CN1513978A - Decolur yeast of manganese producing depended pervxidase and its application - Google Patents
Decolur yeast of manganese producing depended pervxidase and its application Download PDFInfo
- Publication number
- CN1513978A CN1513978A CNA021602026A CN02160202A CN1513978A CN 1513978 A CN1513978 A CN 1513978A CN A021602026 A CNA021602026 A CN A021602026A CN 02160202 A CN02160202 A CN 02160202A CN 1513978 A CN1513978 A CN 1513978A
- Authority
- CN
- China
- Prior art keywords
- yeast
- decolouring
- manganese
- sequence
- dependent peroxidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A decoloring yeast to generate the Mn-dependent peroxidase used to decolor and degradate the industrial sewage generated by textile, printing and dyeing, and preparing dye is obtained from natural environment through selective culture. It includes Debaryomyces polymorphus (CGMCC No.0813) and candiba tropicalis (CGMCC No.0814).
Description
Invention field
The invention belongs to microbiology and environmental protection technical field, particularly the decolouring yeast and the application thereof of manganese-dependent peroxidase produced in two strains
Background of invention:
Azo active dyestuff is a class chemical synthetic dye of present usage quantity maximum, all contains azo bond and phenyl ring in its molecular structure, and multiple different substituted radical is arranged, and can form colour-change widely.Such dyestuff is widely used in industries such as weaving, papermaking because of its high-quality dyeing property simultaneously.A large amount of waste water containing dyes that these industries produce have that toxicity is big, composition changes characteristics many, difficult for biological degradation, and traditional bioremediation is difficult to play a role.As production, consumption and the big export country of dyestuff in the world, the dyestuff of China, the handling problem of dyeing waste water never are well solved, and problem of environmental pollution has become one of principal element of these industry developments of restriction.
For many years, many investigators at home and abroad are devoted to seek the effective ways that solve dyestuff and treatment of dyeing wastewater from the angle of bacterial classification.It is found that the azo reductase that anerobe produces can be dye decolored to azo, but the intermediate product aromatic amine that anaerobic condition forms down has higher toxicity, and can be converted into can with the covalently bound high reactivity electrophilic group of DNA, its hazardness bigger (Tarpley et al., 1980).Therefore, those can receive more concern at the peculiar microorganism monoid of degrade azo dyestuff under the aerobic condition.Bacillussubtilis in bacterium, Aeromonas hydrophila, Pseudomonas cepacia, Flavobacterium sp. and Stenotrophmonas maltophilia etc. can be with azoic dyestuff oxidative decoloration (Chungea al., 1993 ﹠amp under the situation of aerobic; Zissi ea al., 2001).But all there is following shortcoming in above-mentioned aerobic bacteria: 1. can not be with the thorough mineralising of dyestuff; 2. can only act on a few dye molecule simple in structure (for example p-aminoazobenzene) (Chung and Cerniglia, 1992); 3. the decolorization enzyme specificity is stronger, and a kind of bacterium can only act on a kind of dye molecule; 4. the decolouring gene generally in plasmid, is lost easily.Therefore, these bacterial classifications have run into very big problem on using.
In recent years, the utilization white-rot fungi that can produce lignin-degrading enzymes carries out dye decolored research and has been subjected to showing great attention to of many investigators.Report that two kinds of maximum white-rot fungis are respectively Phanerochaete chrysosporium and Trametes versicolor, they can produce and comprise lignin peroxidases (Lip), laccases and manganese-dependent peroxidases (MnP) lignin-degrading enzymes outside interior non-specific born of the same parents.The great advantage of these enzymes is non-specificitys of structure of its effect substrate, and the thorough mineralising of dyestuff can be able to be adapted to many, assorted, the labile characteristics of dye species in dyestuff, the dyeing industry waste water.This zymoid microorganism that can produce of report is detected in some white-rot fungis and other filamentous fungus of minority at present.Yet the common poor growth of these filamentous funguss, it is longer to produce the enzyme course, directly apply to dye wastewater treatment and be easy to be subjected to the pollution of the bacterium of growth fast, cost is too high again to handle waste water with above-mentioned enzyme purification class, thereby has limited this quasi-microorganism and the application of enzyme in wastewater treatment.
Yeast is extensive in distributed in nature as unicellular fungi, have some other microbe groups can not than advantage: similar to filamentous fungus on physiology and hereditary property, can tolerate high osmotic pressure, can produce some special enzymes, genetic stability is good; Similar to bacterium on thalli growth and reaction kinetics, have the fast advantage of speed of response and rate of propagation.Kwasniewska (1985), Kakuta et al. (1992 and 1998), Trindade ﹠amp; Angelis (1995), and Meehan et al. (2000) has reported that several saccharomycetes can carry out adsorption bleaching to some dyestuffs.Produce the lignin degradation enzyme and yet there are no so far, and dyestuff is carried out the report of degradation and decolorization about yeast.
Summary of the invention
The objective of the invention is to: in order to address the above problem from physical environment sampling and to screen that two strains can the similar dyestuff of dye structure or compound be degraded or the decolouring yeast and the application thereof of the product manganese-dependent peroxidase that decolours therewith to azo active dyestuff reactive black (Reactive Black 5) and other.Through identifying that this two saccharomycete is many types of Dbaly yeast Debaryomyces polymorphus and candida tropicalis Candidatropicalis.This two saccharomycete is to be that nutrient solution below the 1000mg/L can effectively decolour to containing reactive black 5 concentration under the situation of 0.2g wet cell/50ml nutrient solution or bigger inoculum size in inoculum size, is that nutrient solution below the 200mg/L reaches 100% decolouring in 16 hours to reactive black 5 concentration.This two saccharomycete all can be in nutrient solution pH be 3 to 10 scope the effective decolorization of performance.
Technical scheme of the present invention is as follows:
The decolouring yeast of product manganese-dependent peroxidase provided by the invention, be included in the many types of Dbaly yeast Debaryomyces polymorphus that was preserved in " China Committee for Culture Collection of Microorganisms common micro-organisms center " on October 11st, 2002, its preserving number is respectively CGMCC NO.0813;
The 18SrDNA sequence of described many types of Dbaly yeast is published in Genebank, and sequence number is AF545629, and its 18SrDNA sequence is seen accompanying drawing 1;
The 26SrDNA sequence of described many types of Dbaly yeast is published on the Genebank, and sequence number is AF545634, and its 26SrDNA sequence is seen accompanying drawing 2;
Described many types of Dbaly yeast biological property is: be the circular bacterium colony of oyster white on the potato glucose substratum, the surface is dry slightly, and bacterium colony is thick, easily provokes, and wine flavour is arranged, and presents typical yeast bacterium colony.
The decolouring yeast of product manganese-dependent peroxidase provided by the invention, also be included in the candida tropicalis Candida tropicalis that was preserved in " China Committee for Culture Collection of Microorganisms common micro-organisms center " on October 11st, 2002, its preserving number is respectively CGMCC NO.0814;
The 18SrDNA sequence of described candida tropicalis is published on the Genebank, sequence number AF545630, and its 18SrDNA sequence is seen accompanying drawing 3;
The 26SrDNA sequence of described candida tropicalis is published on the Genebank, sequence number AF545635, and its 26SrDNA sequence is seen accompanying drawing 4;
Described candida tropicalis biological property is: be the circular bacterium colony of oyster white on the potato glucose substratum, the surface is dry slightly, and bacterium colony is thick, easily provokes, and wine flavour is arranged, and presents typical yeast bacterium colony.
The saccharomycetic purposes of the decolouring of product manganese-dependent peroxidase provided by the invention, it is characterized in that the manganese-dependent peroxidase that described many types of Dbaly yeast produced is used for textile waste, dyeing waste water, waste water in dye production and uses the decolouring of relevant trade effluent with dyestuff; Be used for paper bleaching and with the degraded of dye structure similar compounds;
The manganese-dependent peroxidase that described candida tropicalis produced is used for textile waste, dyeing waste water, waste water in dye production and uses the decolouring of relevant trade effluent with dyestuff; Be used for paper bleaching and with the degraded of dye structure similar compounds.
The screening process of two saccharomycetes provided by the invention is screened according to following flow process for to obtain the active sludge sample from municipal sewage plant and treatment of dyeing wastewater factory:
Described enrichment medium component is: glucose 5g, KH
2PO
41g, (NH
4)
2SO
41g, MgSO
47H
2O 500mg, yeast powder 200mg, tap water 1000ml, pH5.0-6.0.；
Described dyestuff substratum 1 component is: glucose 5g, KH
2PO
41g, (NH
4)
2SO
41g, MgSO
47H
2O 500mg, yeast powder 200mg, tap water 1000ml, pH5.0-6.0, the sterilization back adds the reactive black 5 of 10g/L, makes its final concentration be respectively 30mg/L;
Described dyestuff substratum 2 components are: glucose 5g, KH
2PO
41g, (NH
4)
2SO
41g, MgSO
47H
2O 500mg, yeast powder 200mg, tap water 1000ml, pH5.0-6.0, the sterilization back adds the reactive black 5 of 10g/L, makes its final concentration be respectively 60mg/L;
Described dyestuff substratum 3 components are: glucose 5g, KH
2PO
41g, (NH
4)
2SO
41g, MgSO
47H
2O 500mg, yeast powder 200mg, tap water 1000ml, pH5.0-6.0, the sterilization back adds the reactive black 5 of 10g/L, makes its final concentration be respectively 100mg/L;
Described selective medium component is: glucose 5g, KH
2PO
41g, (NH
4)
2SO
41g, MgSO
47H
2O 500mg, yeast powder 200mg, tap water 1000ml, pH5.0-6.0, the sterilization back adds the reactive black 5 of 10g/L, makes its final concentration be respectively 100mg/L, and it is 50U/L that the adding Streptomycin sulphate makes its final concentration;
Its concrete screening step is as follows:
Get 1 gram mud sample and put into the abundant mixing of triangular flask that fills granulated glass sphere and 100mL sterilized water, get this mixed solution 10mL and insert 100mL and went out in the rich basic substratum of bacterium, and in 28 ℃ of shaking tables, 140 change and cultivated 5 days.Getting this nutrient solution 10mL is inoculated in the dyestuff substratum that contains the 30mg/L reactive black 5 similarity condition and cultivated 3 days down, from the triangular flask of decolouring fully, get the 10mL nutrient solution and be inoculated in the dyestuff substratum that contains the 60mg/L reactive black 5 similarity condition and cultivated 3 days down, and the nutrient solution that will decolour is fully transferred in the dyestuff substratum of 100mg/L with same method.To after carry out gradient dilution, the nutrient solution that can decolour fully in the presence of the 100mg/L dyestuff get the different dilution cultures of 0.2mL and coat on the selective dye culture medium flat plate 28 ℃ of cultivations 3 days.Picking has the bacterium colony of obvious decolouring circle and purifying three times on the dyestuff culture medium flat plate.The decolorizing bacterial strain of picking is inoculated in the liquid nutrient medium that contains the 100mg/L reactive black 5 at 28 ℃, 140 change cultivation, every 6 hours sampling and measuring percent of decolourizations, can decolour fully in the picking liquid medium within and thalline not the bacterial strain of absorbing dye be the resulting bacterial strain of this patent, and it is identified and preservation.
The bacterial strain that the present invention obtains is through being accredited as many types of Dbaly yeast Debaryomyces polymorphus and candida tropicalis Candida tropicalis, and being preserved in " China Committee for Culture Collection of Microorganisms common micro-organisms center " respectively, its preserving number is respectively CGMCC NO.0813 and preserving number is respectively CGMCCNO.0814.
The saccharomycetic purposes of the decolouring of product manganese-dependent peroxidase provided by the invention is: the decolouring yeast of this product manganese-dependent peroxidase is used manganese-dependent peroxidase that enzyme produced and is used for textile waste, dyeing waste water, waste water in dye production and uses the decolouring of relevant trade effluent with dyestuff; Be used for paper bleaching and with the degraded of dye structure similar compounds.
The decolouring yeast of product manganese-dependent peroxidase provided by the invention, can solve the problem that exists in the prior art, being that nutrient solution below the 1000mg/L can effectively decolour to containing reactive black 5 concentration in inoculum size under the situation that is 0.2g wet cell/50ml nutrient solution or bigger inoculum size, is that nutrient solution below the 200mg/L reaches 100% decolouring in 16 hours to reactive black 5 concentration; All can be in nutrient solution pH be 3 to 10 scope the effective decolorization of performance.
Description of drawings
Accompanying drawing 2 is the 26SrDNA sequence table of many types of Dbaly yeast Debaryomyces polymorphus;
Accompanying drawing 3 is the 18SrDNA sequence table of candida tropicalis Candida tropicalis;
Accompanying drawing 4 is the 26SrDNA sequence table of candida tropicalis Candida tropicalis;
Accompanying drawing 5 be many types of Dbaly yeast under aerobic condition to the decolouring of the reactive black 5 of different concns wherein:
◇—100mgL
-1 ■—200mgL
-1 ▲—300mgL
-1；
○—400mgL
-1 ●—1000mgL
-1
Accompanying drawing 6 is candida tropicalis decolouring to the reactive black 5 of different concns under aerobic condition
Wherein:
◆—100mgL
-1 ■—200mgL
-1 ▲—300mgL
-1；
○—400mgL
-1 △—1000mgL
-1
Accompanying drawing 7 exists and does not have two kinds of situation MnP specific activitys in reactive black 5 for many types of Dbaly yeast;
Accompanying drawing 8 exists and does not have two kinds of situation MnP specific activitys in reactive black 5 for candida tropicalis;
Accompanying drawing 9 is the decolouring of many types of Dbaly yeast to different dyes;
Accompanying drawing 10 is the decolouring of candida tropicalis to different dyes;
Embodiment
Embodiment 1:
Two saccharomycete strains of the present invention can effectively be decoloured within 24 hours to the dyestuff nutrient solution that contains 100～1000mg/L reactive black 5, can reach 100% decolouring to the dyestuff nutrient solution below the 300mg/L.(seeing accompanying drawing 5 and 6).
This two saccharomycete all can produce manganese-dependent peroxidase (MnP) under the condition that reactive black 5 exists, the activity of this enzyme in nutrient solution can reach 2000U/L or higher; See accompanying drawing 7 and Fig. 8.
Embodiment 2
Two saccharomycetes of the present invention have tangible decolorization equally to other azo active dyestuffs with azo bond and benzene ring structure and to not having an anthraquinone dye of azo bond.Debaryomyces polymorphus and Candida tropicalis are the following several dyestuffs of 100mg/L to concentration under aerobic culture condition: anthraquinone dye Reactive blue RB19, azoic dyestuff reactive red (Reactive Red) M-3BE, azoic dyestuff reactive yellow (ReactiveYellow) M-3RE, azoic dyestuff reactive brilliant red (Reactive Brilliant Red) K-2BF, azoic dyestuff Procion Scharlach H-E3G, the percent of decolourization of azoic dyestuff Procion MarineH-EXL in 24 and 48 hours is respectively as Fig. 9 and 10.Yet the present invention is not limited only to this to the decolouring and the degraded of compound.
SEQUENCE?LISTING
＜110〉Ecological Environment Research Center, Chinese Academy of Sciences
＜120〉the decolouring yeast and the application thereof of product manganese-dependent peroxidase
<130>PI023972
<160>4
<170>PatentIn?version?3.1
<210>1
<211>519
<212>DNA
<213>Debaryomyces?polymorphus
<400>1
ccatgcatgt?ctaagtataa?gcaatttata?cagtgaaact?gcgaatggct?cattaaatca 60
gttatcgttt?atttgatagt?acctttacta?cttggataac?cgtggtaatt?ctagagctaa 120
tacatgctaa?aaatcccgac?tgtttggaag?ggatgtattt?attagataaa?aaatcaatgc 180
ttttcggagc?tctttgatga?ttcataataa?cttttcgaat?cgcatggcct?tgtgctggcg 240
atggttcatt?caaatttctg?ccctatcaac?tttcgatggt?aggatagtgg?cctaccatgg 300
tttcaacggg?taacggggaa?taagggttcg?attccggaga?gggagcctga?gaaacggcta 360
ccacatccaa?ggaaggcagc?aggcgcgcaa?attacccaat?cccaatacgg?ggaggtagtg 420
acaataaata?acgatacagg?gccctttcgg?gtcttgtaat?tggaatgagt?acaatgtaaa 480
taccttaacg?aggaacaatt?ggagggcaag?tctggtgcc 519
<210>2
<211>557
<212>DNA
<213>Debaryomyces?polymorphus
<400>2
aacggcgagt?gaagcggcaa?aagctcaaat?ttgaaatctg?gcaccttcgg?tgtccgagtt 60
gtaatttgaa?gaaggtaact?ttggagttgg?ctcttgtcta?tgttccttgg?aacaggacgt 120
cacagagggt?gagaatcccg?tgcgatgaga?tgcccaactc?tatgtaaagt?gctttcgaag 180
agtcgagttg?tttgggaatg?cagctctaag?tgggtggtaa?attccatcta?aagctaaata 240
ttggcgagag?accgatagcg?aacaagtaca?gtgatggaaa?gatgaaaaga?actttgaaaa 300
gagagtgaaa?aagtacgtga?aattgttgaa?agggaagggc?ttgagatcag?acttggtatt 360
ttgcaagcct?taccttcgtg?gtggggtccc?ctgcagttta?ctgggccagc?atcggtttgg 420
atggtaggat?aatgacttgg?gaatgtgact?ttgcttcggt?aaagtgttat?agcccttgtt 480
gatactgcct?gtctagaccg?aggactgcgt?ctttgactag?gatgctggca?taatgatctt 540
aagtcgcccg?tcttgac 557
<210>3
<211>515
<212>DNA
<213>Candida?tropicalis
<400>3
ccatgcatgt?ctaagtataa?gcaatttata?cagtgaaact?gcgaatggct?cattaaatca 60
gttatcgttt?atttgatagt?accttactac?ttggataacc?gtggtaattc?tagagctaat 120
acatgcttaa?aatcccgact?gtttggaagg?gatgtattta?ttagataaaa?aatcaatgtc 180
ttcggactct?ttgatgattc?ataataactt?ttcgaatcgc?atggccttgt?gctggcgatg 240
gttcattcaa?atttctgccc?tatcaacttt?cgatggtagg?atagtggcct?accatggttt 300
caacgggtaa?cggggaataa?gggttcgatt?ccggagaggg?agcctgagaa?acggctacca 360
catccaagga?aggcagcagg?cgcgcaaatt?acccaatccc?gacacgggga?ggtagtgaca 420
ataaataacg?atacagggcc?ctttcgggtc?ttgtaattgg?aatgagtaca?atgtaaatac 480
cttaacgagg?aacaattgga?gggcaagtct?ggtgc 515
<210>4
<211>537
<212>DNA
<213>Candida?tropicalis
<400>4
caagctcaaa?tttgaaatct?ggctctttca?gagtccgagt?tgtaatttga?agaaggtatc 60
tttgggtctg?gctcttgtct?atgtttcttg?gaacagaacg?tcacagaggg?tgagaatccc 120
gtgcgatgag?atgatccagg?cctatgtaaa?gttccttcga?agagtcgagt?tgtttgggaa 180
tgcagctcta?agtgggtggt?aaattccatc?taaagctaaa?tattggcgag?agaccgatag 240
cgaacaagta?cagtgatgga?aagatgaaaa?gaactttgaa?aagagagtga?aaaagtacgt 300
gaaattgttg?aaagggaagg?gcttgagatc?agacttggta?ttttgtatgt?tacttcttcg 360
ggggtggcct?ctacagttta?tcgggccagc?atcagtttgg?gcggtaggag?aattgcgttg 420
gaatgtggca?cgactttggt?tgtgtgttat?agccttcgtc?gatactgcca?gcctagactg 480
aggactgcgg?tttataccta?ggatgttggc?ataatgatct?taagtcgccc?gtcttga 537
Claims (8)
1, a kind of decolouring yeast that produces manganese-dependent peroxidase, it is characterized in that, this decolouring yeast is for being preserved in the many types of Dbaly yeast Debaryomyces polymorphus at " China Committee for Culture Collection of Microorganisms common micro-organisms center " on October 11st, 2002, its preserving number is respectively CGMCCNO.0813.
2, by the decolouring yeast of the described product manganese-dependent peroxidase of claim 1, it is characterized in that the 18SrDNA sequence of this many types of Dbaly yeast is published in Genebank, sequence number is AF545629, and its 18SrDNA sequence is:
CCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATT
AAATCAGTTATCGTTTATTTGATAGTACCTTTACTACTTGGATAACCGTGGTAAT
TCTAGAGCTAATACATGCTAAAAATCCCGACTGTTTGGAAGGGATGTATTTATT
AGATAAAAAATCAATGCTTTTCGGAGCTCTTTGATGATTCATAATAACTTTTCG
AATCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACT
TTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAG
GGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGG
CAGCAGGCGCGCAAATTACCCAATCCCAATACGGGGAGGTAGTGACAATAAAT
AACGATACAGGGCCCTTTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATAC
CTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCC
The 26SrDNA sequence of this many types of Dbaly yeast is published on the Genebank, and sequence number is AF545634, and its 26SrDNA sequence is:
CAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGA
AGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAG
AGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCG
AAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTA
AAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGA
TGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGG
GAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCC
TCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGA
ATGTGGCACGACTTTGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAG
ACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGCCC
GTCTTGA
3, press the decolouring yeast of the described product manganese-dependent peroxidase of claim 1, it is characterized in that, described many types of Dbaly yeast biological property is: be the circular bacterium colony of oyster white on the potato glucose substratum, the surface is dry slightly, bacterium colony is thick, easily provoke, wine flavour is arranged, present typical yeast bacterium colony.
4, a kind of decolouring yeast that produces manganese-dependent peroxidase, it is characterized in that, this decolouring yeast is for being preserved in the candida tropicalis Candida tropicalis at " China Committee for Culture Collection of Microorganisms common micro-organisms center " on October 11st, 2002, its preserving number is respectively CGMCC NO.0814.
5, by the decolouring yeast of the described product manganese-dependent peroxidase of claim 4, it is characterized in that the 18SrDNA sequence of described candida tropicalis is published on the Genebank, sequence number is AF545630, and its 18SrDNA sequence is:
CCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATT
AAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATT
CTAGAGCTAATACATGCTTAAAATCCCGACTGTTTGGAAGGGATGTATTTATTA
GATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATC
GCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCG
ATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTT
CGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAG
CAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATAA
CGATACAGGGCCCTTTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCT
TAACGAGGAACAATTGGAGGGCAAGTCTGGTGC
The 26SrDNA sequence of this candida tropicalis is published on the Genebank, and sequence number is AF545635, and its 26SrDNA sequence is:
CAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGA
AGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAG
AGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCG
AAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTA
AAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGA
TGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGG
GAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCC
TCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGA
ATGTGGCACGACTTTGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAG
ACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGCCC
GTCTTGA
6, press the decolouring yeast of the described product manganese-dependent peroxidase of claim 4, it is characterized in that, the biological property of described candida tropicalis is: be the circular bacterium colony of oyster white on the potato glucose substratum, the surface is dry slightly, bacterium colony is thick, easily provoke, wine flavour is arranged, present typical yeast bacterium colony.
7, the saccharomycetic purposes of decolouring of the described product manganese-dependent peroxidase of a kind of claim 1, it is characterized in that the manganese-dependent peroxidase that described many types of Dbaly yeast produced is used for textile waste, dyeing waste water, waste water in dye production and uses the decolouring of relevant trade effluent with dyestuff; Be used for paper bleaching and with the degraded of dye structure similar compounds.
8, the saccharomycetic purposes of decolouring of the described product manganese-dependent peroxidase of a kind of claim 4, it is characterized in that the manganese-dependent peroxidase that described candida tropicalis produced is used for textile waste, dyeing waste water, waste water in dye production and uses the decolouring of relevant trade effluent with dyestuff; Be used for paper bleaching and with the degraded of dye structure similar compounds.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02160202 CN1222609C (en) | 2002-12-31 | 2002-12-31 | Decolur yeast of manganese producing depended pervxidase and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02160202 CN1222609C (en) | 2002-12-31 | 2002-12-31 | Decolur yeast of manganese producing depended pervxidase and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1513978A true CN1513978A (en) | 2004-07-21 |
| CN1222609C CN1222609C (en) | 2005-10-12 |
Family
ID=34237810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02160202 Expired - Fee Related CN1222609C (en) | 2002-12-31 | 2002-12-31 | Decolur yeast of manganese producing depended pervxidase and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1222609C (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100344749C (en) * | 2005-03-10 | 2007-10-24 | 清华大学 | Saccharomycete and its application |
| CN101906388B (en) * | 2010-01-29 | 2011-12-28 | 清华大学 | Yeast and application thereof in decolorization |
| CN104403969A (en) * | 2014-11-26 | 2015-03-11 | 厦门大学 | Peroxidase capable of degrading malachite green and preparation method for peroxidase |
| CN105647823A (en) * | 2016-02-03 | 2016-06-08 | 中山大学 | Candida tropicalis PNY2013 with nitrogen and phosphorus removal function and application thereof |
| CN109880883A (en) * | 2019-03-25 | 2019-06-14 | 中国农业科学院饲料研究所 | The application of reactive black 5 and the screening technique of degrading mold toxin enzyme |
-
2002
- 2002-12-31 CN CN 02160202 patent/CN1222609C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100344749C (en) * | 2005-03-10 | 2007-10-24 | 清华大学 | Saccharomycete and its application |
| CN101906388B (en) * | 2010-01-29 | 2011-12-28 | 清华大学 | Yeast and application thereof in decolorization |
| CN104403969A (en) * | 2014-11-26 | 2015-03-11 | 厦门大学 | Peroxidase capable of degrading malachite green and preparation method for peroxidase |
| CN105647823A (en) * | 2016-02-03 | 2016-06-08 | 中山大学 | Candida tropicalis PNY2013 with nitrogen and phosphorus removal function and application thereof |
| CN105647823B (en) * | 2016-02-03 | 2019-01-01 | 中山大学 | It is a kind of with the candida tropicalis PNY2013 of dephosphorization denitrogenation function and its application |
| CN109880883A (en) * | 2019-03-25 | 2019-06-14 | 中国农业科学院饲料研究所 | The application of reactive black 5 and the screening technique of degrading mold toxin enzyme |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1222609C (en) | 2005-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bhatti et al. | Optimization of culture conditions for enhanced decolorization of Cibacron Red FN-2BL by Schizophyllum commune IBL-6 | |
| CN1563342A (en) | Microbe preparation in use for treating high difficult wastewater and preparation method | |
| Aragão et al. | Mycoremediation of vinasse by surface response methodology and preliminary studies in air-lift bioreactors | |
| Kahraman et al. | Decolorization and bioremediation of molasses wastewater by white-rot fungi in a semi-solid-state condition | |
| Tišma et al. | Production, characterisation and immobilization of laccase for an efficient aniline-based dye decolourization | |
| Radhakrishnan et al. | Investigation on microorganisms and their degradation efficiency in paper and pulp mill effluent | |
| Kumaran et al. | Decolorization of textile dyes by white rot fungi Phanerocheate chrysosporium and Pleurotus sajor-caju. | |
| Zhao et al. | Biodegradation and detoxification of the triphenylmethane dye coomassie brilliant blue by the extracellular enzymes from mycelia of Lactarius deliciosus | |
| Zuleta-Correa et al. | Use of white rot fungi in the degradation of an azo dye from the textile industry | |
| Nurhayat et al. | Bioprospecting three newly isolated white-rot fungi from Berbak-Sembilang National Park, Indonesia for biodecolorization of anthraquinone and azo dyes | |
| Liu et al. | Dye-decolorization of a newly isolated strain Bacillus amyloliquefaciens W36 | |
| US6613559B2 (en) | Simultaneous decolorization and detoxification of molasses spent wash using novel white rot-lignin-modifying fungus Flavodon flavus | |
| Pourbabaee et al. | Decolorization of cibacron black w-55 under alkaline conditions by new strain of Halomonas sp. isolated from textile effluent | |
| CN1222609C (en) | Decolur yeast of manganese producing depended pervxidase and its application | |
| Castillo-Carvajal et al. | Evaluation of three immobilization supports and two nutritional conditions for reactive black 5 removal with Trametes versicolor in air bubble reactor | |
| PARK et al. | Decolorization of three acid dyes by enzymes from fungal strains | |
| Ozmen et al. | Valorization and biodecolorization of dye adsorbed on lignocellulosics using white rot fungi. | |
| Khelifi et al. | Enhancement of textile wastewater decolourization and biodegradation by isolated bacterial and fungal strains | |
| El Enshasy et al. | Mycoremediation: Decolourization potential of fungal ligninolytic enzymes | |
| Melati et al. | The recent status of synthetic dyes mycoremediation: A review | |
| Chicatto et al. | Treatment of the textile wastewater through fungi: a sustainable alternative | |
| Obanan et al. | Decolorization of Synthetic Textile Dyes by Fungal Endophytes Isolated from the Leaves of Philippine Mangrove (Avicennia marina) | |
| Spina et al. | Selection of strains and carriers to combine fungi and activated sludge in wastewater bioremediation. | |
| Urbaniak et al. | Decolorization of azo and triphenylmethane dyes by MW113 Beauveria bassiana strain | |
| Siddiqui et al. | Up-flow immobilized fungal Column Reactor for the Treatment of Anthraquinone dye Drimarene blue Ksub> 2RL |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20051012 Termination date: 20121231 |