described in 11. claim 5 or 6 is carried on Y chromosome is prepared
Application in the product of the buck cell of labelling.
The DNA molecular described in test kit or claim 7 or 8 described in 12. claim 5 or 6 is being prepared for Animal Sex
Identification or selection product in application.
Application of the DNA molecular described in test kit or claim 7 or 8 described in 13. claim 5 or 6 in animal breeds.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410646040.3A CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410646040.3A CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388560A CN104388560A (en) | 2015-03-04 |
| CN104388560B true CN104388560B (en) | 2017-04-12 |
Family
ID=52606517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410646040.3A Active CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388560B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861554B (en) * | 2016-05-10 | 2020-01-31 | 华南农业大学 | method for realizing animal sex control based on editing Rbmy gene and application |
| CN114015705A (en) * | 2021-11-28 | 2022-02-08 | 华中科技大学同济医学院附属协和医院 | Sex selection method for mouse in-vitro fertilization breeding |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1745626B (en) * | 2004-09-06 | 2010-10-06 | 戴蕴平 | Modified cell line of male mammal, its production and use thereof |
| AU2012222144B2 (en) * | 2011-02-25 | 2017-04-27 | Recombinetics, Inc. | Genetically modified animals and methods for making the same |
| WO2014172470A2 (en) * | 2013-04-16 | 2014-10-23 | Whitehead Institute For Biomedical Research | Methods of mutating, modifying or modulating nucleic acid in a cell or nonhuman mammal |
| CN103882061B (en) * | 2014-02-23 | 2017-01-11 | 浙江大学 | Transcription activator-like effector nuclease (TALEN) target gene editing and optimizing method taking IDLV as template |
| CN103865897A (en) * | 2014-04-15 | 2014-06-18 | 西南大学 | Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system |
-
2014
- 2014-11-14 CN CN201410646040.3A patent/CN104388560B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388560A (en) | 2015-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087620B (en) | One kind is overexpressed the 1BB carriers of pig costimulation acceptor 4 and its application | |
| Shemesh et al. | Gene integration into bovine sperm genome and its expression in transgenic offspring | |
| CN104419719B (en) | A kind of method that transgene pig riddled basins are knocked out | |
| CN1202084A (en) | Quiescent cell populations for nuclear transfer | |
| CN104263754A (en) | Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig | |
| CN103725710B (en) | One oneself can delete free carrier and application thereof | |
| CN111778287A (en) | Preparation method of chimeric embryo or animal | |
| CN103993027B (en) | A kind of method that transgene pig riddled basins are knocked out | |
| CN113957093A (en) | System for site-directed modification of pAPN gene and application thereof | |
| CN110184301A (en) | Efficiently accurate targeted integration is realized by Tild-CRISPR | |
| CN104388560B (en) | Method for marking Y chromosome and application thereof | |
| JP2005519633A (en) | Replicated pigs in which GFP gene is expressed, replicated pigs in which GT gene is removed, and production methods thereof | |
| KR100807644B1 (en) | Piglet production method by simultaneous transfer of embryos formed by in vitro fertilization and nuclear transfer | |
| Church | Embryo manipulation and gene transfer in domestic animals | |
| CN102747102B (en) | HSA (Human Serum Albumin) mammary gland specific expression vector and reconstitution cell constructed by HSA mammary gland specific expression vector | |
| CN102517329A (en) | Method for breeding transgenic pig for over expression of pig PBD-2 gene | |
| CN104450673B (en) | A kind of Y chromosome method of modifying and its application | |
| CN102260711A (en) | Method for knocking out bovine myostatin gene by using zinc finger nuclease | |
| CN103952424B (en) | Method for producing double-muscular trait somatic cell cloned pig with MSTN (myostatin) bilateral gene knockout | |
| CN1745626B (en) | Modified cell line of male mammal, its production and use thereof | |
| JP2023516767A (en) | animal production method | |
| CN101412999A (en) | A kind of gene targeting locus-specific transgenic method and application thereof | |
| CN103992409B (en) | Fusion protein and its application for rejecting marker gene | |
| John Clark | Generation of transgenic livestock by pronuclear injection | |
| Walker et al. | In vitro assessment of the viability of sheep zygotes after pronuclear microinjection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Dai Yunping Inventor after: Sun Zhaolin Inventor after: Wang Ming Inventor after: Ding Fangrong Inventor after: Wang Haiping Inventor after: Li Ling Inventor before: Dai Yunping Inventor before: Sun Zhaolin Inventor before: Ding Fangrong Inventor before: Wang Haiping Inventor before: Li Jing Inventor before: Li Ling |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201231 Address after: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee after: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. Address before: 100193 No. 2 Old Summer Palace West Road, Beijing, Haidian District Patentee before: CHINA AGRICULTURAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211125 Address after: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee after: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. Patentee after: Inner Mongolia Shunxin Xinyuan animal husbandry Co., Ltd Address before: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee before: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. |
|
| TR01 | Transfer of patent right |