CN1490411A - Method for obtaining human copper and zinc superoxide dismutase genes from human body - Google Patents
Method for obtaining human copper and zinc superoxide dismutase genes from human body Download PDFInfo
- Publication number
- CN1490411A CN1490411A CNA021476608A CN02147660A CN1490411A CN 1490411 A CN1490411 A CN 1490411A CN A021476608 A CNA021476608 A CN A021476608A CN 02147660 A CN02147660 A CN 02147660A CN 1490411 A CN1490411 A CN 1490411A
- Authority
- CN
- China
- Prior art keywords
- tissue
- human
- add
- superoxide dismutase
- centrifugal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
A process for extracting the human Cu, Zn superoxide dismutase (hCu, Zn-SOD) gene from human tissue includes such steps as extracting the common RNA from human embryo tissue, and reverse transcription-PCR for amplifying cDNA of hCu, Zn-SOD. Its advantages are simple process, low cost, and high sequence homology up to 99.8%.
Description
(1) technical field
The present invention relates to a kind of biotechnology, especially a kind of method of from tissue, extracting the human copper and zinc superoxide dismutase gene.
(2) background technology
Superoxide-dismutase (Superoxide dismutase, SOD) be the single-minded scavenging agent of ultra-oxygen anion free radical, (Kushleika J.Checkoway H.Woods J.S.et al.Ann Neurol plays an important role in the running balance of keeping biological interior free yl, 1996,39 (3): 378-381; Noda J.Otagiri M.Akaike T et al.J PharmacolExp Ther, 1996,279 (1): 162-171).SOD has a wide range of applications at aspects such as medical treatment, health care, food.
The research of recombinant human SOD, one side can solve the source problem that comes of people SOD, the safety issue that also can avoid inhuman source SOD may bring on the other hand in application.Obtain hCu at present, the method of Zn-SOD gene mainly contains two kinds: a kind of is synthetic method (Takeshima, Y, Takasugu N.Proc.Natl.Acad.Sci.USA 1994,91:9685~9689), promptly earlier with 17 oligonucleotide of phosphoramidite method chemosynthesis, behind the HPLC purifying by double-stranded 35~60 based compositions, 5 ' end of each oligonucleotide of phosphorylation except that oligonucleotide 1 and 17 is borrowed T
4Dna ligase connects 3~4 oligonucleotide, makes it be combined as a module (block), and finally using the same method these combined modules is complete hSOD gene.This method difficulty is big, the cost height.Another kind is with the total RNA of guanidinium isothiocyanate/phenol/chloroform extraction from healthy human liver tissue, the cDNA that RNA obtains through AMV reversed transcriptive enzyme reverse transcription is used as the template of pcr amplification, through 30 PCR thermal cyclings, amplify hCu, and Zn-SOD cDNA (to China, Wei Wenzhong, Tan Huarong etc. the clone of human copper zinc superoxide dismutase and the expression in Lactococcus lactis. the biotechnology journal, 2000,16 (1): 6~9), but the healthy human body hepatic tissue is difficult to obtain.
(3) summary of the invention
The present invention aims to provide and a kind ofly simple and effective extracts human copper zinc superoxide dismutase (hCu, Zn-SOD) method of gene from tissue.
From tissue obtain human copper zinc superoxide dismutase (hCu, Zn-SOD) step of the method for gene is from the total RNA of human embryo's tissue extraction; (hCu, cDNA Zn-SOD), cDNA are through pcr amplification, and agarose gel electrophoresis inspection and order-checking prove hCu, the Zn-SOD gene to amplify people's copper zinc SOD with reverse transcription-polymerase chain reaction (RT-PCR) technology.
From the method for the total RNA of human embryo's tissue extraction can be:
Get the firm human embryo's tissue that of miscarrying and put into liquid nitrogen vessel; Water is got the Freshman embryonic tissue, puts into glass homogenizer, adds 1ml TRIZOL reagent, grinds; Tissue homogenate is moved in the centrifuge tube; In tissue homogenate, add chloroform, vibration; Move to after centrifugal in another centrifuge tube, and add Virahol, centrifugal again; Abandon supernatant, add ethanol, washing; Centrifugal again; Abandon supernatant, precipitation is dried, and adds the water that DEPC handles, suction; After the water-bath, the product packing.
Total RNA is identified through agarose gel electrophoresis.
Obtain hCu with the RT-PCR technology, Zn-SOD cDNA can be according to the synthetic hCu of the method reverse transcription that cDNA synthetic agent box is recommended, Zn-SOD cDNA.According to Sherman, L. wait reported sequence (Sherman L, Dafni N, Lieman-HurwitzJ et al.Nucleotide sequence and expression of human chromosome 21-encodedsuperoxide dismutase mRNA.Pro.Natl.Acad.Sci.U.S.A., 1983,80 (18): 5465-5469), design 2 primers: primer 1 is 5-TTACATGTAGATGGCGACGAAGGCCG-, contains the BanHI site; Primer 2 is 5-GCAAGCTTCTAGATTTATTGGGCCATCC-, contains the HindIII site.
Can in place's centrifuge tube, mix following reagent with pcr amplification cDNA: 10 * Reaction Buffer, 25mM MgCl
2, Deocynucleotide Mix, Upstueam Primer, Downstream Primer, Taq DNA Polymerase, H
2O, Template cDNA.
Its reaction parameter is:
At first 94 ℃ of pre-sex change, 94 ℃ of sex change then, 50 ℃ of annealing, 72 ℃ of extensions, so circulation; 72 ℃ of extensions more at last.
The evaluation of PCR product can be identified the PCR product with agarose gel electrophoresis.
The clone of PCR product can reclaim dna fragmentation from sepharose; Carry out the connection of PCR product again, in centrifuge tube, add DNA, PMD18-T, T
4DNA Ligase Buffer, T
4DNA Ligase, H
2The O mixing, reaction.Transformed into escherichia coli JM101; And carry out the evaluation of recon, and the some single bacterium colonies of picking are inoculated in respectively in the nutrient solution at random, add the Amp resistance, and shaking culture is spent the night; Extract plasmid; Plasmid is through BamHI and HindIII double digestion, and electrophoresis is identified.
Cu, the order-checking of Zn-SOD DNA is to prove hCu, the Zn-SOD gene.
Compare with method such as existing synthetic method, the invention provides a kind of very simple and effective, the lower-cost method of from tissue, extracting the human copper and zinc superoxide dismutase gene.The total RNA that is extracted among the present invention is complete, amplified band is clear among the PCR product agarose gel electrophoresis result, can illustrate that sod gene is connected into carrier in the electrophoresis result after recombinant plasmid footpath BamHI and HindIII two site enzymes are cut, hCu, the Zn-SOD sequence is measured by Shanghai biotechnology Services Co., Ltd, the check order sequence comparison of row and bibliographical information of institute, 1 place's difference is only arranged, promptly the 165th base C replaces into T, and all the other sequences are all consistent, and homology reaches 99.8%.
(4) description of drawings
Fig. 1 total RNA of embryo that behaves.
Fig. 2 Cu that behaves, Zn-SOD cDNA PCR product.
Fig. 3 is a recon plasmid restriction analysis.
Fig. 4 is hCu, clone's synoptic diagram of Zn-SOD gene.
(5) embodiment
1, the system of total RNA respectively
1.1 the extraction of total RNA
Get the firm human embryo's tissue (about 28 weeks) that of miscarrying and put into liquid nitrogen vessel; Water is got the Freshman embryonic tissue, puts into glass homogenizer, adds 1ml TRIZOL reagent, grinds; Tissue homogenate is moved in the centrifuge tube; Add the 0.2ml chloroform in tissue homogenate, vibration is placed; 4 ℃, the centrifugal 15min of 12000g; Move in another centrifuge tube, and add the 0.5ml Virahol, place; 4 ℃, the centrifugal 10min of 12000g; Abandon supernatant, add 1ml 75% ethanol, the vibration washing; 4 ℃, the centrifugal 5min of 7500g; Abandon supernatant, precipitation is dried, and adds the water that 50 μ l DEPC handle, suction; 55 ℃, water-bath 10min;-20 ℃ of preservations are placed in the product packing.
1.2 the electrophoresis of total RNA is identified
1) processing of electrophoresis chamber:
With stain remover electrophoresis chamber is cleaned, with the flowing water flushing, used 75%7 alcohol dry again, fill with 3%H2O2 then and soak 10min, the pond of handling with DEPC is washed at last.
2) preparation of gel:
Take by weighing the 0.187g agar powder in the burning ring that handled, add the water that 12.5ml DEPC handles, dissolving is cooled to 60 ℃, adds formaldehyde and 5 times of formaldehyde gel electrophoretic buffers of 4.0ml of 3.6ml 37%, mixes encapsulating.
3) processing of sample:
Press following mixed reagent:
RNA 4.5μl
5 times of formaldehyde gel electrophoretic buffer 2.0 μ l
Formaldehyde 3.5 μ l
Methane amide 10.0 μ l
Total 20.0 μ l
Centrifugal collection, 65 ℃ of water-bath 15min, ice bath cooling, centrifugal collection.
4) electrophoresis:
50V prerunning 5min gets sample and 1 μ l sample loading buffer that 10 μ l handled, and point sample rifle head is stained with a little ethidium bromide, point sample, 40V electrophoresis 2~3h.
5) the gel imaging analysis system scan is analyzed:
Fig. 1 is total RNA1.5% agarose gel electrophoresis result, can clearly see two ribosome-RNA(rRNA) bands of 18S and 28S, illustrates that the total RNA that is extracted is complete.
2, RT-PCR obtains hCu, Zn-SOD cDNA 2.3
According to the synthetic hCu of method reverse transcription that cDNA synthetic agent box is recommended, Zn-SOD cDNA as template, carries out the PCR reaction.
2.1 cDNA's is synthetic:
In the 0.5ml centrifuge tube that handled, mix following reagent:
10×Reaction?Buffer 2.0μl
25mM?MgCl2 4.0μl
Deoxynucleotide?Mix 2.0μl
Random?Primer?P(dN)6 2.0μl
Rnase?Inhihitor 1.0μl
AMV?reverse?Transcriptase 0.8μl
Sterile?Water 7.2μl
RNA?sample 1.0μl
Total 20.0 μ l
Respectively by following temperature and time reaction: 25 ℃ of 10min; 42 ℃ of 60min; 99 ℃ of 5min; 4 ℃ of 5min; Reaction finishes the back in-20 ℃ of preservations.
2.2 design of primers
According to Sherman, L. wait reported sequence (Sherman, L., Dafni, N., Lieman-Hurwitz, J.et al.Nucleotide sequence and expression of humar chromosome 21-encoded superoxidedismutase mRNA.Pro.Natl.Acad.Sci.U.S.A., 1983.80 (18): 5465-5469), design 2 primers at SOD sequence two ends: primer 1 is 5`-TTACATGTAGATGGCGACGAAGGCCG-, contains the BanHI site; Primer 2 is 5`-GCAAGCTTCTAGATTTATTGGGCCATCC-, contains the HindIII site.
2.3 pcr amplification cDNA
In the 0.5ml of a place centrifuge tube, mix following reagent:
10×Reaction?Buffer 8.0μl
25mM?MgCl
2 2.0μl
Deocynucleotide?Mix 1.0μl
Upstueam?Primer 1.0μl
Downstream?Primer 1.0μl
Taq?DNA?Polymerase 1.0μl
H
2O 76.5μl
Template?cDNA 10.0μl
Total 100.0 μ l
Reaction parameter:
94 ℃ of pre-sex change 5min at first; 94 ℃ of sex change 1min then; 50 ℃ of annealing 1min; 72 ℃ are extended 1.5min and so circulate 40 times; At last again 72 ℃ extend 10min.
2.4 the evaluation of PCR product
The PCR product is identified with 1.5% agarose gel electrophoresis.Fig. 2 is PCR product 1.5% agarose gel electrophoresis result, can clearly see the amplified band that a size is about 490bp.
3, the clone of PCR product:
3.1 from sepharose, reclaim dna fragmentation:
1) the PCR product under ultraviolet lamp, downcuts the gel that contains required DNA behind agarose gel electrophoresis, puts in the pipe and weighs;
2) add the 6mol/L Nal solution of triplication (V/W), 55 ℃ of temperature are bathed to glue and are dissolved (about 10min) fully;
3) add 20 μ l silica powders, mix the back room temperature and place 5min;
4) the centrifugal 10s of 10000rpm;
5) abandon supernatant liquor, add 70% ethanol of 500 μ l precoolings, mixing, the centrifugal 10s of 10000rpm;
6) repeating step 5) twice;
7) after the precipitation drying, add 20 μ l dH
2O suspends, and puts 50 ℃ of water-bath 5min, the centrifugal 3min of 15000rpm;
8) it is standby in-20 ℃ of preservations to get supernatant.
3.2 the connection of PCR product and conversion
1) in a 0.5ml centrifuge tube, add:
DNA 5.0μl
PMD18-T 1.0μl
T
4?DNA?Ligase?Buffer 2.0μl
T
4DNA?Ligase 0.1μl
H
2O 11.9μl
Total 20.0 μ l
2) mixing places 37 ℃ of reaction 1h.
3.3 the preparation of competent cell:
1) choose bacterium JM101 in nutrient solution 37 planning adjustment shaking culture 0.5~3h, for reaching efficient conversion, viable count must be less than 10
8Cell/ml;
2) get 4ml bacterium liquid under aseptic condition, transfer to one aseptic, with and ice precooling centrifuge tube in;
3) the centrifugal 10min of 4000rpm reclaims cell;
4) pour out nutrient solution, pipe is inverted 1min the trace nutrient solution of final residual is flow to end;
5) add the 0.1mol/L CaCl of 2ml precooling
2The re-suspended cell precipitation;
6) the centrifugal 10min of 4000rpm abandons supernatant liquor;
7) add the 0.1mol/L mol/L CaCl of 400 μ l precoolings
2The re-suspended cell precipitation, 4 ℃ of preservations are spent the night.
3.4 transform
1) get the competent cell 150 μ l that spend the night, (concentration is about 200~600mg), mixing to add 7~10 μ l connection product;
2) ice bath 30min;
3) 42 ℃ of water-bath 90min (strict this temperature and time of control);
4) ice bath 2min;
5) add 800 μ l nutrient solutions, in 37 ℃ of shaking culture 1h;
6) centrifugal concentrated bacterium liquid, and coat LB flat board (containing Ap100ug/ml), cultivate about 10h for 37 ℃.
3.5 the evaluation of recon:
1) 4 single bacterium colonies of picking at random are inoculated in respectively in the 4ml nutrient solution, add 4 μ l Amp resistances, and 37 ℃ of shaking culture are spent the night;
2) extract plasmid; (alkaline denaturation)
1. get 4m1 bacterium liquid, the centrifugal 1min of 15000rpm; Outwell nutrient solution, and blot as far as possible;
2. add 200 μ l solution; Thermal agitation;
3. add the solution that 400 μ l newly join, gentleness is put upside down for several times rapidly, puts 5min on ice;
4. add 300 μ l solution, gentleness is put upside down for several times rapidly, ice bath 10min;
5. the centrifugal 15min of 15000rpm, supernatant liquor moves in another new pipe;
6. add the phenol vibration 10s of equivalent, the centrifugal 2min of 1200rpm moves water to another pipe;
7. add 2 times of volume dehydrated alcohols, put upside down mixing, on ice 30mim;
8. add the dissolving of 30 μ l sterilized waters, transfer in another pipe;
9. add the dissolving of 30 μ l sterilized waters, transfer in another pipe;
10. add 1 μ l Rmase, put 37 ℃ of 30min; Get 2 μ l electrophoretic examinations concentration.
3) plasmid is identified through BamHI and HindIII double digestion:
Add respectively in each 0.5ml centrifuge tube:
Plasmid 3.0 μ l
Buffer?E 2.0μl
Restriction endonuclease (BamHI/HindIII) 0.1 μ l
H
2O 14.9μl
Total 20.0 μ l
Mixing places 37 ℃ of reaction 1h; Electrophoresis is identified.Fig. 3 is the electrophoresis result of recombinant plasmid after BamHI and HindIII two site enzymes are cut, and the band about a visible 490bp is the SOD fragment, illustrates that sod gene has been connected into carrier.
4, Cu, the order-checking of Zn-SOD DNA
HCu, the Zn-SOD sequence is measured by Shanghai biotechnology Services Co., Ltd, and the result is as follows:
AATGTTTATTGGGCGATCCCAATTACACCACAAGCCAAACGAC
TTCCAGCGTTTCCTGTCTTTGTACTTTCTTCATTTCCACCTTTGC
CCAAGTCATCTGCTTTTTCATGGACCACCAGTGTGCGGCCAATG
ATGCAATGGTCTCCTGAGAGTGAGATCACAGAATCTTCAATAGA
CACATCGGCCACACCATCTTTGTCAGCAGTCACATTGCCCAAGT
CTCCAACATGCCTCTCTTCATCCTTTGGCCCACCGTGTTTTCTGG
ATAGAGGATTAAAGTGAGGACCTGCACTGGTACAGCCTGCTG
TATTATCTCCAAACTCATGAACATGGAATCCATGCAGGCCTTCA
GTCAGTCCTTTAATGCTTCCCCACACCTTCACTGGTCCATTACT
TTCCTTCTGCTCGAAATTGATGATGCCCTGCACTGGGCCGTCG
CCCTTCAGCACGCACACGGCCTTCGTCGCCAT
Check order row and the sequence of bibliographical information relatively, 1 place's difference is only arranged, promptly the 165th base C replaces into T, all the other sequences are all consistent, homology reaches 99.8%.
Fig. 4 provides Cu, clone's synoptic diagram of Zn-SOD gene.
Embodiment 2:
Its method steps is similar to Example 1.In the extraction of total RNA, to get the firm human embryo that of miscarrying and organize and put into liquid nitrogen vessel rapidly, water is got Freshman embryonic tissue 100mg, puts into glass homogenizer rapidly.Can place 5min in room temperature after moving to tissue homogenate in the centrifuge tube; Add fierce vibration 15s behind the 0.2ml chloroform in the tissue homogenate, room temperature is placed 3min; 4 ℃, the centrifugal 20min of 15000g moves in another centrifuge tube again, and adds the 0.5ml Virahol, and room temperature is placed 10min; 4 ℃, the centrifugal 15min of 12000g.Abandon supernatant, add 1ml 75% ethanol, the vibration washing; In 4 ℃ of centrifugal 8min of 10000g.Adding the water that DEPC handles, after the suction, in 55 ℃ of water-bath 12min.
Claims (8)
1, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue is characterized in that obtaining human copper and zinc superoxide dismutase gene's the step of method for from the total RNA of human embryo's tissue extraction from tissue; Amplify the cDNA of people's copper zinc SOD with reverse transcription-polymerase chain reaction method; CDNA is through pcr amplification, and agarose gel electrophoresis inspection and order-checking prove hCu, the Zn-SOD gene.
2, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue as claimed in claim 1 is characterized in that said method from the total RNA of human embryo's tissue extraction is:
Get the firm human embryo's tissue that of miscarrying and put into liquid nitrogen vessel; Water is got the Freshman embryonic tissue, puts into glass homogenizer, adds 1ml TRIZOL reagent, grinds; Tissue homogenate is moved in the centrifuge tube; In tissue homogenate, add chloroform, vibration; Move to after centrifugal in another centrifuge tube, and add Virahol, centrifugal again; Abandon supernatant, add ethanol, washing; Centrifugal again; Abandon supernatant, precipitation is dried, and adds the water that DEPC handles, suction; After the water-bath, the product packing.
3, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue as claimed in claim 2 is characterized in that from the method for the total RNA of human embryo's tissue extraction it being to get the firm human embryo's tissue that of miscarrying to put into liquid nitrogen vessel; Water is got Freshman embryonic tissue 100mg, puts into glass homogenizer, adds 1ml TRIZOL reagent, grinds; Tissue homogenate is moved in the centrifuge tube; Add the 0.2ml chloroform in tissue homogenate, vibration is placed; 4 ℃, the centrifugal 15min of 12000g; Move in another centrifuge tube, and add the 0.5ml Virahol, place; 4 ℃, the centrifugal 10min of 12000g; Abandon supernatant, add 1ml 75% ethanol, the vibration washing; 4 ℃, the centrifugal 5min of 7500g; Abandon supernatant, precipitation is dried, and adds the water that 50 μ l DEPC handle, suction; 55 ℃, water-bath 10min;-20 ℃ of preservations are placed in the product packing.
4, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue as claimed in claim 3 is characterized in that adding the 0.2ml chloroform in tissue homogenate, vibration 15s, and room temperature is placed 2~3min; 4 ℃, the centrifugal 15~20min of 12000g~15000g; Move in another centrifuge tube, and add the 0.5ml Virahol, place; 4 ℃, the centrifugal 10~15min of 12000g; Abandon supernatant, add 1ml 75% ethanol, the vibration washing; 4 ℃, the centrifugal 5~8min of 7500g~10000g; Abandon supernatant, precipitation is dried, and adds the water that 50 μ l DEPC handle, suction; 55 ℃, water-bath 10min;-20 ℃ of preservations are placed in the product packing.
5, a kind of method that from tissue, obtains the human copper and zinc superoxide dismutase gene as claimed in claim 1, it is characterized in that the said cDNA that amplifies people's copper zinc SOD with reverse transcription-polymerase chain reaction method is the synthetic hCu of method reverse transcription that recommends according to cDNA synthetic agent box, Zn-SOD cDNA, design 2 primers: primer 1 is 5-TTACATGTAGATGGCGACGAAGGCCG-, contains the BanHI site; Primer 2 is 5-GCAAGCTTCTAGATTTATTGGGCCATCC-, contains the HindIII site.
6, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue as claimed in claim 4 is characterized in that said 2 design of primers are at SOD sequence two ends.
7, a kind of method that obtains the human copper and zinc superoxide dismutase gene from tissue as claimed in claim 1 is characterized in that the said pcr amplification cDNA that uses can mix following reagent in place's centrifuge tube: 10 * Reaction Buffer, 25mM MgCl
2, Deocynucleotide Mix, Upstueam Primer, Downstream Primer, Taq DNAPolymerase, H
2O, Template cDNA; Its reaction parameter is: at first 94 ℃ of pre-sex change, 94 ℃ of sex change then, 50 ℃ of annealing, 72 ℃ of extensions, so circulation; 72 ℃ of extensions more at last.
8, a kind of method that from tissue, obtains the human copper and zinc superoxide dismutase gene as claimed in claim 6, it is characterized in that the said pcr amplification cDNA that uses can mix following reagent in place's centrifuge tube: 10 * Reaction Buffer8.0 μ l, 25mM MgCl
22.0 μ l, Deocynucleotide Mix 1.0 μ l, Upstueam Primer 1.0 μ l, Downstream Primer 1.0 μ l, Taq DNA Polymerase 1.0 μ l, H
2O 76.5 μ l, TemplatecDNA 10.0 μ l.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA021476608A CN1490411A (en) | 2002-10-19 | 2002-10-19 | Method for obtaining human copper and zinc superoxide dismutase genes from human body |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA021476608A CN1490411A (en) | 2002-10-19 | 2002-10-19 | Method for obtaining human copper and zinc superoxide dismutase genes from human body |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1490411A true CN1490411A (en) | 2004-04-21 |
Family
ID=34148737
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA021476608A Pending CN1490411A (en) | 2002-10-19 | 2002-10-19 | Method for obtaining human copper and zinc superoxide dismutase genes from human body |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1490411A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108085330A (en) * | 2011-01-13 | 2018-05-29 | 奥索临床诊断有限公司 | treponema pallidum triplet antigen |
-
2002
- 2002-10-19 CN CNA021476608A patent/CN1490411A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108085330A (en) * | 2011-01-13 | 2018-05-29 | 奥索临床诊断有限公司 | treponema pallidum triplet antigen |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1314807C (en) | Gene clone and expression of RGD die body protein of oral gland in Japan lamprey possessing function for anti tumour | |
CN1490411A (en) | Method for obtaining human copper and zinc superoxide dismutase genes from human body | |
CN1814785A (en) | Method for detecting Brucellosis and primer thereof | |
CN101050472A (en) | Method of increasing specificity of nucleic acid hybridization using zwitterionic compound | |
CN1904068A (en) | H5N1 type poultry grippal virus fluorescent augmentation detection kit and detection method | |
CN100344758C (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
CN1752210A (en) | Chicken interferon gamma, preparing process and use thereof | |
Mahmoud et al. | Nucleotide sequence polymorphism within exon 3 region of leptin and prolactin genes in Herri sheep | |
CN101033489A (en) | Mononucleotide polymorphic site of CDC6 gene correlated to primary liver cancer and application thereof | |
CN1752214A (en) | Molecular signing method for predicting and identifying chicken body fat character | |
CN1800398A (en) | Prunus necrotic ring spot virus coat protein gene and its special primer for checking | |
Dalimi et al. | Molecular Study on Cryptosporidium andersoni Strains Isolated from Sheep Based on 18S rRNA Gene | |
CN100342011C (en) | Clone of pig immunity character relative gene PSMC5 and its use | |
CN1314815C (en) | Molecular marking method for prediction and identification of characters of chicken metatarsal | |
CN1320116C (en) | Genome sequence of O-foot and mouth disease virus NYOO lines | |
CN101063132A (en) | Lateolabrax interleukins 8 gene order | |
CN1721532A (en) | Clone of gene MAC30 related to pig backfat thickness and its use in mark-assisted selection | |
CN1228451C (en) | Method for screening poly-drug resistance reverse medicine for rumour | |
CN1876681A (en) | Cancer-suppressing protein and its gene and uses | |
CN1768581A (en) | Method for breeding pork tenderness and its detection kit | |
CN1141319C (en) | Method for efficiently expressing recombinant human interleukin 12 in eukaryotic cell | |
CN1587409A (en) | Epinephelus coioides SRY box relative gene SOX and its use | |
CN101063131A (en) | Lateolabrax agglutinin gene order |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |