CN101090979A - Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same - Google Patents

Abstract

The invention relates to nucleic acid probes, nucleic acid probe libraries, and kits for detecting, classifying, or quantifying components in a complex mixture of nucleic acids, such as a transcriptome, and methods of using the same. The invention also relates to methods of identifying nucleic acid probes useful in the probe libraries and to methods of identifying a means for detection of a given nucleic acid.

Description

Probe, library and the test kit and the construction process thereof that are used for analysis of mixtures of nucleic acids

Technical field

The present invention relates to be used to detect, classify or quantitatively complicated nucleic acid mixture for example nucleic acid probe, nucleic acid probe library and the test kit of the component in the transcript group (transcriptome), and their using method.

Background technology

Along with the microarray that is used to describe thousands of expression of gene spectrums, for example GeneChip ^TMArray (Affymetrix, Inc., Santa Clara, appearance CA), utilize traditional method for example rna blot analysis and dot blotting analyze the required financial resources and the sub-fraction of material resources, just can identify the gene of expression and the dependency between the cell phenotype.Microarray allows a plurality of replicate(determination)s of exploitation, with the biological marker of differentiating and verify disease and the drug targets that can be used to diagnose and treat.In addition, gene expression profile also can be used for the assessment and predicted exposure in the metabolism and the toxicology consequence of certain factor (for example, medicine, potential toxin or carcinogens etc.) or condition (for example, temperature, pH etc.).

The microarray experiment usually only produces wherein, and sub-fraction is valuable mass data for the experimenter.In addition, because based on the height flat row mode of the analysis of microarray, for each capture probe, condition may not be best.For these reasons, the microarray experiment is very trailed the checking research of use single-gene homogeneous determination frequently or is substituted subsequently by this checking research.These single-gene homogeneous determinations often are based on the method for quantitative PCR, and for example 5 ' nuclease is measured or the double-tagging probe quantitative experiment of other type.Yet these experiments are still single reaction experiment consuming time, are subjected to the obstruction of probe design program expensive and consuming time.And 5 ' nuclease is measured probe relatively large (for example, 15-30 Nucleotide).Therefore, these in the present known homogeneous determination system are restricted finds result's checking and the target verification method that focuses on has all been constituted bottleneck microarray.

A method that is used for avoiding this bottleneck is to save 5 ' nuclease to measure expensive double-tagging indication probe and the molecular beacon that uses, and the use in generation is fluorescigenic non-sequence specific DNA intercalative dye, for example SYBR Green in the combination two strands but not during single stranded DNA.Use this dyestuff, can the real-time sequence that detects any amplification in general ground.Yet this technology is subjected to the obstruction of several problems.For example, the non-special primer in the pcr amplification process cause can produce participate in quantitative process with the irrelevant non-target amplicon of purpose.And, the interaction in this reaction between the ubiquity PCR primer, thus form " primer dimer ".Because the typical case uses the primer of high density in the PCR reaction, this can cause the double-stranded non-target amplicon of weak point of remarkable quantity, and this amplicon is also in conjunction with chimeric dyestuff.Therefore, the preferred method by the PCR in real time quantification of mrna is to use the sequence-specific detection probes.

A method that is used to avoid random amplification and primer dimer to form problem is to use and can be used to detect a large amount of dissimilar nucleic acid molecule but keeps certain sequence-specific general detection probes, this method is by (Nucleic Acid Research30 (17): 91,2002 such as Simeonov; U.S. Patent Publication 20020197630) describe, it relates to and uses and comprised and have given certain the probe library of the sequence more than 10% in the possible sequence of institute of (or some) length.This library can comprise various non-natural nucleic acid bases and other and modify to stablize combining of library middle probe/primer and target sequence.Even so, for most of sequences, also need the shortest length of at least 8 bases to obtain and with great majority and to use (for example PCR in real time) relevant compatible degree of stability of condition determination.Contain 65 owing to have the general library of all possible 8 aggressiveness, therefore 536 different sequences before also contained more than 10% of all possibilities by considerations such as Simeonov even minimum library, promptly, at least 6554 sequences, this operation on be unpractiaca and also its construction cost huge.

From angle of practice, several factors limit current homogeneous determination accessibility and the availability used.The problem that the user of conventional determining technology faces comprises:

● since buy at the price of the probe of each transcript very high, when attempting in a few sample, detecting many different genes, will price surprisingly high.

● the complex sign probe is consuming time, and receives that from ordering goods to the time of the goods that producer sends usually surpassed for 1 week.

● the test kit of user's design may not can work when the first time, and therefore, by every mensuration, the effective agents box is expensive.

● be difficult to detect apace new target drone or improve probe design repeatedly.

● the commercial effectively definite probe sequence of probe may not be known to the human consumer, thereby causes going wrong on the suitability of result's assessment and scientific publication.

● when condition determination or component are unclear, can not order reagent from substituting the source.

The invention solves these practical problemss, and be intended to guarantee develop fast and inexpensively accurate the and special mensuration that is used for the quantitate gene transcript.

The invention summary

The oligonucleotide detection probes that expectation can be used limited quantity is quantitatively for example most of genes (for example,＞98%) the expression in people's transcript group (transcriptome) in the homogeneous determination system.The invention solves the problem that the existing scheme of above-mentioned homogeneous determination faces.This realizes that by the method that provides structure to have enough sequence-specific general multiprobes described general multiprobe can not detect the sequence fragment or the primer dimer of random amplification, but still can detect many different target sequences separately.These probes can be used for different mensuration, and can be combined in the little probe library (50 to 500 probes), when uniting with the target-specific primer sets, each component of the complex mixture that it can be used for detecting and/or quantitatively be made up of thousands of different nucleic acid (for example detect by＞30, each transcript in people's transcript group of 000 different nucleic acid composition).

Each multiprobe (multi-probe) comprises two elements: 1) form bonded measuring element or test section with detection probes and target by one or more markers; With 2) guarantee and specific objective target (one or more) bonded recognition component or recognition sequence label.Measuring element can be any detection principle of using in the homogeneous determination.Can change directly by the measurable character that combines the one or more markers in back with target and (for example detect combination, the molecular beacon class that is with or without stem structure is measured), perhaps can by in conjunction with after detect combination indirectly with afterreaction (for example cutting that 5 ' nuclease by archaeal dna polymerase carries out in 5 ' nuclease mensuration).

Each measuring element can comprise quencher, and it is selected from european patent application 04078170 and 03759288 disclosed quencher.In the context of the present invention, all the elements relevant with disclosed quencher in these two pieces of patent applications relate to the quencher of a part that forms oligonucleotide probe, described probe is the part in library of the present invention, thereby this content of two pieces is incorporated by reference in this article.

Quencher preferably has formula I

R wherein ¹, R ⁴, R ⁵And R ⁸In one or two be key independently, or be selected from replacement or unsubstituted amino, it constitutes and being connected of the remainder of oligonucleotide probe, and other R wherein ¹To R ⁸Group is hydroxyl, amino, alkyl, aryl, aralkyl or alkoxyl group hydrogen or replacement or unsubstituted independently of one another.Amino substituting group can be alkyl, alkylaryl or aryl.

In the context of formula I, term " alkyl (alkyl) " is used in reference to ramose or not ramose, saturated or unsaturated, univalence hydrocarbyl in this article, and it has about 1-30 carbon usually, preferred 1-6 carbon.Suitable alkyl comprises, and for example, contains the structure of one or more methylene radical, methyne (methine) and/or methyne (methyne).The ramose structure has the motif with similar branch such as sec.-propyl, the tertiary butyl, isobutyl-, 2-ethyl propyl.As used herein, this term comprises " alkyl that replaces " and " cycloalkyl "." alkyl that replaces " refers to previously defined alkyl, and it comprises one or more substituting groups, for example, and C ₁-C ₆-alkyl, aryl, acyl group, halogen (be haloalkyl, for example, CF ₃), hydroxyl, amino, alkoxyl group, alkylamino, acyl amino, thioamides, acyl group oxygen, aryl oxide, aryl oxide alkyl, sulfydryl, sulfo-, azepine, oxa-, saturated and undersaturated cyclic hydrocarbon, heterocycle etc.These groups can be incorporated on any carbon or substituting group of alkyl.In addition, these groups can hang down or mix the alkyl chain from alkyl chain.

Term " alkylaryl " refers in the present context by making up the group that alkyl and aryl obtain.Typical alkylaryl comprises styroyl, ethylphenyl etc.

Term " alkylamino " refers to the amino that replaced by alkyl in the present context.In a preferred embodiment, amino is attached on the anthraquinone ring.

Term " alkyl aryl amino " refers to the amino that replaced by alkylaryl in the present context.In a preferred embodiment, amino is attached on the anthraquinone ring.

Term " arylamino " refers to the amino that replaced by aryl in the present context.In a preferred embodiment, amino is attached on the anthraquinone ring.

The particularly preferred example of the quencher of Shi Yonging comprises in the present invention: 1,4-two-(3-hydroxyl-propyl group amino)-anthraquinone, (3-(4 for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl amino)-anthraquinone, 1,5-two-(3-hydroxyl-propyl group amino)-anthraquinone, (3-hydroxypropyl amino)-(3-(4 for 5-for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone, 1,4-two-(4-(2-hydroxyethyl) phenyl amino)-anthraquinone, ((2-(4 for 4-for 1-, 4 '-dimethoxy-trityl oxygen) phenyl amino ethyl))-4-(4-(2-hydroxyethyl) phenyl amino)-anthraquinone, 1,8-two-(3-hydroxyl-propyl group amino)-anthraquinone, 1,4-two (3-hydroxypropyl amino)-6-tectoquinone, (3-(4 for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl amino)-6 (7)-methyl-anthraquinones, 1,4-two (4-(2-hydroxyethyl) phenyl amino)-6-methyl-anthraquinone, 1,4-two (4-methyl-phenyl amino)-6-carboxyl-anthraquinone, 1,4-two (4-methyl-phenyl amino)-(N-(6 for 6-, 7-dihydroxyl-4-oxygen-heptane-1-yl)) carboxylic acid amides-anthraquinone, 1,4-two (4-methyl-phenyl amino)-6-(N-(7-dimethoxytrityl oxygen-6-hydroxyl-4-oxygen-heptane-1-yl)) carboxylic acid amides-anthraquinone, 1,4-two (propyl group amino)-6-carboxyl-anthraquinone, 1,4-two (propyl group amino)-(N-(6 for 6-, 7-dihydroxyl-4-oxygen-heptane-1-yl)) carboxylic acid amides-anthraquinone, 1,4-two (propyl group amino)-6-(N-(7-dimethoxytrityl oxygen-6-hydroxyl-4-oxygen-heptane-1-yl)) carboxylic acid amides-anthraquinone, 1,5-two (4-(2-hydroxyethyl) phenyl amino)-anthraquinone, (4-(2-hydroxyethyl) phenyl amino)-((2-(4 for 4-for 5-for 1-, 4 '-dimethoxy-trityl oxygen) phenyl amino ethyl))-anthraquinone, 1,8-two (3-hydroxypropyl amino)-anthraquinone, (3-hydroxypropyl amino)-(3-(4 for 8-for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone, 1,8-two (4-(2-hydroxyethyl) phenyl amino)-anthraquinone, and 1-(4-(2-hydroxyethyl) phenyl amino)-8-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-anthraquinone.

The compound 11 that a kind of particularly preferred quencher is embodiment 21, promptly 1,4-two (2-hydroxyethylamino)-6-tectoquinone.

Recognition component also helps novelty of the present invention.It comprises the short oligonucleotide part, and its sequence is through selecting consequently can detect a big subclass of target nucleotide in the given complex sample mixture.These new probes that are designed to detect many different target molecules respectively are known as multiprobe.By selecting the most frequent sequence that runs into to be designed for the probe of a plurality of targets and to utilize the notion of the reproduction of short recognition sequence is new, and with design so that have at the specific conventional probe of single target sequence different as far as possible.Subsequently, the probe sequence of primer and selection is guaranteed the specificity of this multiprobe together on every side.By this new principle of design of attempting to produce with the target of minimum probe processing maximum is a part of the present invention equally.This is achieved by following discovery: it is compatible containing the oligonucleotide probe of very short 8-9 aggressiveness LNA and the mensuration of PCR-based.In one aspect of the invention, in recognition component, mix the modifier or the analogue of nucleotide base, nucleoside base or nucleic acid base (nucleobase), and minor groove binding and other modification possibly, all these all are intended to stablize the duplex that forms between probe and the target molecule, so that can use the shortest possibility probe sequence with the wideest target scope.Of the present invention one preferred aspect, described modification is to mix the LNA residue, is reduced to 8 or 9 Nucleotide with the length with recognition component, and keeps the enough stability of duplex of formation simultaneously, so that detect under common condition determination.Typically, be less than 20% oligonucleotide probe in the described library and have guanidine radicals (G), but preferably, be less than 10% oligonucleotide probe and have G, for example be less than 5% at 5 ' end of recognition component in 5 ' and/or 3 ' position of recognition component.Particularly preferably be such library, wherein recognition component does not have G at 5 ' end.

Preferably, modify multiprobe so that this probe with have identical sequence but the probe of unmodified is compared under same detection condition (for example PCR conditioned disjunction stringent hybridization condition) the binding affinity increase of target sequence twice at least.The preferred modification comprises, but be not limited to, mix by chemical group and modify or (for example by analogue, mix ribose or ribodesose analogue) nucleic acid base, nucleoside base or Nucleotide alternative or that carried out modification by key (for example key between the Nucleotide of non-phosphoric acid ester) between the Nucleotide that uses non-phosphodiester bond, to increase binding affinity.Preferred modification can also comprise adheres to the duplex stablizer, for example minor groove binding (MGB) or embedding nucleic acid (INA).In addition, preferred modification can also comprise adds non-differentiation base, 5-nitroindoline for example, and it can be stablized duplex and form, no matter the nucleic acid base on the target chain relative position is how.In fact, an embodiment preferred requirement, all probes in the library of the present invention all comprise at least one 5-nitroindoline residue, and most preferably, all probes comprise an independent 5-nitroindoline residue.At last, can sequence specific ground and the target sequence bonded, by the multiprobe that non-sugar-phosphate backbone is formed, for example PNA also is the modification of being considered.The different modifying of all above-mentioned increase binding affinities will be called " stabilization modification " hereinafter, and consequent multiprobe also will be called " oligonucleotide of modification " hereinafter.More preferably, the binding affinity of the oligonucleotide of modification than having identical sequence but do not have probe that this stabilization modifies in conjunction with high at least about 3 times, 4 times, 5 times or 20 times.

Most preferably, the stabilization modification is to mix one or more LNA nucleotide analogs.Probe according to 6 to 12 Nucleotide of the present invention can comprise 1 to 8 stabilization Nucleotide, for example LNA Nucleotide.When comprising at least two LNA Nucleotide, these Nucleotide can be successive, or are separated by one or more non-LNA Nucleotide.On the one hand, LNA Nucleotide is α and/or xylo LNA Nucleotide.

The present invention also provides the oligomer multiprobe that can use library under the NASBA condition determination.

NASBA is a kind of cloning RNA, specificity isothermal nucleic acid amplification method of being suitable for.By with guanidine thiocyanate+Triton X-100 cracking, the nucleic acid of wash-out purifying from the silica dioxide granule carries out separate nucleic acid at last.The amplification of being undertaken by NASBA relates to the synergistic activity of three kinds of enzymes (that is, AMV reversed transcriptive enzyme, RNase H and t7 rna polymerase).By the internal calibrant that when separating, adds, realize detection by quantitative, wherein said internal calibrant increases with wild type rna, and uses electrochemiluminescence to differentiate subsequently.

The present invention also provides the oligomer multiprobe that comprises multiprobe library, and described multiprobe comprises the stabilization of at least one above-mentioned definition and modifies.Preferably, the length of probe is less than about 20 Nucleotide, more preferably less than 12 Nucleotide, and most preferably about 8 or 9 Nucleotide.In addition, preferably, the library comprises about probe below 3000 kinds, and more preferably, the library comprises the probe below 500 kinds, most preferably about 100 kinds of probes.According to the type of the measuring element that recognition component connected, the library that contains underlined multiprobe can be used for multiple application.These application include, but not limited to two or single marker determination, and for example 5 ' nuclease is measured, and molecular beacon is used (referring to for example Tyagi and Kramer Nat.Biotechnol.14:303-308,1996) and other mensuration based on FRET.

In one aspect of the invention, above-mentioned multiprobe is designed together, so that can replenish each other become have given length might sequence a following predetermined subset, the nucleic acid of maximum quantity in the multiprobe sequential detection/signs/quantitative complex mixture of this subclass through selecting to use minimum number.These design in advance might sequence smaller subset constitute the multiprobe library.Multiprobe of the present invention library realizes that with the complexity of very big reduction this is functional in the following way: select oligomer normal appearance, that have one or more given lengths wittingly, make this selection variation simultaneously hardy, to reach best possible fraction of coverage in complex nucleic acid target colony.One preferred aspect, about in the probe in library and the nucleic acid target colony (for example, people mRNA colony) be hybridization more than 60%.More preferably, in all target nucleic acid molecules of probe and target molecule colony more than 70%, more than 80%, more than 90%, more than 95%, even 98% above hybridization (seeing, for example Fig. 1).

Of the present invention one most preferably aspect, comprise have selected probe length about 0.1% in might sequence the probe library (promptly, for example, about 100 kinds of multiprobes) can detect, classify and/or quantitative any specific species (Mammals especially, people more particularly) the mRNA transcript in the transcript group more than 98% (promptly,＞35,000 different mRNA sequence).In fact, preferably, at least 85% in all target nucleic acids of multiprobe of the present invention library covering target colony.

The multiprobe library of the problems referred to above the application of the invention that exists in existing homogeneous determination is solved, described library is made up of the minimum combination of short detection probes, and the great majority of all expressing genes in the given cell type of given biology can be discerned or detect to this probe through selection.On the one hand, the library comprises can detect to have and surpasses about 10,000 gene, surpass about 15,000 gene, surpass about 20,000 gene, surpass about 25,000 gene, surpass about 30,000 genes or surpass the probe of each transcript in the transcript group of different mRNA transcripts of about 35,000 genes or equal number.One preferred aspect, the library comprises the probe that can detect Mammals transcript sequence (for example, mouse, rat, rabbit, monkey or human sequence).

Can be used for developing fast quantitatively the cost-effective multiprobe set of terminal point PCR mensuration in real time by providing, the present invention has overcome exist above-mentioned restricted in present homogeneous determination.The measuring element of multiprobe of the present invention can be (for example, by terminal in each of probe or comprise marker at the interior location of probe) single mark or double-tagging.Therefore, can adjust probe of the present invention, make it be applicable to that 5 ' nuclease is measured, molecular beacon is measured, FRET measures similar mensuration with other.On the one hand, the detection multiprobe comprises can be interact with each other to produce two markers of signal or change signal, can detect signal or signal change thus after probe and target sequence hybridization.A special aspect is that two markers comprise quencher molecule and reporter molecule.

On the other hand, probe comprises target-specific identification fragment, and this fragment can be specifically and a plurality of different making nucleic acid molecular hybridizations that comprise complementary recognition sequence.A specific context of detection of the present invention is called " molecular beacon with stem district ",, discerns the first and second complementary hair clips formation sequences that segmental both sides connect the formation hair clip of can annealing that is.The report marker is connected in the end of a complementary sequence, and cancellation partly is connected in the end of another complementary sequence.The stem that (, probe identification fragment with its target hybridization time) forms when first and second complementary sequence hybridizations makes these two markers abut one another, thereby causes signal that reporter molecule produces because FRET (fluorescence resonance energy transfer) (FRET) and by cancellation.Reduced the degree of approach between two markers when the hybridization of probe and target sequence, the change of the degree of approach causes that two interactions between the marker change.The hybridization of probe causes from reporter molecule and produces signal (for example, fluorescence) thus, and this signal can be detected and/or quantitative.

On the other hand, multiprobe comprises terminal relatively reporter molecule and the quencher molecule that is positioned at short recognition sequence, such two parts each other fully near so that the quencher molecule signal that can reduce reporter molecule significantly and produced.This probe be free in the solution with and all be like this when combining with target nucleic acid.Be called at one of the present invention aspect the particular detection of " 5 ' nuclease mensuration ", multiprobe can easily be cut by 5 ' nuclease of archaeal dna polymerase.This reaction can cause quencher molecule to be separated with reporter molecule and detectable signal produces.Thus, can in based on the mensuration of amplification, use the amplification procedure of such probe with detection and/or quantifying target nucleic acid.

First aspect the present invention relates to above-mentioned multiprobe library.In this oligonucleotide probe library, each probe all comprises measuring element and the identification fragment with about 8-9 length of nucleotides, some or all of nucleic acid bases in the wherein said Nucleotide are compared with the natural acid base can be increased the non-natural of binding affinity base and substitute, and/or the some or all of nucleotide units in the described oligonucleotide probe are modified to increase binding affinity by chemical group, and/or wherein said oligonucleotide is modified to increase binding affinity by chemical group, probe will have with the target sequence bonded fully stable under the condition that is suitable for detecting like this, and, wherein, the institute that different identification number of fragments account for given length is possible segmental below 10%, and wherein the probe more than 90% can detect an above complementary target in the target nucleic acid colony, and the most of in fact target sequence in all target sequences of target nucleic acid colony can be detected in this oligonucleotide probe library thus.

Therefore, the present invention relates to the oligonucleotide probe library, each probe in its Chinese library all is made up of recognition sequence label and test section, wherein at least one monomer in each oligonucleotide probe is the monomer analogue of modifying, thereby compare with corresponding unmodified oligonucleotide (it for example can be the oligodeoxyribonucleotide or the oligoribonucleotide of unmodified), increased binding affinity to complementary target sequence, like this, the library probe has the substantive part that sufficient stability can be used for the combination of sequence-specific ground and detect the target nucleic acid of any given target colony, and, wherein the quantity of different recognition sequences account for given length might below 10% of sequence label.

The invention still further relates to the oligonucleotide probe library, the recognition sequence label fragment of its Chinese library probe is modified at least a following mode:

I) substituted by at least one non-natural nucleotide; With

Ii) substituted, to increase the stability of probe by at least one chemical group.

And, the invention still further relates to the oligonucleotide probe library, the long 6-12 of a recognition sequence label Nucleotide (that is, 6,7,8,9,10,11 or 12) wherein, and also wherein preferred length is 8 or 9 Nucleotide.

In addition, the invention still further relates to by the recognition sequence label of LNA nucleotide substitution.

Another part of the present invention is to comprise the oligonucleotide probe of formula I quencher and 5 '-nitroindoline residue.Think that this useful multiprobe itself is creationary.Preferred this probe does not have 5 ' guanidine radicals residue, and the probe of such invention usually is disclosed in this specification sheets and claims.Particularly preferred probe is a table 1, table 1A, Figure 13, or described those set of Figure 14.

In addition, the present invention relates to library of the present invention, wherein surpass 90% oligonucleotide probe can in conjunction with and detect at least two target sequences in the nucleic acid population, preferably because the recognition sequence complementation of bonded target sequence and probe.

And preferably, probe can detect an above target in the target nucleic acid colony, for example, probe can with contained a plurality of different making nucleic acid molecular hybridizations in the target nucleic acid colony.

The present invention also is provided for designing method, the system of the multiprobe that comprises at least one stabilization nucleic acid base and writes on computer program (" computer program ") on the computer-readable medium.Described method (for example comprises inquiry target sequence database, the expressed sequence database) and little probe set of design (for example, 50 or 100 200 or 300 or 500 kind), wherein said probe: 1) have under the PCR condition abundant combination stability in conjunction with its respective target sequence, ii) has the tendency that limited self forms the duplex structure, iii) can in conjunction with and all sequences of detected/quantified given sequence database (for example, expressed sequence database) at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95%.

Computer (In silico) designing probe might make up by Nucleotide to comprise the institute with given length, thereby forms virtual candidate probe database.These virtual probe are retrieved with respect to the target sequence database, have the probe (" best probe ") that detects the maximum capacity of maximum different target sequences in the database with discriminating.Take out the best probe of so differentiating from the virtual probe database.In addition, the target nucleic acid that deduction is differentiated by this previous best probe set from the target nucleic acid database.Remaining then probe is retrieved to differentiate second group of best probe with respect to remaining target sequence.Repeat this method up to differentiate one group of probe that can cover the target sequence database requiredly.This group probe storage can be used for the transcript group analysis as the sequence source in database.Can synthesize the multiprobe that has corresponding to the recognition sequence of sequence in this database, to produce the multiprobe library.

One preferred aspect, the target sequence database comprises corresponding to the nucleotide sequence of people mRNA (for example, mRNA molecule, cDNA etc.).

On the other hand, the inventive method also comprises computational stability, and this comprises the prerequisite of at least one stabilization Nucleotide (for example, LNA molecule) based on recognition sequence.One preferred aspect, the stability of utilize calculating before the discriminating of inquiring about with respect to the target sequence database first with initial best probe recognition sequence, is removed stable insufficient probe recognition sequence from virtual candidate probe database.

On the other hand, the inventive method also comprises the prerequisite that comprises at least one stabilization Nucleotide (for example LNA molecule) based on recognition sequence, calculates the tendency that given probe recognition sequence self forms the duplex structure.One preferred aspect, the proneness of utilize calculating before the discriminating of inquiring about with respect to the target sequence database first with initial best probe recognition sequence, is removed the probe recognition sequence that may form the probe duplex from virtual candidate probe database.

On the other hand, the inventive method also comprises by with respect to the inquiry of residue target sequence and the inquiry of gathering with respect to initial target sequence, estimates the suitability that given candidate probe recognition sequence can be added to ever-increasing best probe material standed for set.One preferred aspect, in the best probe recognition sequence set of having only the probe recognition sequence that frequently appears at simultaneously in residue target sequence and the initial target sequence just to be added into to increase.Aspect most preferred, this realizes in the following way: calculate the fractional product that is obtained by these inquiries, and select to have the highest product and at the probe recognition sequence that still belongs to 20% probe recognition sequence with best score in the inquiry of front target.

The present invention also provides the computer program that writes computer-readable medium, described program comprise be used for retrieving the database that comprises a plurality of different target sequences and be used to differentiate can determine described database at least about 60%, about 70%, about 80%, about 90% and the instruction of one group of probe recognition sequence of about 95% sequence.On the one hand, this program provides and implements the instruction of method as mentioned above.On the other hand, this program provides the instruction of enforcement algorithm as shown in Figure 2.The present invention also provides system, wherein said system comprises the holder of the database that is used to store the sequence information that comprises a plurality of different target sequences, also comprise the application program that is used to carry out following programmed instruction, described programmed instruction be used for from database retrieve can with database at least about 60%, one group of probe recognition sequence of about 70%, about sequence hybridization of 80%, about 90% and about 95%.

The present invention relates on the other hand and comprises the identification fragment that has about 1 to 8 or 9 length of nucleotides independently of one another and the oligonucleotide probe of measuring element, wherein the some or all of Nucleotide in the oligonucleotide can be increased the non-natural base of binding affinity or base analogue substitutes for the natural nucleotide base, and/or the some or all of nucleotide units of oligonucleotide probe are modified by chemical group or replaced to increase binding affinity by analogue, and/or wherein said oligonucleotide is modified by chemical group or oligonucleotide analogs is to increase binding affinity, like this, probe has under the condition that is suitable for detecting the abundant stability in conjunction with target sequence, and its middle probe can detect more than one complementary target in the target nucleic acid colony.

A preferred embodiment of the present invention is to be used to characterize or the test kit of detection or quantifying target nucleic acid, and described test kit comprises multiprobe library sample.On the one hand, test kit comprises computer (in silico) operation scheme at its purposes.On the other hand, test kit comprises and the relevant information of suggestion that obtains cheap dna primer.The probe that is comprised in these test kits can have above-mentioned arbitrary or all features.One preferred aspect, a plurality of probes all comprise at least one stabilization Nucleotide, for example LNA Nucleotide.On the other hand, a plurality of probes all comprise with the Nucleotide of at least one chemical group coupling or stable bond to increase the combination stability of probe.Again one preferred aspect, test kit comprises about 100 kinds of different probes.Allow the user to develop the mensuration that is used for thousands of different nucleic acid targets fast and effectively according to test kit of the present invention.

The present invention also provides the multiprobe that comprises one or more LNA Nucleotide, has the minimizing length of about 8 or 9 Nucleotide.By selecting common 8 and the 9-aggressiveness that occurs, can use same probe to detect many different genes as target.Each 8 or 9-aggressiveness probe can be used to detect different people mRNA sequence more than 7000.And essential specificity by at the DNA that cheap dna primer and target increased of target gene this 8 or the compound action of 9-aggressiveness probe sequence guarantee (Fig. 1).

In a preferred embodiment, the present invention relates to comprise the oligonucleotide multiprobe library of LNA alternate eight aggressiveness and nine aggressiveness, this library has and is less than about 1000 sequences, preferably be less than 500 sequences, or more preferably be less than about 200 sequences, for example form by about 100 different selected sequences, thus this library can discern about more than 90% in target biology or the target organ, more preferably about more than 95%, more preferably about mRNA sequence more than 98%.

Positive control sample:

Recurrent problem is when being designed for polygenic PCR in real time detection assay: these success ratios that from the beginning design are less than 100%.Find out that it may be thorny that non-functional is measured, because each probe needs a target-specific template to check the functional of this detection probes ideally.And if whether the unknown exists target in specimen, then the target-specific template can be used as positive control.The detection probes of the limited quantity in using probe of the present invention library test kit (for example, 90) when operating, but the positive control target of PCR amplification template form also can be provided, and this positive control target contains might target (for example, 90) at the institute of the probe of this limited quantity.This feature allows the user to estimate the function of each probe, and for the mensuration based on probe of non-reproduction, this feature is unfavorable, and this feature has constituted another useful feature of the present invention thus.At the preferred proposal probe recognition sequence that Figure 13 lists, we have designed the control sequence concatermer that is used for all probes, but to comprise the PCR amplified target that is used for preceding 40 each probes of probe.

Probe sequence is selected

An importance of the present invention is under the situation of given target choice criteria, to select best probe target sequence, so that use the least possible probe target to numerous targets.This can realize in the following way: select the frequency of occurrences to be higher than the target sequence of the frequency of occurrences that is contemplated to from stochastic distribution wittingly.

Therefore, one aspect of the present invention relates to the method for the oligonucleotide sequence that selection can use in multiprobe of the present invention library, and this method comprises

A) provide pre-determined quantity N (typically to be selected from 6,7,8,9,10,11 and 12 integer, preferably 8 or 9) Nucleotide might oligonucleotide first set (firstlist), described oligonucleotide has the melting temperature(Tm) T of at least 50 ℃ (preferably at least 60 ℃, for example at least 62 ℃) _m

B) provide second of target nucleic acid sequence to gather (second list) (for example set of the target nucleic acid colony of this paper discussion);

C) at each member of described first set, store second set member's of the complementary sequence that has comprised this member number from the described second set discriminated union respectively;

D) be chosen in the discriminating of step c with step c in described first set member of second set member coupling of the maximum quantity that identifies;

E) member who selects in the steps d is added into the 3rd set, the 3rd set is made up of the oligonucleotide of selecting that can be used in the library of the present invention;

F) member who selects among the deduction step d from described first set is to provide first set of revision;

M) repeating step d to f, gather by following member composition up to the described the 3rd, at least 30% member's complementation during described member can gather with the target nucleic acid sequence of step b together (normally, this percentage ratio will be higher, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or even higher, for example at least 97%, at least 98%, even up at least 99%).As another feature, have opposition and in the 3rd set, comprise the preference of the member with 5 ' guanidine radicals (G), and/or oppose in the 3rd set, to comprise the preference of the member with 3 ' guanidine radicals (G).This is the result of following wonderful discovery, and promptly when probe of the present invention did not contain 5 ' guanidine radicals residue, they were very effective in mensuration, but also verified, and the omission meeting of 3 ' guanidine radicals provides advantage under condition determination.

So, preferably, in all oligonucleotide sequences of described the 3rd set, avoid guanidine radicals as 5 ' residue.

Preferably, this first set only comprise can not oneself hybridization oligonucleotide have less false positive tendency so that subsequently probe is used.

Described system of selection can comprise several steps after step f but before step m:

G) all following members of deduction are to obtain second set of revision from described second set, and wherein said member comprises and member's complementary sequence of selecting in steps d;

H), from second set of described revision, differentiate and storage comprises quantity with the member of described each member's complementary sequence at each member of first set of described revision;

I) be chosen in the discriminating of step h with step h in the member of described first set of second set member coupling of the maximum quantity differentiated; Perhaps, select to provide described first set member of maximum number by the product of the quantity differentiated among the quantity differentiated among the step h and the step c;

J) member who selects in the step I is added described the 3rd set;

K) member who from first set of described revision, selects among the deduction step i; With

L) all following members of deduction from second set of described revision, described member comprise with step I in member's complementary sequence of selecting.

Preferably, following realization is above-mentioned avoids guanidine radicals as 5 ' residue: i) reduce the set of step a, only to comprise those sequences that do not comprise 5 ' guanidine radicals residue, and/or ii) avoid in steps d and/or i selecting to comprise those sequences of 5 ' guanidine radicals residue, and/or iii) in step e and/or j, omit those sequences that comprise 5 ' guanidine radicals residue.

The selection of steps d can be carried out after the following member in differentiating described first set easily behind the step c, surpass selected percentage ratio (60% or higher in described member and described second set, for example, the member who so differentiates is only selected in member's hybridization of greatest member's number preferably 80%) thus in steps d.

Method of the present invention also can comprise following characteristics, and the member who is not named as useful probe before promptly guaranteeing can not enter the 3rd set.Perhaps, with simpler description, after the design library, test each member's availability, the probe that will show suboptimum in related assays is included in " negative set ", when designing new probe and probe library afterwards, reexamines this " negative set ".The oligonucleotide sequence of qualitative failure before in the 3rd set, comprise, can: i) reduce the set of step a, there not to be those sequences of qualitative failure before only comprising, and/or do not have those sequences of qualitative failure before ii) avoiding in steps d or i, selecting, and/or iii) in step e and/or j, there are not those sequences of qualitative failure before the omission.

In the actual enforcement of this system of selection, described first, second gathered the storer that is stored in computer system with the 3rd, preferably in database.Storer (being also referred to as " computer-readable medium ") can be volatibility with non-volatile, that is, routine is used for any storing device of computer system: random-access memory (ram), read-only storage (ROM), data storage equipment be hard disk, CD-ROM, DVD-ROM and any other known storing device for example.

The present invention also is provided in the computer-readable medium (as above definition) and has write the computer program of implementing the instruction of system of selection of the present invention.That is, can in the high-speed computer storer, compile and this computer program of load, perhaps can be on permanent storage device (randomly with packed format) load and carry out this computer program from this storing device.Therefore, the present invention also comprises following system, and this system comprises the target sequence database and is used to carry out the application program of this computer program.Provided the source code that is used for this computer program among Figure 17.

In the nucleic acid population of stochastic distribution, the occurrence rate with selected sequence of given length will be followed with undefined statistical distribution:

The total length of this given nucleic acid population of N1=(in the RefSeq of the 1st issue on June 30th, 2003, being 76,002,917 base pairs for example).

The fragment number that this nucleic acid population of N2=comprises (in the RefSeq of the 1st issue on June 30th, 2003, being 38,556 genes for example).

The length of N3=recognition sequence (for example, 9 base pairs)

N4=occurrence rate

N4＝(N1-((N3-1)×2×N2))/(4 ^N3)

For example,

Perhaps

Therefore, as described in the above example, 8-aggressiveness at random and 9-aggressiveness sequence on average occur in the random population with described 38,556 mRNA sequences 1,151 time and 287 times respectively.

In above example, 76,002,917 base pairs that come from 38,556 genes will respectively contain 1971-16 or 1955 9-aggressiveness target sequences corresponding to the transcript length of average 1971bp.Therefore, as the statistics minimum value, for the gene, will need 38,556/1955/287 or 5671 9-aggressiveness probes for a probe target.

Yet the appearance of 9-aggressiveness sequence is not a stochastic distribution.In fact, group's sequence has surprising high occurrence rate, up to more than 30 times of the occurrence rate of anticipating from stochastic distribution.In a particular target colony of selecting according to preferred standard, preferably, should select modal sequence to increase the fraction of coverage in selected probe target sequence library.As previously mentioned, should progressively implement to select, so that in initial target colony and in the residue colony after each selects step, all the selection of modal target sequence is made an appraisal.

In a preferred embodiment of the invention, the target in probe library is the transcript group of whole expression.

Owing to the success ratio of reverse transcriptase reaction elongated the reducing of distance along with used RT primer, and, owing to usually use the poly-A tail of poly-T primer target mRNA, so above-mentioned target can further be limited to the base of only comprise among each mRNA 1000 nearsides.This can cause another selection of organizing best probe target sequence to obtain best fraction of coverage.

Similarly, above-mentioned target also can be limited to the coding region sequence that only comprises gene intron flank 50bp, preferably only monitor mRNA and monitoring gene group DNA not thereby guarantee to measure, perhaps, can be restricted to only comprise do not contain two-, three-or the zone of four-tumor-necrosis factor glycoproteins, to avoid combining repeatedly of probe or primer and the zone of not giving up known allelic variation, avoid because the target sequence of high GC content or primer that the sequence variations in the zone causes or the mistake annealing of probe, thereby avoid restraining effect pcr amplification.

Depend on each target selection, best probe set can change along with the ubiquity of the target sequence in each target selection.

The example in probe library

The people's gene group:, can extract the set of genome sequence from genome (it can be the people) by genome sequence being divided into the long fragment of 500 Nucleotide.Such probe library can be used to measure genome sequence arbitrarily, comprises the adjusting sequence, intron, tumor-necrosis factor glycoproteins and other genome sequence.By method disclosed herein, with reference to Figure 17, the library below having identified.

Be applicable to the table of the oligonucleotide (oligo) of people's gene group

# no	dnaID	?n	nmer	?newhit	?cover	?sum	?p	?tm	?sc	?self	lnaID	?ok	?oligo
														1	18805	?8	cagcctcc	9059	?9059	?9059	?15	?69	?60	?36	3365869	?1	?cAGCCTCC
2	21671	?8	cccaggct	3786	?8143	?12845	?22	?66	?56	?38	2543023	?1	?ccCAGGCT
														3	23888	?8	cctcccaa	2446	?8442	?15291	?26	?63	?56	?8	3660644	?1	?cCTCCCAA

70	58868	?8	tgccttca	123	?1578	?51468	?90	64	?54	28	8052716	1	?tGCCTTCA
														71	4583	?8	acactgct	122	?1495	?51590	?90	63	?54	36	1466287	1	?aCACTGCT
72	227199	?9	tctctcttt	116	?1652	?51706	?91	62	?55	0	62847999	1	?tCTCTCTTT
														73	31300	?8	ctggcaca	113	?1487	?51819	?91	65	?54	38	4156200	1	?cTGGCACa
74	59901	?8	tggctttc	113	?1456	?51932	?91	64	?54	36	8085501	1	?tGGCTTTC
														75	19796	?8	catcccca	110	?1496	?52042	?91	64	?56	16	3398508	1	?cATCCCCA
76	24039	?8	cctctgct	100	?1949	?52142	?91	64	?56	28	3661743	1	?cCTCTGCT
														77	10199	?8	agcttcct	95	?1717	?52237	?91	62	?54	38	1769327	1	?aGCTTCCT
78	61112	?8	tgtggtga	99	?1540	?52336	?92	66	?54	12	8121844	1	?tGTGGTGA
														79	58543	?8	tgcaggtt	106	?1381	?52442	?92	64	?54	38	8048063	1	?tGCAGGTT
80	22493	?8	cccttctc	90	?1719	?52532	?92	63	?56	0	3604349	1	?cCCTTCTC
														81	61397	?8	tgtttccc	92	?1538	?52624	?92	62	?54	14	8126317	1	?tGTTTCCC
82	59256	?8	tgctctga	95	?1423	?52719	?92	64	?54	36	8059892	1	?tGCTCTGA
														83	7911	?8	actgtgct	93	?1413	?52812	?92	64	?54	36	1568687	1	?aCTGTGCT
84	10196	?8	agcttcca	91	?1426	?52903	?93	63	?54	38	1769324	1	?aGCTTCCA
														85	251895	?9	ttcctttct	82	?1411	?52985	?93	62	?55	0	66519023	1	?tTCCTTTCT
86	63867	?8	ttgcctgt	81	?1506	?53066	?93	62	?54	28	8346615	1	?tTGCCTGT
														87	7655	?8	actctgct	86	?1260	?53152	?93	63	?54	28	1564591	1	?aCTCTGCT
88	234487	?9	tgcatttct	84	?1242	?53236	?93	62	?55	38	64389103	1	?tGCATTTCT
														89	64119	?8	ttggctct	75	?1425	?53311	?93	62	?54	36	8350703	1	?tTGGCTCT
90	59284	?8	tgctgcca	71	?1512	?53382	?93	67	?54	38	7011692	1	?tgCTGCCA

Bacterium: can be from NCBI: Ftp.ncbi.nih.govDownload 199 bacteriums and archeobacteria genome.According to the use of Nucleotide, genome can be classified.The equalization of Nucleotide is used, and every kind of Nucleotide (a, c, g, t) frequency of utilization is 25%.The impartial deviation of using can be that for example deviation surpasses 3%.According to this standard, 199 genomes are divided into: 91 AT enrichments, 44 GC enrichments, 28 do not have＞3% degree of bias, 21 A enrichments, 15 other classifications.

Bacterium can be height A T enrichment.What this can be interpreted as can not produce good fraction of coverage from the probe in people's probe library.Because low melting temperature(Tm) is for the biological designing probe that is rich in AT is a challenge.Probe must be longer, and reaching melting temperature(Tm), but this can reduce fraction of coverage.In below " bacterium table ", provided the main genomic probe library of being rich in AT (also differentiating) by the described program of Figure 17.

#no	dnaID	?n	nmer	?newhit	cover	sum	?p	tm	sc	?self	lnaID	ok	oligo
														1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20	64235 63976 228852 64099 64232 63721 237565 62951 63956 228855 65369 253945 16057 63843 53833 57321 63380 55679 261961 15689	?8 ?8 ?9 ?8 ?8 ?8 ?9 ?8 ?8 ?9 ?8 ?9 ?8 ?8 ?8 ?8 ?8 ?8 ?9 ?8	ttggtggt ttgctgga tcttcttca ttggcgat ttggtgga ttgatggc tgctttttc ttcctgct ttgctcca tcttcttct ttttccgc ttcttttgc attggtgc ttgccgat tcagcagc tctttggc ttctgcca tcgccttt tttttcagc attccagc	?15138 ?12289 ?11067 ?10164 ?9220 ?8466 ?8295 ?7481 ?6847 ?6418 ?6217 ?5716 ?5223 ?5032 ?4631 ?4344 ?4173 ?3935 ?3809 ?3267	15138 13631 12888 13063 13163 12948 12487 12549 12608 12133 11950 11886 12364 11970 12189 12242 11996 11760 11550 12463	15138 27427 38494 48658 57878 66344 74639 82120 88967 95385 101602 107318 112541 117573 122204 126548 130721 134656 138465 141732	?5 ?10 ?14 ?18 ?22 ?25 ?28 ?31 ?34 ?36 ?38 ?41 ?43 ?45 ?46 ?48 ?50 ?51 ?53 ?54	64 68 63 63 69 64 66 62 63 62 62 65 66 62 62 66 63 62 63 62	54 54 55 54 54 54 55 54 54 55 54 55 54 54 54 54 54 54 55 54	?12 ?36 ?8 ?38 ?12 ?28 ?28 ?28 ?30 ?0 ?28 ?28 ?36 ?38 ?38 ?28 ?36 ?28 ?28 ?28	8351671 8347572 62906348 8350631 8351668 8343477 64487421 8314799 8347500 62906351 8387445 66584565 2092533 8346535 7744309 7864245 8322412 7822335 67107637 2087733	1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1	tTGGTGGT tTGCTGGA tCTTCTTCA tTGGCGAT tTGGTGGA tTGATGGC tGCTTTTTC tTCCTGCT tTGCTCCA tCTTCTTCT tTTTCCGC tTCTTTTGC aTTGGTGC tTGCCGAT tCAgCAGC tCTTTGGC tTCTGCCA tCGCCTTT tTTTTCAGC aTTCCAGC

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86

57317 64916 58249 63717 57172 5759 65209 57236 55796 61332 98292 237439 97791 65429 59348 98295 59325 63855 63959 14973 55935 15083 261501 58345 40831 60409 65365 64932 32244 54911 64125 55805 57305 261621 60047 6047 56953 14565 32247 63969 253941 63465 65001 131028 59371 7805 59856 86004 63869 1695 59901 65161 8057 65449 228861 262005 5369 60395 62969 58341 8009 61341 55289 61413 261757 65179

?8 ?8 ?8 ?8 ?8 ?8 ?8 ?8 ?8 ?8 ?9 ?9 ?9 ?8 ?8 ?9 ?8 ?8 ?8 ?8 ?8 ?8 ?9 ?8 ?9 ?8 ?8 ?8 ?9 ?8 ?8 ?8 ?8 ?9 ?8 ?8 ?8 ?8 ?9 ?8 ?9 ?8 ?8 ?9 ?8 ?8 ?8 ?9 ?8 ?8 ?8 ?8 ?8 ?8 ?9 ?9 ?8 ?8 ?8 ?8 ?8 ?8 ?8 ?8 ?9 ?8

tctttgcc tttcgcca tgatgagc ttgatgcc tcttccca accgcttt tttggtgc tcttgcca tcgcttca tgttgcca cctttttca tgcttcttt ccttctttt ttttgccc tgcttcca cctttttct tgctgttc ttgccgtt ttgctcct atggcttc tcggcttt atggtggt ttttccttc tgattggc agcttcttt tggtttgc ttttcccc tttcggca acttcttca tccgcttt ttggcttc tcgctttc tctttcgc ttttcttcc tggggatt acctgctt tctgctgc atgatgcc acttcttct ttgctgac ttcttttcc ttcttggc tttctggc ctttttcca tgcttggt actgcttc tggctcaa ccattttca ttgccttc aacggctt tggctttc tttggagc acttctgc ttttgggc tcttctttc tttttctcc accattgc tggttggt ttccttgc tgattgcc acttcagc tgttgctc tcctttgc tgtttgcc ttttgcttc tttggcgt

3366 3161 3063 2792 2957 2572 2413 2393 2299 2138 2135 2102 2143 1855 1844 1911 1687 1597 1691 1439 1432 1394 1531 1286 1366 1221 1329 1152 1206 1024 1005 1084 958 1086 1010 922 847 854 891 802 841 788 738 776 681 673 658 739 626 637 623 629 592 643 632 652 523 511 577 485 483 475 519 481 455 428

11301 11512 11204 11450 10260 11074 11267 10890 10806 11233 10703 10423 9728 10845 10290 9610 10619 10785 9861 10673 10401 10337 9094 10495 9482 10407 9259 10181 9405 10796 10701 9724 10624 8914 9349 10045 10447 10029 9333 10101 9306 9701 10120 9397 10310 10218 10072 8750 9973 9529 9558 9307 9719 8621 8621 8108 9894 9801 8431 9841 9585 9458 8560 8906 9306 9562

?145098 ?148259 ?151322 ?154114 ?157071 ?159643 ?162056 ?164449 ?166748 ?168886 ?171021 ?173123 ?175266 ?177121 ?178965 ?180876 ?182563 ?184160 ?185851 ?187290 ?188722 ?190116 ?191647 ?192933 ?194299 ?195520 ?196849 ?198001 ?199207 ?200231 ?201236 ?202320 ?203278 ?204364 ?205374 ?206296 ?207143 ?207997 ?208888 ?209690 ?210531 ?211319 ?212057 ?212833 ?213514 ?214187 ?214845 ?215584 ?216210 ?216847 ?217470 ?218099 ?218691 ?219334 ?219966 ?220618 ?221141 ?221652 ?222229 ?222714 ?223197 ?223672 ?224191 ?224672 ?225127 ?225555

55 56 57 59 60 61 62 62 63 64 65 66 67 67 68 69 69 70 71 71 72 72 73 73 74 74 75 75 76 76 77 77 77 78 78 78 79 79 79 80 80 80 81 81 81 82 82 82 82 83 83 83 83 83 84 84 84 84 85 85 85 85 85 86 86 86

?64 ?63 ?62 ?62 ?62 ?65 ?63 ?65 ?62 ?64 ?65 ?65 ?54 ?64 ?64 ?64 ?62 ?62 ?62 ?65 ?65 ?65 ?62 ?65 ?65 ?65 ?62 ?64 ?65 ?62 ?64 ?62 ?62 ?62 ?68 ?65 ?64 ?63 ?64 ?62 ?62 ?64 ?64 ?64 ?65 ?64 ?63 ?62 ?62 ?63 ?64 ?65 ?64 ?68 ?63 ?62 ?63 ?66 ?62 ?63 ?62 ?62 ?64 ?63 ?65 ?64

54 54 54 54 54 54 54 54 54 54 53 55 53 54 54 53 54 54 54 54 54 54 55 54 55 54 54 54 55 54 54 54 54 55 54 54 54 54 55 54 55 54 54 53 54 54 54 53 54 54 54 54 54 54 55 55 54 54 54 54 54 54 54 54 55 54

?28 ?28 ?28 ?28 ?8 ?28 ?36 ?36 ?28 ?36 ?8 ?28 ?0 ?28 ?28 ?0 ?28 ?28 ?28 ?36 ?36 ?10 ?0 ?28 ?38 ?28 ?0 ?36 ?8 ?28 ?36 ?28 ?28 ?0 ?24 ?28 ?38 ?28 ?5 ?28 ?0 ?28 ?36 ?8 ?36 ?28 ?38 ?16 ?28 ?36 ?36 ?28 ?28 ?28 ?0 ?0 ?36 ?24 ?28 ?28 ?33 ?28 ?28 ?28 ?28 ?36

7864237 8379756 8027445 8343469 7863148 1502207 8383989 7863660 7823340 8125804 29360108 64486399 29351935 8387949 8060780 29360111 8060413 8346559 8347503 2059261 7826431 2060215 67099645 8028085 14154751 8093685 8387437 8379820 12574700 7793663 8350717 7823357 7864181 67100653 8088895 1506687 7842805 2052013 12574703 8347557 66584557 8322997 8380341 33554284 8060855 1567741 8085348 28573676 8346621 1240447 8085501 8383797 1571829 8388021 62906365 67107821 1495029 8093623 8314869 8028077 1571637 8125821 7798773 8126381 67103741 8383863

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

?tCTTTGCC ?tTTCGCCA ?tGATGAGC ?tTGATGCC ?tCTTCCCA ?aCCGCTTT ?tTTGGTGC ?tCTTGCCA ?tCGCTTCA ?tGTTGCCA ?cCTTTTTCA ?tGCTTCTTT ?cCTTCTTTT ?tTTTGCCC ?tGCTTCCA ?cCTTTTTCT ?tGCTGTTC ?tTGCCGTT ?tTGCTCCT ?aTGGCTTC ?tCGGCTTT ?aTGGTGGT ?tTTTCCTTC ?tGATTGGC ?aGCTTCTTT ?tGGTTTGC ?tTTTCCCC ?tTTCGGCA ?aCTTCTTCA ?tCCGCTTT ?tTGGCTTC ?tCGCTTTC ?tCTTTCGC ?tTTTCTTCC ?tGGGGATT ?aCCTGCTT ?tCTgCTGC ?aTGATGCC ?aCTTCTTCT ?tTGCTGAC ?tTCTTTTCC ?tTCTTGGC ?tTTCTGGC ?cTTTTTCCA ?tGCTTGGT ?aCTGCTTC ?tGGCTCAA ?cCATTTTCA ?tTGCCTTC ?aACGGCTT ?tGGCTTTC ?tTTGGAGC ?aCTTCTGC ?tTTTGGGC ?tCTTCTTTC ?tTTTTCTCC ?aCCATTGC ?tGGTTGGT ?tTCCTTGC ?tGATTGCC ?aCTTCAGC ?tGTTGCTC ?tCCTTTGC ?tGTTTGCC ?tTTTGCTTC ?tTTGGCGT

87 88 89 90

122877 59381 257917 60392

?9 ?8 ?9 ?8

ctctttttc tgctttcc ttgttcttc tggttgga

479 462 471 429

8379 8539 8098 8764

?226034 ?226496 ?226967 ?227396

?86 ?86 ?86 ?87

?62 ?63 ?62 ?70

?53 ?54 ?55 ?54

0 28 17 20

33030141 8060909 66845693 8093620

1 1 1 1

cTCTTTTTC tGCTTTCC tTGTTCTTC tGGTTGGA

Select detection means and differentiate mononucleotide

Another part of the present invention relates to the method that is used to differentiate the means that detect target nucleic acid, and this method comprises:

A) import the data of determining the nucleotide sequence of described target nucleic acid uniquely to computer system, wherein said computer system comprises the composition database of information that accommodates at least one nucleic acid probe of the present invention library, and, wherein said computer system also comprises the target nucleic acid sequence database at each probe in described at least one library, and/or also comprises the means of obtaining and comparing nucleic acid sequence data;

B) differentiate probe from described at least one library in this computer system, the sequence of wherein said probe is present in the target nucleic acid sequence or is present in the complementary sequence of this target nucleic acid sequence;

C) in computer system, differentiate the primer of the described target nucleic acid sequence that can increase; With

D) provide the output result who points out the primer sequence differentiated among the probe differentiated among the step B and the step C, as the specific discriminating means that are used to detect.

When expectation was differentiated specific nucleic acid fast and specifically, aforesaid method had several advantages.If the investigator has obtained suitable multiprobe of the present invention library, this method makes the relevant information that can obtain the relevant library probe that should be applied to measure subsequently in the several seconds and relevant information that should the synthetic primer.Because primer is synthetic to spending the night, and synthesizing of probe is normally very time-consuming and loaded down with trivial details, so time factor is important.

In order to help the application of this method, can identify probe library (for example, the product code of the composition by can informing this probe library of computer system basically).Thus, steps A comprises the data to described at least one nucleic acid library of computer system input sign, expectation is selected the member who uses from this nucleic acid library the particular detection means.

Preferred inputting interface is based on the web interface of Internet, because this method can be stored on the webserver easily to allow the user who obtains probe of the present invention library to enter.Yet this method also can be as the part that can be installed in the mount type computer applied algorithm on single computer or the local area network.

In the preferred embodiment of this method, select the primer of differentiating among the step C so that be minimized in the possibility of amplification gene group nucleic acid in the PCR reaction.This certainly only may contain under the situation of genomic material at sample is appropriate.A kind of mode of the minimizing possibility of amplification gene group nucleic acid that simply makes is to be included in the nucleotide sequence that is interrupted by intron in the genomic dna at least one primer.In this way, primer will only cause the amplification that the transcript of intron has been removed in montage.

Perhaps, can select can not amplifying genom DNA or the primer of other transcript right.By using primer to carry out computerized search at this genome and transcript group, promptly computer PC R can differentiate such primer.It is right that following primer be found and be filtered to such search must, and wherein a left side and right primer can mate the DNA in the typical amplicon length distance, and described length can be 600 Nucleotide or thousands of Nucleotide.Left and right primer can mate in 4 kinds of different modes: 1: the reverse complemental chain of left primer and right primer.2: the reverse complemental chain of left primer and left primer.3: the reverse complemental chain of right primer and left primer.4: the reverse complemental chain of right primer and right primer.

Another optimization of the inventive method is to select primer among the step C to minimize the length of the amplicon that obtains from the pcr amplification of target nucleic acid sequence, in addition, also preferred select this primer to optimize GC content so that implement subsequently PCR.

With regard to the probe system of selection, can provide the method for selecting detection means for the terminal user so that the computer program form of the enforcement instruction of the present invention that writes on the computer-readable medium to be provided.Therefore, the present invention also provides the system that comprises probe of the present invention library database and carry out the application program of this computer program.

This method and computer program and system allow the existence of target nucleic acid in qualitative or definite quantitatively sample, and it comprises

I) by detection means system of selection of the present invention, differentiate the special means that are used to detect target nucleic acid, this limited means that wherein is used to detect comprises oligonucleotide probe and one group of primer;

Ii) obtain in step I) in primer and the oligonucleotide probe differentiated;

Iii) from step I i) primer and oligonucleotide probe in the presence of sample is implemented the molecular cloning program; With

Iv) determine the existence of target nucleic acid based on step I result ii).

Easily, step I i) primer that obtains in obtains by synthetic, and preferably this oligonucleotide probe available from library of the present invention.

The molecular cloning method is PCR or NASBA program typically, but any in vitro method that is used for nucleic acid specificity amplification (with detecting possibly) also all is useful.Preferred PCR method is qPCR (being also referred to as real-time reverse transcription PCR or dynamic RT-PCR).

Others of the present invention are discussed following.

The accompanying drawing summary

Fig. 1 illustrates the use of conventional long probe in (A) figure, and in (B) figure characteristic and use from the short multiprobe in the library that makes up according to the present invention is described.This weak point multiprobe comprises the identification fragment of selection, and each probe sequence all can be used to detect and/or quantitatively comprise the several different target sequences of complementary recognition sequence like this.Figure 1A shows the method according to prior art.Figure 1B shows the method according to one aspect of the invention.

Fig. 2 is the schema of method that shows the multiprobe sequence in the library be used for design consideration one aspect of the invention.This method can be implemented by the instruction that computer program provided that execution writes on the computer-readable medium.In one aspect, this programmed instruction is by comprising sequence library, and for example the system of expressed sequence database carries out.

The redundancy of Fig. 3 explanation probe of each gene of target in according to the library of 100 probes of one aspect of the invention.Y-axis shown in people's transcript group by the probe target of different quantities in the library to the gene number.Significantly, in all genes most of genes all by several probe targets to.The average number of probes of every gene is 17.4.

Fig. 4 shows the fraction of coverage of the super redundant oligonucleotide with given length of selection to people's transcript group.The figure illustrates in about 38,000 people mRNA sequences the percentage ratio that the selected short multiprobe of different lengths that can be by increasing progressively quantity detects.This figure illustrates that (that is super redundant, non-self-complementary, heat-staple) short multiprobe of optimal selection of different lengths is to the theoretical coverage rate of people's transcript group.This homo sapiens (Homo sapiens) transcript group sequence obtains from European bioinformation mechanism (EMBL-EBI).The 1000nt zone (3 ' terminal upstream 50nt to 1050nt) near each mRNA sequence 3 ' end is used to analyze.By behind the pcr amplification, two chains of the duplex of amplification all are considered to effective target of the multiprobe in the probe library in each sequence.Get rid of even have probe sequence and self the complementary probe sequence that does not also have suitable Tm under the LNA alternate situation.

Fig. 5 shows the MALDI-MS spectrum of oligonucleotide probe EQ13992, shows [M-H] ^-=4121,3Da.

Fig. 6 is presented at the typical PCR in real time curve that uses 9-aggressiveness multiprobe to detect target sequence in the double-tagging probe assay.The result is from the real-time PCR reactions that uses the same intragenic different 9-aggressiveness sequences of LNA enhanced double-tagging 9nt long probe target.In PCR, analyze three different double-tagging probes respectively, produce 469,570 or 671 SSA4 amplicon (each length 81 is to 95nt).Figure a, b and c show double-tagging probe 469,570 and 671 respectively.Each probe only detects its amplicon that is designed for detection.For double-tagging probe 469,570 and 671, C _tValue is respectively 23.7,23.2 and 23.4.Add 2 * 10 ⁷The SSA4 cDNA of individual copy is as template.Although probe sequence and its corresponding primer on all there are differences, highly similar between the result, this illustrates that this mensuration is very reliable.

Fig. 7 shows the example of the PCR in real time curve of the molecular beacon with 9-aggressiveness and 10-aggressiveness recognition site.Figure (A): the molecular beacon probe with 10-aggressiveness recognition site detects the 469SSA4 amplicon.Only be added with SSA4 cDNA (2 * 10 ⁷Copy) picked up signal in the sample.Obtain 24.0 C _tValue.Figure (B) has shown the similar experiment that uses the molecular beacons detection 570SSA4 amplicon with 9-aggressiveness recognition site.Only adding SSA4 cDNA (2 * 10 ⁷Individual copy) the picked up signal time.

Fig. 8 shows to use to have the PCR in real time curve example of the SYBR probe target of 9-aggressiveness recognition site to the 570SSA4 amplicon.Only adding SSA4 cDNA (2 * 10 ⁷Individual copy) picked up signal in the sample, and when not adding template, detect less than signal.

Fig. 9 shows the working curve of three different 9-aggressiveness multiprobes that use double-tagging probe assay principle obtains.SSA4 cDNA by the different copy number levels of three double-tagging probe in detecting.Cycle number when cycle threshold nr defines each PCR and detects signal first.Slope of three linear regression lines (α) and relation conefficient (R ²) be: α=-3.456﹠amp; R ²=0.9999 (double-tagging 469); α=-3.468﹠amp; R ²=0.9981 (double-tagging 570); α=-3.499﹠amp; R ²=0.9993 (double-tagging 671).

Figure 10 is presented at the quantitative heat shock protein(HSP) of multiprobe that is exposed to before the heat-shocked and utilizes 9-aggressiveness double-tagging afterwards in wild-type yeast strain and mutant strain, has wherein lacked this corresponding gene in described mutant strain.Shown that 570 probes that utilize double-tagging knock out the real-time detection of the SSA4 transcript level in the mutant to wild-type (wt) yeast and SSA4.Described different strains 30 ℃ of cultivations up to results (HS) or before results, be exposed to 40 ℃ 30 minutes.Use 570 probes of double-tagging in this example.Only detect this transcript in wt type bacterial strain, this transcript is extremely a large amount of in+HS culture.For+HS and-the HS culture, C _tValue is respectively 26.1 and 30.3.

Figure 11 shows an example that how does not detect simultaneously the nucleic acid molecule that does not contain probe target sequence (that is, with the recognition sequence complementation) by above gene of identical 9-aggressiveness probe in detecting.In (a), 469 of double-tagging had both detected SSA4 (469 amplicon) and had also detected POL5 transcript, C _tValue is respectively 29.7 and 30.1.Do not detect signal from APG9 and HSP82 transcript.In (b), 570 of double-tagging had both detected SSA4 (570 amplicon) and had also detected APG9 transcript, C _tValue is respectively 31.3 and 29.2.Do not detect signal from POL5 and HSP82 transcript.In (c), 671 of double-tagging had both detected SSA4 (671 amplicon) and had also detected HSP82 transcript, C _tValue is respectively 29.8 and 25.6.Do not detect signal from POL5 and APG9 transcript.Be presented at the amplicon that produces among the different PCR in the caption.Use cDNA with the described mensuration same amount of Figure 10.Only use from the cDNA of the wild-type yeast of heat-shocked not.

Figure 12 is presented at the agarose gel electrophoresis of the part amplicon that produces in the PCR reaction shown in the example of Figure 11, illustrates that probe is special to the target sequence that comprises recognition sequence, but its not with the making nucleic acid molecular hybridization that does not contain this target sequence.Swimming lane 1 contains SSA4-469 amplicon (81bp), and swimming lane 2 contains POL5 amplicon (94bp), and swimming lane 3 contains APG9 amplicon (97bp), and swimming lane 4 contains HSP82 amplicon (88bp).Swimming lane M contains the 50bp gradient as big or small indicator.Significantly, in all 4 kinds of situations, all formed product; Yet the amplification (that is, SSA4-467 and POL5) that only comprises correct multiprobe target sequence is detected by the probe 467 of double-tagging.Detected segmental difference in size from swimming lane 1 and 2 has produced and has detected two kinds of different amplifications on speaking.

Figure 13: preferred target sequence.

Figure 14: other preferred target sequence.

Figure 15: long polymers (1ongmer) (positive control).Sequence is presented among the SEQ ID NOs.32-46.

Figure 16: select probe and the scheme that is designed for the primer of qPCR.

Figure 17: the source code of the program of in the calculating of multiprobe data set, using.

Figure 18: carry out the result that PCR in real time obtains with the probe that carries Q4 quencher and fluorescein(e) dye.

Figure 19: the probe with the double-tagging of carrying 3 '-nitroindoline carries out the result that PCR in real time obtains.

Figure 20: the probe of using target sequence with respect to amplification to have fully coupling or single mispairing carries out the result that PCR in real time obtains.In contrast, in experimental group, comprise the PCR that does not add template.

Detailed Description Of The Invention

The present invention relates to short oligonucleotide probe or multiprobe, it is selected and is designed for detection, classification or characterizes and/or quantitative many different target nucleic acid molecules. These multiprobes comprise at least one and for increasing probe the non-natural of the binding affinity of recognition sequence are modified (for example, LNA nucleotides), and wherein said recognition sequence is the subsequence of target nucleic acid molecule. These target nucleic acid molecules are different outside this recognition sequence.

On the one hand, multiprobe comprises at least one and modifies to increase probe to the nucleotides of the binding affinity of recognition sequence (it is the subsequence of target nucleic acid sequence) with chemical group. On the other hand, probe comprises at least one non-natural nucleotides and at least one nucleotides of being modified by chemical group. On the one hand, described at least one non-natural nucleotides is modified by chemical group again. The present invention also provides kit, library and other composition that comprises described probe.

The present invention also provides i) for the method for the suitable oligonucleotide probe of given target sequence mixture Choice and design, ii) have the single probe of these abilities, and an iii) through Choice and design so that probe sequence that can enough minimum numbers detect, classification and/or quantitative this type of probe library of the target nucleotide of maximum quantity. Therefore all can be in conjunction with many different targets according to each probe of the present invention, and can be for creating special mensuration during one group of Specific primer pair in measuring with PCR.

Preferred nucleotides of the present invention is made up of about 8 to 9 nucleotide units, and its substantive part comprises stabilisation nucleotides, for example LNA nucleotides. Preferred library contains 100 the such probes of having an appointment, and these probes can characterize one group of specific nucleic acid through Choice and design, for example, and mRNA, cDNA or genomic DNA. Can there be multiple use in this library, for example, and (seeing for example Fig. 1) such as gene expression analysis, SNP detections.

Definition

The particular term of using in open for the present invention provides as giving a definition.

Unless context has clearly separately explanation, as used herein, singulative " a ", " an " and " the " comprise the situation of plural number. For example, term " cell " comprises a plurality of cells, comprises its mixture. Term " nucleic acid molecules " comprises a plurality of nucleic acid molecules.

In this article, term " transcript group " (transcriptome) refers to the full set that the element of any species gene group transcription consists of.

Except mRNA, this term also refers to for structure and regulates the non-coding RNA of purpose.

In this article, term " amplicon " refers to little repetition DNA fragment.

Herein, " sample " refers to from tissue or the humoral sample of one or more organisms separation, including but not limited to, for example, skin, blood plasma, serum, spinal fluid, lymph liquid, synovia, urine, tears, blood cell, organ, tumour, and cell in vitro is cultivated the sample of component (including but not limited to the conditioned medium, recombinant cell and the cellular component that produce by the growth of cell in cell culture medium).

As used herein, " biology " refers to entity alive, including but not limited to, for example, people, mouse, rat, fruit bat (such as D.melanogaster), Caenorhabditis elegans (C.elegans), yeast, arabidopsis (Arabidopsis), zebra fish, primate (such as chimpanzee), domestic animal etc.

Term " SBC nucleic acid base " refers to " complementation of selective binding " nucleic acid base, that is, can form stable hydrogen bond with its complementary nucleic acid base but can not form with other SBC nucleic acid base the nucleic acid base of the modification of stablizing hydrogen bond. For example, SBC nucleic acid base A ' can form with the non-modification of nucleic acids base T of its complementation stable hydrogen bonding pair. Equally, SBC nucleic acid base T ' can form with the non-modification of nucleic acids base A of its complementation stable hydrogen bonding pair. Yet SBC nucleic acid base A ' and T ' and base-pair A '-T compare with A-T ' the unsettled hydrogen bonding of formation pair. Similarly, the SBC nucleic acid base of C is known as C ', can form with the non-modification of nucleic acids bases G of its complementation stable hydrogen bonding pair, and the SBC nucleic acid base of G is known as G ', can forms with the non-modification of nucleic acids base C of its complementation stable hydrogen bonding pair; And compare with C-G ' with base-pair C '-G, C ' and G ' will form unsettled hydrogen bonding pair. Obtain stable hydrogen bonding pair when the hydrogen bond that forms more than 2 or 2, for example, what form between A ' and T, A and T ', C and G ' and C ' and the G is right. When forming 1 hydrogen bond or not forming hydrogen bond, obtain unsettled hydrogen bonding pair, for example, right between A ' and T ' and C ' and the G '.

Especially significant SBC nucleic acid base be 2,6-diaminopurine (A ', be also referred to as D) and 2-paper substrate (U ', be also referred to as^2SU) (2-sulfo--4-oxo-pyrimidine) and 2-thio-thymine (T ', be also referred to as^2ST) (2-sulfo--4-oxo-5-methyl-pyrimidine). Fig. 4 illustrates A-^2ST and D-T are to having the hydrogen bond more than 2 or 2, and D-^2ST single to forming (unsettled) hydrogen bond. Similarly, Fig. 9 has shown SBC nucleic acid base pyrrolo--[2,3-d] pyrimidine-2 (3H)-ketone (C ', be also referred to as PyrroloPyr) and hypoxanthine (G ', be also referred to as I) (6-oxo-purine), wherein PyrroloPyr-G and C-I be to respectively having 2 hydrogen bonds, and PyrroloPyr-I is to forming single hydrogen bond.

" SBC LNA oligomer " refers to contain " the LNA oligomer " of at least one " LNA unit ", and wherein this nucleic acid base is " SBC nucleic acid base ". " the LNA unit with SBC nucleic acid base " refers to " SBC LNA monomer ". In general, SBC LNA oligomer comprises the oligomer that also contains nucleotides other modification or natural or nucleosides except SBC LNA monomer. " SBC monomer " refers to have the non-LNA monomer of SBC nucleic acid base. " wait sequence oligonucleotides " and refer to the oligonucleotides that has identical sequence on the Watson-Crick meaning with corresponding modified oligonucleotide, for example, sequence agTtcATg is equivalent to agTscD^2SUg, wherein s is equivalent to SBC dna single body 2-sulfo--t or 2-sulfo--u, and D is equivalent to SBC LNA monomer LNA-D,^2SU is equivalent to SBC LNA monomer LNA^2SU。

As used herein, term " nucleic acid ", " polynucleotides " and " oligonucleotides " guide thing, probe, oligomer fragment, oligomer contrast and unlabelled sealing oligomer to be detected, and should belong to polydeoxyribonucleotide (containing DRI), polybribonucleotide (containing D-ribose) and as the polynucleotides of any other type of the N glucosides of the purine of purine or pyrimidine bases or modification or pyrimidine bases. Do not have the length difference of having a mind between term " nucleic acid ", " polynucleotides " and " oligonucleotides ", these terms can Alternate. These terms only refer to the primary structure of molecule. Therefore, these terms comprise double-stranded and single stranded DNA and two strands and single stranded RNA. Oligonucleotides is by corresponding at least 3 nucleotides of pact of the nucleotides sequence column region of appointment, preferably at least about 6 nucleotides, and more preferably the sequence at least about 8 to 30 nucleotides forms. " corresponding " refers to identical or complementary with the sequence of this appointment.

Physically, oligonucleotides not necessarily derives from any existing or natural sequence, but can produce by any way, comprises chemical synthesis, dna replication dna, reverse transcription or its combination. Term " oligonucleotides " or " nucleic acid " mean semi-synthetic source or the genomic DNA in synthetic source or the polynucleotides of RNA, cDNA, according to its source or operation, these polynucleotides: (1) with natural with it all or part polynucleotides that are connected and all do not link to each other; And/or (2) connect with non-its natural polynucleotides that are connected; (3) be non-existent in natural.

Because the 5 ' phosphoric acid of the reaction between the mononucleotide by the pentose ring of a mononucleotide is adjacent 3 ' oxygen of mononucleotide and connects by phosphodiester bond by certain orientation and form oligonucleotides, so the end of oligonucleotides is not known as " 5 ' end " when 5 ' phosphoric acid of oligonucleotides is connected with 3 ' oxygen of mononucleotide pentose ring, if when its 3 ' oxygen is not connected with 5 ' phosphoric acid of the pentose ring of subsequently mononucleotide then the end of this oligonucleotides is known as " 3 ' end ". In this article, one section nucleotide sequence, even be positioned at the inside of bigger oligonucleotides, also have 5 ' and 3 ' end.

When the zones of different of two different non-overlapped oligonucleotides and same linear complementary nucleotide sequence was annealed, 3 ' end of an oligonucleotides will be facing to 5 ' end of another oligonucleotides; The former can be known as " upstream " oligonucleotides, and the latter is known as " downstream " oligonucleotides.

Term " primer " can refer to an above primer, it referred to when the primer extension product that is placed on catalysis and nucleic acid chains complementation synthetic lower time of condition, the oligonucleotides that can work as the synthetic starting point along complementary strand, and no matter this oligonucleotides is natural (with the form of the restrictive diges-tion product of purifying) or synthetic generation. Described Conditional Include is for example archaeal dna polymerase or reverse transcriptase of 4 kinds of different deoxyribonucleoside triphosphates of existence and polymerisation induced agent in suitable buffer solution (" buffer solution " comprises as co-factor or affect the component of pH, ionic strength etc.) and under preference temperature. Primer preferably strand in order to obtain maximum amplification efficiency.

As used herein, term " PCR reaction ", " pcr amplification ", " PCR " and " PCR in real time " be can Alternate term, it is used in reference to uses the target nucleic acid that the nucleic acid amplification system is detected with amplification. The example of this system comprises PCR (PCR) system and ligase chain reaction (LCR) system. Other method of well known by persons skilled in the art and recent description has the amplification (NASBA based on nucleotide sequence^TM, Cangene, Mississauga, Ontario) and Q β replicase system. The product that forms by described amplified reaction can detect in real time or also can not carry out Real-Time Monitoring, perhaps only carries out terminal point and measure after reaction.

Herein, the complement of nucleotide sequence refers to when aliging with this nucleotide sequence so that the 5 ' oligonucleotides that exists antiparallel to concern with this nucleotide sequence when terminal and 3 of another sequence ' terminal pairing of a sequence. Can be included in uncommon base in the natural acid in nucleic acid of the present invention, these bases comprise for example trophicardyl and the assorted guanine (7-deazaguanine) of 7-denitrogenation. Complementation can not be completely; Stable duplex can contain base mismatch to or unpaired base. The technical staff in nucleic acid field can consider a plurality of variablees by experience ground, the right incidence of percent concentration, ionic strength and base mismatch that comprises cytimidine and guanine base in the length, oligonucleotides of oligonucleotides for example is to determine the stability of duplex.

The stability of nucleic acid duplex can be measured by melting temperature or " Tm ". The Tm of specific nucleic acid duplex is the temperature of half base-pair when dissociating under rated condition.

As used herein, the sequence in the oligonucleotides of term " probe " digit synbol, itself and target nucleic acid is owing at least one section sequence in the probe and the complementary duplex structure that forms of the sequence in this target area. Probe does not preferably contain the sequence with the sequence complementation that is used as the PCR primer. Usually, 3 of probe ' end is mixed primer extension product by " sealing " with the prevention probe. " sealing " can by use the incomplementarity base or by to 3 ' hydroxyl interpolation chemical group of last nucleotides for example biotin or even phosphate group (depend on selected part, this can reach dual purpose by the effect of also playing mark) realize.

Term " label " refers to be used for providing any atom or the molecule that can detect (preferably can be quantitative) signal and can be connected with nucleic acid or protein in this article. Label can provide and can pass through the signal that fluorescence, radioactivity, colorimetric, X-ray diffraction or absorption, magnetic, enzymatic activity etc. detect.

As used herein, " 5 ' → 3 ' nuclease " or " 5 ' to 3 ' nuclease " refer to the activity of template specificity nucleic acid polymerase, comprise 5 conventional relevant with some archaeal dna polymerases ' → 3 ' exonuclease activity--by this activity, nucleotides is removed (for example, e. coli dna polymerase I has this activity Klenow fragment and then do not possess this activity) from 5 ' end of oligonucleotides successively--perhaps 5 ' → 3 ' endonuclease enzymatic activity--excise the position of its middle distance 5 ' above nucleotides of end--perhaps both.

As used herein, term " thermally-stabilised nucleic acid polymerase " refers to and for example compares the enzyme that heating has relatively high stability and the polymerization of catalysis nucleosides from colibacillary nucleotide polymerase. Usually, this enzyme with 3 of the primer of target sequence annealing ' terminal initial synthetic, and advance towards 5 ' direction along template, and, if it has 5 ' to 3 ' nuclease the time, to be hydrolyzed or replace intervention annealing probe therebetween with release mark and unlabelled probe fragment or complete probe, until synthetic the termination. Separation is described in United States Patent (USP) 4 from the representative thermophilic enzyme (Taq) of thermus aquaticus (Thermus aquaticus), 889, in 818, in conventional PCR, use its method to be described in (1988) such as Saiki, among the Science239:487.

Term " nucleic acid base " comprises natural acid bases adenine (A), guanine (G), cytimidine (C), thymidine (T) and uracil (U) and non-natural nucleic acid base for example xanthine, diaminopurine, 8-oxo-N⁶-methyl adenine, 7-denitrogenation heteroxanthine, the assorted guanine of 7-denitrogenation, N⁴，N ⁴-ethano-cytimidine (ethanocytosin), N⁶，N ⁶-ethano-(ethano)-2,6-diaminopurine, 5-methylcytosine, 5-(C³-C ⁶The United States Patent (USP) 5 of)-alkynyl-cytimidine, 5 FU 5 fluorouracil, 5-bromouracil, pseudouracil (pseudoisocytosine), 2-hydroxy-5-methyl base-4-Triazolopyridine, iso-cytosine, isoguanine, trophicardyl and Benner etc., 432,272 and Susan M.Freier and Karl-Heinz Altmann, Nucleic Acid Research, 25:4429-4443, " non-natural " nucleic acid base of describing in 1997. Term " nucleic acid base " not only comprises known purine and pyrimidine heterocyclic thus, also comprises their heterocyclic analogs and dynamic isomer. Other natural and non-natural nucleic acid base comprises those as describing in the Publication about Document: United States Patent (USP) 3,687,808; Antisense Research and Application, S.T.Crooke and B.Lebleu compile, CRC Press, the 15th chapter of Sanghvi work in 1993; Englisch etc., Angewandte Chemie, International Edition, 30:613-722,1991 (seeing especially the 622nd and 623 page); And Concise Encyclopedia of Polymer Science and Engineering, J.I.Kroschwitz Ed., John Wiley﹠Sons, 858-859 page or leaf, 1990; Cook, Anti-Cancer DrugDesign6:585-607,1991; All above-mentioned documents are complete being incorporated herein by reference hereby.

Term " nucleoside base " or " nucleic acid base analog " also are intended to comprise the heterocyclic compound that can work as nucleoside base, comprise some " universal base ", these bases are not that still it can serve as nucleoside base to nucleoside base by the most classical meaning. Especially " universal base " that can mention is 3-nitro-pyrrole and 5-nitroindoline. Other preferred compound comprises pyrene and pyrido  Zole derivatives, pyrenyl, pyrenyl methyl-prop triol derivates etc. Other preferred universal base comprises, and pyrroles, diazole or triazole derivative comprise those universal base known in the art.

" universal base " refers to natural or desirably non-natural compound or group, its can with natural base (for example, adenine, guanine, cytimidine, uracil and/or thymidine) pairing and as described herein have differ from 15,12,10,8,6,4 or 2 ℃ or still less Tm.

" oligonucleotides ", " oligomer " or " few thing " refer to a continuous monomer (for example, the glucosides of the heterocyclic base) chain by key connection between nucleosides. Key in few thing between two continuous monomers by 2 to 4, desirably 3 group/atoms form, described group/atom is selected from :-CH₂-、-O-、-S-、-NR ^H-、＞C＝O、＞C＝NR ^H、＞C＝S、-Si(R″) ₂-、-SO-、 -S(O) ₂-、-P(O) ₂-、-PO(BH ₃)-、-P(O，S)-、-P(S) ₂-、-PO(R″)-、-PO(OCH ₃)-and-PO (NHR^H)-, be R wherein^HBe selected from hydrogen and C_1-4Alkyl, and R " is selected from C_1-6-alkyl and phenyl. The illustrative example of this key has-CH₂-CH ₂-CH ₂-、-CH ₂-CO-CH ₂-、 -CH ₂-CHOH-CH ₂-、-O-CH ₂-O-、-O-CH ₂-CH ₂-、-O-CH ₂-CH=(comprises R when as the key that forms with monomer subsequently⁵)、-CH ₂-CH ₂-O-、-NR ^H-CH ₂-CH ₂-、-CH ₂-CH ₂-NR ^H-、 -CH ₂-NR ^H-CH ₂-、-O-CH ₂-CH ₂-NR ^H-、-NR ^H-CO-O-、-NR ^H-CO-NR ^H-、-NR ^H-CS-N R ^H-、-NR ^H-C(＝NR ^H)-NR ^H-、-NR ^H-CO-CH ₂-NR ^H-、-O-CO-O-、-O-CO-CH ₂-O-、 -O-CH ₂-CO-O-、-CH ₂-CO-NR ^H-、-O-CO-NR ^H-、-NR ^H-CO-CH ₂-、-O-CH ₂-CO-NR ^H-、 -O-CH ₂-CH ₂-NR ^H-、-CH＝N-O-、-CH ₂-NR ^H-O-、-CH ₂-O-N=(comprises R when as the key that forms with monomer subsequently⁵)、-CH ₂-O-NR ^H-、CO-NR ^H-CH ₂-、CH ₂-NR ^H-O-、 CH ₂-NR ^H-CO-、-O-NR ^H-CH ₂-、-O-NR ^H-、-O-CH ₂-S-、-S-CH ₂-O-、-CH ₂-CH ₂- S-、-O-CH ₂-CH ₂-S-、-S-CH ₂-CH=(comprises R when as the key that forms with monomer subsequently⁵)、 -S-CH ₂-CH ₂-、-S-CH ₂-CH ₂-O-、-S-CH ₂-CH ₂-S-、-CH ₂-S-CH ₂-、-CH ₂-SO-CH ₂-、 -CH ₂-SO ₂-CH ₂-、-O-SO-O-、-O-S(O) ₂-O-、 -O-S(O) ₂-CH ₂-、-O-S(O) ₂-NR ^H-、-NRH-S(O) ₂-CH ₂-、-O-S(O) ₂-CH ₂-、 -O-P(O) ₂-O-、-O-P(O，S)-O-、-O-P(S) ₂-O-、-S-P(O) ₂-O-、-S-P(O，S)-O-、 -S-P(S) ₂-O-、-O-P(O) ₂-S-、-O-P(O，S)-S-、 -O-P(S) ₂-S-、-S-P(O) ₂-S-、-S-P(O，S)-S-、-S-P(S) ₂-S-、-O-PO(R″)-O-、 -O-PO(OCH ₃)-O-、-O-PO(OCH ₂CH ₃)-O-、 -O-PO(OCH ₂CH ₂S-R)-O-、-O-PO(BH ₃)-O-、-O-PO(NHR ^N)-O-、-O-P(O) ₂-NR ^H-、 -NR ^H-P(O) ₂-O-、-O-P(O，NR ^H)-O-、-CH ₂-P(O) ₂-O-、-O-P(O) ₂-CH ₂-and-O-Si (R ")₂-O-; Especially the expectation be wherein-CH₂-CO-NR ^H-、-CH ₂-NR ^H-O-、 -S-CH ₂-O-、-O-P(O) ₂-O-、-O-P(O，S)-O-、-O-P(S) ₂-O-、-NR ^H-P(O) ₂-O-、 -O-P(O，NR ^H)-O-、-O-PO(R″)-O-、-O-PO(CH ₃)-O-and-O-PO (NHR^N)-O-, wherein R^HBe selected from hydrogen and C_1-4-alkyl, and R " is selected from C_1-6-alkyl and phenyl. Other illustrative examples is found in Mesmaeker etc., Current Opinion in Structural Biology1995,5,343-355 and Susan M.Freier and Karl-Heinz Altmann, Nucleic Acids Research, 1997,25 volumes, the 4429-4443 page or leaf. The left side of key is as substituting group P between nucleosides^*Be connected with 3 ' position of 5 yuan of rings, and its right side is connected with 5 ' position of last monomer.

" LNA unit " refers to single LNA monomer (for example, LNA nucleosides or LNA nucleotides) or comprises the oligomer (for example, oligonucleotides or nucleic acid) of at least one LNA monomer. Usually, the LNA unit that is described among the WO99/14226 is the modification of nucleic acids of especially expecting to mix in the oligonucleotides of the present invention. In addition, this nucleic acid can be 3 ' and/or 5 ' terminally modified by any modified types known in the art. For example, appoint one or both ends can add cap with protecting group, connect and flexibly connect group, coupled reaction group helping the attaching substratum surface, etc. LNA unit and the synthetic method thereof of expectation also are disclosed in as in the Publication about Document: WO 00/47599, US 6,043,060, US 6,268, and 490, PCT/JP98/00945, WO 0107455, WO 0100641, WO 9839352, WO 0056746, WO 0056748, WO 0066604; Morita etc., Bioorg.Med.Chem. Lett.12 (1): 73-76,2002; Hakansson etc., Bioorg.Med.Chem.Lett. 11 (7): 935-938,2001; Koshkin etc., J.Org.Chem.66 (25): 8504-8512,2001; Kvaerno etc., J.Org.Chem.66 (16): 5498-5503,2001; Hakansson etc., J.Org.Chem.65 (17): 5161-5166,2000; Kvaerno etc., J.Org.Chem.65 (17): 5167-5176,2000; Pfundheller etc., Nucleosides Nucleotides18 (9): 2017-2030,1999; With Kumar etc., Bioorg.Med.Chem.Lett.8 (16): 2219-2222,1998.

Preferred LNA monomer is also referred to as " oxygen base-LNA ", is to comprise the LNA monomer that PCT announces dicyclic compound described in the WO 03/020739, wherein R shown in the following formula (I)⁴' and R²' between bridge represent-CH together₂-O-(methoxyl group LNA) or-CH₂-CH ₂-O-(ethyoxyl LNA is also referred to as ENA).

Other preferred LNA monomer is called " sulfenyl-LNA " or " amino-LNA ", comprises disclosed twin nuclei among the WO 99/14226, wherein R shown in the following formula (I)⁴' and R²' between bridge in hetero atom represent-CH together₂-S-、-CH ₂-CH ₂-S-、-CH ₂-NH-or-CH₂-CH ₂-NH-。

" LNA modify oligonucleotides " refers to comprise oligonucleotides and basic salt and the acid-addition salts of the LNA monomeric unit of at least one following formula (I), and it has exemplary modification example described below:

Wherein X is selected from-O-,-S-,-N (R^N)-，-C(R ⁶R ^6*)-，-O-C(R ⁷R ^7*)-， -C(R ⁶R ^6*)-O-，                              -S-C(R ⁷R ^7*)-， -C(R ⁶R ^6*)-S-，-N(R ^N*)-C(R ⁷R ^7*)-，-C(R ⁶R ^6*)-N(R ^N*)-and-C (R⁶R ^6*)-C(R ⁷R ^7*)。

B is selected from aforesaid modified base, for example, the optional isocyclic aryl that replaces, for example, the optional pyrene that replaces or the optional pyrenyl methyl-prop triol that replaces, or the optional heterolipid ring that replaces or the optional heteroaromatic that replaces, for example, the optional pyrido  azoles that replaces, the optional pyrroles who replaces, the optional diazole that replaces or the optional triazole part that replaces; Hydrogen, hydroxyl, the optional C that replaces_1-4-alkoxyl, the optional C that replaces_1-4-alkyl, the optional C that replaces_1-4-acyloxy, nucleic acid base, DNA intercalator, photochemical activity group, heat chemistry active group, chelation group, reporter group and part;

P represent for and subsequently monomer form the group position of key between nucleosides or represent 5 ' end group, key or 5 ' end group randomly comprise substituent R between this nucleosides⁵ Substituent R²、R ^2*、 R ³And R^3*In one be group P^*，P ^*Key or 2 '/3 between the nucleosides that the monomer of expression and front forms '-end group. R^1*、R ^4*、R ⁵、R ^5*、R ⁶、R ^6*、R ⁷、R ^7*、R ^NSubstituting group and do not represent P^*R²、R ^2*、R ³And R^3*Substituting group can represent to be selected from the following double-basis that comprises about 1-8 group/atom separately :-C (R^aR ^b)-、-C(R ^a)＝C(R ^a)-、-C(R ^a)＝N-、 -C(R ^a)-O-、-O-、-Si(R ^a) ₂-、-C(R ^a)-S、-S-、-SO ₂-、-C(R ^a)-N(R ^b)-、 -N(R ^a)-and＞C=Q, wherein Q be selected from-O-,-S-and-N (R^a)-, and R^aAnd R^bBe selected from independently of one another hydrogen, the optional C that replaces_1-12-alkyl, the optional C that replaces_2-12-alkenyl, the optional C that replaces_2-12-alkynyl, hydroxyl, C_1-12-alkoxyl, C_2-12-alkenyl oxy, carboxyl, C_1-12-alkoxy carbonyl group, C_1-12-alkyl-carbonyl, formoxyl, aryl, aryloxy carbonyl, aryloxy, aryl carbonyl, heteroaryl, heteroaryl oxygen base carbonyl, heteroaryl oxygen base, heteroaryl carbonyl, amino, single and two (C_1-6-alkyl) amino, carbamoyl, single and two (C_1-6-alkyl) amino carbonyl, amino-C_1-6-alkyl-amino carbonyl, single and two (C_1-6-alkyl) amino-C_1-6-alkyl-amino carbonyl, C_1-6-alkyl-carbonylamino, urea groups, C_1-6-alkanoyl oxygen base, sulphono, C_1-6-alkyl sulphonyl oxygen base, nitro, azido, sulfanyl (sulphanyl), C_1-6-alkyl sulfenyl, halogen, DNA intercalator, photochemical activity group, heat chemistry active group, chelation group, reporter group and part, wherein aryl and heteroaryl can randomly be replaced, and two geminal substituent R wherein^aAnd R^bCan be optional the methylene (=CH that replaces together₂), and wherein two be selected from R^a、R ^bNon-geminal or the substituting group of geminal and existence and do not participate in P, P^*Or the substituent R of described double-basis^1*、R ²、R ^2*、R ³、R ^3*、R ^4*、R ⁵、R ^5*、R ⁶、R ^6*、 R ⁷、R ^7*Arbitrary double-basis that can form together the connection of the double-basis that is selected from aforementioned same type; Thus non-geminal substituting group pair with the atom of (i) and the combination of described non-geminal substituting group and (ii) any intervenient atom form list or dicyclo entity;

That exist but do not participate in P, P^*Or the substituent R of double-basis^1*、R ²、R ^2*、R ³、R ^4*、R ⁵、 R ^5*、R ⁶、R ^6*、R ⁷And R^7*Be selected from independently of one another: hydrogen, the optional C that replaces_1-12-alkyl, the optional C that replaces_2-12-alkenyl, the optional C that replaces_2-12-alkynyl, hydroxyl, C_1-12-alkoxyl, C_2-12-alkenyl oxy, carboxyl, C_1-12-alkoxy carbonyl group, C_1-12-alkyl-carbonyl, formoxyl, aryl, aryloxy carbonyl, aryloxy, aryl carbonyl, heteroaryl, heteroaryl oxygen base carbonyl, heteroaryl oxygen base, heteroaryl carbonyl, amino, single and two (C_1-6-alkyl) amino, carbamoyl, single and two (C_1-6-alkyl) amino carbonyl, amino-C_1-6-alkyl-amino carbonyl, single and two (C_1-6-alkyl) amino-C_1-6-alkyl-amino carbonyl, C_1-6-alkyl-carbonylamino, urea groups, C_1-6-alkanoyl oxygen base, sulphono, C_1-6-alkyl sulphonyl oxygen base, nitro, azido, sulfanyl (sulphanyl), C_1-6-alkyl sulfenyl, halogen, DNA intercalator, photochemical activity group, heat chemistry active group, chelation group, reporter group and part, wherein aryl and heteroaryl can randomly be replaced, and wherein two geminal substituting groups can represent oxo, sulphur oxo (thioxo), imino group or the optional methylene that replaces together, perhaps can form together the spiral shell double-basis that is formed by 1-5 carbon atom alkylidene chain, wherein said alkylidene chain randomly is selected from-O-,-S-and-(NR^N)-(be R wherein^NBe selected from hydrogen and C_1-4-alkyl) one or more hetero atoms/group interrupt and/or stop, and wherein two adjacent (non-geminal) substituting groups can represent to cause another keys of two keys; And, when existing but not participating in double-basis, R^N*Be selected from hydrogen and C_1-4-alkyl.

Exemplary 5 '; 3 ' and/or 2 ' end group comprise-H;-OH; halo (for example; chloro; fluoro; iodo or bromo); the optional aryl (for example phenyl or benzyl) that replaces; alkyl (for example; methyl or ethyl); alkoxyl (for example methoxyl group); acyl group (for example; the acetyl or benzoyl base); aroyl; aralkyl; hydroxyl; hydroxy alkyl; alkoxyl; aryloxy; aralkoxy; nitro; cyano group; carboxyl; alkoxy carbonyl group; aryloxy carbonyl; aromatic alkoxy carbonyl; acyl amino; aroylamino; alkyl sulphonyl; aryl sulfonyl; heteroarylsulfonyl; alkyl sulphinyl; aryl sulfonyl kia; the heteroaryl sulfinyl; the alkyl sulfenyl; artyl sulfo; the heteroaryl sulfenyl; aromatic alkyl sulfurio; the heteroarylalkyl sulfenyl; amidino groups; amino; carbamoyl; sulfamoyl; alkenyl; alkynyl; protecting group (for example; silicyl; 4; 4 '-dimethoxytrityl; the mono methoxy trityl; or trityl); joint (for example; contain amine; ethylene glycol; quinone is the joint of anthraquinone for example); detectable (for example, radioactive label or fluorescence labeling) and biotin.

Be appreciated that and comprise independent nucleosides unit and nucleosides unit and the nucleotide units in nucleotide units and the oligonucleotides when mentioning nucleic acid unit, nucleic acid residue, LNA unit or similar terms herein.

" base of modification " or other similar terms refer to can with natural base (for example, adenine, guanine, cytimidine, uracil and/or thymidine) pairing and/or can with the synthetic (for example, non-natural nucleic acid base or nucleoside base) of non-natural nucleic acid base or nucleoside base pairing. Desirably, the base of modification provides 15,12,10,8,6,4 or 2 ℃ or the Tm still less of differing from as described. Exemplary modified base is described among EP1072679 and the WO97/12896.

Term " chemical group " refers to the part of molecule. " modified by chemical group " and refer to thus the modification the standard molecule structure carried out by comprising uncommon chemical constitution. Described structure adhere to can be covalency or non-covalent.

Term " comprises chemical group " and refers to thus the attachment molecules structure in oligonucleotide probe. This chemical group includes but not limited to covalently and/or the minor groove binding (MGB) of non-covalent ground combination and/or embed nucleic acid (INA)--be selected from unsymmetrical cyanine dye, DAPI, SYBR Green I, SYBR Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst33342, ethidium bromide, 1-O-(1-pyrenyl methyl) glycerine and Hoechst33258. Other chemical group comprises the oligonucleotides that nucleic acid base, nucleoside base or the LNA of modification modify.

Term " probe of double labelling " refers to have the oligonucleotides of two labels that adhere to. On the one hand, a label is attached to 5 of probe molecule ' end, and another label is attached to 3 of molecule ' end. A particular aspects of the present invention comprises the fluorescence molecule that is attached to an end and is attached to the molecule that can pass through this fluorogen of FRET (FRET) cancellation of the other end. 5 ' nuclease is measured probe and some molecular beacons are examples of the probe of double labelling.

Term " 5 ' nuclease is measured probe " refers to can be by the double labelling probe of 5 of archaeal dna polymerase '-3 ' exonuclease activity hydrolysis. Measure under the used condition at specific PCR, 5 ' nuclease is measured probe not necessarily by 5 of archaeal dna polymerase '-3 ' exonuclease activity hydrolysis. The use of title " 5 ' nuclease mensuration " and viewed hydrolysis degree are irrelevant, and it does not represent any expection of experimenter. Term " 5 ' nuclease measure probe " and " 5 ' nuclease mensuration " only refer to such mensuration, and the hydrolysis of related probe is avoided in not special concern in this mensuration. " 5 ' nuclease is measured probe " usually is known as " TaqMan measures probe ", and " 5 ' nuclease mensuration " then usually is known as " TaqMan mensuration ". These titles in this application can Alternate.

Term " oligonucleotide analogs " refers to identify the nucleic acid binding molecule of specific target nucleotide sequences. A kind of specific oligonucleotide analogs is peptide nucleic acid (PNA), and in PNA, the sugared phosphate backbone of oligonucleotides is substituted by albumen sample main chain. In PNA, nucleic acid base is combined with uncharged polyamide skeleton, produces chimeric false peptide-nucleic acid structure, this structure and nucleic acid form similar shape.

Term " molecular beacon " refers to be subjected to 5 of the archaeal dna polymerase ' list of-3 ' exonuclease activity impact or the probe of double labelling. Can avoid separation marking thing or nucleotides component owing to 5 '-3 ' exonuclease activity of archaeal dna polymerase to the specific modification of probe, polymerase or condition determination. Therefore, the principle of detection depends on that molecular beacon is combined the detectable difference that the signal that causes at label afterwards occurs with its target sequence. In one aspect of the invention, this oligonucleotide probe forms hairpin structure in the molecule under selected mensuration temperature by the mediation of the complementary series of its 5 ' and 3 ' end. Described oligonucleotides is the combined with fluorescent molecule at one end, the other end in conjunction with when with hairpin structure in the molecule of this fluorogen of fluorogen time energy cancellation adjacent to each other. In another aspect of this invention, the complementary structure based on the probe sequence two ends does not form hairpin structure, but can be owing to the interaction between one or two label and the formed duplex structure, or owing to the general change in conjunction with rear probe space conformation--or owing to the interaction in conjunction with the reduction between the rear label, and cause changing in conjunction with rear detected signal. A particular aspects of molecular beacon comprises a plurality of LNA residues with the hydrolysis of 5 '-3 ' exonuclease activity of inhibition archaeal dna polymerase.

Term " multiprobe " refers to contain the probe of identifying fragment in this article, wherein said identification fragment be fully complementary with recognition sequence in the target nucleic acid molecule so that can under the medium stringent condition and/or be suitable for PCR, 5 ' nuclease measures and/or the condition of molecular beacon analysis (or usually any method based on FRET) under the probe sequence of being combined with this sequence. Described condition is well known to those skilled in the art. Preferably, recognition sequence is present in a plurality of sequences of estimating, for example in the transcript group. Multiprobe of the present invention can contain non-natural nucleotides (" stabilisation nucleotides ") and can be than containing identical sequence but do not have the probe that stabilisation modifies and have higher recognition sequence binding affinity. Preferably, at least one nucleotides of multiprobe modified by chemical group (for example, at least crossing phase of PCR reaction, covalently or otherwise stably in conjunction with), to increase the identification fragment to the binding affinity of recognition sequence.

As used herein, to recognition sequence than containing identical sequence but the probe that does not have stabilisation nucleotides has the multiprobe of " binding affinity " of increase refers to such probe, the binding constant (K of the identification fragment of this probe_a) than the binding constant height of the complementary strand of duplex molecule. In another preferred embodiment, the binding constant of the identification fragment of this probe is than the dissociation constant (K of the complementary strand of the recognition sequence of target sequence in the duplex molecule_d) height.

" multiprobe library " or " library of multiprobe " comprises a plurality of multiprobes, the sum of library middle probe can be identified the major part (comprising the highest sequence of abundance) of transcript group thus, like this in the transcript group about 60%, about 70%, about 80%, about 85%, about 90 % more preferably, even more preferably 95% target nucleic acid can be by probe in detecting.

When monomer contains can be according to the Watson-Crick basepairing rule (for example, G and C, A and T or A and U) when forming the nucleic acid base of hydrogen bond or containing other hydrogen bonding motif (such as diaminopurine and T, trophicardyl and C, false iso-cytosine and G etc.), this monomer b referred to as " complementation ".

Term " monomer subsequently " refers to be positioned at the adjacent monomer of 5 ' extreme direction, and " monomer of front " refers to be positioned at the adjacent monomer of 3 ' extreme direction.

As used herein, term " target colony " refers to a plurality of different nucleotide sequences, for example from genome or other nucleic acid of specific species, comprise genomic transcript group, wherein the transcript group refers to the set of genomic all elements of transcribing of any species. Usually, the number of different target sequences is at least 100 in the nucleic acid population, but clearly, and this number is much higher (surpass 200,500,1000 and 10000--when target colony is Eukaryotic transcript group) usually.

As used herein, term " target nucleic acid " refers to any relevant nucleic acid with single particular sequence, for example, biotinylated nucleic acid is such as deriving from patient, animal (people or non-human animal), plant, bacterium, fungi, archeobacteria (archae), cell, tissue, organism etc. For example, when target nucleic acid derives from bacterium, archeobacteria, plant, non-human animal, cell, fungi or non-human being, the inventive method randomly also comprises the detection based on target nucleic acid, selects this bacterium, archeobacteria, plant, non-human animal, cell, fungi or non-human being. In the embodiment, target nucleic acid derives from the patient, for example people patient. In this embodiment, the present invention randomly also comprises the detection based on target nucleic acid, the genetic predisposition that select therapy, diagnoses the illness or diagnose the illness.

As used herein, term " target sequence " refers to the specific nucleic acid sequence in any target nucleic acid.

Term " stringent condition " in this article refers to about Tm-5 ℃ (being lower than 5 ℃ of probe melting temperatures (Tm)) to being less than about the stringency that occurs in Tm20-25 ℃ the scope. It will be understood by those skilled in the art that the stringency that can change hybridization is to differentiate or to detect identical or relevant polynucleotide sequence. Hybridization technique usually can be referring to Nucleic Acid Hybridization, A Practical Approach, Bd.Hames, B.D. and Higgins, S.J., IRL Press, 1985; Gall and Pardue, Proc.Natl.Acad.Sci., USA63:378-383,1969; With John etc., Nature223:582-587,1969.

Multiprobe

Refer now to Figure 1B, multiprobe according to the present invention is preferably short sequence probe, its can from the recognition sequence combination that exists in a plurality of different target nucleic acids, but thus this multiprobe specifically with target nucleic acid hybridization but the hybridization of detection level does not take place with the nucleic acid molecules that does not contain this recognition sequence. Preferably, the set of multiprobe, or multiprobe library, can identify the major part (comprising the highest sequence of abundance) of transcript group, for example in the transcript group about 60%, about 70%, about 80%, about target nucleic acid of 85%, more preferably about 90% even more preferably 95% can be by probe in detecting. Multiprobe of the present invention comprises " stabilisation modification ", non-natural nucleotides (" stabilisation nucleotides ") for example, and it is than comprising identical sequence but the probe that does not have this stabilizing sequences has higher binding affinity to recognition sequence. Preferably, at least one nucleotides of multiprobe is modified (for example, at least crossing phase of PCR reaction, covalently or otherwise stably being combined with probe) by chemical group, to increase the identification fragment to the binding affinity of recognition sequence.

On the one hand, the multiprobe with 6 to 12 nucleotides comprises 1 to 6 or even nearly 12 stabilisation nucleotides, for example LNA nucleotides. The short probe of the short recognition sequence of identification (for example, 8 to 9 nucleotides) is contained in the probe library that LNA strengthens. The LNA nucleic acid base can comprise α-LNA molecule (for example seeing that WO 00/66604) or xylo-LNA molecule (for example seeing that WO 00/56748).

On the one hand, preferably, the Tm of multiprobe when its recognition sequence is combined is about 55 ℃ to about 70 ℃.

On the other hand, multiprobe comprises the nucleic acid base of one or more modifications. The base unit of modifying can contain and the nucleic acid unit, and for example joint is passed through in 1 ' position of furyl glycosyl (furasonyl) ring, for example the ring element (for example, carbocyclic ring unit such as pyrenyl) of straight or branched alkylidene or alkylene group group connection. Alkylidene group have aptly 1 (that is ,-CH₂-) to about 12 carbon atoms, more typically 1 to about 8 carbon atoms, even more typically 1 to about 6 carbon atoms. The alkylene group group has 1,2 or 3 carbon-to-carbon double bond and 2 aptly to about 12 carbon atoms, and more typically 2 to about 8 carbon atoms, even more typically 2 to about 6 carbon atoms.

Multiprobe of the present invention is desirable for implementing such as mensuration such as PCR in real time, because probe of the present invention preferably has and is less than about 25 nucleotides, is less than about 15 nucleotides, is less than about 10 nucleotides, and 8 or 9 nucleotides for example. Preferably, multiprobe can be under the PCR condition with target sequence in recognition sequence hybridize specifically, and preferably this recognition sequence be present at least about 50, at least about 100, at least about 200, at least about in 500 different target nucleic acid molecules. Multiprobe of the present invention library comprises the multiprobe that contains different recognition sequences, and so any two multiprobes can be hybridized from different target nucleic acid molecule groups. On the one hand, described target nucleic acid molecule group comprises some identical target nucleic acid molecules, that is, the target nucleic acid molecule that contains the genes of interest sequence can be by more than one multiprobe combination. This target nucleic acid molecule will contain at least two different recognition sequences, and these sequences can overlapping one or more nucleotides, but be less than x nucleotides of the recognition sequence that comprises x nucleotides.

On the one hand, the multiprobe library comprises a plurality of different multiprobes, and each different probe is positioned at the discrete location on the solid matrix respectively. In this article, " location " refers to be restricted to or is addressed on the described position, like this, can along this position probing to hybridisation events trace into the probe with known array identity. The probe of location can with matrix stably in conjunction with maybe getting along well stably combination of matrix. For example, probe can be in the solution in the microtitre plate hole, and is positioned thus or is addressed to this hole. As alternative, perhaps this other places, probe can stably be combined with matrix, uses buffer solution to wash after this matrix probe at one or many like this and still is retained on the matrix really on the allocation. For example, probe can directly or by linkers be combined with matrix by chemical mode, and wherein said linkers can be nucleotide sequence, peptide or the molecule that the molecule on the matrix had any type of affinity.

Perhaps, target nucleic acid molecule can be positioned on the matrix (for example, with the form point of cell, cell lysate or nucleic acid on matrix).

In case determined suitable sequence, preferably many LNA probe uses commercially available method and the equipment that (Tetrahedron54:3607-30,1998) are described in the prior art, and is synthetic by chemical mode. For example, can use the short LNA probe of solid phase phosphoramidite method preparation (Caruthers etc., Cold Spring Harbor Symp.Quant.Biol.47:411-418,1982; Adams etc., J.Am.Chem.Soc.105:661 (1983)).

The hybridization degree of the multiprobe in the multiprobe library and one or more target sequences (preferably with a plurality of target sequences) can be measured by any method known in the art. If there is not detectable hybridization, the hybridization degree is 0. Typically, the signal detection of nucleic acids of usage flag hybridization. Complementary nucleic acid or signal nucleic acid can be by typically carrying out mark for detection of in the several method of the polynucleotides that whether have hybridization any. Modal detection method is to use the part of being combined with antibody, fluorogen or the chemical illuminating reagent of mark. Other label comprises the antibody that can serve as for the right member of the specific bond of the part of mark. Easy degree, stability requirement and the available equipment that required sensitivity and probe are puted together is depended in the selection of mark.

The probe that contains LNA typically carries out mark in building-up process. The flexibility of phosphoramidite synthetic method also helps the LNA that easily produces with all the commercial joints, fluorogen and the labelled molecule that can be used for this standard chemical. LNA also can be by enzyme reaction, and for example kinase reaction comes mark.

Multiprobe of the present invention can contain single marking thing or a plurality of label. Can be interact with each other to produce signal or to produce the paired label that signal changes when in one aspect, described a plurality of label is included in multiprobe and target sequence generation hybridization.

On the other hand, multiprobe comprises fluorogen part and quencher part, these two parts in multiprobe residing position so that the hybridization state of this probe can be different from by the increase from the fluorescence signal of this nucleic acid the not hybridization state of this probe. On the one hand, multiprobe also contains first and second complementary series except containing recognition component, these two sequences probe not with target molecule in recognition sequence each other specifically hybridization of when hybridization, thereby so that the enough approaching fluorescence with the cancellation reporter molecule of quencher molecule and described reporter molecule. The hybridization of target molecule so that quencher molecule and reporter molecule away from, cause measuring proportional signal with hybridization.

On the other hand, can use the polymerase with 5 ' nuclease to detect the polymerization of nucleic acid chains. Fluorogen and quencher molecule are mixed in the probe in the mode that fully approaches, consequently the signal of quencher molecule cancellation fluorogen molecule when probe and the hybridization of its recognition sequence. Polymerase with 5 ' nuclease will cause quencher molecule and fluorogen molecular separation to the cutting of probe and along with there is the increment signal amount in nucleotide sequence.

In this article, term " label " refers to reporter group, and it is detected itself can be detected or to can be used as a part that detects series. The example of the functional part of reporter group is that biotin, digoxigenin, fluorophor (can absorb the electromagnetic radiation of specific wavelength, for example light or x ray, and emit subsequently the group of the energy that is absorbed with long wavelength's forms of radiation more; Illustrate example DANSYL (5-dimethylamino)-1-naphthalene sulfonyl base is arranged); DOXYL (N-oxygen base-4; 4-dimethyl  azoles alkane); PROXYL (N-oxygen base-2; 2; 5; the 5-tetramethylpyrrolidi-e); TEMPO (N-oxygen base-2; 2; 6; the 6-tetramethyl piperidine); dinitrophenyl; acridine; cumarin; Cy3 and Cy5 (Biological Detection Systems; Inc. trade mark); erythrosine; coumaric acid; umbelliferone; Texas is red; rhodamine; the tetramethyl rhodamine; Rox; 7-nitro benzo-2--1-diazole (NBD); pyrene; fluorescein; europium; ruthenium; samarium and other rare earth metal); radioisotopic tracer; chemiluminescent labels (label that can obtain detecting by the light that discharges in the chemical reaction process); (free radical of being combined with biomolecule (for example for spin label; the organic amino oxygen (nitroxide) that replaces) or other paramagnetic probe (for example, Cu²⁺、Mg ²⁺), it can detect by using electron spin resonance spectrometry). Especially significant example is that biotin, fluorescein, Texas are red, rhodamine, dinitrophenyl, digoxigenin, ruthenium, europium, Cy5, Cy3 etc.

The suitable example of target nucleic acid molecule can comprise diversified eucaryon and prokaryotic, comprises protoplast; Other biomaterial that maybe may contain target nucleic acid. Therefore, method of the present invention can be applied to tissue and cultivate zooblast, zooblast (for example, blood, serum, blood plasma, granulophilocyte, lymphocyte, urine, myeloid tissue, cerebrospinal fluid or from the spawn of blood or lymph preparation) or the biopsy thing of any type (for example, the muscle biopsy thing, the liver biopsy article, the kidney biopsy article, the bladder biopsy article, the bone biopsy article, the cartilage biopsy article, the skin biopsy thing, the pancreas biopsy article, the enteron aisle biopsy article, the thymus gland biopsy article, the breast biopsy thing, the uterus biopsy article, the testis biopsy thing, eye biopsy article or biopsy of brain thing, for example homogenate in lysis buffer), filing organize nucleic acid, plant cell or to other cell of osmotic shock sensitivity, and bacterial cell, yeast, virus, mycoplasma, protozoan, rickettsia, fungi and other little microbial cell etc.

Can analyze that the target nucleic acid identified by a plurality of multiprobes accounts for 10% below to detect, about below 5%, about below 1%, about below 0.1%, about sequence (for example, specifically gene order) below 0.01% in target nucleic acid molecule colony. Type for detection of this sequence is not restricted feature of the present invention, can comprise PCR or known in the art or exploitation for detection of some other suitable mensuration of the recognition sequence of shared less than 10% in the target nucleic acid molecule colony.

On the one hand, the mensuration that detects more low-abundance recognition sequence comprises and at least one primer hybridization, wherein said primer can be hybridized with this recognition sequence specifically, but its can not be substantially with colony in about more than 50, about more than 25, about more than 10, about more than 5, about more than 2 (for example, two copies of this probe identification homozygous gene sequence) target nucleic acid molecule, or the target nucleic acid more than 1 (allele of the single copy heterozygous genes sequence that for example, exists in the sample) hybridization. One preferred aspect, a pair of this type of primer is provided, this is positioned at the recognition sequence flank that multiprobe is differentiated to primer, namely, but be positioned at the augmentation distance of recognition sequence, the amplicon of about 40 to 5000 bases be can produce thus, 50 to 500 or the amplicon of 60 to 100 bases more preferably preferably produced. One or more in can these primers of mark.

Multiple amplified reaction is well known to those skilled in the art, including but not limited to PCR, RT-PCR, LCR, in-vitro transcription, roll ring PCR, OLA etc. Also can in multiplex PCR, use a plurality of primers to detect one group of specific target molecule.

The present invention also provides the method for the multiprobe sequence that is designed in the inventive method and the kit. Fig. 2 has shown the flow chart that outlines the method step.

On the one hand, computer (in silico) produces a plurality of n aggressiveness (n-aggressiveness) with n nucleotides, to comprise all possible n aggressiveness. Selection has the subset of the n aggressiveness of Tm 〉=60 ℃. On the other hand, select the probe subset, the probe in described subset can not self be hybridized, thereby row candidate's n aggressiveness or a candidate n aggressiveness database is provided. Use the sequence of each n aggressiveness to inquire about the database that comprises a plurality of target sequences. Preferably, this target sequence database contains the sequence of expression, for example people mRNA sequence.

From being used for these row candidate n aggressiveness of Query Database, the n aggressiveness of the target sequence of selection discriminating maximum quantity (for example, comprise with the target database in the n aggressiveness of identification fragment of subsequence complementation of target sequence of maximum quantity), to produce n aggressiveness/target sequence matrix. To be stored in the sequence of the n aggressiveness that the target sequence of maximum quantity is combined in the best probe sequence database, and from candidate n aggressiveness database, deduct these n aggressiveness. From the target sequence database, remove the target sequence of being differentiated by this first group best probe. Repeat this process for remaining candidate probe then, until differentiate to comprised can cover about more than 60%, about more than 80%, about more than 90%, one group of multiprobe of a plurality of n aggressiveness of about 95% target sequence. The optimal sequence that can use each step to differentiate produces virtual (virtual) multiprobe sequence library. Can synthesize the multiprobe that contains from the sequence of this multiprobe database then.

On the other hand, the method also comprises the general applicability that given candidate probe is included in the ever-increasing optimal candidate probe groups by inquiring about and inquire about to estimate in the target sequence in residue in initial target sequence group. One preferred aspect, the probe recognition sequence that only appears at continually in residue target sequence and the initial target sequence just is added in the best probe recognition sequence of ever-increasing this group. One most preferred aspect, this realizes in the following way: calculate the product (product) of the mark that obtains from these inquiries, and select to have the highest product and still belong to the probe recognition sequence of the probe recognition sequence with best score of 20% in the inquiry of carrying out with respect to current target.

The present invention also provides and is beneficial to the computer program (seeing, for example Fig. 2) that said method is implemented. On the one hand, this computer program comprises the programmed instruction that can carry out by can connected to the networkly carrying out computer that memory exchanges or subscriber equipment.

The present invention also provides the system that comprises the computer storage that contains the target sequence database and be used for carrying out the application system of the instruction that this computer program provides.

The kit that comprises multiprobe

A preferred embodiment of the present invention is that it comprises multiprobe library sample for the kit of sign or detection or quantifying target nucleic acid. On the one hand, this kit contains computer (in silico) operation scheme for its application. On the other hand, this kit contains the information relevant with the suggestion that obtains the low price dna primer. Contained probe can have any or all above-mentioned feature in the kit. One preferred aspect, a plurality of probes comprise at least one stabilisation nucleic acid base, for example LNA nucleic acid base.

On the other hand, a plurality of probes comprise and at least one chemical group coupling or the stable bond nucleotides with the combination stability that increases this probe. Again one preferred aspect, kit comprises a plurality of different probes and has the colony of different target sequences with covering, transcript group for example, at least 60%. One preferred aspect, this transcript group is people's transcript group.

On the other hand, kit comprises at least one with the probe of one or more label marks. More on the one hand, one or more probes comprise label can be in the mensuration based on FRET interact with each other, that is, these probes can be designed for the mensuration based on 5 ' nuclease or molecular beacon.

The mensuration that kit of the present invention allows the user fast and exploitation is used for many different nucleic acid target effectively. This kit can also comprise one or more and be used for implementing for example reagent of PCR of amplified reaction.

Embodiment

The present invention is described further with reference to following embodiment.Should be appreciated that following only is for example form, and can make amendment and still fall within the scope of the present invention details.

In following examples, the reference numerals of probe is represented at the LNA-oligonucleotide sequence shown in the following synthetic embodiment.

Embodiment 1

The source of transcript group data

Obtain people's transcript group mRNA sequence from ENSEMBL.ENSEMBL is the collaboration items of EMBL-EBI and Sanger Institute, be used to the system of developing software with produce and keep automatic note to the eukaryotic gene group (see, for example, Butler, Nature406 (6794): 333,2000).ENSEMBL is mainly subsidized by Wellcome Trust.Should be noted in the discussion above that sequence data can obtain from any kind database that comprises expressed sequence, yet ENSEMBL is especially attractive because its provide up-to-date sequence data and to metazoan genomic best may note.On May 14th, 2003 is from ENSEMBL ftp website: Ftp: //ftp.ensembl.org/pub/current_human/dataDownloaded " Homo-sapiens.cdna.fa ".This document contains all ENSEMBL transcript forecasts (that is 37347 different sequences).From each sequence, choose the zone of 50 Nucleotide to 3 in 3 ' terminal upstream ' 1050 Nucleotide in terminal upstream.Further, estimate selected probe sequence group (seeing following best mode) with respect to from the concentrated people mRNA sequence of the reference sequences (RefSeq) of NCBI.The RefSeq standard is used as the basis of medical science, functional and Study on Diversity; Its discovery and comparative analysis for gene discriminating and sign, mutation analysis, expression study, polymorphism provides stable reference.The RefSeq collection is intended to provide one group of comprehensive, complete nonredundancy sequence for the biology of main research, comprises genomic dna, transcript (RNA) and protein.For 19567 sequences that 37347 sequences and RefSeq from ENSEMBL concentrate, all found similar fraction of coverage, that is, the type of database of descriptions is not a restricted feature of the present invention.

Embodiment 2

Calculate multiprobe data set (dataset) (α library)

The specific software that design moves on the UNIX computer is to calculate the best probe set in the library.The schema of Fig. 2 is for example understood this algorithm.

Obtain in two steps the best of transcript group is covered.The first step is determined the sparse matrix of n-mer and gene, can easily find to contain the quantity of the gene of given n aggressiveness thus.This sequential file operation getcover program by use-p option and the input of FASTA form is carried out.

In second step,, use algorithm to determine best fraction of coverage based on the matrix that the first step is determined.For this purpose, import described matrix with working procedure, for example the getcover program.Yet, those skilled in the art can readily design the program that realizes identity function and be used to carry out similar step.

Acquisition covers the good oligonucleotide of transcript group

1. produce all 4 ⁿIndividual n aggressiveness, and calculate the melting temperature(Tm) of expection.From this set, remove the n aggressiveness that has 60 ℃ of following melting temperature(Tm)s or have high-self hybridization energy.This provides the row n aggressiveness with acceptable physical properties.

2. from the ENSEMBL database, choose a row gene order of representative's transcript group.

3. initial major cycle: given this n aggressiveness and gene row by differentiating all n aggressiveness and the result is stored in the matrix in given gene, produce the sparse matrix of n aggressiveness with respect to gene.

4. if this is the iteration first time, the copy of storing this matrix is standby, and called after " total n aggressiveness/genetic matrix ".

5. differentiate the n aggressiveness of cover-most gene and the number of the gene that it covered is stored as " max-gene ".

6. determine the fraction of coverage of residue gene in the matrix, and the gene that fraction of coverage is reached at least 80% max-gene is stored in " the n aggressiveness set with good fraction of coverage ".

7. best n aggressiveness is that the product of its current fraction of coverage and total fraction of coverage is maximum n aggressiveness.

8. from this n aggressiveness set, remove this best n aggressiveness (step 1).

9. from this gene sets, remove the gene (step 2) that this n aggressiveness is covered.

10. this n aggressiveness is added in the best n aggressiveness set, begins to continue this program up to no longer finding the n aggressiveness from step 3.

The program code (" getcover " of Niels Tolstrup2003 1.0 editions) that is used for calculating the multiprobe data set is listed in Figure 17.It is by three patent module: getcover.c, dyp.c, and dyp.h forms.

This program has also been incorporated 4 modules that covered by GNU Lesser General Public Licence into:

getopt.c，getopt.h，getoptl.c，getopt-init.c

/*Copyright(C)1987，88，89，90，91，92，93，94，95，96，98，99，2000，2001

Free?Software?Foundation，Inc.

These files are parts of GNU C Library.GNU C Library is a freeware; Can be under the condition of the GNU Lesser GeneralPublic License that Free Software Foundation announces to its redistribute and/or revise */

This software compiles with aap.The main.aap file that is used for preparing this program is listed in Figure 17 equally.

In order to move the program that has compiled, use to issue orders:

getcover-l?8，9-b?bad.lst-p-f<h_sap_cdna_50_1050.fasta>h_sap_cdna_50_1050_19.statgetcover-l?8，9-b?bad.lst-s<h_sap_cdna_50_1050_19.stat>h_sap_cdna_50_1050_19.cover

Use this computer program and the instruction that is used to carry out above-mentioned algorithm, utilize following parameter that analyst's transcript group is set:

L89: probe length=8 or 9 Nucleotide

I1: comprise mark (inclusion fraction)=100%

D15: the target duplex is with respect to Δ Tm=15 ℃ of self duplex

T62: minimum Tm=62 ℃ of target duplex

C: the complementary target sequence of Shi Yonging also

M80: the best probe that uses product rule and 80% rule from the most general probe of handling the residue target, to select

N:LNA Nucleotide preferably is contained in the segmental centre portions of identification;

B:bad.lst is rule of thumb known to tabulation bad and the necessary few thing of getting rid of;

The result differentiates multiprobe target sequence database.

Target sequence in this database is the exemplary best target that is used for the multiprobe library.These best multiprobes are listed in the following table 1, and it comprises 5 ' fluorescein fluorophore and 3 ' Eclipse or other quencher (as follows).

Table 1 double-tagging thing oligonucleotide probe

cagcctcc cagagcca agctgtga aggaggga

aggaggag ctggaagc cagagagc tgtggaga

cccaggag cagccaga tgaggaga ctggggaa

ctccagcc cttctggg acagtgga ctcctgca

ctcctcca ttctgcca acagccat tgaggtgg

ctgctgcc aggagaga tttctcca aaggcagc

ctccagca ttcctgca cagtggtg ctgtggca

ctgctggg tttgggga aaagggga agaagggc

cttcctgg caggcaga tgtgggaa tggatgga

acagcagc ctgtgcca actgggaa ttctggca

cagctcca ttccctgg tcacagga cagaaggc

ccccaccc aaccccat ttcctccc atcccaga

tggtggtg ctgcccag aggtggaa caggtgct

ttcctcca ctgaggca tgtggaca ctgtctcc

ctgctcca ctgctggt tggaggcc tgctgtga

tggagaga cagtgcca atggtgaa agctggat

aaggcaga atggggaa ctggaagg tggagagc

cagccagg agggagag caggcagc cttggtgg

cagcagga ctctgcca tcaggagc caccttgg

ctgtgctg ctgctgag acacacac cagccacc

agaggaga ccctccca catcttca ctgtgacc

ctgtggct aggaggca cacctgca agggggaa

cagtggct cactgcca ccagggcc tgggacca

ttctccca ctgtgtgg cagaggca acagggaa

cctggagc ttcccagt ctgggact ctgggcaa

cccagcag tccagtgt ctgcctgt ctggagga

ttctcctg ctcctccc tggaaggc tccactgc

cttcctgc cttcccca ctgtgcct ctgccacc

ccacctcc ctctgcca ctgtgctc acagcctca

ttcctctg cagcaggt ctgtgagc ctgtggtc

tggtgatg ctccatcc tcctcctc cttcaggc

tgtggctg tgctgtcc ctcagcca tctgggtc

cttctccc tcctctcc ctcttccc cttggagc

ctgcctcc ctctgcct ctgggcac ccaggctc

ctccttcc ctggctgc tgggcatc tctctggt

tcctgctc ccgccgcc ctctggct cttgggct

catcctcc ctcctcct tgctgggc ctgccatc

aggagctg cagcctgg ctgctctc cactggga

tcctgctg cagcagcc ctggagtc tgccctga

ctcctcca tgctggag cttcagcc ttggtggt

ccagccag cttcctcc cttccagc ttgggact

cagcccag ttcctggc tccaggtc ctgctgga

ctccacca tcctcagc cagcatcc caggagct

ctccagcc aggagcag cagaggct ctcagcct

tggctctg ccaggagg ctgccttc ttctggct

caggcagc cagcctcc ctgggaga ctgtctgc

ctgcctct agctggag cccagccc ctgtccca

cttctgcc ctgctgcc cagctccc tctgccca

ctgctccc tggctgtg ccagccgc ctggacac

tggtggaa cctggaga cctcagcc ttgccatc

agctggga ccagggcc tcctcttct cttcccct

ctgcttcc ccaccacc ctggctcc cttgggca

cagcaggc tctgctgc ccagggca ttctggtc

tctggagc cagccacc ctccacct ccgccgcc

catccagc cagaggag ctgcccca cttcttctc

atggctgc ctctcctc tgggcagc ttccctcc

ctcctgcc caggagcc ctggtctc ttcctcaga

tggtggcc tctggtcc ctggggcc tccaaggc

ctggggct ctgtctcc cagtggca ttggggtc

ttgccatc cttcccct cttgggca ttctggtc

cttcttctc ttccctcc ttcctcaga tccaaggc

ttggggtc

The 9-aggressiveness of these superelevation abundance and 8-aggressiveness sequence satisfy the choice criteria among Fig. 2, that is,

● the target of each probe accounts at least 6% (that is, each target sequence more than 2200, the sequence of target more than 800 near the 1000nt of transcript 3 ' end) in the sequence of people's transcript group.

● their not self complementations (that is, can not form the probe duplex).

Self score is lower than the Tm at least 10 estimated and duplex that target forms.

● the duplex that forms with its target sequence has 60 ℃ or greater than 60 ℃ Tm.

They cover in people's transcript group＞98% mRNA when combining.

Provided especially preferred multiprobe form in the table 1 among the following table 1a:

Table 1a:LNA alternate oligonucleotide

cAgCCTCc cAGAGCCa aGCTGTGa aGGAGGGa

aGGAGGAg cTGGAAGc cAGAGAGc tGTGGAGa

ccCAGGAg cAGCCAGa tGAGGAGa ctGGGGAa

cTCCAgCc cTTCTGGg aCAGTGGa cTCCtGCa

cTCCTCCa tTCTGCCa aCAGCCAt tGAGGtGg

cTgCTGCc aGGAGAGa tTTCTCCa aAGGCAGc

cTCCAGCa tTCCTGCa cAGTGGTg ctGTGGCa

cTGCTGgg tTTGGGGa aAAGGGGa aGAAGGGc

cTTCCTGg cAGGCAGa tGTGGGAa tGGATGGa

aCAGCAGc ctGTGCCa aCTGGGAa tTCTGGCa

caGCTCCa tTCCCTGg tCACAGGa cAGAAGGc

cCCCACCc aACCCCAt tTCCTCCc aTCCCAGa

tGGTGGTg ctGCCCag aGGTGGAa cAGGtGCt

tTCCTCCa cTGAGGCa tGTGGACa cTGTCTCc

cTGCTCCa cTGCtGGt tGGAGgCc tGCTGTGa

tGGAGAGa cAGtGCCa atGGTGAA aGCTGGAt

aAGGCAGa aTGGGGAa cTGGAAGg tGGAGAGc

cAGCcAGg aGGGAGAg cAGGcAGc cTTGGTGg

cAGCAGGa cTCtGCCa tCAGGaGc cACCTTGg

cTGTGCTg cTGCTGAg aCACACAC cAgCCACc

aGAGGAGa cCCtCCCa cATCTTCA cTGTGACc

ctGTGGCt aGGAGGca cACCtGCa aGGGGGAa

caGTGGCt cACtGCCa cCAGgGcc tGgGACCa

tTCTCCCa cTGTGTGg cAGAGGCa aCAGGGAa

cTGgcTGC cAGCAGGC cAGCATCC tCTGCCCA

ccGCCgCC cTGCCTCT cAGAGGCT cTGGACAC

cTCCTCCT cTCCACCT cATCCTCC tCAgCAGC

cTGGAGGA cTCCTCCC cTCTGCCT tTCTTGGC

caGCcTGG cTTCCCCA cAGTGGCA cggCGGCA

cAGcAGCC cTTCAGCC cAGCACCC cTGGTGGT

cTTCCTCC cTCTGCCA cTCTCCTC cCTTCTCC

ccAGGAGG cTTCTGCC tCTGgTCC cCTCTTCC

cAGCcTCC cAGCAGGT cAGGAGCC tGTTGCCA

aGcTGGAG tcTGGAGC cTGTCTCC tGGaTGGC

cTGcTGcC cTGCCCCA cTGGGACT cCAGCATC

tGGcTGTG cATCCAGC cTGCCTGT tCTTCTTCT

cCTGGAGa aTGGcTGC tGGaAGGC tcgCCGCC

cCAGGGcC cTCCTGCC cTGTGCCT tGCTGTTC

cCACCACC cTGGGGcc cTGTGCTC tCAAGGGC

acAGCCTCA cTCCATCC cTGTGAGC tgCTGCTC

cAGAGGAG cTGGGCAA cTCTTCCC tcGCCGTC

tGcTGGAG cCAGCCGC cTGGGCAC tTGATGCC

aGGAGcAG tGGTGGcc tGGGCATC cCTTCAGC

aGGaGCTG cTGGGGCT tCCTCCTC aTTCCAGC

tCCTGCTG cTGCTCCC cTCTGGCT tTGATGGC

cCTGGAGC tGCTGTCC tgcTGGGC cCAGTTCC

cTCCTCCA tCCTCTCC cTCAGCCA tTGGCTTC

cCAGCCAG tGGTGGAA cTGCTCTC tTGCCTTC

cCCAGCAG aGCTGGGA cTGGAGTC aTGGCTTC

tTCTCCTG cTGGTCTC cTGTGGTC cACCCGCT

cAGCCCAG tTCCCAGT cTTCAGGC tCTTTGCC

cTTCCTGC tCCTCTTCT tCTGGGTC cTGGTTGC

cTCCACCA tCCAGTGT cTTGGAGC tGGACACC

cTTCCAGC tGGGcAGC cCAGGCTC tcGTCGCC

cCCAGCCC cCAGGGCA tCTCTGGT cCATCAGC

cTGCCTTC cTGGCTCC cTTGGGCT tGGTGGAT

cTCCAGCC tCTGcTGC cTGCCATC aTGGTGGT

cCACCTCC cAGCCACC cACTGGGA cCtGGTGC

tTCCTCTG tTCcTGGC tGCCCTGa tCCTCGTC

tGGCTCTG tCCTCAGC tTGGTGGT tTCTTGCC

tGGTGATG cTCCTTCC tTGGGACT tGGgCTTC

tGTGGcTG cTGGGAGA cTGCTGGA tGATGAGC

cTTCTCCC tCCTGCTC cAGGaGCT tCCTggCC

cTGCCTCC cAGGcAGC cTCAGCCT cCTCCTTC

cAGCTCCC tCCACTGC tTCTGGCT tGCTGGAG

cTGCTTCC cTGCCACC cTGTCTGC

ccTCAGCC tCcAGGTC cTGTCCCA

-wherein, lowercase is represented deoxyribonucleotide, capitalization is represented LNA Nucleotide.

＞95.0% mRNA sequence near its 3 ' terminal 1000nt (distance 3 ' terminal 50 to 1050) by target, and＞95% mRNA contains the target sequence at an above probe in the library.Containing the target site of differentiating these 100 multiprobes in people's transcript group of 37,347 nucleotide sequences above 650,000.At each transcript, the average number of multiprobe is 17.4 in this transcript group, and intermediate value is the target site of 14 different probes.

Although non-selected above-mentioned sequence is to be optimized at specific organism, above-mentioned sequence also is that the excellent probe that is used for other transcript group is selected.Therefore, although in fact above-mentioned probe design only is used at the transcript of people's transcript group discriminating/sign/quantitatively, we have estimated the fraction of coverage of above-mentioned library to mouse and rat gene group.For example, see Table 2.

Table 2	The transcript group
				People's probe library	The people	Mouse	Rat
The mRNA sequence number	37347	32911	28904
				The fraction of coverage of full length mRNA	96.7％	94.6％	93.5％
The fraction of coverage of the 1000nt of close 3 ' end	91.0％	-	-
				At least covered by two probes	89.8％	80.2％	77.0％

Nt～Nucleotide.

Embodiment 3

The frequent 9-aggressiveness oligonucleotide that occurs is to the expection fraction of coverage of people's transcript group

Exemplary determination data (being similar to Fig. 6) illustrates, strengthens with LNA if PCR in real time is measured used double-tagging probe, then the length of the recognition sequence of this probe can be reduced to 8 or 9 Nucleotide according to this sequence.It is essential that unique duplex stabilization character of LNA has enough stability (that is, Tm＞60 ℃) for the duplex of guaranteeing this weak point.This functional PCR in real time probe will almost be pure LNA, have 6 to 10 LNA oligonucleotide in recognition sequence.Yet this weak point recognition sequence makes and can use identical LNA probe in detecting and quantitative many heterogeneic abundance.By people's transcript group (Fig. 3) of suitably selecting the best (that is, modal) 8 or 9-aggressiveness recognition sequence according to algorithm shown in Figure 2, can cover to contain 37347 mRNA that have an appointment.

Fig. 3 has shown can be in the nearly 3 ' terminal long 1000nt fragment of each sequence (promptly, the sequence of distance 3 ' terminal 50nt to 1050nt) in by the optimization probe in detecting of different lengths to people's transcript group in the expection fraction of coverage of mRNA sequence, represent percentage ratio for mRNA sequence sum in people's transcript group.That these probes are required enough is stable (Tm＞60 ℃) and have the tendency of low formation self duplex, and this has just eliminated many 9-aggressiveness and even more 8-aggressiveness probe sequence.

If all probe sequences with given length can be used as probe, then can obtain the best of transcript group is covered by these the shortest possible probe sequences significantly.When the probe that limited quantity is only arranged (＜55) when being comprised in the library, this is so (Fig. 4) really.Yet, because many short probes with low GC content do not have sufficient thermostability, so it is deleted from the library.The limited diversity of acceptable 8-aggressiveness probe is renderd a service lower aspect the gene that detects low GC content, and therefore, the library of being made up of 100 different 9-aggressiveness probes has better covering than similar 8-aggressiveness library to the transcript group.Yet, the mixing library that optimal selection is made up of the sequence of different lengths, best library for example listed above pattern.The fraction of coverage that in Fig. 4, does not show this library.

The designed probe library of containing 100 modal 9-aggressiveness and 8-aggressiveness, that is, " people mRNA probe library " can be with box or microtiter plate formal operations easily.

The initial sets that can change these 100 probes that are used for people mRNA is used for transcript group from other species (mouse, rat, fruit bat, Caenorhabditis elegans (C.elegans), yeast, Arabidopis thaliana, zebra fish, primate, domestic animal etc.) to produce similar library test kit.Making up these new probe libraries needs effort hardly, because great majority can be reused for these new library test kits (table 2) in these people mRNA probes.

Embodiment 4

The number of probes of each gene of target in the library

The probe of the limited quantity in the not only proposed library can target people transcript group major part (＞98%), and have the redundancy of big degree (almost 95%) can be by more than one probe in detecting because most of gene.At 100 probes in the pattern of above-mentioned best library, in people's transcript group (37347 genes), differentiated the target site more than 650,000.This causes average 6782 target sites of each probe (that is, transcript group 18%), and scope is 2527 sequence to 12066 sequences of each probe.The average number of probes that can detect a specific gene is 17.4, and intermediate value is 14.Thus, in this library of 100 probes only, we have at least 14 probes at 50% above sequence in everyone the mRNA sequence.

Can be shown among Fig. 4 by the gene digital display of the probe of given number in library institute target.

Embodiment 5

Design 9-aggressiveness probe is to confirm feasibility

Selection is used for expressing mensuration from the SSA4 gene of yeast (yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)), because this gene transcription level can pass through heat shock induction, and can obtain to knock out the mutant of expression.From people's transcript group, select 3 different 9-aggressiveness sequences (table 3) in the common 9mer sequence.These sequences are present in people's transcript group near 3 ' end of 1.8 to 6.4% mRNA sequence.Further choice criteria is that self of medium level is complementary and be equal to or greater than 60 ℃ Tm.All three sequences all are present in 1000 bases of end of SSA4 ORF.Have the FITCH fluorophore and have these three sequences of Eclipse quencher (Epoch Biosciences) by synthesizing, made up 5 ' nuclease and measured probe at 3 ' end at 5 ' end.According to probe in that ORF YER103W (SSA4)--wherein position 1201 is set to the position among the 1--of position, and probe is named.Design three pairs of primers to produce three nonoverlapping amplicons that respectively contain one of these three probe sequences.According to the probe sequence that amplicon comprised, the name amplicon.

Table 3: 5 ' nuclease of design is measured probe and primer

Sequence	The probe title	The forward primer sequence	The reverse primer sequence	Amplicon length
					?aaGGAGAAG ? ? ?cAAGGAAAg ? ? ?ctGGAGCaG	-671 of-570 double labellings of-469 double labellings of double labelling	cgcgtttactttgaaaaat tctg (SEQ?ID?NO：1) gcccaagatgctataaatt ggttag (SEQ?ID?NO：3) tacggagc?tgcaggtggt (SEQ?ID?NO：5)	gcttccaatttcctggc atc SEQ?ID?NO：2) gggtttgcaacaccttc tagttc (SEQ?ID?NO：4) gttgggccgttgtctgg t (SEQ?ID?NO：6)	81bp ? ? 95bp ? ? 86bp

Bp～base pair

Also designed two molecular beacons with detection SSA4 469-and SSA4 570 sequences, and difference called after beacon-469 and beacon-570.The sequence of SSA4 469 beacons is CAAGGAGAAGTTG (SEQ ID NO:7,10-aggressiveness recognition site), this sequence should make this oligonucleotide form intramolecularly beacon infrastructure, have by 5 '-stem that LNA-LNA between CAA and the TTG-3 ' interacts and forms.The sequence of SSA4 570 beacons is CAAGGAAAGttG (9-aggressiveness recognition sites), wherein this intramolecularly beacon infrastructure can be 5 '-form between CAA and the ttG-3 '.Synthesize and have the fluorescein fluorophore at 5 ' end and have these two sequences of Dabcyl quencher at 3 ' end.

The probe that has also designed a SYBR Green mark to be detecting SSA4 570 sequences, and with this probe called after SYBR-probe-570.The sequence of this probe is CAAGGAAaG.Synthesize this probe that has amino-C6 joint at 5 ' end, at this 5 ' end that fluorophore SYBR Green101 (Molecular Probes) is attached to it according to manufacturers instruction.After hybridizing with target sequence, the fluorophore that joint adheres to should embed the double-stranded tagma of LNA-DNA of generation, causes the fluorescence from the increase of SYBR Green101.

Table 4: sequence

The EQ numbering	Title	Type	Sequence	Position in the gene
					13992 ? 13994 ? 13996 ? 13997 ? 14148 ? 14165 ? 14012 14013 ? 14014 ? 14015 ? 14016 14017 ? 14115 ? 14116 ? 14117 ? ? 14118 ? ? 14119 ? 14120	Double labelling 469 double labellings 570 double labelling 671 beacons-469 beacon-570 SYBR-probe-570 SSA4-469-F SSA4-469-R SSA4-570-F SSA4-570-R SSA4-671-F SSA4-671-R POL5-469-F POL5-469-R APG9-570-F APG9-570-R HSP82-671-F HSP82-671-R	5 ' nuclease is measured probe 5 ' nuclease and is measured probe 5 ' nuclease mensuration probe molecule beacon molecular beacon SYBR-probe primer primer primer primer primer primer primer primer primer primer primer primer	5′-Fluor-aaGGAGAAG-Eclipse-3′ ? 5′-Fluor-cAAGGAAAg-Eclipse-3′ ? 5′-Fluor-ctGGAGCaG-Eclipse-3′ 5′-Fluor-CAAGGAGAAGTTG-Dabcyl-3′ (5′-Fluor-SEQ?ID?NO：8-Dabcyl-3′) 5′-Fluor-CAAGGAAAGttG-Dabcyl-3′ (5′-Fluor-SEQ?ID?NO：9-Dabcyl-3′) ? 5′-SYBR101-NH2C6-cAAGGAAAg-3′ cgcgtttactttgaaaaattctg(SEQ?ID?NO： 10) gcttccaatttcctggcatc(SEQ?ID?NO：11) gcccaagatgctataaattggttag(SEQ?ID NO：12) gggtttgcaacaccttctagttc(SEQ?ID?NO： 13) tacggagctgcaggtggt(SEQ?ID?NO：14) gttgggccgttgtctggt(SEQ?ID?NO：15) gcgagagaaaacaagcaagg(SEQ?ID?NO： ? 16) attcgtcttcactggcatca(SEQ?ID?NO：17) cagctaaaaatgatgacaataatgg(SEQ?ID ? NO：18) attacatcatgattagggaatgc(SEQ?ID?NO： ? 19) gggtttgaacattgatgagga(SEQ?ID?NO： ? 20) ggtgtcagctggaacctctt(SEQ?ID?NO：21)	?469-477 ? ?570-578 ? ?671-679

Embodiment 6

Synthesize, go to protect and the oligonucleotide of purifying double-tagging

At automatic dna synthesizer (Expedite8909DNA synthesizer; PerSeptiveBiosystems; 0.2 μ mol scale); use phosphoramidite method (Beaucage and Caurthers; Tetrahedron Lett.22:1859-1862,1981) and LNA and DNA phosphoramidite (Sinha etc., the Tetrahedron Lett.24:5843-5846 of the protection of 2-cyano ethyl; 1983), the oligonucleotide EQ13992 to EQ14148 (table 4) of preparation double-tagging.With Eclipse quencher (EQ13992-EQ13996) or Dabcyl (EQ13997-EQ14148) and 5 '-fluorescein phosphoramidite (GLEN Research, Sterling, Virginia, USA) the CPG solid support of deriving.Compared to the DNA phosphoramidite, change synthesis cycle at LNA phosphoramidite (250s coupling time).At coupling step, use 1H-tetrazolium or 4,5-dicyano imidazole (Proligo, Hamburg, Germany) is as activator.

Use 32% ammoniacal liquor that this oligonucleotide is gone protection (room temperature 1 hour, then 60 ℃ 2 hours), and by HPLC (Shimadzu-SpectraChrom series; Xterra ^TMThe RP18 post, 10? m 7.8 * 150mm (Waters) purifying.Damping fluid: A:0.05M second triethylenetetraminehexaacetic acid ammonium pH7.4; The B:50% acetonitrile solution.Elutriant: 0-25min:10-80%B; 25-30min:80%B).The composition of oligonucleotide and purity are analyzed by MALDI-MS (PerSeptiveBiosystem, Voyager DE-PRO) and are verified, see Table 5.Fig. 5 is the MALDI-MS spectrum of EQ13992, shows [M-H] ^-=4121,3Da.This is the typical MALDI-MS spectrum of 9-aggressiveness probe of the present invention.

Table 5:

EQ#	Sequence	MW (calculating)	MW (actual measurement)
				13992 13994 13996 ? 13997	5’-Fitc-aaGGAGAAG-EQL-3’ 5’-Fitc-cAAGGAAAg-EQL-3’ 5’-Fitc-ctGGAGmCaG-EQL-3’ 5’-Fitc-mCAAGGAGAAGTTG-dabcy1-3’ (5’-Fitc-SEQ?ID?NO：22-dabcy1-3’)	4091，8Da. 4051，9Da. 4020，8Da. ? 5426，3Da.	4091，6Da. 4049，3Da. 4021，6Da. ? 5421，2Da.

Capitalization expression LNA monomer (A, G, mC, T), wherein mC is the LNA methylcystein.Small letter represent the dna single body (a, g, c, t).The Fitc=fluorescein; The EQL=Eclipse quencher; The Dabcyl=Dabcyl quencher.The MW=molecular weight.

Embodiment 7

The SSA4 cDNA standard that preparation detects with 9-aggressiveness probe

In PCR measures, analyze the function of the 9 aggressiveness probes that make up, wherein check the ability of the different SSA4 pcr amplification of probe in detecting.SSA4 gene catchment among the in-vitro transcription expression vector pTRIamp18 (Ambion) with the cRNA reverse transcription that obtains, obtains the cDNA as the template of above-mentioned PCR reaction.Clone as follows the catchment of SSA4 gene:

Pcr amplification

Use pastoris genomic dna as template, by standard pcr amplification part yeast genes.From wild-type yeast saccharomyces cerevisiae standard laboratory bacterial strain, use Nucleon MiY DNA extraction test kit (Amersham Biosciences), according to supplier's specification sheets, the preparation genomic dna.In the first step of pcr amplification, use forward primer that contains restriction enzyme site and the reverse primer that contains the universal joint sequence.In this step, to 3 ' end of amplicon, 20bp is added in the place of contiguous terminator codon.In second step of amplification, with containing poly-T ₂₀The nested primers of tail and restriction enzyme site is changed reverse primer.The SSA4 ORF that this SSA4 amplicon contains 729bp adds universal joint sequence and the poly-A of 20bp ₂₀Tail.

Used PCR primer is as follows:

YER103W-For-SacI：acgtgagctcattgaaactgcaggtggtattatga(SEQ?ID?NO：23)

YER103W-Rev-Uni：gatccccgggaattgccatgctaatcaacctcttcaaccgttgg(SEQ?ID?NO：24)

Uni-polyT-BamHI：acgtggatccttttttttttttttttttttgatccccgggaattgccatg(SEQ?ID?NO：25).

The plasmid DNA construction body

Use Restriction Enzyme EcoRI+BamHI, cutting pcr amplification.Use Quick Ligation test kit (New England Biolabs),, this dna fragmentation is connected with pTRIamp18 carrier (Ambion) according to supplier's specification sheets, and by standard method transformed into escherichia coli DH-5.

Dna sequencing

In order to verify the clone of pcr amplification, use M13 forward primer and M13 reverse primer order-checking plasmid DNA, and on ABI377, analyze.

In-vitro transcription

Use Megascript T7 test kit (Ambion),, implement in-vitro transcription, obtain SSA4 cRNA according to supplier's specification sheets.

Reverse transcription

With 1 μ g cRNA and 0.2U reversed transcriptive enzyme Superscript II RT (Invitrogen), according to supplier's specification sheets--but interpolation 20U Suprase-In (the RNAse inhibitor-Ambion)--carry out reverse transcription.On QiaQuick PCR purification column (Qiagen),, use the EB-damping fluid that is provided to carry out wash-out, the cDNA that purifying produces according to supplier's specification sheets.Measure the DNA concentration of the cDNA of wash-out, and this cDNA is diluted to corresponding to 2 * 10 ⁷The SSA4 cDNA copy concentrations of individual copy/μ l.

Embodiment 8

The scheme that is used for the double-tagging probe assay

According to following scheme (table 6), be mixed for the reagent of double-tagging probe PCR:

Table 6

Reagent	Final concentration
		H 2O GeneAmp10 * PCR damping fluid II Mg 2+DNTP double-tagging probe template forward primer reverse primer AmliTaq Gold	1x 5.5mM 0.2mM 0.1 or 0.3 μ M*, 1 μ L, 0.2 μ M, 0.2 μ M 2.5U
Amount to	50μL

*) final concentration of 5 ' nuclease mensuration probe is 0.1 μ M, and the final concentration of beacon/SYBR-probe is 0.3 μ M.

In this experiment, add 2 * 10 ⁷The SSA4 cDNA of individual copy is as template.In DNAEngine Opticon  (MJ Research), use following PCR recycle scheme, implement to measure:

Table 7

5 ' nuclease is measured	Xin Biao ﹠SYBR-probe assay
		40 circulations of 95 ℃ of 7 minutes ﹠: 94 ℃ of 60 ℃ of fluoroscopic examinations in 1 minute in 20 seconds	40 circulations of 95 ℃ of 7 minutes ﹠: 94 ℃ 30 seconds 52 ℃ 1 minute *72 ℃ of fluoroscopic examinations 30 seconds

* for the beacon with 9-aggressiveness recognition site-570, annealing temperature is reduced to 44 ℃.

Listed PCR recycle scheme will be called standard 5 ' nuclease mensuration or standard beacon condition determination in the composition of the reaction of PCR shown in the table 6 and the table 7.

Embodiment 9

9-aggressiveness 5 ' nuclease is measured the specificity of probe

In following mensuration, confirm the specificity of these 5 ' nucleases mensuration probes, in this mensuration, add each probe respectively, produce different SSA4 pcr amplification to 3 different PCR reactions.As shown in Figure 6, each probe only produce fluorescent signal with and the amplicon (also seeing Figure 10,11 and 12) of designed detection.Importantly, different probe has quite similar cycle threshold C _t(from 23.2 to 23.7) illustrate that these are measured and probe has the effectiveness that very is equal to.And, illustrate that these mensuration should detect similar expression level when described mensuration being used for truly expressed mensuration.This is an important discovery, because the variability of different probe on performance is not supposed to.

Embodiment 10

The specificity of 9-aggressiveness and 10-polymer molecular beacon probe

In addition, also at the molecular beacon design concept, confirmed the ability of pcr amplification that the detection real time new produces.Be designed for 469 amplicons, have the molecular beacon of 10-aggressiveness recognition sequence, when in PCR, having the SSA4 cDNA template that is used to produce this 469 amplicon and primer, produced signal clearly, Fig. 7 A.Viewed C _tValue is 24.0, very is similar to use 5 ' nuclease to measure the C that probe obtains _tValue, this illustrates the quite similar sensitivity of different probe once more.When not adding the SSA4 template, no signal produces.Utilization is designed for 570 amplicons, has the molecular beacon of 9-aggressiveness recognition sequence, obtains analog result, sees Fig. 7 B.

Embodiment 11

The specificity of 9-aggressiveness SYBR-probe

Also confirmed to detect the ability of new pcr amplification that produces at SYBR-probe design notion.Be designed for this 9-aggressiveness SYBR-probe of 570 amplicons of this SSA4 cDNA, when in PCR, having the SSA4 cDNA template be used to produce this 570 amplicon and primer, produced signal clearly, see Fig. 8.When not adding the SSA4 template, no signal produces.

Embodiment 12

Quantitative transcript copy number

The ability that detects the genetic transcription thing of different levels is the basic need that probe uses in truly expressed is measured.In following mensuration, measure probe by three 5 ' nucleases, confirmed that this need be met, wherein, in described mensuration the SSA4 cDNA that derives from expression vector of different levels and described 5 ' nuclease being measured one of probe adds in the different PCR reactions (Fig. 9) together.Set composition and cycling condition according to standard 5 ' nuclease condition determination.

CDNA copy number before the circulation beginning among the PCR is by cycle threshold C _t(that is the cycle number when, at first detecting signal) reflects.At this, signal only is defined as the signal when fluorescence is higher than 5 times of the standard deviations of detected fluorescence in 3 to 10 PCR circulation.The result is presented at the logarithm and the C of initial cDNA copy number _tThere is good population characteristic valuve (Fig. 9) between the value.This dependency shows as and depends on probe and have the straight line of-3.456 to-3.499 slope and 0.9981 to 0.9999 relation conefficient.The efficient of slope of a curve reflection PCR wherein, suppose that amplicon doubles in each PCR circulates, and then 100% efficient is corresponding to-3.322 slope.The PCR efficient of the slope of PCR indication at present 94% to 100%.This relation conefficient is same high or higher with the value (result does not show) that obtains in the mensuration of the identical SSA4 cDNA of the DNA5 ' nuclease mensuration probe in detecting level of using 17 to 26 length of nucleotides with PCR efficient.Therefore, these results confirm that these 3 9-aggressiveness 5 ' nucleases mensuration probes satisfy the requirement of truly expressed probe, illustrate that these probes should be used for expression pattern analysis.

Embodiment 13

Detect SSA4 transcript level in the yeast

In the different yeast strains under being grown in different culture condition (± heat-shocked), detect the expression level of SSA4 transcript.The standard laboratory Wine brewing yeast strain is used as wild-type yeast in above-mentioned experiment.Obtain SSA4 from EUROSCARF (registration number Y06101) and knock out mutant.This bacterial strain is referred to herein as the SSA4 mutant.Two yeast strains all grow in the YPD substratum, up to OD in 30 ℃ ₆₀₀Equal 0.8A.The yeast culture of pending heat-shocked is transferred to 40 ℃ placed 30 minutes, afterwards centrifugal cell harvesting and precipitation is chilled in-80 ℃.Simultaneously, the cell of heat-shocked is not retained in 30 ℃ of growths 30 minutes, afterwards by gathering in the crops as upper type.

Use FastRNA test kit (Bio101) and FastPrep instrument, according to the yeast separation RNA of supplier's specification sheets from results.

Use few thing (dT) primer of 5 μ g grapplings so that initiation reaction on the total RNA of 1 μ g, and use 0.2U reversed transcriptive enzyme Superscript II RT (Invitrogen), according to supplier's specification sheets--except add 20U Superase-In (RNAse inhibitor-Ambion)--carry out reverse transcription.After hatching in 2 hours, 70 ℃ made enzyme deactivation in 5 minutes.With 10mM Tris pH of buffer 8.5 the cDNA reactant is diluted 5 times, and pass through at MicroSpin ^TMS-400HR post (Amersham Pharmacia Biotech) is gone up purifying and is removed oligonucleotide and enzyme.Before implementing to express mensuration, with 20 times of cDNA dilutions.Use standard 5 ' nuclease condition determination--except adding 2 μ L templates--and double-tagging-570 probe carry out this expression and measure.Template is 100 times of dilutions of initial reverse transcription reaction thing.4 kinds of used different cDNA templates derive from wild-type or the mutant that carries out or do not carry out heat-shocked.This is measured and produces expected result (Figure 10), shows and the wild-type yeast (C that does not accept elevated temperature _t=30.3) compare the SSA4 transcript level (C of the wild-type yeast of heat-shocked _t=26.1) increase.Regardless of culture condition, in mutant yeast, all do not detect transcript.3.5 C _tValue difference has been induced 17 times expression level corresponding to the wild-type yeast of heat-shocked for the wild-type yeast of heat-shocked not, this value is near about 19 value of report in the document (Causton etc., 2001).These values obtain by using typical curve, and wherein said typical curve utilizes 570 probes of double-tagging to obtain (see figure 9) in the quantitative experiment of the SSA4 transcript with known quantity.These description of tests, these 9-aggressiveness probes can detect the expression level that extremely conforms to disclosed result.

Embodiment 14

Using single 9-aggressiveness probe to carry out many transcripts detects

In order to verify the ability of these three other expression of gene levels of 5 ' nucleases mensuration probe in detecting, three different yeast genes of one of described probe sequence have been selected wherein respectively to exist.The design primer is with the 60-100 base pair zone of amplification around probe sequence.Selected three yeast genes and corresponding primer have been shown in the following table.

Table 8

The another kind of design of expressing mensuration

Sequence/title	The coupling probe	The forward primer sequence	The reverse primer sequence	Amplicon length
					?YEL055C/POL5	-469 of double-tagging	gcgagagaaaaca agcaagg (SEQ?ID?NO：26)	attcgtcttcactggca tca (SEQ?ID?NO：27)	94bp
?YDL149W_APG9	-570 of double-tagging	cagctaaaaatga tgacaataatgg (SEQ?ID?NO：28)	attacatcatgat?tagg gaatgc (SEQ?ID?NO：29)	97bp
					?YPL240C_HSP82	-671 of double-tagging	gggtttgaacatt gatgagga (SEQ?ID?NO：30)	ggtgtcagctggaacct ctt (SEQ?ID?NO：31)	88bp

Derive from the template that total cDNA of the wild-type yeast of heat-shocked not measures as this expressions, this expression mensuration utilizes standard 5 ' nuclease condition determination--except adding 2 μ L templates--to carry out.As shown in figure 11, the mensuration design listed according to table 8, three all probes all can detect expression of gene.Any other probe and combination of primers outside use table 8 is listed all do not detect expression.For SSA4, POL5, HSP82 and APG9, can obtain expression data (Holstege, etc., 1998) in the literature.For the yeast of heat-shocked not, for SSA4 (0.8 transcript copy/cell), POL5 (0.8 transcript copy/cell) and HSP82 (1.3 transcript copy/cells), these data descriptions similar expression level, and APG9 transcript level low slightly (0.1 transcript copy/cell).

These data result of obtaining of place therewith extremely conform to, because have 25.6 C except HSP82 _tOutside the value, all other genes all show similar C _tValue.This prompting, the abundance that the relative abundance document of HSP82 transcript in the used bacterial strain of these experiments shows wants high.At the PCR of double-tagging-469 probe, carry out agarose gel electrophoresis shown in use Figure 11 a.Sepharose (Figure 12) shows, in fact produced the PCR product in the reaction of picked up signal not, and therefore the shortage from the fluorescent signal of these reactions is not by due to the PCR failure.And the amplicon explanation of the different lengths that produces at different genes in express measuring is actually and is specific to target gene expressing the signal that produces at different genes in measuring.

Embodiment 15

Select target

Use from The EnsMart software of http://WWW.ensembl.org/EnsMart 16.1 edition, from all exons of Homo Sapiens NCBI33 dbSNP115 Ensembl Genes, extract respectively apart from the 50bp of arbitrary end of each exon, form the set of people Exon50 target.Use GetCover program (referring to Figure 17), calculate the occurrence rate of all probe target sequences, remove, excessively probe target sequence by choice criteria such as GC content complementary according to excessive oneself.In residue sequence, select the highest probe target sequence (No.1 covers 3200 targets) of abundance, select occurrence rate to be higher than 0.8 times (3200 * 0.8) or all probe targets of 2560 targets of the occurrence rate of the highest probe target sequence of abundance afterwards.From remaining sample, calculate the new hits of each probe, and the new hits that calculate each probe target are compared to the existing product of selecting and total occurrence rate of this same probe target, and by selecting the highest product number to select the highest probe target sequence of next abundance.The following table example length of probe target (n), sequence (nmer) and the occurrence rate in all targets (cover), and the product of each probe target new hits (Newhit), Newhit and the cover that select (newhit * cover) and the accumulative total hits (sum) from the target colony that all probes totally obtain.

No	n	nmer	Newhit	Cover	newhit?x	?cover	sum
									1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34	8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8	ctcctcct ctggagga aggagctg cagcctgg cagcagcc tgctggag agctggag ctgctgcc aggagcag ccaggagg tcctgctg cttcctcc ccgccgcc cctggagc cagcctcc tggctgtg cctggaga ccagccag ccagggcc cccagcag ccaccacc ctcctcca ttctcctg cagcccag ctggctgc ctccacca cttcctgc cttccagc ccacctcc ttcctctg cccagccc tggtgatg tggctctg ctgccttc	3200 2587 2132 2062 1774 1473 1293 1277 1179 1044 945 894 1017 781 794 805 692 661 578 544 641 459 534 471 419 426 437 415 366 435 354 398 358 396	3200 3056 3074 2812 2809 2864 2863 2608 2636 2567 2538 2477 2003 2439 2325 2122 2306 2205 2318 2373 1916 3010 1894 2033 2173 2097 1972 1883 2018 1666 1948 1675 1767 1557	10240000 7905872 6553768 5798344 4983166 4218672 3701859 3330416 3107844 2679948 2398410 2214438 2037051 1904859 1846050 1708210 1595752 1457505 1339804 1290912 1228156 1381590 1011396 957543 910487 893322 861764 781445 738588 724710 689592 666650 632586 616572		3200 5787 7919 9981 11755 13228 14521 15798 16977 18021 18966 19860 20877 21658 22452 23257 23949 24610 25188 25732 26373 26832 27366 27837 28256 28682 29119 29534 29900 30335 30689 31087 31445 31841

No	n	nmer	Newhit	Cover	newhit?x	?cover	sum
								35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70	8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8	ctcca?gcc tgtggctg cagaggag cagctccc ctgcctcc tctgctgc ctgcttcc cttctccc cctcagcc ctccttcc cagcaggc ctgcctct ctccacct ctcctccc cttcccca cttcagcc ctctgcca ctgggaga cttctgcc cagcaggt tctggagc tcctgctc ctggggcc ctcctgcc ctgggcaa ctggggct tggtggcc ccagggca ctgctccc tgggcagc ctccatcc ctgcccca ttcctggc atggctgc tggtggaa tgctgtcc	294 304 302 275 262 267 280 291 232 236 217 251 215 205 224 203 201 192 195 170 206 159 159 155 185 149 145 147 146 135 161 143 155 157 155 135	2378 1930 1845 1914 1977 1912 1777 1663 1863 1762 1868 1575 1706 1701 1537 1650 1628 1606 1533 1711 1328 1864 1659 1733 1374 1819 1731 1613 1582 1821 1389 1498 1351 1285 1263 1424	699132 586720 557190 526350 517974 510504 497560 483933 432216 415832 405356 395325 366790 348705 344288 334950 327228 308352 298935 290870 273568 296376 263781 268615 254190 271031 250995 237111 230972 245835 223629 214214 209405 201745 195765 192240		32135 32439 32741 33016 33278 33545 33825 34116 34348 34584 34801 35052 35267 35472 35696 35899 36100 36292 36487 36657 36863 37022 37181 37336 37521 37670 37815 37962 38108 38243 38404 38547 38702 38859 39014 39149

?No	n	nmer	Newhit	Cover	newhit?x	?cover	?sum
								?71 ?72 ?73 ?74 ?75 ?76 ?77 ?78 ?79 ?80 ?81	8 8 8 8 8 8 8 8 8 9 8	ccagccgc catccagc tcctctcc agctggga ctggtctc ttcccagt caggcagc tcctcagc ctggctcc tcctcttct tccagtgt	159 122 118 121 128 142 108 105 103 127 123	1203 1590 1545 1398 1151 1023 1819 1654 1607 1006 968	191277 193980 182310 169158 147328 145266 196452 173670 165521 127762 119064		?39308 ?39430 ?39548 ?39669 ?39797 ?39939 ?40047 ?40152 ?40255 ?40382 ?40505

Embodiment 16

The qPCR of people's gene

Use is united in this probe library and following PCR in real time design software, wherein said software can:

● by the identifier of uniqueness or the nucleotide sequence of submitting to by registration, the sequence of identification input

● all probes that discriminating can this nucleic acid of target

● according to the target sequence choice criteria, for example near 3 ' end or near intron-exon border, the letter sorting probe

If ● can, according to the PCR design rule, design is positioned at the PCR primer of the probe flank of this nucleotide sequence of target

● based on above step, propose the available PCR in real time and measure.

By Www.probelibrary.comOn software, the effective and reliable qPCR that can be designed for people's gene measures.

ProbeFinder software can be designed best qPCR probe and primer fast and reliably at given people's gene.

This design comprises following steps:

1) determines the position of intron

By selecting to stride the intron of qPCR, eliminate noise from chromosomal DNA.Determine intron by blast retrieval people's gene group.Appear at that DNA goes up but the zone that do not appear on the transcript is considered to intron.

2) with probe library and gene coupling

In these 90 probes at least one can cover almost all people's transcript, and the LNA of recognition sequence label modifies and makes this high coverage rate become possibility.

3) qPCR that design primer and selection are best measures

With ' Primer3 ' (Whitehead Inst.For Biomedical Research, S.Rozen and H.J.Skaletsky), design primer.At last, according to the grade of selected regularly arranged probe, thereby guarantee best possible qPCR.The intron that these rules help striding amplicon is to remove the spurious response that pollutes from DNA and to help being used for repeatably the little amplicon size of similar mensuration and the GC content that optimization is used for PCR.

Embodiment 17

Preparation ena-monomer and oligomer

Preparation ENA-T monomer, and use it for preparation double-tagging probe of the present invention.

In following sequence, X represents 2 '-O, 4 '-C-ethylidene-methyl uracil (ENA-T).This monomeric synthesizing in WO 00/47599 describes.Be used to mix 5 '-O-dimethoxytrityl-2 '-O, 4 '-C-ethylidene-methyl uracil-3 '-O-(2-cyano ethyl-N, N ,-di-isopropyl) reaction conditions of phosphoramidite is corresponding to the reaction conditions that is used to prepare LNA oligomer described in the embodiment 6.

Be prepared as follows the probe of three double-taggings:

?EQ#	Sequence	MW (calculating)	MW (actual measurement)
				?16533 ?16534 ?16535	5’-Fitc-ctGmCXmCmCAg-EQL-3’ 5’-Fitc-cXGmCXmCmCA-EQL-3’ 5’-Fitc-tGGmCGAXXX-EQL-3’	4002Da. 3715Da. 4128Da.	4001Da. 3716Da. 4130Da.

X represents the ENA-T monomer.Lowercase represent the dna single body (a, g, c, t).The Fitc=fluorescein; The EQL=Eclipse quencher; The Dabcyl=Dabcyl quencher.The MW=molecular weight.Except ' X ' capitalization represent methoxyl group LNA Nucleotide.

Embodiment 18

Double-tagging probe assay scheme

According to following scheme (table 9), mix the reagent of real-time double-tagging probe PCR:

Table 9

Reagent	Final concentration
		H 2O GeneAmp10x PCR damping fluid II Mg 2+DATP; DGTP, dCTP dUTP 17302Q4 double labelling probe 15319 few thing template 15321 forward primers 15322 reverse primer uracil dna glycosylase AmpliTaq Gold	? 1x 5.5mM 0.2mM 0.6mM 0.1μM 4?pM 0.2μM 0.2μM 0.5U 2.5U
Amount to	50μL

In above-mentioned PCR mixture, comprise primer, probe and the few thing template of following table 10 from table 9;

Table 10

Title	Sequence	Quencher
			15321 forward primers, 15322 reverse primer 17302Q4 double-tagging probes, 15319 few thing templates	gactcacggtcgcacca(SEQ?ID?NO：47) ccgcgttccacggtta(SEQ?ID?NO：48) 5’6-Fitc-tTmCmCTmCTG#Q4z?3’ attgactcacggtcgcaccaaattcctctgccttcctgctctgctggga gaaggaggtggtgatgtggctggaaggaggcagctccaggagaaaataa ccgtggaacgcggtcat(SEQ?ID?NO：49)	- - Q4 ? ? -

Capitalization is a LNA Nucleotide;

6-Fitc: fluorescein 6-lsothiocyanates;

#Q4:1,4-two (2-hydroxyethylamino)-6-tectoquinone, with reference to embodiment 21, its phosphoramidite form that has also shown the 2-cyano ethyl protection of this molecule (is that (4-(2-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) ethyl) phenyl amino)-((2-(4 for 4-for 4-for 1-, 4 '-dimethoxy-trityl oxygen) preparation-6 (7)-methyl-anthraquinones phenyl amino ethyl))), it is used for the general method of embodiment 6;

Z:2 '-deoxidation-5-nitroindoline-ribofuranosyl (ribofuranosyl);

The mC:5-methylcystein.

As embodiment 6 general descriptions ground, preparation 17302Q4 double-tagging probe.

PCR recycle scheme (table 11) below using, in DNA Engine Opticon  (MJResearch), measure:

Table 11

	37 ℃ 10 minutes
			95 ℃ 7 minutes
40 circulations:	94 ℃ of 60 ℃ of fluoroscopic examinations in 1 minute in 20 seconds

Explained the result of PCR in real time in Figure 18, it confirms that the double-tagging probe that contains quencher Q4 can play the function of PCR in real time probe fully.

Embodiment 19

Double-tagging probe functional in PCR in real time

The scheme of double-tagging probe assay

According to following scheme (table 12), mix the reagent of real-time double-tagging probe PCR:

Table 12

Reagent	Final concentration
		H 2O GeneAmp10x PCR damping fluid II Mg 2+DATP; DGTP, dCTP dUTP 15305Q1 double labelling probe 15319 few thing template 15321 forward primers 15322 reverse primer uracil dna glycosylase AmpliTaq Gold	? 1x 5.5mM 0.2mM 0.6mM 0.1μM 4?pM 0.2μM 0.2μM 0.5U 2.5U
Amount to	50μL

In above-mentioned PCR mixture, comprise primer, probe and the few thing template of following table 13 from table 12;

Table 13

Title	Sequence	Quencher
			15321 forward primers	gactcacggtcgcacca(SEQ?ID?NO：47)	-

15322 reverse primer 15305Q1 double-tagging probes, 15319 few thing templates

ccgcgttccacggtta(SEQ?ID?NO：48) 5’6-Fitc-tTmCmCTmCTG#Q1z?3’ attgactcacggtcgcaccaaattcctctgccttcctgctctgctggga gaaggaggtggtgatgtggctggaaggaggcagctccaggagaaaataa ccgtggaacgcggtcat(SEQ?ID?NO：49)

- Q1 ? ? -

* capitalization is a LNA Nucleotide;

6-Fitc: fluorescein 6-lsothiocyanates;

#Q1:1,4-two (3-hydroxypropyl amino)-anthraquinone, with reference to embodiment 20, it has also shown the phosphoramidite form of 2-cyano ethyl protection of this molecule, and ((3-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) propyl group amino)-(3-(4 for 4-for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone) preparation, it is used for the general method of embodiment 6;

Z:2 '-deoxidation-5-nitroindoline-ribofuranosyl;

The mC:5-methylcystein.

As embodiment 6 general descriptions ground, preparation 15305Q1 double-tagging probe.

PCR recycle scheme below using, in DNA Engine Opticon  (MJ Research), measure:

Table 14

	37 ℃ 10 minutes
			95 ℃ 7 minutes
40 circulations:	94 ℃ of 60 ℃ of fluoroscopic examinations in 1 minute in 20 seconds

Explained the result of PCR in real time in Figure 19, it confirms that the double-tagging probe that contains 3 '-nitroindoline can play the function of PCR in real time probe fully.

Embodiment 20

Preparation 1-(3-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) propyl group amino)-4-(3-(4,4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone (3)

1,4-two (3-hydroxypropyl amino)-anthraquinone (1)

With quinizarin leuco compound (Leucoquinizarin) (9.9g; 0.04mol) mix mutually with 3-amino-1-propyl alcohol (10mL) and ethanol (200mL), and reflux 6 hours.Mixture is cooled to room temperature, under atmospheric condition, stirs and spend the night.Mixture is poured in the water (500mL), leached precipitation, water (200mL) washing, and dry.Solid is boiled in vinyl acetic monomer (300mL), be cooled to room temperature, pass through solid collected by filtration.

Output: 8.2g (56%)

1-(3-(4,4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl ammonia Base)-anthraquinone (2)

With 1,4-two (3-hydroxypropyl amino)-anthraquinone (7.08g; 0.02mol) be dissolved in exsiccant N, in the mixture of dinethylformamide (150mL) and exsiccant pyridine (50mL).Add dimethoxytrityl chlorine (3.4g; 0.01mol), mixture was stirred 2 hours.Add other dimethoxytrityl chlorine (3.4g; 0.01mol), mixture was stirred 3 hours.Enriched mixture under vacuum is dissolved in resistates in the methylene dichloride (400mL) again, water (2 * 200ml) washings, and dry (Na ₂SO ₄).By silicagel pad ( 10cm; H10cm) filtering solution is used the methylene dichloride wash-out, begins to wash out up to list-DMT-anthraquinone product, after this, solvent is changed to 2% methyl alcohol in the methylene dichloride.Merge pure fraction, concentrate, obtain blue foam.

Output: 7.1g (54%)

¹H-NMR (CDCl ₃): 10.8 (2H, 2xt, J=5.3Hz, NH), 8.31 (2H, m, AqH), 7.67 (2H, dt, J=3.8 and 9.4, AqH), 7.4-7.1 (9H, m, ArH+AqH), 6.76 (4H, m, ArH) 3.86 (2H, q, J=5.5Hz, CH ₂OH), 3.71 (6H, s, CH ₃), 3.54 (4H, m, NCH ₂), 3.26 (2H, t, J=5.7Hz, CH ₂ODMT), 2.05 (4H, m, CCH ₂C), 1.74 (1H, t, J=5Hz, OH).

1-(3-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) propyl group ammonia Base)-4-(3-(4,4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone (3)

With 1-(3-(4,4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl amino)-anthraquinone (0.66g; 1.0mmol) be dissolved in the exsiccant methylene dichloride (100mL), and add 3  molecular sieves.Mixture was stirred 3 hours, add 2-cyano ethyl-N then, N, N ', N '-tetra isopropyl two phosphoramidite (335mg; 1.1mmol) and 4,5-dicyano imidazole (105mg; 0.9mmol).Mixture was stirred 5 hours, add saturated NaHCO then ₃(50mL), and stirred 10 minutes.Separate phase, use saturated NaHCO ₃(50mL), salt solution (50mL) washing organic phase, and dry (Na ₂SO ₄).After concentrating, obtain blue foamed phosphoramidite, it is synthetic to be used for oligonucleotide without further purification.

Output: 705mg (82%)

³¹P-NMR(CDCl ₃)：150.0

¹H-NMR(CDCl ₃)：10.8(2H，2xt，J＝5.3Hz，NH)，8.32(2H，m，AqH)，7.67(2H，m，AqH)，7.5-7.1(9H，m，ArH+AqH)，6.77(4H，m，ArH)3.9-3.75(4H，m)，3.71(6H，s，OCH ₃)，3.64-3.52(3.54(6H，m)，3.26(2H，t，J＝5.8Hz，CH ₂ODMT)，2.63(2H，t，J＝6.4Hz，CH ₂CN)2.05(4H，m，CCH ₂C)，1.18(12H，dd，J＝3.1Hz，CCH ₃)。

Embodiment 21

Preparation 1-(4-(2-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) ethyl) phenyl amino)-4-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-6 (7)-methyl-anthraquinones (13)

6-methyl-quinizarin (10)

With 4-methyl-Tetra hydro Phthalic anhydride (10g, 62mmol), P-Chlorophenol (3.6g, 28mmol) and boric acid (1.6g) be dissolved in dense H ₂SO ₄(34ml), in the flask of stacked coated glass sheets, mixture was stirred 6 hours at 200 ℃.After reaction finished, cooling mixture was poured in the water (160ml) then, by filtering collecting precipitation.Solid suspension in boiling water (320ml), was boiled 5 minutes, pass through solid collected by filtration.After the drying, obtain the garnet solid state product (5g, 19.7mmol).MALDI-MS：m/z255.7(M+H)。

1,4-two (4-(2-hydroxyethyl) phenyl amino)-6-methyl-anthraquinone (11)

With 6-methyl-quinizarin (10,2.5g) be suspended in the acetic acid (30ml), add Zn-powder (2g), mixture is stirred 1h at 90 ℃.By Celite pad, filtering mixt is cooled to room temperature, adds entry (90ml) then, collects the reductive anthraquinone derivative by filtering then.Then, with solid and boric acid (1.9g; 0.03mol) mix mutually with ethanol (100mL), and refluxed 1 hour.Mixture is cooled to room temperature, adds 4-amino-benzene ethyl alcohol (4.1g; 0.03mol), after this heated mixt refluxed 3 days.Spissated mixture is dissolved in the methylene dichloride (300mL) again water (3 * 100mL) washings, dry (Na ₂SO ₄) and concentrate.On silicagel column, use MeOH/ methylene dichloride purifying resistates.Output: 1.5g (30%).

1-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-4-(4-(2- Hydroxyethyl) (7)-methyl-anthraquinone (12) phenyl amino)-6

With 1,4-two (4-(2-hydroxyethyl) phenyl amino)-6-methyl-anthraquinone (0.95g; 1.9mmol) be dissolved in exsiccant pyridine (30mL).Add dimethoxytrityl chlorine (0.34g; 1mmol), mixture was stirred 2 hours.Add other dimethoxytrityl chlorine (0.34g; 1mmol), mixture was stirred 4 hours.Enriched mixture under vacuum is dissolved in resistates in the methylene dichloride (200mL) again, water (2 * 100ml) washings, and dry (Na ₂SO ₄).By the column chromatography (purified product of toluene/EtoAc).Output: 0.81g (54%).

1-(4-(2-(2-cyano group oxyethyl group (diisopropylaminoethyl) phosphino-oxygen) ethyl) phenylamino Base)-4-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-6 (7)-methyl -anthraquinone (13)

With 1-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-4-(4-(2-hydroxyethyl) phenyl amino)-6 (7)-methyl-anthraquinone (0.50g; 0.63mmol) be dissolved in the exsiccant methylene dichloride (50mL), and add 3  molecular sieves.Mixture was stirred 3 hours, add 2-cyano ethyl-N then, N, N ', N '-tetra isopropyl two phosphoramidite (215mg; 0.72mmol) and 4,5-dicyano imidazole (64mg; 0.55mmol).Mixture was stirred 4 hours, add saturated NaHCO then ₃(25mL), and stirred 10 minutes.Separate phase, use saturated NaHCO ₃(25mL), salt solution (25mL) washing organic phase, and dry (Na ₂SO ₄).Evaporate phosphoramidite then to dry, it is synthetic to be used for oligonucleotide without further purification.Output: 0.59g (94%).

Embodiment 22

Using the probe library to carry out SNP detects

Single nucleotide polymorphism (SNP) is a modal genetic mutation type in people and other genome.By using 2 kinds of not probes of isolabeling simultaneously, they are hybridized with a SNP allele-specific ground separately, can use the probe of double-tagging to carry out the SNP detection.The result of PCR in real time can indicate one or another or two existence of allelotrope in sample thus.Can use genomic dna or RNA as sample.

The SNP great majority take place randomly, as the result of SNP, predict almost arbitrarily that can there be many arrangements in sequence background, at present known 2,000,000 SNP that surpass.Therefore, make the relevant probe of all preservations be used for supplying with or setting up the SNP detection assay, need millions of probes.

Relevant with the present invention, because the short probe that uses LNA to realize uses 8 or the 9-aggressiveness probe that contain LNA, can reduce this number.In theory, can have 4 ⁹Or 262144 kinds of possible 9-aggressiveness and 4 ⁸Or 65536 kinds of 8-aggressiveness, and be that all possible SNP sequence of covering is necessary.Another advantage that contains the few thing of LNA is the specificity that improves, and allows the SNP-position in the probe is placed the optional position of probe.Therefore, each probe can cover 9 different SNP positions, this can with 8-aggressiveness sequence required 65536 be reduced to 65536/9=7281.Detection also can occur on two chains, thereby only needs 7281/2=3640 probe.

Embodiment 23

SNP distinguishes that embodiment-in PCR in real time uses the double-tagging probe to realize that single mispairing distinguishes Double-tagging probe assay scheme

According to following scheme (table 15), mix the reagent of real-time double-tagging probe PCR:

Table 15

Reagent	Final concentration
		H 2O GeneAmp10x PCR damping fluid II Mg 2+DATP; DGTP, few thing template (14229 or 14226) 14117 forward primers of dCTP dUTP 13996 double labelling probes 14118 reverse primer uracil dna glycosylase AmpliTaq Gold	1x 5.5mM 0.2mM 0.6mM 0.1μM 40fM 0.2μM 0.2μM 0.5U 2.5U
Amount to	50μL

In above-mentioned PCR mixture (table 15), comprise following primer, probe and few thing template;

Table 16

Title	Sequence
		The few thing template of 14117 forward primers, 14118 reverse primer 13996 double-tagging probes, 14229 single mispairing few thing template 14226 Perfect Matchings	cagctaaaaatgatgacaataatgg attacatcatgattagggaatgc 5′6-Fitc-ctGGAGmCaG-EQL?3′ cagctaaaaatgatgacaataatgggctaacggagaagcgggagcagatcg gcattccctaatcatgatgtaat cagctaaaaatgatgacaataatgggctaaaggagaagctggagcagatcg gcattccctaatcatgatgtaat

Capitalization is a LNA Nucleotide;

6-Fitc: fluorescein 6-lsothiocyanates;

EQL:Eclipse ^TMDark quencher (Epoch Biosciences);

The mC:5-methylcystein.

PCR recycle scheme below using, in DNA Engine Opticon  (MJResearch), measure:

Table 17

	37 ℃ 10 minutes
			95 ℃ 7 minutes
40 circulations:	94 ℃ of 60 ℃ of fluoroscopic examinations in 1 minute in 20 seconds

Explained the result of PCR in real time in Figure 20, it confirms that the double-tagging probe can be distinguished the target of Perfect Matchings and have the target of single mispairing with respect to probe.

Reference and note

1.Helen?C.Causton，Bing?Ren，Sang?Seok?Koh，Christopher?T.Harbison，Elenita?Kanin，Ezra?G.Jennings，Tong?Ihn?Lee，Heather?L.True，Eric?S.Lander，and?Richard?A.Young(2001).Remodelling?of?Yeast?Genome?ExpresSion?in?Response?toEnvironmental?Changes.Mol.Biol.Cell?12：323-337(2001).

2.Frank?C.P.Holstege，Ezra?G.Jennings，John?J.Wyrick，TongIhn?Lee，Chr?istoph?J.Hengartner，Michael?R.Green，ToddR.Golub，Eric?S.Lander，and?Richard?A.Young(1998).Dissecting?the?Regulatory?Circuitry?of?a?Eukaryotic?Genome.Cell?1998?95：717-728.

3.Simeonov，Anton?and?Theo?T.Nikiforov，Single?nucleotidepolymorphism?genotyping?using?short，fluorescentlylabelled?locked?nucleic?acid(LNA)probes?and?fluores?cencepolarization?detection，Nucleic?Acid?Research，2002，Vol.30?No17e?91.

Those skilled in the art can change, modify and otherwise implement the description of this paper, and do not depart from the spirit and scope of description herein and the present invention for required protection, and these changes, modification and embodiment are all within the scope of the present invention.

More than disclosed reference, patent, patent application and international application intactly incorporate into herein as a reference.

Sequence table

<110>Exiqon?A/S

＜120〉be used for probe, library and test kit and the construction process thereof of analysis of mixtures of nucleic acids

<130>16079PCT00

<160>49

<170>PatentIn?version3.2

<210>1

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>1

cgcgtttact?ttgaaaaatt?ctg 23

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>2

gcttccaatt?tcctggcatc 20

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>3

gcccaagatg?ctataaattg?gttag 25

<210>4

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>4

gggtttgcaa?caccttctag?ttc 23

<210>5

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>5

tacggagctg?caggtggt 18

<210>6

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>6

gttgggccgt?tgtctggt 18

<210>7

<211>13

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>7

caaggagaag?ttg 13

<210>8

<211>13

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>8

caaggagaag?ttg 13

<210>9

<211>12

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>9

caaggaaagt?tg 12

<210>10

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>10

cgcgtttact?ttgaaaaatt?ctg 23

<210>11

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>11

gcttccaatt?tcctggcatc 20

<210>12

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>12

gcccaagatg?ctataaattg?gttag 25

<210>13

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>13

gggtttgcaa?caccttctag?ttc 23

<210>14

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>14

tacggagctg?caggtggt 18

<210>15

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>15

gttgggccgt?tgtctggt 18

<210>16

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>16

gcgagagaaa?acaagcaagg 20

<210>17

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>17

attcgtcttc?actggcatca 20

<210>18

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>18

cagctaaaaa?tgatgacaat?aatgg 25

<210>19

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>19

attacatcat?gattagggaa?tgc 23

<210>20

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>20

gggtttgaac?attgatgagg?a 21

<210>21

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>21

ggtgtcagct?ggaacctctt 20

<210>22

<211>13

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<220>

<221>modified_base

<222>(1)..(1)

＜223〉N is the LNA methylcystein

<220>

<221>misc_feature

<222>(1)..(1)

＜223〉n is a, c, g, or t

<400>22

naaggagaag?ttg 13

<210>23

<211>35

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>23

acgtgagctc?attgaaactg?caggtggtat?tatga 35

<210>24

<211>44

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>24

gatccccggg?aattgccatg?ctaatcaacc?tcttcaaccg?ttgg 44

<210>25

<211>50

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>25

acgtggatcc?tttttttttt?tttttttttt?gatccccggg?aattgccatg 50

<210>26

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>26

gcgagagaaa?acaagcaagg 20

<210>27

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>27

attcgtcttc?actggcatca 20

<210>28

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>28

cagctaaaaa?tgatgacaat?aatgg 25

<210>29

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>29

attacatcat?gattagggaa?tgc 23

<210>30

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>30

gggtttgaac?attgatgagg?a 21

<210>31

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>31

ggtgtcagct?ggaacctctt 20

<210>32

<211>164

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>32

caccgttcgg?catatccata?tttcccacag?ccaccaccag?gaaggcagca?gccaggagga 60

gcagcctcct?cagagaagca?gcctggagac?ttcctccagc?tccagggccg?ccgcctgctg 120

gagcagcagc?accagaagag?ggggaggtac?ggttggttgt?acga 164

<210>33

<211>108

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>33

tggcggacgc?acaccgctta?cccctgctgg?aggaagctga?ggaggagcag?cctggagcag 60

cagcagccag?ctccgccgcc?aggaagccga?ctcacgggcc?acgcatta 108

<210>34

<211>115

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>34

gggtgcgacc?gtgagtcaat?ggtctccagg?aggctgtctt?ctggtgctgc?tcctctgctg 60

cctccagctt?ctctggccct?ggtggtggct?gtgggtaatg?cgtggcccgt?gagtc 115

<210>35

<211>106

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>35

attgactcac?ggtcgcacca?aactctgctg?ggctgcctgg?aagctccagg?agaacttcca 60

gccagctcct?ccaccagcag?gaagaataac?cgtggaacgc?ggtcat 106

<210>36

<211>124

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>36

atacccatcc?aaggcgtccc?taaaggaggc?agaggaaggg?agctgccttc?ccagcccttc 60

tcccagcaca?gcagagcaga?gccacctcca?gccacatcac?caaaatgacc?gcgttccacg 120

gtta 124

<210>37

<211>115

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>37

attgactcac?ggtcgcacca?aacctggaag?gcagaggaac?tgcctcctcc?accatcacca 60

ctgctgggct?gggaagcttc?cagcacagca?ggaaataacc?gtggaacgcg?gtcat 115

<210>38

<211> 121

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>38

atacccatcc?aaggcgtccc?taaact?tctc?ccagagccac?ctccagccag?ccacaccagc 60

agagcaggaa?ggagctgcct?ggagcagctc?ccaggagaaa?aatgaccgcg?ttccacggtt 120

a 121

<210>39

<211>115

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>39

attgactcac?ggtcgcacca?aattcctctg?ccttcctgct?ctgctgggag?aaggaggtgg 60

tgatgtggct?ggaaggaggc?agctccagga?gaaaataacc?gtggaacgcg?gtcat 115

<210>40

<211>114

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>40

atacccatcc?aaggcgtccc?taaacttcca?ggcagctccc?tccagccagc?aggacttccc 60

agcccagctc?ctccaccagc?acagcagagc?caaaatgacc?gcgttccacg?gtta 114

<210>41

<211>114

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>41

ttagggacgc?cttggatggg?tatggctgag?gcggctggct?cctgcatcct?cttctgcctc 60

tgctcccagc?tgagccatgc?cctggcttcc?accaattgcc?gacccaccgg?gata 114

<210>42

<211>122

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>42

attcgctacg?gcccaacacc?ttactccacc?tcctgcccca?ctggggctga?agtccagtgt 60

ctggagctgc?ttcccagtgg?gcagccatcc?agcaggccac?catatcccgg?tgggtcggca 120

at 122

<210>43

<211>124

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>43

taaggtgttg?ggccgtagcg?aatcgctctg?ccactggggc?ctggtctcca?tcctctcctc 60

cctgggcaac?ctgctgtcct?tggcagtggg?gaagctgtgc?caattgtcct?ccgcccggac 120

tcat 124

<210>44

<211> 122

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>44

ttagggacgc?cttggatggg?tatctctgcc?actggctcca?gatcctcttc?tgccccactg 60

ccatgggcag?ctggggcctc?ctccctccac?ctggcttccc?caattgccga?cccaccggga 120

ta 122

<210>45

<211>118

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>45

attcgctacg?gcccaacacc?ttacctcagc?cccagctcca?tccagccgcc?aaggactggt 60

ctcctgccct?gggcaactgg?gaatggctgc?ttccaccata?tcccggtggg?tcggcaat 118

<210>46

<211>124

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>46

taaggtgttg?ggccgtagcg?aatctgcctc?ttcagccgct?ctgctcccag?ctgagccatc 60

cagtgtgcag?gagaggacag?caggtggcac?agcaggccac?caattgtcct?ccgcccggac 120

tcat 124

<210>47

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>47

gactcacggt?cgcacca 17

<210>48

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>48

ccgcgttcca?cggtta 16

<210>49

<211>115

<212>DNA

＜213〉artificial sequence

<220>

＜223〉composition sequence

<400>49

attgactcac?ggtcgcacca?aattcctctg?ccttcctgct?ctgctgggag?aaggaggtgg?60?tgatgtggct

ggaaggaggc?agctccagga?gaaaataacc?gtggaacgcg?gtcat 115

Claims (90)

1. oligonucleotide probe library, each probe in its Chinese library is formed by recognition sequence label and test section, wherein, at least one monomer is modified monomer analogue in each oligonucleotide probe, thereby for the oligonucleotide of corresponding unmodified, increased binding affinity to complementary target sequence, these library probes have the substantive part that enough stability is used for the combination of sequence-specific ground and detects the target nucleic acid of any given target colony thus, and wherein, the number of different recognition sequences account for the possible sequence label of institute with given length less than 10%, and wherein

It is right that each probe contains the fluorophore-quencher that is useful on detection, and wherein said quencher has formula (I)

R wherein ¹, R ⁴, R ⁵And R ⁸In one or two be key independently, or be selected from replacement or unsubstituted amino, it constitutes and being connected of the remainder of oligonucleotide probe, and wherein remaining R ¹To R ⁸Group is hydrogen independently of one another, or that replace or unsubstituted hydroxyl, amino, alkyl, aryl, aralkyl or alkoxyl group, and/or be less than in the wherein said library 20% oligonucleotide probe 5 ' and/or 3 ' position have guanidine radicals (G) residue.

2. according to the library of claim 1, wherein said quencher is selected from 1,4-two-(3-hydroxyl-propyl group amino)-anthraquinone, (3-(4 for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl amino)-anthraquinone, 1,5-two-(3-hydroxyl-propyl group amino)-anthraquinone, (3-hydroxypropyl amino)-(3-(4 for 5-for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone, 1,4-two-(4-(2-hydroxyethyl) phenyl amino)-anthraquinone, ((2-(4 for 4-for 1-, 4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-4-(4-(2-hydroxyethyl) phenyl amino)-anthraquinone, 1,8-two-(3-hydroxyl-propyl group amino)-anthraquinone, 1,4-two (3-hydroxypropyl amino)-6-tectoquinone, (3-(4 for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-4-(3-hydroxypropyl amino)-6 (7)-methyl-anthraquinones, 1,4-two (4-(2-hydroxyethyl) phenyl amino)-6-methyl-anthraquinone, 1,4-two (4-methyl-phenyl amino)-6-carboxyl-anthraquinone, 1,4-two (4-methyl-phenyl amino)-(N-(6 for 6-, 7-dihydroxyl-4-oxygen-heptane-1-yl)) methane amide-anthraquinone, 1,4-two (4-methyl-phenyl amino)-6-(N-(7-dimethoxytrityl oxygen-6-hydroxyl-4-oxygen-heptane-1-yl)) methane amide-anthraquinone, 1,4-two (propyl group amino)-6-carboxyl-anthraquinone, 1,4-two (propyl group amino)-(N-(6 for 6-, 7-dihydroxyl-4-oxygen-heptane-1-yl)) methane amide-anthraquinone, 1,4-two (propyl group amino)-6-(N-(7-dimethoxytrityl oxygen-6-hydroxyl-4-oxygen-heptane-1-yl)) methane amide-anthraquinone, 1,5-two (4-(2-hydroxyethyl) phenyl amino)-anthraquinone, (4-(2-hydroxyethyl) phenyl amino)-((2-(4 for 4-for 5-for 1-, 4 '-dimethoxy-trityl oxygen) phenyl amino ethyl))-anthraquinone, 1,8-two (3-hydroxypropyl amino)-anthraquinone, (3-hydroxypropyl amino)-(3-(4 for 8-for 1-, 4 '-dimethoxy-trityl oxygen) propyl group amino)-anthraquinone, 1,8-two (4-(2-hydroxyethyl) phenyl amino)-anthraquinone, and 1-(4-(2-hydroxyethyl) phenyl amino)-8-(4-(2-(4,4 '-dimethoxy-trityl oxygen) ethyl) phenyl amino)-anthraquinone.

3. according to the library of claim 1, wherein said quencher is 1,4-two (2-hydroxyl-ethylamino)-6-tectoquinone.

4. according to each the library in the aforementioned claim, wherein be less than 10% oligonucleotide probe and have G at 5 ' end, for example be less than 5%.

5. according to the library of claim 4, there is not oligonucleotide to have G in its Chinese library at 5 ' end.

6. according to each the oligonucleotide probe library in the aforementioned claim, the recognition sequence label fragment of its Chinese library middle probe is modified at least a following mode:

I) Nucleotide that exists with at least one non-natural substitutes;

Ii) substitute to increase the stability of probe with at least one chemical group.

7. according to each the oligonucleotide probe library in the aforementioned claim, long 6 to 12 Nucleotide of recognition sequence label wherein.

8. according to the oligonucleotide probe library of claim 7, wherein the recognition sequence label is grown 8 or 9 Nucleotide.

9. oligonucleotide probe library according to Claim 8, wherein recognition sequence label LNA nucleotide substitution.

10. according to each the oligonucleotide probe library in the aforementioned claim, wherein the oligonucleotide probe more than 90% can in conjunction with and detect at least two target sequences in the nucleic acid population.

11. according to the library of claim 10, at least two target complement sequences in recognition sequence label and the nucleic acid population wherein.

12. have the library of the oligonucleotide probe of 8 and 9 length of nucleotides, it comprises the mixture of the subclass of the oligonucleotide probe that defines in each of claim 1-11.

13. according to each the oligonucleotide probe library in the aforementioned claim, wherein the number of the different target sequences in the nucleic acid population is at least 100.

14. according to each the oligonucleotide probe library in the aforementioned claim, wherein key substitutes between the Nucleotide of the nucleotide analog, ribodesose or ribose analogue or the non-phosphodiester bond that exist with non-natural of at least one Nucleotide in each oligonucleotide probe.

15. according to each the oligonucleotide probe library in the aforementioned claim, wherein the test section is covalently or non-covalent ground bonded minor groove binding or intercalator, and it is selected from: unsymmetrical cyanine dye, DAPI, SYBR Green I, SYBR Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst 33342, ethidium bromide, 1-O-(1-pyrenyl methyl) glycerol and Hoechst 33258.

16. according to the oligonucleotide probe library of claim 14 or 15, key is a key between the Nucleotide of non-phosphoric acid ester between the Nucleotide of wherein said non-phosphodiester bond.

17. according to the oligonucleotide probe library of claim 16, key is selected between wherein said Nucleotide: phosphonate ester, phosphoramidite, alkyl phosphotriester, thiophosphatephosphorothioate and phosphorodithioic acid ester bond.

18. according to each the oligonucleotide probe library in the aforementioned claim, wherein said oligonucleotide probe contains the Nucleotide that non-natural exists, for example 2 '-O-methyl, diaminopurine, 2-sulfo-uridylic, 5-nitroindoline, general or degeneracy base, embed nucleic acid or minor groove binding, to strengthen combining of probe and complementary nucleic acid sequence.

19. according to the library of claim 18, wherein all oligonucleotide probes contain at least one 5-nitroindoline residue.

20. according to each the oligonucleotide probe library in the aforementioned claim, wherein said different recognition sequences account for have given length might below 1% of oligonucleotide.

21. according to each the oligonucleotide probe library in the aforementioned claim, wherein each probe can use the double-tagging thing to utilize the molecular beacon measuring principle to detect.

22. according to each the oligonucleotide probe library of claim 1-20, wherein each probe can use the double-tagging thing to utilize 5 ' nuclease measuring principle to detect.

23. according to each the library in the aforementioned claim, wherein each probe all contains single test section, this test section can be detected by the molecular beacon measuring principle.

24. according to each the oligonucleotide probe library in the aforementioned claim, wherein target nucleic acid colony is mRNA sample, cDNA sample or genome DNA sample.

25. according to the oligonucleotide probe library of claim 24, wherein said said target mrna or target cDNA colony derive from the transcript group of people, mouse, rat, Arabidopis thaliana, drosophila melanogaster (Drosophilamelanogaster), chimpanzee or Caenorhabditis elegans (Caenorhabditis elegan).

26. according to each the oligonucleotide probe library in the aforementioned claim, wherein said probe target sequence occurs at least once in the different target nucleic acids more than 4% target nucleic acid colony.

27., wherein from described library, removed self complementary probe sequence according to each the oligonucleotide probe library in the aforementioned claim.

28. according to the oligonucleotide probe library of claim 27, selected remove (de-selected) of wherein said self complementary sequence.

29. oligonucleotide probe library according to claim 27, wherein said self complementary sequence is by the sequence specific sex modification, for example non-standard Nucleotide, have the Nucleotide, 2 of SBC nucleic acid base '-0-methyl, diaminopurine, 2-sulfo-uridylic, general or degeneracy base or minor groove binding, and be eliminated.

30. according to each the oligonucleotide probe library in the aforementioned claim, the wherein melting temperature(Tm) (T of each probe _m) by the modification with the non-natural existence, for example, LNA, randomly modify with the SBC nucleic acid base, 2 '-O-methyl, diaminopurine, 2-sulfo-uridylic, 5-nitroindoline, general or degeneracy base, embed nucleic acid or minor groove binding, substitute strengthening combining of probe and complementary nucleic acid sequence, and be adjusted to be applicable to the mensuration of PCR-based.

31. according to each the oligonucleotide probe library in the aforementioned claim, the wherein melting temperature(Tm) (T of each probe _m) be at least 50 ℃.

32. according to each the oligonucleotide probe library in the aforementioned claim, wherein each probe has DNA Nucleotide at 5 ' end, and/or has DNA Nucleotide at 3 ' end.

33. according to each the oligonucleotide probe library in the aforementioned claim, wherein each probe can detect by the molecular beacon principle.

34. according to each the oligonucleotide probe library in the aforementioned claim, its colony that hits is people's transcript group.

35. according to each the oligonucleotide probe library in the aforementioned claim, wherein each oligonucleotide probe detects the different target nucleic acids of most probable number MPN purpose, thereby causes described library that the maximum of given target nucleic acid colony is covered.

36. according to each the oligonucleotide probe library in the aforementioned claim, wherein in order to obtain maximum detection, these oligonucleotide probes have target sequence as much as possible or binding site through selection in target nucleic acid colony.

37. according to each the oligonucleotide probe library in the aforementioned claim, wherein in order to obtain maximum detection, these oligonucleotide probes have at least one target sequence through selection in the target nucleic acid as much as possible in target nucleic acid colony.

38. the oligonucleotide probe library of table 1 or table 1a or Figure 13 or Figure 14, it can detect the complementary sequence in any given nucleic acid population.

39. according to each the library in the aforementioned claim, it comprises the probe that respectively has the listed recognition component of table 1 in the specification sheets or table 1a, and/or its comprise respectively have with described table 1 in the probe of listed recognition component complementary recognition component.

40. oligonucleotide probe, its comprise the quencher and 5 of formula I '-the nitroindoline residue.

41. the oligonucleotide probe of claim 40, it does not have 5 ' guanidine radicals residue.

42. the oligonucleotide probe of claim 40 or 41, it is at claim 1-9, and 14-18 defines in each of 21-23 and 31-1.

43. according to each the oligonucleotide probe among the claim 40-42, described probe is selected from and the complementary or identical probe of table 1, table 1A, Figure 13 or sequence shown in Figure 14.

44. according to each the oligonucleotide probe among the claim 40-43, it has the nucleotide sequence that is selected from table 1 or table 1A.

45. select to can be used for the method for the oligonucleotide sequence in the library of aforementioned each claim, it comprises:

A) provide have predetermined Nucleotide number N might oligonucleotide first set, wherein said oligonucleotide has at least 50 ℃ melting temperature(Tm) T _m,

B) provide second of target nucleic acid sequence to gather,

C) at each member of described first set, from described second set, differentiate and storage comprises number with the member of described each member's complementary sequence of described first set,

D) be chosen in the discriminating of step c with step c in the member of described first set of member's coupling of described second set of the maximum number differentiated,

E) member who selects in the steps d is added in the 3rd set of forming by the oligonucleotide in the library of selecting, can be used for aforementioned each claim,

F) member who selects among the deduction step d from described first set gathers so that first of revision to be provided,

M) repeating step d to f, up to described the 3rd set by following member composition, described member together can with the complementation of at least 30% member in the set of the target nucleic acid sequence of step b, wherein

Described method has opposition and comprise the preference of the member with 5 ' guanidine radicals (G) in the 3rd set, and/or opposes to comprise in the 3rd set the preference of the member with 3 ' guanidine radicals (G).

46., wherein avoid the 5 ' residue of guanidine radicals as all oligonucleotide sequences of described the 3rd set according to the method for claim 45.

47. method according to claim 46, wherein realize avoiding guanidine radicals as 5 ' residue in the following way: i) to reduce the set of step a, only to comprise those sequences that do not comprise 5 ' guanidine radicals residue, and/or ii) avoid in steps d selecting to comprise those sequences of 5 ' guanidine radicals residue, and/or iii) in step e, omit those sequences that comprise 5 ' guanidine radicals residue.

48. according to each the method among the claim 45-47, wherein T _mIt is at least 60 ℃.

49. according to each the method among the claim 45-48, first set of wherein said oligonucleotide only comprise can not self hybridization oligonucleotide.

50. according to each the method among the claim 45-49, the step below it comprises after step f but before step m:

G) all following members of deduction are to obtain second set of revision from described second set, and wherein said member comprises and member's complementary sequence of selecting in steps d;

H), from second set of described revision, differentiate and storage comprises quantity with the member of described each member's complementary sequence at each member of first set of described revision;

I) be chosen in the discriminating of step h with step h in the member of described first set of second set member coupling of the maximum quantity differentiated; Perhaps, select to provide described first set member of maximum number by the product of the quantity differentiated among the quantity differentiated among the step h and the step c;

J) member who selects in the step I is added described the 3rd set;

K) member who from first set of described revision, selects among the deduction step i; With

L) all following members of deduction from second set of described revision, described member comprise with step I in member's complementary sequence of selecting.

51. method according to the claim 50 of quoting claim 46, wherein following realization avoids guanidine radicals as 5 ' residue: avoid selecting to comprise those sequences of 5 ' guanidine radicals residue in step I, and/or omit those sequences that comprise 5 ' guanidine radicals residue in step j.

52. each the method according among the claim 45-51 wherein continues the repeating step among the step m, up to the forming member of described the 3rd set combine can with from least 85% member's complementation in the target nucleic acid sequence set of step b till.

53. according to each the method among the claim 45-52, wherein, behind first member who selects described the 3rd set, differentiate in described first set member with described second set member hybridization of the selected percentage ratio that surpasses described maximum number before the selection after step c and in steps d, only have these members that differentiate like this to carry out selection in the steps d thus.

54. according to the method for claim 53, wherein Xuan Ding percentage ratio is 80%.

55. according to each the method among the claim 45-54, the member who is not named as useful probe before wherein guaranteeing can not enter the 3rd set.

56. method according to claim 55, wherein following avoid in the 3rd set, comprising before the oligonucleotide sequence of qualitative failure: i) reduce the set of step a, there not to be those sequences of qualitative failure before only comprising, and/or do not have those sequences of qualitative failure before ii) avoiding in steps d or i, selecting, and/or iii) in step e and/or j, there are not those sequences of qualitative failure before the omission.

57. according to each the method among the claim 45-56, wherein N is selected from 6,7,8,9,10,11 and 12 integer.

58. according to the method for claim 57, wherein N is 8 or 9.

59. according to each the method among the claim 45-58, second set of wherein said step b comprises the target nucleic acid sequences of claim 24 or 25 definition.

60. according to each the method among the claim 45-59, it is implemented according to mode shown in Figure 2 basically.

61. according to each the method among the claim 45-60, wherein said first, second and the 3rd set are stored in the storer of computer system, preferably are stored in the database.

62. each the computer program of instruction of method of execution according to claim 45-61 is provided, and it writes in the computer-readable medium.

63. comprise the database of target sequence and be used for the system that enforcement of rights requires the application program of 62 computer program.

64. differentiate the method for the limited means be used to detect target nucleic acid, this method comprises:

A) input identifies the data of nucleotide sequence of described target nucleic acid uniquely in computer system, wherein said computer system comprises and accommodates at least one each composition database of information in nucleic acid probe library according to claim 1-39, and, wherein this computer system also comprises the database at the target nucleic acid sequence of each probe in described at least one library, and/or also comprise the means that are used to obtain and compare nucleic acid sequence data

B) in this computer system, differentiate probe from described at least one library, wherein the sequence of this probe be present in the described target nucleic acid sequence or be present in this target nucleic acid sequence complementary sequence in,

C) in this computer system, differentiate this target nucleic acid sequence that can increase primer and

D) provide the output result who points out the primer sequence differentiated among the probe differentiated among the step B and the step C, as discriminating to the particular detection means.

65. according to the method for claim 64, wherein steps A also comprises data from least one nucleic acid library of the member who is used for these particular detection means to the expectation of described computer system input sign that therefrom select.

66. according to the method for claim 65, the data that wherein identify the composition in this at least one library are product codes.

67. according to each the method among the claim 64-66, wherein the input in the steps A realizes by the Internet interface.

68. each the method according among the claim 64-66 wherein is chosen in the primer of differentiating among the step C, to be minimized in the possibility of amplification gene group nucleic acid in the PCR reaction.

69., wherein select at least one described primer to be included in the nucleotide sequence that is interrupted by intron in the genomic dna according to the method for claim 68.

70. each the method according among the claim 64-69 wherein is chosen in the primer of selecting among the step C, to be minimized in the length of implementing the amplicon that PCR obtains on the target nucleic acid sequence.

71. each the method according among the claim 64-70 wherein is chosen in the primer of selecting among the step C, to optimize GC content so that implement PCR.

72. computer program, it is provided for carrying out each the instruction of method according to claim 64-71, and this instruction writes on the computer-readable medium.

73. a system, it comprises the database of the nucleic acid probe that defines in each of claim 1-39 and is used for the application program that enforcement of rights requires 72 computer program.

74. characterize the method for a plurality of target sequences, it comprises the sample that makes target sequence and contacts and detect, characterizes with each library according to claim 1-39 or quantitatively and described target sequence bonded probe sequence.

75. according to the method for claim 74, it detects and is lower than 10% nucleotide sequence that exists in the described a plurality of sequences of described multiprobe sequence bonded.

76. according to the method for claim 75, wherein said said target mrna sequence or cDNA sequence comprise the transcript group.

77. according to the method for claim 76, wherein said transcript group is people's transcript group.

78. according to each method, wherein said probe library and the solid support covalent attachment among the claim 74-77.

79. according to the method for claim 78, wherein said solid support comprises microtiter plate, each hole of this microtiter plate comprises a kind of different library probe.

80., wherein detect step and undertaken by the target nucleic acid sequence that amplification comprises with library probe complementary recognition sequence according to each the method among the claim 74-79.

81. the method for claim 80 wherein uses the Oligonucleolide primers that is positioned at library probe complementary recognition sequence flank to increase to carrying out target nucleic acid.

82. the method for claim 74-81, the phenotypic correlation of the existence of wherein one or more target nucleic acid sequences or expression level and species.

83. the method for claim 82, wherein said phenotype is a disease.

84. use each the method for library analysis of mixtures of nucleic acids according to claim 1-39, it comprises step:

(a) target oligonucleotide is contacted with the library of the oligonucleotide probe of mark, so that at least one member's hybridization in described target oligonucleotide and described probe library, form the library of hybridization thus, each of wherein said oligonucleotide probe all has known sequences and combines with known location on the solid support;

(b) make the library of described hybridization contact a part or its fragment with the nuclease that can cut double chain oligonucleotide with the oligonucleotide probe that from the library of described hybridization, discharges described mark; With

(c) differentiate probe or its segmental position of having removed mark on the library of described hybridization, to determine the sequence of described unlabelled target oligonucleotide.

85. the method for the library analysis of mixtures of nucleic acids of each of use claim 1-39, it comprises step:

(a) target oligonucleotide is contacted with the library of the oligonucleotide probe of mark, so that at least one member's hybridization in described target oligonucleotide and described probe library, form the library of hybridization thus, each of wherein said oligonucleotide probe all has known sequences and combines with known location on the solid support;

(b) probe of mark or the position that its fragment has been hybridized on the library of the described hybridization of discriminating are to determine the sequence of described target oligonucleotide; With

(c) differentiate probe or its segmental position of having removed mark on the library of described hybridization, to determine the sequence of described unlabelled target oligonucleotide.

86. the method for the existence of target nucleic acid in qualitative or definite quantitatively sample, this method comprises:

I) utilize each method according to claim 64-71, differentiate the limited means that detects described target nucleic acid, wherein said particular detection means comprise oligonucleotide probe and primer sets,

Ii) obtain step I) middle primer and the oligonucleotide probe of differentiating,

Iii) exist from step I i) primer and the situation of oligonucleotide probe under to described sample implement the molecular cloning operation and

Iv), determine the existence of target nucleic acid based on step I result ii).

87. 6 method, wherein step I i according to Claim 8) in the primer that obtains obtain by synthetic.

88. 6 or 87 method according to Claim 8, wherein oligonucleotide probe is to obtain from each the library according to claim 1-39.

89. the method for each among the 6-88 according to Claim 8, wherein the described operation of step I in ii) is PCR or NASBA operation.

90. 9 method according to Claim 8, wherein said PCR operation is qPCR.

Images