CN1517441A - Ultrahigh annealing temperature polymerase chain reaction method and its application - Google Patents

Abstract

A method for performing the PCR at ultrahigh annealing temp (72-82 deg.C) features use of a primer with high melting temp. so simplifying the cyclic steps of PCR into high-temp modifying and annealing elongation steps. It can be used to reject non-specific amplified product and false negative result.

Description

A kind of superelevation annealing temperature polymerase chain reaction method and application thereof

Technical field

The present invention relates to Protocols in Molecular Biology, particularly relate to a kind of method and application thereof of polymerase chain reaction.

Technical background

The polymerase chain reaction is the method for a kind of specific DNA that increases efficiently, particularly is widely used in the clinical medicine detection in biomedical every field.The polymerase chain reaction mainly is the circulation that the cycle changes by 25-35 temperature and forms, and each circulation comprises sex change, anneals and extends three steps.Wherein, the annealing steps purpose is that positive and negative primer is combined with two strands of template are complementary respectively, and archaeal dna polymerase then begins to extend by 5 ' to 3 ' direction expansion from 3 ' end of complementary portion, thereby finishes a round-robin amplification.Primer and template are fully annealed be the key that guarantees high amplification efficiency, generally speaking annealing temperature is low helps primer and combines with template.On the other hand, annealing must remain on more than certain temperature again, annealing temperature is on the low side to make the complementation of primer and non-template order and the complementary significantly enhancing between the primer, thereby not only cause the formation of non-single-minded amplified production and primer dipolymer, also can reduce the amplification efficiency of target product even can not get the target amplification product because of competition.Suitable annealing temperature is to average out between amplification efficiency and specificity, determine by design of primers with at the test of each amplified production, and suitable annealing temperature is the most important step that whole amplification procedure is succeedd.

According to the book of teaching, handbook, test kit specification sheets and ten hundreds of research papers, the typical anneal temperature of existing PCR is about 55 ℃, usually annealing region is between 45-65 ℃, use higher temperature as 68 ℃ under a few cases, the highest annealing temperature of reported in literature is 72 ℃, and some primer-design softwares such as Oligo also are set at the highest permission annealing temperature with 72 ℃.The analysis of PCR process and our practice are shown, employing has the primer of high melting temperature(Tm) can finish amplification under 72-82 ℃ of high annealing temperature, not only this is a kind of general feasible methods to various templates for this, and be created in following inaccessible good result of common annealing temperature, wide practical value is arranged.

Summary of the invention

The technical problem of required solution

Technical problem to be solved by this invention provides a kind of superelevation annealing temperature polymerase chain reaction method and application thereof, to break through the routine of primer and template annealing upper temperature limit in the existing PCR method, expanded the ability that non-specificity amplified production, primer dimer and eliminating false negative result are got rid of in the adjusting that utilizes annealing temperature.

Technical scheme

The polymerase chain reaction method of superelevation annealing temperature of the present invention comprises following three steps successively: template sex change, primer and template annealing and extend synthetic complementary dna chain under archaeal dna polymerase catalysis, carry out amplified reaction by this three step cycle then.Wherein, primer and template annealing temperature are 72-82 ℃, are preferably 75-80 ℃.

For realizing the polymerase chain reaction of above-mentioned superelevation annealing temperature, can adopt length is the positive anti-primer of 15-50 base, and preferred primer length is the 30-45 base.The melting temperature(Tm) Tm value scope of positive anti-primer is 74-96 ℃, preferred 84-92 ℃.In design of primers, should follow the principle of preciseness, make primer base sequence and template complementary fully, but can have indivedual bases outside primer 3 ' end, mispairing to occur in the zone according to detecting needs.

Carry out the polymerase chain reaction owing to adopt the superelevation annealing temperature, its annealing region reaches 72-82 ℃, so can realize the design that annealing temperature is identical with elongating temperature in the amplified reaction, be reduced to high-temperature denatured and annealing extension two steps by sex change-annealing-three steps of extension the PCR circulation step, in primer and template annealing, promptly carry out the catalytic new DNA chain extension of archaeal dna polymerase, the constant temperature time that step is extended in annealing is shorter than conventional three-step approach.

Annealing temperature of the present invention is that 72-82 ℃ superelevation annealing temperature PCR method is applicable to Standard PC R and reverse transcription PCR, also can be used for competing quantitative PCR and real-time fluorescence quantitative PCR, to reduce and to get rid of non-specificity amplified production or primer dimer, can also be applied to multiplex PCR, nested PCR and other are by various improvement PCR of Standard PC R deutero-and applicability PCR method, improve atopic and reaction sensitivity, get rid of the generation of non-specificity amplified production or primer dimer.In above-mentioned application, its amplified production can reach 22--5 ℃ with the difference of the melting temperature(Tm) of positive anti-primer, and preferable range is 15-0 ℃.

Superelevation annealing temperature PCR method of the present invention is in the mispairing that 0-5 base arranged when primary template and primer, when particularly base mismatch is 1-3, can effectively reduce and get rid of all kinds of Standard PC R and by the false negative result of various improvement PCR of Standard PC R deutero-and applicability PCR method.

For understanding technical conceive of the present invention and using main points, reaction primer design and melting temperature(Tm) test thereof are explained as follows:

The suitableeest annealing temperature of PCR and the melting temperature(Tm) of the highest permission annealing temperature and primer are closely related.Melting temperature(Tm) that it is generally acknowledged the primer that the suitableeest annealing temperature is lower than melting temperature(Tm) in a pair of primer is low 5-10 ℃.

With the hepatitis B virogene is example, utilizes primer-design software Oligo to search the outstanding primer with very high preciseness that 116 pairs of length are 20 bases altogether, and amplified production length is between the 150-800 base.Analyzed the melting temperature(Tm) of these 116 pairs of primers with primer-design software, the suitableeest PCR annealing temperature and the highest permission annealing temperature, its statistics is listed in table 1

Table 1.116 pair primer melting temperature(Tm) and annealing temperature analytic statistics result

Project	The primer melting temperature(Tm) (℃)	The suitableeest annealing temperature (℃)		The highest annealing temperature (℃)
						Statistical value	Poor with melting temperature(Tm)	Statistical value	Poor with melting temperature(Tm)
		Minimum	??61.3	??53.2	??6.7					??64.3	???3
The highest	??76.3					??63.1	??16.7	??72	???-4.3
		On average	??66.5	??54.7	??11.8					??68.9	???2.4
The highest minimum poor	??15					??9.9	??10	??7.7	???7.7
		Standard error	??3.2	??1.5	???2.2					??2.3	???1.5

Table 1 explanation is when the primer length that adopts is 20 bases, and the suitableeest annealing region is between 53-63 ℃ accordingly, and on average the suitableeest annealing temperature is 54.7 ℃.Low 7-17 ℃ of the annealing temperature of that primer that the suitableeest annealing temperature is lower than primer centering melting temperature(Tm), on average low 12 ℃.The annealing temperature of that primer that the annealed maximum permissible temperature is lower than primer centering melting temperature(Tm) is high 3 ℃.But no matter how high the melting temperature(Tm) of primer is, and the highest permission annealing temperature of software analysis is 72 ℃.

Further calculating the length that contains different G+C% with the G+C% method that is fit to the short chain oligonucleotide is the melting temperature(Tm) of 18-25 base oligonucleotide, the results are shown in table 2.

Table 2. melting temperature(Tm) of the 15-25 base long primer of G+C% method calculating

15 bases		18 bases		20 bases		25 bases
								??G+C％	????Tm(℃	??G+C％	?Tm(℃)	??G+C％	??Tm(℃)	??G+C％	??Tm(℃)
??33.3	????58.0	??38.9	??65.8	??40	????69.1	????40	????74.1
								??40	????60.7	??44.4	??68.1	??45	????71.1	????44	????75.7
??46.7	????63.5	??50.0	??70.4	??50	????73.2	????48	????77.3
								??53.3	????66.2	??55.6	??72.7	??55	????75.2	????52	????79
??60	????68.9	??61.1	??74.9	??60	????77.3	????56	????80.6
								??66.7	????71.7	??66.7	??77.2	??65	????79.3	????60	????82.3
				??70	????81.4	????64	????83.9
														????68	????85.6
						????72	????87.2

The G+C% optimum range that it has been generally acknowledged that primer is between 45%-55%, so, the melting temperature(Tm) of 18-25 base long primer is usually between 64-80 ℃, the resulting analytical results of application table 1 can calculate that the suitableeest annealing region is usually between 52-68 ℃ when primer length is the 18-25 base.

Melting temperature(Tm) to long oligonucleotide is more suitable with the most contiguous base method of calculation.This method has been considered the length and the based composition of primer, has also considered the influence of base arrangement to melting temperature(Tm).With the hepatitis B virogene is example, and the random sampling analysis length is 15,18,25,30 and the melting temperature(Tm) of 40 base oligonucleotide, 50 of each length testings, and statistics is shown in table 3.

The melting temperature(Tm) statistics that table 3. calculates with the most contiguous base method

Oligonucleotide length	??15	??18	??20	??25	??30	??40
							Minimum melting temperature(Tm) (℃)	??31.3	??43.1	??48.3	??62.7	??68.7	??77.1
The highest melting temperature(Tm) (℃)	??60.1	??67.0	??70.2	??83.2	??90.1	??96.8
							Average melting temperature(Tm) (℃)	??46.3	??56.7	??62.2	??72.5	??79.9	??89.0
The highest minimum poor (℃)	??28.8	??23.9	??21.9	??20.5	??21.4	??19.7
							Standard error (℃)	??6.7	??6.1	??5.6	??4.7	??4.6	??4.2

Table 3 explanation when oligonucleotide length is 30 and 40 bases, average melting temperature(Tm) respectively up to 80 ℃ with nearly 90 ℃, melting temperature(Tm) is higher than 84 ℃ oligonucleotide and accounts for 26% and 90% of statistical number respectively.In other words, according to the analytical results of table 1, there is the suitableeest annealing temperature of 26% and 90% 30 and 40 base long primers to be higher than 72 ℃ respectively.

Though the highest melting temperature(Tm) of 15 and 18 base oligonucleotide of 50 stochastic samplings as shown in table 3 all is lower than 69 ℃, and according to table 1 analytical results, its highest permission annealing temperature all is lower than 72 ℃.But, as shown in following examples, still can search minority length high melting temperature(Tm) being arranged and have the primer of high preciseness right between 15-18 with primer-design software, they can be in annealing more than 72 ℃.With the primer length increase just increase of ratio of annealed primer at high temperature.Can be just quite general when primer length expands to 30 or 40 bases at annealed primer more than 72 ℃.

Beneficial effect

PCR method of the present invention annealed meaning and effect under 72-82 ℃ of high temperature are very tangible:

The 1st, annealing under the high temperature more than 72 ℃, the temperature head of sex change and annealing steps is significantly dwindled, and can be with PCR by sex change, annealing and extend that three steps were reduced to sex change and annealing extended for two steps, these improve the operational stability that obviously helps the PCR reaction and result's repeatability.

The 2nd, annealing temperature is high more, and primer and non-template order annealed possibility are just low more, helps reducing and overcome fully the formation of non-single-minded amplified production, makes PCR reaction specificity more guaranteed.

The 3rd, the optimum temperuture of Taq-DNA polysaccharase is usually between 72-78 ℃.Annealing and extension in this scope not only make the step simplification of PCR that speed of response is accelerated.The Taq archaeal dna polymerase is very heat-resisting, in annealing more than 78 ℃ and extension, still shows stronger reaction vigor, and has the characteristic that other help increasing.

The 4th, can be under high temperature more than 72 ℃ and the primer of template annealing, must have high melting temperature(Tm), less even be higher than the melting temperature(Tm) of amplified production with the gap of the melting temperature(Tm) of amplified production.

With people's glyceraldehyde-3-phosphate dehydrogenase gene is example, at the different zones amplified production that to get 9 length at random be 400 bases, the primer length of each product of increasing is respectively 20,30 and 40 bases, according to 9 primers of primer computed in software and amplified production the statistics of characteristic list in table 4.

The relation of table 4. primer length and primer and amplified production characteristic

Characteristic	20 bases	30 bases	40 bases
				On average the suitableeest annealing temperature (℃)	????57.6	????62.1	????64.6
On average the highest permission annealing temperature (℃)	????69.5	????72	????72
				The average melting temperature(Tm) of amplified production (1) (℃)	???????????????????????????89.2
Average positive primer melting temperature(Tm) (2a) (℃)	????70.9	????84.8	????91.9
				Average anti-primer melting temperature(Tm) (2b) (℃)	????69.0	????85.1	????93.9
(1)-(2a) or (1)-(2b) (℃)	????22.0	????7.6	????-1.5

The result shows that as primer length be 20 bases, 22 ℃ of the melting temperature(Tm) mean deviations of primer melting temperature(Tm) and amplified production, and when primer length was the 30-40 base, the melting temperature(Tm) of primer and amplified production melting temperature(Tm) were close even surpass the amplified production melting temperature(Tm).PCR proceeds to certain phase, when amplified production is accumulated to relative higher concentration, amplified production can be finished the annealing of self rapidly the process that is reduced to annealing temperature from denaturation temperature, thereby has suppressed the annealing of primer and template, pcr amplification efficient is reduced enter plateau.The melting temperature(Tm) of raising primer can reduce or eliminate the time difference between primer and template annealing and the amplified production self-annealing, thereby postpones the appearance of PCR flat slope, helps the realization of quantitative PCR.

The 5th, the primer that can under high annealing temperature, increase, not only the bonding strength of primer and template improves greatly, and simultaneously, the false coupling of analysis revealed primer and template but decreases on the contrary, and this has very big positive effect to specificity and the efficient that improves PCR.

With total length nearly 10, people's immune deficiency virus (HIV) gene of 000 base is an example, each 10 of the length 20,30 that picked at random 3 ' end position is identical and the primers of 40 bases, with the single-minded bonding strength and the false coupling intensity of Oligo analysis primer and template, statistics is shown in table 5.

The single-minded bonding strength of table 5. primer and template and false coupling strength analysis

Characteristic	Primer length	20 bases	30 bases	40 bases
					The primer melting temperature(Tm) (℃)	Schwellenwert	????52.3	????71.5	????80.7
Maximum	????68.6	????81.9	????89.2
				Mean value		????58.4	????75.5	????84.6
Standard error	????5.4	????3.2	????3.1
				The single-minded bonding strength of primer and template (point)		Schwellenwert	????321	????408	????462
Maximum	????460	????521	????568
					Mean value	????377	????464	????511
Standard error	????40	????35	????33
					The false bonding strength sums of three maximums of primer and template normal chain (point)	Schwellenwert	????278	????147	????169
Maximum	????769	????566	????645
				Mean value		????413	????336	????310
Standard error	????164	????116	????158

The false bonding strength sums of three maximums of primer and template anti-chain (point)	Schwellenwert	????215	????188	????183
					Maximum	????552	????466	????456
	Mean value	????370	????323	????306
					Standard error	????104	????93	????82

Table 5 shows, the average melting temperature(Tm) of the primer of 40 bases is up to 85 ℃, can be in annealing more than 72 ℃, and than high about 26 ℃ of the average melting temperature(Tm) of 20 base long primers.Then high more than 130 with template bonded average intensity than 20 base primerses, and false combination is low on the contrary more than 20%.

The 6th, under high temperature more than 72 ℃, anneal in the time of can suitably reducing design of primers to primer hairpin structure characteristic and positive anti-primer self and the mutual 3 ' restriction of holding complementary binding characteristic.The annealing temperature of Standard PC R is between 45-65 ℃, usually hairpin structure and the positive anti-primer self to primer has certain restriction with 3 ' mutual complementary structure when design of primers, because the primer of serious relatively hairpin structure and 3 ' end base complementrity is arranged, just fully linearizing and in this temperature range than being easier to form primer dimer.The hairpin structure of primer is nearly all untied under high temperature more than 72 ℃, and primer dimer also almost has no chance to form.

The 7th, under high annealing temperature, primer hairpin structure and dimer are difficult for forming, and have just created the machine of carving for the concentration that increases primer in the reaction system, and high density primer helps strengthening primer and template annealing to the competition of amplified production self-annealing, makes flat slope occur postponing.

The 8th, the long primer of the primer with high melting temperature(Tm), particularly high melting temperature(Tm) still can be about 72 ℃ have the target sequences of 1-3 mispairing to anneal with non-3 ' end and finish amplification, thereby has both kept the specificity that increases, has reduced the false negative of clinical detection again.

The 9th, the primer with high melting temperature(Tm) can still be finished single-minded amplification under high annealing temperature about 72 ℃ in the reaction solution that contains 10-20% glycerine, help the establishment of premix reagent.This characteristic also helps introducing other denaturing agents and PCR reaction promotor in reaction solution, and keeps the specificity of amplification.

Embodiment

The template DNA behaviour total tissue RNA of PCR in the embodiments of the invention is a primer with Poly (dT), presses the synthetic cDNA of operation institute of the reverse transcription test kit recommendation of Clontech company.The Advantage-2 of Clomech company test kit is all adopted in the PCR reaction.PCR reaction solution (25 μ L meter) composition is as shown in table 6.PCR sex change condition first be 95.5 ℃ 1 minute, circulation sex change condition be 95.5 ℃ 30 seconds.The PGR amplification detects with electrophoresis method to be differentiated.

Table 6.25 μ L PCR reaction solution component and content

Component	Dosage (μ L)	Ultimate density
			10 * PCR reaction buffer	????2.5	?40mM?Tricine-KOH?pH8.7，15mM?KOAc
10mM?dNTPs	????0.5	?0.2mM
			The 35mM magnesium ion	????2.5	?3.5mM
50 * Taq archaeal dna polymerase	????0.5	1 * Taq archaeal dna polymerase
			The positive primer of 10 μ M	????2.5	?1μM
10 μ M anti-primers	????2.5	?1μM
			H 2O	????9
cDNA	????5	?2.5μL/25μL

Embodiment 1.

Design of primers and the reaction result of superelevation annealing temperature PCR.

With people actomyosin gene order is target sequence, and design length is that high rigorous primer about 15,20,30,40 and 50 bases is to (table 7 and 8).

Table 7. embodiment 1 primer order

Title	Position in gene	Product length	(5 ' to 3 ') in proper order
				? ?A1 ?	? ?40-202 ?	? ??163 ?	????????????GAT?CCG?CCG?CCC?GTC ? ????????????CGC?CCT?GGT?GCC?TGG
? ?A2 ?	? ?55-218 ?	? ??164 ?	????????CAC?ACC?CGC?CGC?CAG?CTC?ACC ? ????????CCC?ATG?CCC?ACC?ATC?ACG?CCC
				? ?A3 ?	? ?409-634 ?	? ??226 ?	??CCC?AAG?GCC?AAC?CGC?GAG?AAG?ATG?ACC?CAG ? ????CAG?TCA?GGT?CCC?GGC?CAG?CCA?GGT?CCA
? ? ?A4 ? ?	? ? ?1056-1182 ? ?	? ? ??127 ? ?	?CAA?GAT?CAT?TGC?TCC?TCC?TGA?GCG?CAA?GTA?CTC ???????????????CGT?GTG?GAT?CG ? ???GAT?GGA?GGG?GCC?GGA?CTC?GTC?ATA?CTC?CTG ?????????????????CTT?GCT?G
				? ? ?A5 ?? ? ?	? ? ?904-1375 ? ?	? ? ??472 ?? ?	?ACT?ACC?TTC?AAC?TCC?ATC?ATG?AAG?TGT?GAC?GTG ????????????GAC?ATC?CGC?AAA?GAC?CT ? ?GAC?TGC?TGT?CAC?CTT?CAC?CGT?TCC?AGT?TTT?TAA ????????????ATC?CTG?AGT?CAA?GCC?AA

The characteristic of table 8. embodiment 1 primer

Title	Length	Melting temperature(Tm) (℃)	Bonding strength			3 ' complementary characteristic		Hairpin structure
											Combine with template is complementary	With the maximum mispairing of normal chain	With the maximum mispairing of minus strand	Self	With another primer	The bright base number of hair clip	Energy kilocalorie/mol	The hair clip melting temperature(Tm)
			? ?A1 ?	?15 ? ?15	?73.7 ? ?72.4	?504 ? ?478	?123 ? ?170	?160 ? ?141	?2 ? ?2	?＜2 ? ?2									?＜2 ? ?＜2
? ?A2 ?	?21 ? ?21	?84.8 ? ?84.2									?563 ? ?563	?70 ?85	?132 ?97	?2 ?＜2	?＜2 ?＜2	?＜2 ?3	??1.0	??0
			?A3	?30 ?27	?89.4 ?89.7	?619 ?603	?120 ?80	?68 ?132	?＜2 ?＜2	?＜2 ?2									?＜2 ?＜2
?A4	?44 ?37	?92.9 ?92.0									?629 ?629	?97 ?74	?85 ?93	?2 ?2	?2 ?2	?4 ?3	??-2.4 ??-0.4	??64 ??34
			?A5	?50 ?50	?92.0 ?91.2	?615 ?570	?67 ?142	?49 ?118	?2 ?2	?2 ?2									?5 ?3	??-2.8 ??0.8	??64 ??3

The annealing region of embodiment 1 test is 30 seconds 72-80 ℃ of residence time, extend step be 80 ℃ 60 seconds, totally 25 circulations.The results are shown in Table 10.

The PCR reaction electrophoresis result of table 9. embodiment 1

Primer	Annealing temperature (℃)
										??72.0	???73.3	???74.3	???75.5	???76.9	???78	????78.8	????79.5	????80
	????A1	????+	????-	????-	????-	????-	????-	????-	????-										????-
????A2										????+	????+	????+	????+	????+	????-	????-	????-	????-
	????A3	????+	????+	????+	????+	????+	????+	????+	????-										????-
????A4										????+	????+	????+	????+	????+	????+	????+	????+	????+
	????A5	????+	????+	????+	????+	????+	????+	????+	????+										????+

+ expression positive findings;-expression negative findings

Embodiment 2.

Carry out two-step approach PCR.

Embodiment 2 the primers are identical with embodiment 1 with reaction conditions, but annealing is identical with elongating temperature.Primer is to A1 annealing and extend to 72 ℃ of 60 second, and primer is to A2 annealing and extend to 76 ℃ of 60 second, and primer is to A3 annealing and extend to 78 ℃ of 60 second, and primer is to A4 and A5 annealing and extend to 80 ℃ of 60 second.A1-A5 all detects and the consistent electrophoretic band of target amplification product length behind PCR and electrophoresis primer as a result.

Embodiment 3.

Utilize the superelevation annealing temperature to get rid of non-specificity product.

From people's glyceraldehyde-3-phosphate dehydrogenase gene, select two pairs of primers, 3 ' zone identical (underscore is represented) of two pairs of primers.Lastly primer is about 20 bases claims the standard long primer, a pair of primer in back claims 40 base long primers, and the order of primer and characteristic are listed in table 10 and 11.

Table 10. embodiment 3 primers order

Primer	Length	Primer location	Primer order (5 ' to 3 ')
				Positive primer	????19	????573-591	????????CAA?CTT?TGG?TAT?CGT?GGA?A
????39	????553-591	??CTG?GCC?AAG?GTC?ATC?CAT?GAC?AAC?TTT?GGT ???????????????ATC?GTG?GAA
			Anti-primer		????17	????904-920	??????????ACC?ACC?TGG?TGC?TCA?GT
????37	????904-940	????CGC?TGT?TGA?AGT?CAG?AGG?AGA?CCA?CCT ??????????????GGT?GCT?CAG?T

Table 11. embodiment 3 primer characteristics

Project	The long long primer of standard		40 base long primers
					Forward	Oppositely	Forward	Oppositely
	PCR product length	???????348		?????????388
Primer Tm under the PCR condition (℃)						??63.0	??63.2	??89.1	??88.9
	Primer and PCR product Tm poor (℃)	??27.2	??27.0	??1.1	??1.3
With the target bonding strength						??383	??353	??569	??525

The reaction conditions of embodiment 3 is identical with embodiment 1, and standard long primer test annealing region is 52-68 ℃, and elongating temperature is 72 ℃.40 base long primers test annealing region is 60-80 ℃, and elongating temperature is 80 ℃.Test-results is listed in table 12.

Table 12. embodiment 3 test-results

The long long primer of standard			40 base long primers
						Annealing temperature (℃)	The target amplification product	Non-single-minded amplified production	Annealing temperature (℃)	The target amplification product	Non-single-minded amplified production
????52.0	????+	????+	????60.0	????+	????+
						????54.6	????+	????+	????62.9	????+	????+
????56.5	????+	????+	????65.0	????+	????+
						????58.8	????+	????+	????67.7	????+	????+
????61.5	????+	????+	????70.7	????+	????-
						????63.8	????-	????-	????73.2	????+	????-
????65.5	????-	????-	????75.2	????+	????-
						????66.8	????-	????-	????76.6	????+	????-
????68.0	????-	????-	????78.0	????+	????-

+ expression positive findings;-expression negative findings

The result shows that the standard long primer can finish amplification under 52-62 ℃ of annealing temperature, but all follows non-single-minded amplified production.40 base long primers can be finished amplification under 60-78 ℃ of annealing temperature.Non-single-minded amplified production disappears when annealing temperature is higher than 70 ℃.

Embodiment 4.

Utilize the superelevation annealing temperature to reduce primer hair clip and dimer formation.

Various primer-design softwares are all held the leading indicator of base complementrity as the primer preciseness with weak hairpin structure and low 3 ', the hair clip melting temperature(Tm) of the preciseness primer that searches with primer-design software is all lower, 3 ' end complementary base radix is usually also less than 3, under using the heat start PCR situation and in the annealing region of Standard PC R, it is in fact also not serious that hair clip and dimer form problem.But high annealing temperature can make those have strong hairpin structure still can not be untied its hair clip under the standard annealing temperature the abundant linearizing of primer.

Embodiment 4 usefulness molecular beacon test analysis the characteristic of unwinding of hair clip.Molecular beacon is GCGAGAAGATAAGACCCTATGCTCGC in proper order, and hair clip is bright to contain 5 pairs of bases, and the hair clip melting temperature(Tm) is 67 ℃.Test shows have the molecular beacon of half to be the hair clip state approximately in the time of 55 ℃, and in almost whole linearizings of time more than 72 ℃.

Embodiment 5.

Utilize the superelevation annealing temperature to get rid of false negative.

Under the situation that the equal amts base mismatch is arranged, the approximate decrease of temperature of unwinding of primer is relevant with the length of primer.Following table is from 18 to 50 base long primers with the OIigo computed in software, the approximate decrease of temperature (table 13) of unwinding that each base mismatch causes.

The approximate decrease of temperature of unwinding that each base mismatch of table 13. causes

Primer length	??18	??20	??25	??30	??35	??40	??45	??50
									Approximate melting temperature(Tm) decline (℃)	??6.7	??6	??4.8	??4	??3.5	??3	??2.7	??2.4

The preferred primer length of superelevation annealing temperature PCR is about 40 bases, is about a times of Standard PC R the primer.According to the statistics that is shown in table 3, the average melting temperature(Tm) of 20 base long primers is 62 ℃, and 40 base long primers are 89 ℃.Suppose that primer and certain target gene mutation have the mispairing of three bases, the approximate melting temperature(Tm) of 20 base long primers and mutation template is 44 ℃, is difficult to finish amplification under the annealing temperature of routine, can cause false negative to occur when detecting this mutation.40 base long primers are about 80 ℃ with the approximate melting temperature(Tm) of same mutation template, still can finish amplification under quite high annealing temperature single-mindedly, thereby reduce or eliminate false negative.

Embodiment 5 does the displacement (representing with black matrix) of A and T or C and G with the 4th and 10 bit bases of positive and negative standard long primer shown in the table 10 and positive and negative 40 base long primers, and the order of " sudden change " primer through transforming is listed in table 14.

Table 14. embodiment 5 primers order

Primer	Length	Primer location	Primer order (5 ' to 3 ')
				Positive primer	????19	????573-591	?????????CAA?CTT?TGG?TAT?CGT?GGA?A
????39	????553-591	??CTG?GCC?AAG?GTC?ATC?CAT?GAC?AAC?TTT?GGT ???????????????ATC?GTG?GAA
			Anti-primer		????17	????904-920	??????????ACC?ACC?TGG?TGC?TCA?GT
????37	????904-940	?CGC?TGT?TGA?AGT?CAG?AGG?AGA?CCA?CCT?GGT ????????????????GCT?CAG?T

Calculate " wild " primer that is shown in table 10 and the approximate melting temperature(Tm) and the bonding strength that are shown in " sudden change " primer and the target gene of table 14 with primer-design software Oligo, the results are shown in table 15.

The characteristic of table 15. " wild " and " sudden change " primer

Primer	Project	The standard long primer		40 base long primers
						Positive primer	Anti-primer	Positive primer	Anti-primer
		" wild " primer primer	Approximate melting temperature(Tm)	????58.4	????56.4					????91.1	????90.1
With the target bonding strength	????383					????353	????569	????525
			" sudden change " primer	Approximate melting temperature(Tm)	????45.8				????42.3	????86.2	????83.6
With the target bonding strength	????235	????207				????337	????313

Embodiment 5 has tested the amplification ability of " sudden change " primer, and test conditions is identical with embodiment 3, and long " sudden change " primer annealing test temperature of standard scope is 45-55 ℃, and the result does not all obtain the target amplification band.Long " sudden change " primer annealing test temperature of 40 bases scope is 55-70 ℃, and the result all obtains the target amplification product.

Claims (10)

1. the polymerase chain reaction method of a superelevation annealing temperature in turn includes the following steps:

(1) template sex change;

(2) primer and template annealing;

(3) synthetic complementary dna chain is extended in archaeal dna polymerase catalysis down;

(4) set by step (1)-(3) circulation carrying out amplified reaction;

It is characterized in that primer and template annealing temperature are 72-82 ℃.

2. polymerase chain reaction method according to claim 1 is characterized in that primer length is the 15-50 base.

3. polymerase chain reaction method according to claim 1 is characterized in that primer length is the 30-45 base.

4. according to claim 1,2 or 3 described polymerase chain reaction methods, it is characterized in that annealing temperature is identical with elongating temperature in the amplified reaction.

5. according to claim 1,2 or 3 described polymerase chain reaction methods, it is characterized in that the melting temperature(Tm) of positive anti-primer is 72-96 ℃, preferred 84-92 ℃.

6. the application of the described superelevation annealing temperature of claim 1 polymerase chain reaction method in getting rid of non-specificity amplified production is characterized in that primer and template annealing temperature are 72-82 ℃.

7. the application of polymerase chain reaction method according to claim 6 is characterized in that the amplified production and the difference of the melting temperature(Tm) of positive anti-primer are 22--5 ℃.

8. the application of the described polymerase chain reaction method of claim 1 in getting rid of primer dimer, the temperature that it is characterized in that primer and template annealing is 72-82 ℃.

9. the application of the described superelevation annealing temperature of claim 1 polymerase chain reaction method in getting rid of false negative result is characterized in that it is 72-82 ℃ that primary template and primer have the mispairing of 0-5 base and primer and template annealing temperature.

10. the application of polymerase chain reaction method according to claim 9 in getting rid of false negative result is characterized in that it is 72-82 ℃ that primary template and primer have the mispairing of 1-3 base and primer and template annealing temperature.