CN112266950A

CN112266950A - Probe primer combination and detection kit thereof

Info

Publication number: CN112266950A
Application number: CN202011149535.7A
Authority: CN
Inventors: 翟建新; 刘春森; 丁宁; 张利
Original assignee: Shenzhen Aodong Inspection & Testing Technology Co ltd
Current assignee: Shenzhen Aodong Inspection & Testing Technology Co ltd
Priority date: 2020-10-23
Filing date: 2020-10-23
Publication date: 2021-01-26

Abstract

The invention provides a probe primer combination and a detection kit thereof, wherein the probe primer combination comprises a probe oligonucleotide capable of hybridizing with a target nucleotide sequence, a first primer oligonucleotide and a second primer oligonucleotide for amplifying a nucleic acid region containing the target nucleotide sequence, the probe oligonucleotide is connected with a first labeling molecule, the first primer oligonucleotide or the second primer oligonucleotide is connected with a second labeling molecule, the probe oligonucleotide is complementary to one single strand of the target nucleotide sequence, the primer oligonucleotide connected with the second labeling molecule is complementary to the other single strand of the target nucleotide sequence, the first labeling molecule and the second labeling molecule provide different detectable signals, and fluorescence energy resonance transfer occurs when the first labeling molecule and the second labeling molecule are close to each other. The single-labeled probe designed by the invention can not generate non-specific fluorescent signals due to conformational change, and has lower background.

Description

Probe primer combination and detection kit thereof

Technical Field

The invention relates to the technical field of nucleic acid detection, in particular to a probe primer combination and a detection kit thereof.

Background

Real-time fluorescent PCR technology has been widely used to detect and quantify target nucleic acid sequences. The most commonly used today is the TaqMan probe technique. In many fields where fluorescent PCR methods are applied, DNA genotyping detection is an important field that is currently developing faster. Genotyping assays include genotyping polymorphisms and rare mutation assays, such as genetic mutation assays in pathological specimens, genetic mutation assays in genetically related diseases, and viral genotyping assays, among others. The current fluorescent PCR technology applied to genotyping detection mainly comprises the following steps: 1. and (4) carrying out typing detection on the fluorescent probe. The method designs different fluorescent labeling probes, such as TaqMan probes, molecular beacons and the like, aiming at different genotypes. 2. Melting curve analysis method. Such methods distinguish between different genotypes by differences in the hybridization temperature of the probe to the amplification product. Such as proximity hybridization probes, and melting curve analysis methods based on dual-labeled TaqMan probes or molecular beacons.

However, these methods have certain limitations. The melting curve analysis method of the TaqMan probe or the molecular beacon is widely applied, and the signal difference of the TaqMan probe in a hybridization state and a free state is small, particularly when the length of the probe is long, the signal difference is small, and the TaqMan probe is difficult to distinguish from a background signal. Both specificity and sensitivity are problematic. The proximity hybridization probe requires two probes to hybridize with the amplification product, and the design requirement on the probe is high, thereby limiting the application range of the method. In recent years, a single-labeled probe (U.S. Pat. No.6635427) has been developed, which uses guanylic acid base on a complementary strand to quench a fluorescent group on the probe, has a weak hybridization signal and is difficult to distinguish from a background signal, and has a certain requirement on the design of a probe sequence and limited application. In the prior art, the primer is of a stem-loop structure, the structure is complex, and the design difficulty is high.

The existing real-time fluorescence PCR method uses a bimolecular hybridization technology, including intramolecular hybridization similar to a scorpion-shaped probe and intermolecular hybridization of the probe and an amplification product, and has complex hybrid structure and larger design difficulty. For example, when there is a mismatch between two hybridization, the determination of the detection result is interfered, and even a false negative result is caused. In addition, the existing method involves two times of intramolecular and intermolecular hybridization, the Tm value of the intramolecular hybridization (ring structure) of the amplification product must be much larger than that of the hybridization of the probe and the amplification product, otherwise, the fluorescent group marked on the probe cannot be effectively quenched in the dissolution curve analysis procedure. This also imposes certain limitations on the application of the method.

Disclosure of Invention

The invention provides a probe primer combination and a detection kit thereof.

According to a first aspect, in one embodiment there is provided a probe-primer combination comprising a probe oligonucleotide hybridizable to a target nucleotide sequence, a first primer oligonucleotide for amplifying a region of nucleic acid comprising the target nucleotide sequence, a second primer oligonucleotide and a first label molecule attached to the probe oligonucleotide, wherein the first primer oligonucleotide or the second primer oligonucleotide is attached to a second label molecule, wherein the probe oligonucleotide is complementary to one single strand of the target nucleotide sequence and the primer oligonucleotide attached to the second label molecule is complementary to the other single strand of the target nucleotide sequence, wherein the first label molecule and the second label molecule provide different detectable signals and wherein fluorescence resonance transfer occurs when the first label molecule and the second label molecule are in physical proximity.

In some embodiments, the first labeling molecule is attached to the 3' end of the probe oligonucleotide.

In some embodiments, the base to which the second marker molecule is attached is near the 3' end of the primer oligonucleotide to which the base is attached.

In some embodiments, the base to which the second marker molecule is attached is within 8 bases of the 3 'end of the primer oligonucleotide to which it is attached, and the base to which the second marker molecule is attached is as close as possible to the 3' end of the primer oligonucleotide to which it is attached.

In some embodiments, the base to which the second marker molecule is attached is any one of A, T, C, G bases.

In some embodiments, the probe oligonucleotide has a sequence length of up to 40nt, and may also be 15-30 nt.

In some embodiments, the probe oligonucleotide has a Tm of 55 ℃ to 90 ℃ and can also range from 60 ℃ to 80 ℃.

In some embodiments, the sequence length of the first primer oligonucleotide and the second primer oligonucleotide is within 30nt, and can be 20-25 nt.

In some embodiments, the target nucleotide sequence is at least one of a single-stranded nucleotide, a double-stranded nucleotide.

In some embodiments, the target nucleotide sequence is at least one of a DNA sequence, an RNA sequence.

In some embodiments, when the target nucleotide sequence is a single-stranded nucleotide, the primer oligonucleotide to which the second marker molecule is attached is complementary to a complementary sequence of the target nucleotide sequence.

In some embodiments, the first marker molecule is a fluorescent reporter and the second marker molecule is a fluorescent quencher, or the first marker molecule is a fluorescent quencher and the second marker molecule is a fluorescent reporter.

In some embodiments, the 3' end of the hybridization position of the probe oligonucleotide is proximal to the second labeling molecule.

In some embodiments, the fluorescent reporter group is selected from at least one of FAM, HEX, VIC, ROX, Cy 5;

in some embodiments, the fluorescence quenching group is selected from at least one of BHQ1, BHQ 2.

According to a second aspect, an embodiment provides a test kit comprising a probe-primer combination as described in the first aspect.

In some embodiments, the test kit further comprises an asymmetric PCR reaction system.

In some embodiments, the asymmetric PCR reaction system is selected from any one of a PCR system, a reverse transcription PCR system. The PCR system is mainly used for amplifying DNA target sequences, and the reverse transcription PCR system is mainly used for reverse transcription and amplification of RNA target sequences.

In some embodiments, the PCR system contains at least one of PCR Master Mix, thermostable polymerase, dNTPs.

In some embodiments, the reverse transcription PCR system comprises at least one of RT-PCR Master, thermostable polymerase, reverse transcriptase, dNTPs.

In some embodiments, the thermostable polymerase is selected from one of Taq DNA polymerase, Tth DNA polymerase.

In some embodiments, the final molar concentration of the probe oligonucleotide in the asymmetric PCR reaction system is between 200nM and 800 nM.

In some embodiments, the molar final concentration of the primer oligonucleotide to which the second marker molecule is attached > the molar final concentration of the primer oligonucleotide to which the second marker molecule is not attached.

In some embodiments, the asymmetric PCR reaction system comprises a final molar concentration of the primer oligonucleotide to which the second labeling molecule is attached that is 5-20 times the final molar concentration of the primer oligonucleotide to which the second labeling molecule is not attached.

In some embodiments, the volume of the asymmetric PCR reaction system is 10-100. mu.L, and specifically can be 25. mu.L.

According to a third aspect, there is provided in one embodiment the use of a probe primer combination as described in the first aspect or a test kit as described in the second aspect in a genotyping test.

In some embodiments, the genotyping assays include, but are not limited to, Single Nucleotide Polymorphism (SNPs) site detection, viral genotyping, and the like.

According to a fourth aspect, there is provided in one embodiment the use of a probe-primer combination according to the first aspect or a detection kit according to the second aspect in asymmetric melt curve PCR detection.

In some embodiments, the reaction sequence of the asymmetric melt curve PCR detection method is as follows:

at 95 deg.C for 1-10 min; 45 (95 ℃, 5-10 s; 55 ℃, 30-60 s); at 95 ℃ for 1 min; at 55 deg.C for 1 min; fluorescence signals were collected continuously at 55-95 ℃.

In one embodiment, the fluorescent signal is generated by hybridization of a single fluorescently labeled probe (or a fluorescently quencher-labeled probe) to a fluorescence quencher (or a fluorescence reporter) -labeled oligonucleotide strand. The single-labeled probe designed by the invention can not generate non-specific fluorescent signals due to conformational change, and has lower background.

Drawings

FIG. 1 shows a reaction scheme of an embodiment of the present invention;

FIG. 2 is a diagram showing a reaction program setup interface of asymmetric PCR in example 1 of the present invention;

FIG. 3 is a graph showing the melting profile of a single-labeled probe in example 1 of the present invention.

FIG. 4 is a graph showing the melting curves of the double-labeled probe of example 1 of the present invention.

FIG. 5 is a graph showing the results of detection of the homozygous MTHFR gene 677C of example 2 of the present invention, wherein the Tm value for hybridization with the probe is about 64 ℃.

FIG. 6 is a graph showing the results of detection of 677T homozygote of MTHFR gene in example 2 of the present invention, and the Tm value for hybridization of the probe is about 55 ℃.

FIG. 7 is a graph showing the results of detection of the 677C/T hybrid of MTHFR gene of example 2 of the present invention, wherein the Tm values of the hybridization probes are about 54.5 ℃ and 64.5 ℃.

FIG. 8 shows the results of rs13182883A/A homozygote assay, R1: the method of comparative patent CN 102321765A; r2: the method of example 3 of the present invention.

FIG. 9 shows the results of rs13182883G/G homozygote assay, R1: the method of comparative patent CN 102321765A; r2: the method of example 3 of the present invention.

FIG. 10 shows the results of the rs13182883A/G heterozygote assay, R1: the method of comparative patent CN 102321765A; r2: the method of example 3 of the present invention.

Detailed Description

The present invention will be described in further detail with reference to the following detailed description and accompanying drawings. Wherein like elements in different embodiments are numbered with like associated elements. In the following description, numerous details are set forth in order to provide a better understanding of the present application. However, those skilled in the art will readily recognize that some of the features may be omitted or replaced with other elements, materials, methods in different instances. In some instances, certain operations related to the present application have not been shown or described in detail in order to avoid obscuring the core of the present application from excessive description, and it is not necessary for those skilled in the art to describe these operations in detail, so that they may be fully understood from the description in the specification and the general knowledge in the art.

Furthermore, the features, operations, or characteristics described in the specification may be combined in any suitable manner to form various embodiments. Also, the various steps or actions in the method descriptions may be transposed or transposed in order, as will be apparent to one of ordinary skill in the art. Thus, the various sequences in the specification and drawings are for the purpose of describing certain embodiments only and are not intended to imply a required sequence unless otherwise indicated where such sequence must be followed.

Definition of

The terms and phrases used herein have their art-recognized meanings and may be found by reference to standard texts and journals known to those skilled in the art. The following definitions are provided to illustrate their particular use in the context of the present invention.

The ordinal numbers used herein to describe a technical feature, such as "first", "second", etc., are used solely to distinguish between the objects described and do not have any sequential or technical meaning.

The term "complementary" refers to the specific (hybridization) interaction of a sufficient number of matched base pairs in an oligonucleotide sequence with a target nucleic acid sequence that is amplified or detected. In the art, specificity and sensitivity of hybridization require a very high degree of complementarity, although it need not be 100%.

The term "denaturation" refers to the stretching and separation of complementary DNA strands and may be accomplished by heat or denaturant treatment.

The term "DNA" refers to deoxyribonucleotides (adenine, guanine, thymine, or cytosine) polymerized in a single-stranded or double-stranded state, and includes linear or circular DNA molecules. In discussing DNA molecules, the sequence can only be described by the convention of giving the sequence in the 5 'to 3' direction.

The terms "DNA amplification" and "amplification" refer to any method of increasing the replication of a particular DNA sequence by enzymatic amplification. A commonly used process is the Polymerase Chain Reaction (PCR). PCR involves the use of a thermostable DNA polymerase, primers and heating cycles, which enable the separation of DNA strands and the exponential amplification of a gene region of interest. Any type of PCR may be used, such as quantitative PCR, RT-PCR, hot start PCR, LAPCR, multiplex PCR, touchdown PCR, etc. Advantageously, real-time PCR may be used. The extension product of the chain reaction will be a discontinuous nucleic acid duplex containing terminals corresponding to the ends of the primers used.

The term "enzymatic amplification" or "amplification" refers to DNA amplification. The most commonly used method at present is the Polymerase Chain Reaction (PCR). Other amplification methods include LCR (ligase chain reaction), Strand Displacement Amplification (SDA); q β replicase amplification (Q β RA); self sustained replication (3 SR); and NASBA (nucleic acid sequence based amplification), which can be performed in RNA and DNA.

The term "fluorescent reporter group" refers to any reporter group whose presence can be detected by its luminescent properties.

The term "fluorescence quencher" or "quencher" refers to a molecule that interferes with or absorbs fluorescence emitted by a nearby fluorophore. Typical quenchers include, but are not limited to, DABSYL or Black hole quencher. The quencher can also be TAMRA (carboxytetramethylrhodamine), which emits at different wavelengths.

The term "hybridization" refers to the process of joining two nucleic acid strands to form antiparallel double strands through stable hydrogen bonding between the opposing strands. The terms "hybridize" and "bind" are used interchangeably and refer to the formation of complementary A-T and C-G base pairs between the nucleotide sequences of two polynucleotide fragments. The hybrid strand is referred to as a "duplex".

The term "melting temperature" (Tm) refers to the temperature at which the hybridizing duplex dehybrids and returns to their single stranded state. Likewise, hybridization does not occur at a temperature between the two strands that is higher than the melting temperature of the resulting duplex.

The term "nucleotide" refers to a subunit of a nucleic acid (whether DNA or RNA or an analog thereof) which may include, but is not limited to, phosphate groups, sugar groups, nitrogen-containing groups, and analogs of these subunits. The terms "nucleotide" and "nucleoside" include groups that contain not only naturally occurring purine and pyrimidine bases, such as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U), but also modifications or mimetics of the bases known to those skilled in the art.

The term "oligonucleotide" refers to a series of linked nucleotide residues comprising a sufficient number of nucleotide bases used in a PCR reaction. Short oligonucleotide sequences may be based on or designed from genomic or cDNA sequences and used to amplify, determine, or otherwise reveal the presence of identical, similar, or complementary DNA or RNA in a particular cell or tissue. Oligonucleotides can be chemically synthesized and can be used as primers or probes. The terms "oligonucleotide" and "polynucleotide" as used herein may also refer to RNA or DNA, modified or unmodified.

The term "polymerase chain reaction" or "PCR" as used herein refers to a thermocycling, polymerase-mediated DNA amplification reaction that uses a template molecule, an oligonucleotide primer, that is complementary to a template molecule, a thermostable DNA polymerase, and deoxyribonucleotides. Furthermore, it involves three repetitive processes (denaturation, hybridization and primer extension) which are performed at different temperatures and steps. In many embodiments, the hybridization and extension processes can be performed simultaneously. Other methods of amplification include, but are not limited to, NASBR, SDA, 3SR, TSA, and rolling circle replication.

The term "polymerase" refers to an enzyme that catalyzes the catalytic formation of a polymer chain from successively added monomer units. In an advantageous embodiment of the invention, a "polymerase" will function by adding monomer units whose properties are determined by the complementary template of a particular sequence. DNA polymerases such as DNA polymerase 1 and Taq polymerase add deoxyribonucleotides to the 3' end of a polynucleotide strand in a template-dependent manner, thereby synthesizing a complementary nucleic acid. The polymerase may extend the primer once or the use of two primers may amplify two complementary strands repeatedly.

The term "primer" refers to an oligonucleotide that is complementary to a DNA fragment that is amplified or replicated. Primers are commonly used for PCR. One primer hybridizes (or "anneals") to the template DNA and is used by the polymerase as the origin of the replication/amplification process. By "complementary" is meant that the primer sequence can form a stable hydrogen-bonded complex with the template.

The primers are selected to be "substantially" complementary to different strands of the target DNA sequence, but they do not necessarily reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment can be ligated to the 5' end of a primer, the remainder of the primer being complementary to the strand. Alternatively, non-complementary bases may be inserted into the primer, provided that there is sufficient complementarity to hybridize with the target and prime the extension product.

The term "probe" refers to an oligonucleotide of nucleic acid sequence of variable length, suitable for hybridization detection of identical, similar or complementary nucleic acid sequences. The oligonucleotide sequences used as detection probes may be labeled with a detectable group. Various labeling groups are known in the art, such as radioactive, fluorescent, chemiluminescent or electrochemiluminescent compounds.

The terms "quenching" or "quenched" or "quenching" or "quenched" refer to reducing the signal produced by a molecule. It includes, but is not limited to, reducing the generated signal to zero or below the detection limit. Thus, a given molecule may be "quenched" by another molecule, producing a detectable signal despite the signal being greatly reduced.

The term "quantitative PCR" refers to the real-time polymerase chain reaction, also known as the quantitative real-time polymerase chain reaction (Q-PCR/qPCR/qrt-PCR) that is used for amplification and simultaneous targeted detection of the amount of a target DNA molecule. The amount can be expressed as a large number of copies or normalized to the relative amount of input DNA. Detection does not occur in real time with a reaction as in standard PCR, where the reaction product is detected at its endpoint. Two common methods for detecting products in real-time PCR are: (1) a non-specific fluorescent dye inserted into any double-stranded DNA, and (2) a sequence-specific oligonucleotide labeled with a fluorescent acceptor and permissive detection after hybridization to a complementary DNA target.

The terms "target" and "target nucleotide sequence" refer to the oligonucleotide that is desired to be detected. The target analyte for use in the disclosed methods may be a separate oligonucleotide, either immobilized on a support or in free solution. For the purposes of the method applied to the invention, a "target" can mean any nucleic acid from plants, animals or human individuals, bacteria, viruses or unicellular eukaryotes, or from the whole organism, its tissues, or from cultured cells or cells.

The term "template" refers to a strand of a target polynucleotide, such as, but not limited to, an unmodified naturally occurring DNA strand, wherein a polymerase serves to identify which nucleotides should be next incorporated into an growing strand to polymerize the complementary strand of the naturally occurring strand. The template may be single-stranded or double-stranded. In applications of the invention requiring repeated cycles of polymerization, for example, Polymerase Chain Reaction (PCR), the template strand itself may be modified by incorporation of modified nucleotides, but still serve as a template for the polymerase to synthesize additional polynucleotides.

The term "thermocycling reaction" refers to a multi-step reaction in which at least two steps are achieved by varying the reaction temperature.

The term "thermostable polymerase" refers to a DNA or RNA polymerase that can withstand extremely high temperatures, e.g., approaching 100 ℃. Examples of thermostable polymerases include Taq, Tth, Pfu, Vent, and deep Vent.

Herein, the term "first primer oligonucleotide" may also be referred to as an upstream primer and the term "second primer oligonucleotide" may also be referred to as a downstream primer.

Herein, a single labeled probe refers to a probe to which only one labeled molecule is attached.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of molecular biology. Methods similar or equivalent to those described herein can be used in the practice of the present invention, and suitable methods and materials are described herein.

Abbreviations

SNPs (Single Nucleotide polymorphisms), single Nucleotide polymorphisms.

The existing probe melting curve method utilizes the conformation change of a double-labeled probe in a free state and a hybridization state to generate the difference (namely detection signal) on the fluorescence signal, and the difference of the fluorescence signal is weak. The conformational change of the probe has a great relationship with the nucleotide sequence, and therefore, in order to obtain a better detection effect, the probe sequence needs to be improved, which increases the design difficulty of the probe to a certain extent. Moreover, the probe itself is prone to produce non-specific fluorescent signals, resulting in false positive results. The signal-to-noise ratio is also relatively low.

In some embodiments, the technical problem mainly solved by the present invention is how to improve the signal difference of the probe for nucleic acid detection, so that the positive detection signal and the background signal are easily distinguished, and the design difficulty of the probe and the primer is significantly reduced.

In a first aspect, in one embodiment, there is provided a probe-primer combination comprising a probe oligonucleotide hybridizable to a target nucleotide sequence, a first primer oligonucleotide for amplifying a region of nucleic acid comprising the target nucleotide sequence, a second primer oligonucleotide, said probe oligonucleotide having attached thereto a first label molecule, said first primer oligonucleotide or said second primer oligonucleotide having attached thereto a second label molecule, said probe oligonucleotide being complementary to one single strand of said target nucleotide sequence, said primer oligonucleotide having attached thereto said second label molecule being complementary to the other single strand of said target nucleotide sequence, said first label molecule and said second label molecule providing different detectable signals, said first label molecule and said second label molecule undergoing fluorescence resonance transfer when in physical proximity. The signal difference of the probe for nucleic acid detection is obviously improved, so that a positive detection signal and a background signal are easily distinguished, and the design difficulty of the probe and a primer is obviously reduced.

In some embodiments, the first labeling molecule may be attached to the 3 'end or the 5' end of the probe oligonucleotide.

In a preferred embodiment, the first labeling molecule is attached to the 3' end of the probe oligonucleotide.

In some embodiments, the base to which the second marker molecule is attached is near the 3 'end or the 5' end of the primer oligonucleotide to which the base is attached.

In a preferred embodiment, the base to which the second marker molecule is attached is near the 3' end of the primer oligonucleotide to which it is attached.

In some embodiments, the base to which the second labeling molecule is attached is within 8 bases (including the number of bases) from the 3' end of the primer oligonucleotide to which it is attached, and specifically may be within 8 bases, within 7 bases, within 6 bases, within 5 bases, within 4 bases, within 3 bases, within 2 bases, within 1 base, and the like.

In some embodiments, the first primer oligonucleotide is complementary to one single strand of the target nucleotide sequence and the second primer oligonucleotide is complementary to the other single strand of the target nucleotide sequence.

In some embodiments, the base to which the second marker molecule is attached is any one of A, T, C, G bases. For the method of the invention, the modified bases have no significant difference, but dT modified quenching groups are more used in synthesis and are possibly related to the difficulty of synthesizing raw materials. Even if the 3' end sequence of the primer has no T, the primer can be introduced in a replacement mode, and the effect on the result is not large.

In some embodiments, the base to which the second marker molecule is attached is a T base.

When the target sequence exists, the probe oligonucleotide marked with the first marker molecule is hybridized with a DNA single strand marked with the second marker molecule obtained by target nucleotide asymmetric PCR amplification, and the first marker molecule and the second marker molecule are physically close to each other and interact with each other to generate fluorescence energy resonance transfer, specifically fluorescence quenching. When the target sequence does not exist, the first marker molecule and the second marker molecule do not interact with each other, and further fluorescence quenching does not occur.

In some embodiments, the invention generates a fluorescent signal by hybridizing a singly labeled probe to a single strand of DNA labeled with a fluorescence quencher or a fluorescence reporter. The single-labeled probe designed by the invention can not generate non-specific fluorescent signals due to conformational change, and has lower background. The change of a fluorescent signal generated by hybridization of the probe and the DNA single-stranded template is higher and more stable than that of the traditional method, and the characteristics ensure that the signal-to-noise ratio of the method is higher and the specificity is better. At the same time, the probe is easier to design.

In some embodiments, the probe primer combinations of the present invention can be used in a variety of genotyping assays, including but not limited to Single Nucleotide Polymorphism (SNPs) assays, viral genotyping, and the like. Meanwhile, multiple melting curve analysis in different fluorescence channels can be realized by marking different fluorescent groups and quenching groups. The probe oligonucleotide sequence, the first primer oligonucleotide sequence and the second primer oligonucleotide sequence can be designed according to specific detection samples, and the probe and the primer have simple structures, do not have stem-loop structures and have small design difficulty.

In some embodiments, the probe oligonucleotide has a sequence length including, but not limited to, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 36nt, 37nt, 38nt, 39nt, 40nt, and the like.

In some embodiments, the probe oligonucleotide Tm values include, but are not limited to, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃, 67 ℃, 68 ℃, 69 ℃, 70 ℃, 71 ℃, 72 ℃, 73 ℃, 74 ℃, 75 ℃, 76 ℃, 77 ℃, 78 ℃, 79 ℃, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, 86 ℃, 87 ℃, 88 ℃, 89 ℃, 90 ℃ and the like.

The Tm value is also called a melting temperature (Tm), and refers to a temperature at which the absorbance of the nucleotide chain increases to half the maximum value.

In some embodiments, the sequence length of the first primer oligonucleotide and the second primer oligonucleotide includes, but is not limited to, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, and the like.

In some embodiments, the target nucleotide sequence detected by the present invention includes, but is not limited to, double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, and the like, which can be extracted from nature or synthesized by some biological means to be converted into the target nucleotide sequence for detection.

In some embodiments, double-stranded synthesis can be achieved in the reaction system for subsequent asymmetric PCR without additional synthesis of double strands, whether the target nucleotide sequence is single-stranded or double-stranded. Primer probes can also be designed with only a single-stranded sequence. If the target nucleotide sequence is single-stranded, the corresponding upstream and downstream primers can be designed based on the single-stranded and its complementary strand. After the designed primer is added into a reaction system, the double chains which can be used for asymmetric PCR are converged under the action of related enzyme.

In some embodiments, the target nucleotide sequence may be isolated from a material that is already found in nature or synthesized by artificial methods.

In some embodiments, the target nucleotide sequence includes, but is not limited to, a coronavirus.

Coronaviruses are nonsegmented, single-stranded, positive-stranded RNA viruses belonging to the family Coronaviridae (Coronaviridae) of the order nidoviridae (Nidovirales), the subfamily coronaviruses being divided into four genera, α, β, γ and δ, according to the serotype and genomic characteristics, and can infect many animal species, including humans, bats, dogs, pigs, mice, birds, cattle, whales, horses, goats, monkeys, etc. There are 6 known coronavirus types infecting human, including 229E and NL63 of the alpha genus, OC43 and HKU1 of the beta genus, middle east respiratory syndrome-associated coronavirus (MERSR-CoV), and Severe acute respiratory syndrome-associated coronavirus (SARSr-CoV). The presence of false positives in coronavirus tests will lead to serious false positives.

In some embodiments, the target nucleotide sequence is a coronavirus 229E-type nucleic acid.

It will be appreciated by those skilled in the art that the above target nucleotide sequences are merely exemplary and that the present invention is applicable to a variety of genotyping assays, such as Single Nucleotide Polymorphism (SNPs) site detection, viral genotyping, and the like.

In some embodiments, the probe oligonucleotide comprises the following nucleotide sequence:

5’-CCATTGGCCACAACACCTGCACTTCC-3’(SEQ ID NO：1)。

in some embodiments, the first primer oligonucleotide comprises the nucleotide sequence:

5’-CCCCAGAGACCT(Int BHQ1 dT)GACCACAA-3’(SEQ ID NO：2)。

in some embodiments, the second marker molecule is linked to SEQ ID NO: 2, at the T base near the 3' position in the sequence shown in the figure.

In some embodiments, the second marker molecule is BHQ 1.

In some embodiments, the second primer oligonucleotide comprises the nucleotide sequence:

5’-CACAAGCTCAGCAAATTGTGGATA-3’(SEQ ID NO：3)。

In some embodiments, the first labeling molecule is a fluorescent reporter and the second labeling molecule is a fluorescent quencher.

In some embodiments, the Fluorescence Resonance Energy Transfer (FRET) phenomenon involved in the present invention is any one of the following: 1. when the fluorescent group is close to the quenching group, the fluorescent group is intuitively shown that the fluorescent signal of the fluorescent group is quenched, and the signal is greatly reduced compared with the signal when the fluorescent group exists alone; 2. when two different fluorescent groups are close to each other and the emission spectrum of one group (donor) is overlapped with the excitation spectrum of the other group (acceptor) to a certain extent, when the donor is excited, the acceptor is excited due to the transfer of the excitation energy of the donor, and the intuitive expression is that the fluorescence intensity generated by the donor is much lower than that generated by the donor when the donor exists alone, and the fluorescence emitted by the acceptor is greatly enhanced.

In other embodiments, the first labeling molecule is a fluorescence quencher and the second labeling molecule is a fluorescence reporter.

In some embodiments, the first labeling molecule is proximal to the second labeling molecule when the probe oligonucleotide to which the first labeling molecule is attached hybridizes to an amplification product to which the second labeling molecule is attached.

In some embodiments, when the probe oligonucleotide to which the first labeling molecule is attached hybridizes to an amplification product to which the second labeling molecule is attached and the 3 'segment of the probe oligonucleotide is attached to the first labeling molecule, the 3' end of the hybridization position of the probe oligonucleotide is close to the second labeling molecule, the closer the two groups are, the better the quenching effect, and the stronger the signal. In some embodiments, 20nt or even more is effective. Of course, shorter distances are generally satisfactory in design.

In some embodiments, the amplification product is a single-stranded DNA linked to a second marker molecule amplified by asymmetric PCR of the target nucleotide sequence in the presence of a first primer oligonucleotide and a second primer oligonucleotide.

In some embodiments, the first primer oligonucleotide is an upstream primer oligonucleotide and the second primer oligonucleotide is a downstream primer oligonucleotide.

In some embodiments, the probe oligonucleotide, first primer oligonucleotide, and second primer oligonucleotide are all designed according to the target nucleotide sequence.

In some embodiments, the fluorescent reporter includes, but is not limited to, FAM (6-carboxy-fluorescein, green), HEX, VIC, ROX, Cy5, and the like, and the fluorescent reporter can be at least one of the foregoing listed groups, or any one thereof.

In some embodiments, the fluorescence quenching group includes, but is not limited to, BHQ1 (black hole quenching group), BHQ2, and the like, and the fluorescence quenching group can be at least one of the foregoing listed groups, or any one thereof.

It will be understood by those skilled in the art that the probe oligonucleotide, the first primer oligonucleotide, and the second primer oligonucleotide sequences are only exemplary lists, and that when the target nucleotide sequences are different, the probe oligonucleotide, the first primer oligonucleotide, and the second primer oligonucleotide sequences are all specifically designed according to the target nucleotide sequence.

In a second aspect, an embodiment provides a detection kit, which comprises the probe primer combination of the first aspect.

In some embodiments, the detection kit comprises an asymmetric PCR reaction system.

In some embodiments, the asymmetric PCR reaction system is selected from any one of a PCR system, a reverse transcription PCR system.

In some embodiments, the reverse transcription PCR system can be a one-step reverse transcription PCR system, which does not need to be performed in multiple steps, is completed in one step, and is simple to operate.

In some embodiments, the PCR system contains PCR Master Mix, thermostable polymerase, dNTPs, etc.

In some embodiments, the reverse transcription PCR system comprises RT-PCR Master Mix, thermostable polymerase, reverse transcriptase, dNTPs, and the like.

In some embodiments, RT-PCR Master Mix, thermostable polymerase, reverse transcriptase, dNTPs, as mentioned herein, are commercially available. For example, available from Life, Takara Biotechnology, Inc., Zhuhai Baorui Biotech, Inc., Shenzhen, Fei Peng Bio-Ltd, etc.

In some embodiments, the thermostable polymerase includes, but is not limited to, at least one of Taq DNA polymerase, Tth DNA polymerase.

In some embodiments, the final molar concentration of the probe oligonucleotide in the asymmetric PCR reaction is 200nM 800nM, including but not limited to 200nM, 250nM, 300nM, 350nM, 400nM, 450nM, 500nM, 550nM, 600nM, 650nM, 700nM, 750nM, 800nM, and the like. Generally, the probe concentration has little influence on the result, and can be in a reasonable range, the probe concentration is too high, the background is high, the cost is high, and the probe concentration can be generally reduced as much as possible on the premise of not influencing the detection result.

In some embodiments, the final molar concentration of the primer oligonucleotide to which the second marker molecule is attached > the concentration of the primer oligonucleotide to which the second marker molecule is not attached.

In some embodiments, the final molar concentration of the primer oligonucleotide to which the second labeling molecule is attached is 5-20 times, including but not limited to 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, etc., preferably 10 times, the final molar concentration of the primer oligonucleotide to which the second labeling molecule is not attached.

In some embodiments, the concentration of the primer oligonucleotide to which the second marker molecule is attached is 200nM to 800nM, including but not limited to 200nM, 250nM, 300nM, 350nM, 400nM, 450nM, 500nM, 550nM, 600nM, 650nM, 700nM, 750nM, 800nM, and the like.

In some embodiments, the concentration of primer oligonucleotide not linked to a second marker molecule is 10nM to 100nM, including but not limited to 10nM, 15nM, 20nM, 25nM, 30nM, 35nM, 40nM, 45nM, 50nM, 55nM, 60nM, 65nM, 70nM, 75nM, 80nM, 85nM, 90nM, 95nM, 100 nM.

In some embodiments, the kit further comprises a template, water.

In some embodiments, the template may be an RNA template, a DNA template. By way of example, but not limitation, the template may specifically be a single-stranded DNA virus, a single-stranded RNA virus, and may also be genomic DNA of a prokaryote, a protist, an animal, a plant, a fungus, and the like.

In some embodiments, the template may be human or animal genomic DNA.

In some embodiments, the final concentration of the Taq DNA polymerase in the kit is 0.01-0.5U/. mu.L, including but not limited to 0.01U/. mu.L, 0.05U/. mu.L, 0.1U/. mu.L, 0.15U/. mu.L, 1U/. mu.L, 1.5U/. mu.L, 2U/. mu.L, 2.5U/. mu.L, 3U/. mu.L, 3.5U/. mu.L, 4U/. mu.L, 4.5U/. mu.L, 5U/. mu.L, and the like.

In some embodiments, the final concentration of the reverse transcriptase in the kit is 0.01-0.5U/. mu.L, including but not limited to 0.01U/. mu.L, 0.05U/. mu.L, 0.1U/. mu.L, 0.15U/. mu.L, 1U/. mu.L, 1.5U/. mu.L, 2U/. mu.L, 2.5U/. mu.L, 3U/. mu.L, 3.5U/. mu.L, 4U/. mu.L, 4.5U/. mu.L, 5U/. mu.L, and the like.

In some embodiments, the total volume of the test kit is 10-100. mu.L, including but not limited to 10. mu.L, 15. mu.L, 20. mu.L, 25. mu.L, 30. mu.L, 35. mu.L, 40. mu.L, 45. mu.L, 50. mu.L, 55. mu.L, 60. mu.L, 65. mu.L, 70. mu.L, 75. mu.L, 80. mu.L, 85. mu.L, 90. mu.L, 95. mu.L, 100. mu.L, and the like, preferably 25. mu.L.

In a third aspect, an embodiment provides the use of a probe primer combination as described in the first aspect or a test kit as described in the second aspect in a genotyping test. It should be noted that the genotyping test result herein is only an intermediate reference result, and the final diagnosis result or health condition may be obtained according to information such as subjective feeling symptoms, past medical history, family genetic history, etc. of the subject in clinical diagnosis. The above applications may also be applied for a variety of other non-diagnostic therapeutic purposes.

In some embodiments, the genotyping assays include, but are not limited to, Single Nucleotide Polymorphism (SNPs) site detection, viral genotyping.

SNPs, i.e., Single Nucleotide Polymorphisms (SNPs), mainly refer to DNA sequence Polymorphisms caused by variations of a Single Nucleotide on the genome level.

In a fourth aspect, an embodiment provides the use of the probe-primer combination according to the first aspect or the detection kit according to the second aspect in an asymmetric melting curve PCR detection.

In some embodiments, the reaction sequence for the asymmetric melt curve PCR detection is as follows: at 95 deg.C for 1-10 min; 45 (95 ℃, 5-10 s; 55 ℃, 30-60 s); at 95 ℃ for 1 min; at 55 deg.C for 1 min; fluorescence signals were collected continuously at 95-50 ℃.

In some embodiments, the schematic diagram of the present invention is shown in fig. 1, and the method for detecting a single-labeled probe melting curve nucleic acid of the present invention comprises:

1. and a fluorescence quenching group is marked at the position of the upstream primer or the downstream primer close to the 3' end, so that the fluorescence quenching group is introduced into one strand of a subsequent PCR amplification product.

2. The probe sequence and the upstream primer sequence marked with the fluorescence quenching group are respectively complementary to two strands of the DNA. Or the downstream primer near the 3' end is labeled with a fluorescence quenching group, and the probe sequence and the downstream primer sequence labeled with the fluorescence quenching group are respectively complementary to two strands of the DNA.

3. The 3 'end of the probe is marked with a fluorescent reporter group, the hybridization position of the probe needs to enable the 3' end to be as close to a fluorescent quenching group as possible, and the specific design method can be seen in a schematic diagram shown in FIG. 1.

4. The detection process is divided into two steps, the first step is an asymmetric PCR process, and the second step is a melting curve analysis process.

5. Asymmetric PCR: when a target sequence exists in a PCR reaction system (a positive sample), a large amount of DNA single-strand amplification products with fluorescence quenching groups are generated by asymmetric PCR reaction; when the PCR reaction system has no target sequence (negative sample), the PCR reaction does not occur, and no DNA single-strand amplification product exists.

6. And (3) melting curve analysis: if a DNA single-strand amplification product with a fluorescence quenching group exists, the singly-labeled probe is hybridized with the DNA single strand with the fluorescence quenching group at a lower temperature, and the fluorescence emitted by the fluorescent group is absorbed by the quenching group on a complementary DNA strand. When the temperature gradually rises, the probe and the DNA single-stranded molecule are melted, the fluorescent group on the probe is not quenched by the quenching group on the complementary strand, and the fluorescent signal is rapidly enhanced near the melting temperature. The melting temperature of the probe can be obtained by analyzing the melting curve by a second derivative method. When no target sequence exists in a PCR reaction system, PCR reaction cannot occur, the probe cannot be specifically hybridized with the single-stranded DNA, and no specific peak is generated in a second derivative diagram of a melting curve.

The design of the probe and the Primer of the invention follows the general design principle of the probe and the Primer, for example, the design principle of the probe and the Primer can refer to the real-time fluorescence PCR technology (second edition, scientific Press, Li jin Ming dynasty), and the specific design can use software such as ABI Primer Express and the like.

The probes and primers of the following examples were obtained by the artificial synthesis of the applicants.

The templates of the following examples are from viral samples or human genome samples.

Example 1

Comparison of results of single-labeled probe melting curve method and double-labeled probe melting curve method

Taking the detection of nucleic acid of coronavirus 229E as an example, the following probe primers were designed. The same pathogenic nucleic acid is detected by adopting a single-labeled probe melting curve method and a double-labeled probe melting curve method respectively. The probe primer sequences of the two methods are the same, but the labels are different.

The sequences of the probes and primers for both methods are shown in Table 1.

TABLE 1

The reaction system of asymmetric PCR is shown in Table 2:

TABLE 2

The reaction sequence is shown in fig. 2, and specifically comprises the following steps:

at 50 ℃ for 30 min; 95 ℃ for 5 min; 45 × (95 ℃, 5 s; 55 ℃, 40 s); at 95 ℃ for 1 min; at 55 deg.C for 1 min; fluorescence signals were collected continuously at 55-95 ℃.

The template sequence is as follows:

in the template sequence, the sequence marked by a single straight line drawn downwards is the same sequence as the upstream primer, and the complementary strand of the partial sequence is complementary to the upstream primer; the sequence marked by the lower single wavy line is a sequence complementary to the probe sequence; the sequence marked by the lower double straight line is a sequence complementary to the downstream primer.

FIG. 3 shows a melting curve of a single labeled probe, and FIG. 4 shows a melting curve of a double labeled probe. The dark black line is the positive sample detection result, and the gray line is the negative sample detection result.

The result shows that the result signal of the positive sample and the result signal of the negative sample are more different and the specificity is better by the single-mark melting curve method. However, in the double-labeled probe, due to problems such as probe sequence, a non-specific melting curve peak is generated in the negative sample, and it is difficult to distinguish the probe from the positive result.

Example 2

This example provides detection of rs1801133SNP site of human MTHFR gene.

The following probe primer sequences are designed for detecting the rs1801133SNP site (677C/T) on the human MTHFR gene, and the SNP site is related to the folic acid metabolism capability. The probe primer sequences are shown in Table 3.

TABLE 3

The reaction system for asymmetric PCR is shown in Table 4:

TABLE 4

The template sequence (MTHFR _677C/T) is as follows:

in the above-mentioned template sequence, "C (T)" represents a SNP site, and the bases at this site are C, T in both alleles.

The reaction procedure is as follows: 95 ℃ for 5 min; 45 × (95 ℃, 5 s; 55 ℃, 30 s); at 95 ℃ for 1 min; at 40 ℃ for 1 min; continuously collecting fluorescence signals at 40-80 ℃.

FIGS. 5 to 7 show the results of fluorescence probe dissolution curve method.

FIG. 5 shows the result of detection of the 677C homozygote of the MTHFR gene, and the Tm value for hybridization of the probe is about 64.5 ℃.

FIG. 6 shows the result of detection of 677T homozygote of MTHFR gene, and the Tm value for hybridization of the probe is about 55 ℃.

FIG. 7 shows the results of detection of the 677C/T heterozygote of the MTHFR gene, and the Tm values of the hybridization probes were about 54 ℃ and 64.5 ℃.

The result shows that the method can well distinguish three SNP types of 677 site of MTHFR gene.

Example 3 and comparative example 1

This comparative example was conducted by referring to patent publication No. CN 102321765A (patent name "a real-time fluorescent PCR method and use") (hereinafter referred to as "comparative patent"), and the same probe and primer as in example 2 of the comparative patent document were designed to detect SNP site rs 13182883. Probe primers were synthesized according to the methods described in the comparative patents. Meanwhile, a downstream primer (rs13182883R2) is designed for comparison by applying the technical principle of the invention.

Specifically, the results are shown in Table 5.

TABLE 5

For a strict comparison of the two methods, the probe Pb1 and the downstream primer R1 were shared by the two methods, except that the upstream primer was different.

The reaction system for asymmetric PCR is shown in Table 4.

The reaction program was set up with reference to the comparative patent method: 95 ℃ for 5 min; 40 × (95 ℃, 15 s; 55 ℃, 30 s; 72 ℃, 20 s); at 95 ℃ for 1 min; at 40 ℃ for 1 min; fluorescence signals were collected continuously at 45-90 ℃.

The results of testing the human genome samples are shown in FIGS. 8 to 10.

FIG. 8 shows the results of rs13182883A/A homozygote assay, R1: comparing with the method disclosed in the patent CN 102321765A; r2: the method of example 3 of the present invention.

FIG. 9 shows the results of rs13182883G/G homozygote assay, R1: comparing with the method disclosed in the patent CN 102321765A; r2: the method of example 3 of the present invention.

FIG. 10 shows the results of the rs13182883A/G heterozygote assay, R1: comparing with the method disclosed in the patent CN 102321765A; r2: the method of example 3 of the present invention.

The sequence of neck ring structures designed with reference to the comparative patent is as follows:

among the above sequences, the sequence marked by a single straight line drawn downwards is the same sequence as rs13182883R1 (downstream primer), and the complementary strand of the sequence is complementary to rs13182883R1 (downstream primer); the sequence marked by the lower wavy line is the same sequence as rs13182883Pb1 (probe), the complementary strand of the sequence is complementary to rs13182883Pb1 (probe), wherein, the target sequence site corresponding to the bold G base is a variation site; the sequence marked by the double downward-drawn line is the sequence complementary to rs13182883F2 (forward primer 2).

The same DNA template was tested by the method of comparative patent, example 3, and the sequence information of the DNA template was as follows:

rs13182883[Homo sapiens]

Variant type:

SNV。

Alleles:

G>A[Hide Flanks]

ATGTTTTAAGGAGACTATGAGGTGTGTCTCTCTTTTGTGAGGGGAGGGGT；

CCCTTCTGGCCTAGTAGAGGGCCTGGCCTGCAGTGAGCATTCAAATCCTC。

[G/A]

AGGAACAGGGTGGGGAGGTGGGACAAAGGCAGGAAGAAAGTAACGGAGAG；

CCTGGGGAGACATGGTAGGGCACAAACATGAGCAGACCAAGGATTGTCAG。

Chromosome:

5:137297649(GRCh38)；

5:136633338(GRCh37)。

Gene:

SPOCK1(Varview)。

Functional Consequence:

intron_variant。

Validated:

by frequency,by cluster。

MAF:

A＝0.288333/173(NorthernSweden)；

A＝0.29308/1313(Estonian)；

A＝0.357605/1326(TWINSUK)；

A＝0.36274/1398(ALSPAC)；

A＝0.371427/11616(GnomAD)；

A＝0.398031/49980(TOPMED)；

A＝0.415735/2082(1000Genomes)；

A＝0.425119/33439(PAGE_STUDY)。

HGVS:

NC_000005.10:g.137297649G>A,NC_000005.9:g.136633338G>A,NG_034127.1:g.206681C>T。

a search engine: PubMedLitVar.

As can be seen from the results of fig. 8 to 10, the signal of example 3 of the present invention is stronger. In addition, the method of the patent is complex in probe primer design, the product is required to form a secondary structure, the Tm value of the secondary structure needs to be larger than that of the probe, the Tm value of the SNP site adjacent sequence is low, certain difficulty and limitation are possibly brought to the probe primer design, and the Tm value of the probe is difficult to freely select.

In one embodiment, the invention generates a fluorescent signal by hybridizing a single-fluorescence labeled probe (or a fluorescence quencher labeled probe) with a single-strand DNA labeled with a fluorescence quencher (or a fluorescence reporter). The single-labeled probe related in the invention can not generate non-specific fluorescent signals due to conformational change, and has lower background. The change of a fluorescent signal generated by hybridization of the probe and the DNA single-stranded template is higher and more stable than that of the traditional method, and the characteristics ensure that the signal-to-noise ratio of the method is higher and the specificity is better. At the same time, the probe is easier to design.

In some embodiments, the invention introduces a fluorescent group and a quenching group on a probe and a primer respectively, can amplify a large amount of single-stranded DNA molecules by an asymmetric PCR technology, can generate the change of a fluorescent signal after the probe is hybridized with the single-stranded DNA molecules marked with the quenching group, and detects and analyzes a target sequence by a melting curve method.

The present invention has been described in terms of specific examples, which are provided to aid understanding of the invention and are not intended to be limiting. For a person skilled in the art to which the invention pertains, several simple deductions, modifications or substitutions may be made according to the idea of the invention.

Organization Applicant

----------------------

Street :

City :

State :

Country :

PostalCode :

PhoneNumber :

FaxNumber :

EmailAddress :

<110> OrganizationName Shenzhen Audo inspection and detection technology Co., Ltd

Application Project

-------------------

<120> Title, probe primer combination and detection kit thereof

<130> AppFileReference : 20I25365

<140> CurrentAppNumber :

<141> CurrentFilingDate : ____-__-__

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

ccattggcca caacacctgc acttcc 26

<212> Type : DNA

<211> Length : 26

SequenceName : 1

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

ccccagagac cttgaccaca a 21

<212> Type : DNA

<211> Length : 21

SequenceName : 2

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

cacaagctca gcaaattgtg gata 24

<212> Type : DNA

<211> Length : 24

SequenceName : 3

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

cagcctaatg atgatgtgac atctaatgtc acacaatgtt ttggccccag agaccttgac 60

cacaactttg gaagtgcagg tgttgtggcc aatggtgtta aagctaaagg ctatccacaa 120

tttgctgagc ttgtgccgtc aacagctgct atgctgtttg atagtcacat tgtttccaa 179

<212> Type : DNA

<211> Length : 179

SequenceName : 4

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

tgtctgcggg agccgatttc a 21

<212> Type : DNA

<211> Length : 21

SequenceName : 5

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

gagctttgag gctgacctga a 21

<212> Type : DNA

<211> Length : 21

SequenceName : 6

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

tcaaagaaaa gctgcgtgat ga 22

<212> Type : DNA

<211> Length : 22

SequenceName : 7

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

caggtggagg ccagcctctc ctgactgtca tccctattgg caggttaccc caaaggccac 60

cccgaagcag ggagctttga ggctgacctg aagcacttga aggagaaggt gtctgcggga 120

gctcgatttc atcatcacgc agcttttctt tgaggctgac acattcttcc gctttgtgaa 180

ggcatgcacc gacatgggca tcacttgccc catcgtcccc gggatggcat agtggggtgg 240

tgaata 246

<212> Type : DNA

<211> Length : 246

SequenceName : 8

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

accctgttcc tcgaggattt ga 22

<212> Type : DNA

<211> Length : 22

SequenceName : 9

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

caggctctcc gttactttct tc 22

<212> Type : DNA

<211> Length : 22

SequenceName : 10

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

ggatgctcac tgcctagtag agggcctggc ct 32

<212> Type : DNA

<211> Length : 32

SequenceName : 11

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

ctggcctgca gtgagcatt 19

<212> Type : DNA

<211> Length : 19

SequenceName : 12

SequenceDescription :

Sequence

--------

<213> OrganismName : Artificial Sequence

<400> PreSequenceString :

cacctcgatt gaagacattc actgacctcc tagatcttag tgagataact tctgacaatc 60

cttggtctgc tcatgtttgt gccctaccat gtctccccag gctctccgtt actttcttcc 120

tgcctttgtc ccacctcccc accctgttcc tcgaggattt gaatgctcac tgcaggccag 180

gccctctact aggccagaag ggacccctcc cctcacaaaa gagagacaca cctcatagtc 240

tccttaaaac atagtctgat acttatcgtt gttaaaacaa t 281

<212> Type : DNA

<211> Length : 281

SequenceName : 13

SequenceDescription :

Claims

1. A probe-primer combination comprising a probe oligonucleotide hybridizable to a target nucleotide sequence, a first primer oligonucleotide and a second primer oligonucleotide for amplifying a nucleic acid region comprising the target nucleotide sequence, the probe oligonucleotide having a first label molecule attached thereto, the first primer oligonucleotide or the second primer oligonucleotide having a second label molecule attached thereto, the probe oligonucleotide being complementary to a single strand of the target nucleotide sequence, the primer oligonucleotide having the second label molecule attached thereto being complementary to another single strand of the target nucleotide sequence, the first label molecule and the second label molecule providing different detectable signals, and the first label molecule and the second label molecule undergoing a fluorescence resonance energy transfer when brought into physical proximity.

2. The probe-primer combination of claim 1, wherein the first labeling molecule is attached to the 3' end of the probe oligonucleotide;

optionally, the base to which the second marker molecule is attached is near the 3' end of the primer oligonucleotide to which it is attached;

optionally, the base to which the second label molecule is attached is within 8 bases from the 3' end of the primer oligonucleotide to which it is attached;

optionally, the base to which the second marker molecule is attached is any one of A, T, C, G bases.

3. The probe-primer combination of claim 1, wherein the sequence length of the probe oligonucleotide is within 40nt, preferably 15 to 30 nt;

optionally, the probe oligonucleotide has a Tm value of 55 ℃ to 90 ℃, preferably 60 ℃ to 80 ℃;

optionally, the sequence length of the first primer oligonucleotide and the second primer oligonucleotide is within 30nt, preferably 20-25 nt.

4. The probe-primer combination of claim 1, wherein the target nucleotide sequence is at least one of a single-stranded nucleotide, a double-stranded nucleotide;

optionally, the target nucleotide sequence is at least one of a DNA sequence and an RNA sequence;

optionally, when the target nucleotide sequence is a single-stranded nucleotide, the primer oligonucleotide to which the second marker molecule is attached is complementary to the complementary sequence of the target nucleotide sequence.

5. The probe-primer combination of claim 1, wherein the first labeling molecule is a fluorescent reporter and the second labeling molecule is a fluorescent quencher, or wherein the first labeling molecule is a fluorescent quencher and the second labeling molecule is a fluorescent reporter;

optionally, when the probe oligonucleotide to which the first labeling molecule is attached is hybridized to the amplification product to which the second labeling molecule is attached, and the 3 'segment of the probe oligonucleotide to which the first labeling molecule is attached, the 3' end of the hybridization position of the probe oligonucleotide is adjacent to the second labeling molecule;

optionally, the amplification product is a single-stranded DNA connected with a second marker molecule and obtained by asymmetric PCR amplification of the target nucleotide sequence in the presence of a first primer oligonucleotide and a second primer oligonucleotide.

6. The probe-primer combination of claim 5, wherein the fluorescent reporter group is selected from at least one of FAM, HEX, VIC, ROX, Cy 5;

optionally, the fluorescence quenching group is selected from at least one of BHQ1 and BHQ 2.

7. A detection kit comprising the probe-primer combination according to any one of claims 1 to 6.

8. The test kit of claim 7, wherein the test kit comprises an asymmetric PCR reaction system;

optionally, the asymmetric PCR reaction system is selected from any one of a PCR system, a reverse transcription PCR system;

optionally, the PCR system contains at least one of PCR Master Mix, thermostable polymerase, dNTPs;

optionally, the reverse transcription PCR system contains at least one of RT-PCR Master Mix, thermostable polymerase, reverse transcriptase and dNTPs;

optionally, the thermostable polymerase is selected from at least one of Taq DNA polymerase, Tth DNA polymerase;

optionally, the final molar concentration of the probe oligonucleotide in the asymmetric PCR reaction system is 200-800 nM;

optionally, the molar final concentration of the primer oligonucleotide to which the second marker molecule is attached > the molar final concentration of the primer oligonucleotide to which the second marker molecule is not attached;

optionally, in the asymmetric PCR reaction system, the final molar concentration of the primer oligonucleotide to which the second labeling molecule is linked is 5-20 times the final molar concentration of the primer oligonucleotide to which the second labeling molecule is not linked;

optionally, the volume of the detection kit is 10-100. mu.L, preferably 25. mu.L.

9. Use of the probe-primer combination according to any one of claims 1 to 6 or the test kit according to any one of claims 7 to 8 in genotyping assays;

optionally, the genotyping detection comprises single nucleotide polymorphism site detection, viral genotyping.

10. The use of the probe-primer combination according to any one of claims 1 to 6 or the test kit according to any one of claims 7 to 8 in asymmetric melting curve PCR detection;

and/or the reaction program of the asymmetric melting curve PCR detection is as follows:

at 95 deg.C for 1-10 min; 45 (95 ℃, 5-10 s; 55 ℃, 30-60 s); at 95 ℃ for 1 min; at 55 deg.C for 1 min; fluorescence signals were collected continuously at 95-50 ℃.