CN1478549A - Recombination protein for preventing human trachoma bedsnia infestation and its use - Google Patents

Recombination protein for preventing human trachoma bedsnia infestation and its use Download PDF

Info

Publication number
CN1478549A
CN1478549A CNA021419779A CN02141977A CN1478549A CN 1478549 A CN1478549 A CN 1478549A CN A021419779 A CNA021419779 A CN A021419779A CN 02141977 A CN02141977 A CN 02141977A CN 1478549 A CN1478549 A CN 1478549A
Authority
CN
China
Prior art keywords
ala
vaccine
leu
gly
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA021419779A
Other languages
Chinese (zh)
Other versions
CN1243568C (en
Inventor
王丽颖
杨思睿
于永利
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DIWEIHUAYU BIO-TECHNOLOGY Co Ltd BEIJING
Original Assignee
DIWEIHUAYU BIO-TECHNOLOGY Co Ltd BEIJING
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DIWEIHUAYU BIO-TECHNOLOGY Co Ltd BEIJING filed Critical DIWEIHUAYU BIO-TECHNOLOGY Co Ltd BEIJING
Priority to CNB021419779A priority Critical patent/CN1243568C/en
Priority to PCT/CN2003/000430 priority patent/WO2004020471A1/en
Priority to AU2003246103A priority patent/AU2003246103A1/en
Publication of CN1478549A publication Critical patent/CN1478549A/en
Application granted granted Critical
Publication of CN1243568C publication Critical patent/CN1243568C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/295—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Chlamydiales (O)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A recombinant protein vaccine for preventing the infection of human chlamydia trachomatis, which is a fusion protein recombined by linking the heat shock protein 65 of BCG vaccine with the epitope of main outer membrane protein of chlamydia trachomatis, the nucleotide sequence for coding it, the expression carrier containing said nucleotide sequence, the host cell containing said expression carrier, and the process for preparing said recombinant protein vaccine are disclosed.

Description

Prevent recombiant protein of human chlamydia trachomatis infection and uses thereof
Invention field
The present invention relates to a kind of genetic engineering field, relate to genetic engineering recombinant protein vaccine (hereinafter being also referred to as " genetic engineering recombiant protein " sometimes) particularly, particularly relate to the human chlamydia trachomatis infection of a kind of prevention, especially prevent the recombinant protein vaccine of urogenital infections; The encode nucleotide sequence (hereinafter being also referred to as " gene " sometimes) of this recombinant protein vaccine; The expression vector that contains this nucleotide sequence; The host cell that contains this expression vector, and the preparation method of this recombinant protein vaccine; The invention still further relates to this genetic engineering recombiant protein and be used for preventing the purposes of vaccine product of human chlamydia trachomatis infection and the vaccine product that contains this genetic engineering recombiant protein in preparation.
Background of invention
Chlamydia is the endotrophic microorganism of franchise of not moving, it has unique biocycle: elementary body (elementary body is arranged, hereinafter abbreviate " EB " sometimes as) and two stages of development of original corpusculum (initialbody or reticulate body reticulate body hereinafter abbreviate " RB " sometimes as).EB has infection ability, is adsorbed in host cell, is engulfed in the endochylema by host cell membrane.Approximately infect after 10 hours, EB begins differentiation, increases and becomes RB, and RB is chlamydial proliferous type, has multiplication capacity.The capable binary fission propagation of RB through division repeatedly, forms inclusion body, has been full of EB in the inclusion body, RB and intermediate.Approximately 2-4 days, RB stopped division, has been full of the chlamydia microcolony based on EB in the inclusion body, and inclusion body film and host cell membrane successively break, and EB is released to outside the parasitic host, infects other cells again, begins new biocycle.
Chlamydia trachomatis (Chlamydia Trachomatis, hereinafter abbreviate " CT " sometimes as) can be divided into mice biotype and people's biotype according to the difference of infection host, the mice biotype can cause the Mus pneumonia and have nothing to do with the mankind, and people's biotype has 15 serotype A, B, Ba, C, D, E, F, G, H, I, J, K, L1, L2, L3, and it all is with the pathogen of the mankind as unique host.
The infection of A, B, Ba and C can cause trachoma, and the mankind can serious corneal pannus occur and form cicatrix by the repeated infection chlamydia trachomatis, and this damage can cause the entropion trichiasis, and corneal clouding increases the weight of to cause losing one's sight.Trachoma is to cause human blind most important reason in the world.
D～K can cause inclusion conjunctivitis, genitourinary system, and its urogenital infections is a sexually transmitted disease (STD), and Epidemiological study shows that there is 300-400 ten thousand infected crowds every year in the U.S..Because chlamydia itself has not the easy infection squamous cell and easily invades the characteristic of columnar epithelial cell, the cervix uteri epidermis is a columnar epithelial cell, thereby cervix uteri is the common site that CT infects, and then CT is up along columnar epithelium, cause endometritis, salpingitis, pelvic inflammatory disease, and can cause tubal infertility and fallopian tube ectopic pregnancy, the serious threat WomanHealth.
It is 20-30% that pregnancy period causes anemia of pregnant woman's infection rate to the rising of CT susceptibility, and CT can cause fetal infection by vertical transmission.Have the scholar to report, the cervix uteri of fetus by infecting, about 50-70% become CT and infect neonate, suffer from CT inclusion conjunctivitis and pneumonia.
Lymphogranuloma venereum (LVG) mainly also is the trafficability characteristic contact transmission.The male is common with the groin bubo, and the women sees that so that anorectal lymph nodes is swollen pathological changes progressively extends to other lymph nodes more, the swollen lymph node that has suppurates, perforation formation fistula, late period pathological changes be external genitalia elephantiasis and proctostenosis.Therefore, the hazardness that CT infects is sizable, and Just because of this, it is particularly important and urgent that the development of chlamydia trachomatis vaccine seems.
Through the research of decades, do not have ideal vaccine always and come out, some reasons are because the host's of the anti-chlamydia infection of mediation reproductive tract mucosa immunologic mechanism is still not exclusively clear.But produce evidence to show that according to some experiments of clpp gene deratization and T cell clone the CD4+T cell plays a major role in the protection of chlamydia reproductive tract infection, the effect of CD8+T cell and humoral immunization is then more less important.Above-mentioned viewpoint has obtained common recognition in this research field.
The research focus of chlamydia trachomatis vaccine concentrates on the following aspects at present:
Dna vaccination (DNA vaccine), Chlamydia Trachomatis DNA vaccine also exist at present a lot of problems as: only can induce part protection, Thl immunoreation and antibody response all a little less than.
Attenuated live vaccine (live attenuated chlamydia vaccine); (HuaSu such as Hua Su; Qonald Messer; William Whitmire etc.; the subclinical chlamydia infection of female mice reproductive tract produces intensive protection immunoreation: the conclusion (SubclinicalChlamydial Infection of the Female Mouse Genital Tract Generates a PotentProtective Immune Response:Implications for Development of LiveAttenuated Chlamydial Vaccation Strains) of attenuated live vaccine bacterial strain exploitation; infect and immunity (Infection andImmunity); January 2000; January; P.192-196; vol.68.) with interfering treatment with a small amount of oxytetracycline behind the chlamydia trachomatis infection; make mice be in the sub-clinical state of low-grade infection; to reach the effect that is similar to attenuated live vaccine; its experimental result shows with natural infection to be compared; body produces the excellent protection immunity after this low-grade infection, infers that thus attenuated live vaccine may have extraordinary prospect.But in fact, people are still not exclusively clear to the genic system of chlamydia trachomatis, can't realize attenuation sudden change (attenuating mutation), and therefore present this vaccine may cause serious autoimmune or immunopathogenesis reaction.
The feedback (chlamydia-pulsed DC) of DC (Dendritic Cells) cell, the way that Hua Su etc. feed back from body with heat-inactivated chlamydia-pulsed D C (Heat-killed chlamydia-pulse DC), find to produce extraordinary immune effect (Hua su, Ronald Messer, William, Deng, 1998. inoculation (Vaccination against Chlamydial Tract Infection afterImmunization with Dendritic Cells Pulsed Ex Vivo with NonviableChlamydiae) with the anti-chlamydia tract infection after the arborescent cell immunity of using the external loading of inactive chlamydia. The Journal of Experimental Medicine (J.Exp.Med.) Volume 188, Number 5, September 7,1998 809-818).Just at present, realize that in this way immunoprotection is unpractical, but the immunity that it points out non-viable bacteria to infect equally can realize immunoprotection.
Epiposition vaccine (Epitopes vaccine), major outer membrane albumen (MOMP) are topmost a kind of outer membrane protein of chlamydia trachomatis, and a lot of experiments show that the MOMP of chlamydia trachomatis can produce the immunity of certain protection.Found that in MOMP more than 20 has immunogenic epi-position (Linette Ortiz, Karen P.Demick, Jean W.Petersen etc., 1996. activate the people's of self-infection the chlamydia trachomatis major outer membrane albumen (Chlamydiatrachomatis Major Outer Membrane Protein (MOMP) Epitopes That ActivateHLA Class II-Restricted T Cells from infected Humans) of the restricted T cell of II type HLA-, Journal of Immunology (TheJournal of Immunology), 1996,157:4554-4567.), thereby established certain basis for the design of epiposition vaccine.
Present working centre is immunogenicity and the protective capability that how to improve vaccine, prolongs the time of immunoprotection.Heat shock protein 65 and some epi-positions on the MOMP that has found are connected to achieve the above object provides a kind of probability.
Heat shock protein (heat shock protein hereinafter abbreviates " HSP " sometimes as) is to be present in the intravital molecular chaperone protein matter family of multiple biology.In the process of immunne response, heat shock protein can show following three kinds of basic functions: 1, assist antigenicity substance to enter the antigen presenting cell that comprises dendritic cell; 2, in antigen presenting cell and the antigenic substance of processed interact and to make it to enter MHC I class angtigen presentation approach, and then activation antigen specific CTL; 3, stimulate dendritic cell to express (SuzueK such as collaborative stimulation molecule (as B7 etc.) and secrete cytokines, Zhou X, Eisen HN, Young RA.Heat shock fusion proteins as vehicles forantigen delivery into the major histocompatibility complex class I presentationpathway.Proc.Natl.Acad.Sci.U.S.A.1997 Nov 25; 94 (24): 13146-13151).Owing to have a These characteristics, heat shock protein 65 linked to each other with some epi-positions on the MOMP that has found to be formed fusion rotein and improves immunogenicity and protective capability to reach, and the purpose of the time of prolongation immunoprotection.
Summary of the invention
The polypeptide that one of the present invention provides a kind of bacillus calmette-guerin vaccine heat shock protein 65 and the proteic epi-position of chlamydia trachomatis major outer membrane that can activate the human T-cell merges the genetic engineering recombinant protein vaccine that forms, and they have preventive effect to people's chlamydia trachomatis infection.
The present invention's two provides a kind of nucleotide sequence of this recombiant protein of encoding.
The present invention's three provides a kind of expression vector that contains this nucleotide sequence.
The present invention's four provides a kind of host cell that contains this expression vector.
The present invention's five provides a kind of method for preparing this recombinant protein vaccine.
The present invention's six relates to this genetic engineering recombiant protein is used for preventing the vaccine product of human chlamydia trachomatis infection in preparation purposes.
The present invention's seven relates to the vaccine product that contains this genetic engineering recombiant protein.
Therefore; the inventor is through secular a large amount of research just; solved existing technical barrier; bacillus calmette-guerin vaccine heat shock protein 65 is linked to each other with some epi-positions on the chlamydia trachomatis MOMP first pioneeringly and formed brand-new genetic engineering recombiant protein; thereby improved the immunogenicity and the protective capability of the vaccine of anti-chlamydia infection, and prolonged the time of its immunoprotection.
In addition, it is pointed out that aspect and creationary beneficial effect that other has substantive distinguishing features of the present invention are conspicuous to those skilled in the art on the basis of the application's contextual disclosure.
Brief Description Of Drawings
Fig. 1 is the ideograph that HSP65-Chlamy is implemented in PET28 (a+).
Fig. 2 is a three-wheel PCR agarose gel electrophoresis photo as a result, and Line1:DL2000 DNA marker2: first round PCR takes turns PCR 4: third round PCR at 3: the second.
Fig. 3 is the agarose gel electrophoresis photo that the pMD18T-chlamy recombiant plasmid is identified with EcolRI and HindIII enzyme action, and Line1:DL2000 DNA marker 2: the enzyme action of recombiant plasmid is identified.
Fig. 4 is that the recombiant plasmid that the HSP65 encoding gene is cloned into pET28 (a+) is identified the agarose gel electrophoresis photo with NcoLI and EcoRI enzyme action: the enzyme action of Line1 recombiant plasmid is identified 2 DL2000DNA marker.
Fig. 5 is that pET28 (a+)-HSP65-chlamy recombiant plasmid is identified agarose gel electrophoresis photo: Line1:DL2000 DNA marker 2 with EcolRI and HindIII enzyme action: the enzyme action of recombiant plasmid is identified.
Fig. 6 is inoculation CT-D visible a large amount of inclusion bodys growth (20x) photos after 48～72 hours on the Hela cell monolayer, and the white arrow indication is the chlamydia trachomatis inclusion body.
Fig. 7 is the expression and the purification SDS photo of recombinant protein vaccine: 1 is protein marker, and 2 is the expression of destination protein, and 3,4,5 is the purification of destination protein.
Fig. 8 is that mouse vagina is organized the mild inflammation photo behind the chlamydia trachomatis infection vaccine immunity: show lamina propria vasodilation hyperemia in the white coil, be dispersed in lymphocytic infiltration, proliferation of fibrous tissue.
Fig. 9 is that mouse vagina is organized the moderate inflammation photo behind the chlamydia trachomatis infection: show in the white coil that the lamina propria blood vessel has infiltration of more lymphocytes.
Figure 10 is mouse vagina tissue 3 degree inflammation behind the chlamydia trachomatis infection: show in the white coil that the lamina propria blood vessel has a large amount of lymphocytic infiltrations.
Figure 11 is the rectangular histogram that the antibody titer of proof vaccine immunity group is tired apparently higher than the C57 mouse antibodies with the detection of ELISA method of PBS immune group: 1: blank; The 2:PBS immunity; 3: vaccine immunity; Specimen 1-10.
The specific embodiment
In the context of the present invention, employed term generally has the implication of those of ordinary skill in the art's common sense unless otherwise indicated.Especially, following term has following implication:
" recombinant protein vaccine " is meant that vaccine derives from by engineered method expressed protein in protokaryon or eukaryotic cell.
" bacillus calmette-guerin vaccine heat shock protein 65 " is meant that the molecular weight that derives from bacillus calmette-guerin vaccine is the heat shock protein of 65kDal, and its aminoacid sequence is shown in SEQ ID NO:4.
" can activate human T-cell's the proteic epitope polypeptide of chlamydia trachomatis major outer membrane " and be meant and derive from that proteic 9 epi-positions of chlamydia trachomatis major outer membrane are connected and the polypeptide that forms, its aminoacid sequence is shown in SEQ ID N0:2.
" people's chlamydia trachomatis infection " is meant that chlamydia trachomatis enters the state of the multiple organ (as genitourinary system, respiratory system, conjunctiva palpebrae etc.) of human body and infected person by certain approach, comprises actute infection and chronic infection and asymptomatic carrier state.
" tight hybridization conditions " is meant that the nucleotide sequence for avoiding non-homology in the reaction system or homeologous forms the hybridization conditions that hybridization complex adopts, as higher reaction temperature and low ionic strength.
" treatment " or " prevention " comprising:
(1) prevent disease just makes the clinical symptoms of disease can not develop in mammal, and described mammal may contact with the pathogen of this disease or easily suffer from this disease but never experience or show this symptom of disease,
(2) suppress disease, the development that just stops or alleviate this disease or its clinical symptoms, or
(3) alleviate disease, just cause the degeneration of disease or its clinical symptoms.
The invention provides a kind of recombinant protein vaccine, it is to be connected with the proteic epi-position of chlamydia trachomatis major outer membrane that can activate the human T-cell and the fusion rotein that forms by bacillus calmette-guerin vaccine heat shock protein 65, wherein, the described polypeptide that can activate human T-cell's chlamydia trachomatis major outer membrane albumen epi-position can be any aminoacid sequence that can activate human T-cell's major outer membrane albumen epi-position, preferably has the aminoacid sequence shown in the SEQID NO:2 or its function equivalent.In recombinant protein vaccine of the present invention, it is the heat shock protein of 65kDal that bacillus calmette-guerin vaccine heat shock protein 65 can be the molecular weight that derives from bacillus calmette-guerin vaccine, and its aminoacid sequence is preferably shown in the SEQ ID NO:4, or its function equivalent.It can be positioned at the aminoterminal of this fusion rotein, and the proteic epi-position of chlamydia trachomatis major outer membrane that can activate the human T-cell is positioned at the c-terminus of this fusion rotein.
Recombinant protein vaccine of the present invention has and is selected from following arbitrary aminoacid sequence:
1) aminoacid sequence shown in the SEQ ID NO:4; With
2) by under tight hybridization conditions with coding 1) the coded aminoacid sequence of nucleotide sequence of nucleotide sequence hybridization of aminoacid sequence.
The present invention also provides the nucleotide sequence of the recombinant protein vaccine of the present invention of encoding, and this nucleotide sequence can have and is selected from following arbitrary sequence:
1) nucleotide sequence shown in the SEQ ID NO:3; With
2) by under tight hybridization conditions with 1) the nucleotide sequence of nucleotide sequence hybridization.
The nucleotide sequence of the proteic epitope polypeptide of chlamydia trachomatis major outer membrane that can activate the human T-cell is shown in SEQ ID NO:2 or its function equivalent.
Bacillus calmette-guerin vaccine heat shock protein 65 is a kind of protein that derives from bacillus calmette-guerin vaccine, it links to each other with the proteic epitope polypeptide of chlamydia trachomatis major outer membrane that can activate the human T-cell and merges the fusion rotein (sequence is shown in SEQ ID NO:4) that forms all can stimulate human body DC cell rise MHC (I class and II class) and costimulatory molecules (B7.2) after entering human body level, secrete cytokines, bacillus calmette-guerin vaccine heat shock protein 65 also has a unique distinction, it can be assisted to form the fusion rotein epitope polypeptide with it and enter the antigen presenting cell that comprises dendritic cell, and enter MHC I classpath processing and offer, and then activation antigen specificity cell toxicity T lymphocyte (cytotoxic T lymphocyte, CTL) pathogen is carried out specificity and attack and kill and wound, and induce this CTL need not be by means of the participation of external source adjuvant or CD4+ cell.
Recombinant protein vaccine of the present invention can pass through methods known in the art, for example according to MolecularCloning one book (J.Sambrook, Cold Spring Harbor Laboratory Press, Molecularcloning, 1989) described production, following embodiment has at length exemplified a kind of method of producing recombinant protein vaccine of the present invention.
Therefore, the present invention also provides the expression vector of the nucleotide sequence that contains above-mentioned coding recombinant protein vaccine of the present invention; The host cell that contains this expression vector, it can be the various prokaryotic cells of this area routine, eukaryotic cell or mammalian cell; And the gene engineering preparation method of this recombinant protein vaccine.
In addition, the invention still further relates to this genetic engineering recombiant protein and be used for preventing the purposes of vaccine product of human chlamydia trachomatis infection and the vaccine product that contains this genetic engineering recombiant protein in preparation.It will be appreciated by persons skilled in the art that these vaccine products can prepare with the known various conventional methods in this area.
Recombinant protein vaccine of the present invention can be inoculated to the people by hypodermic mode, and the dosage of inoculation is 100-500 μ g.For stiffening effect, can carry out 2-3 time booster immunization.Interval can be 2 weeks-February.
Below in conjunction with concrete preparation embodiment and biology effect embodiment, and the present invention is described in further detail with reference to accompanying drawing.Should be understood that these embodiment just in order to demonstrate the invention, but not limit the scope of the invention by any way.
Embodiment
In following embodiment, various processes of Xiang Ximiaoshuing and method are not conventional methods as known in the art, for example Molecular Cloning one book (J.Sambrook, Cold Spring HarborLaboratory Press, Molecular cloning, 1989) described method.
In following embodiment, the source of agents useful for same, trade name and/or be necessary to list its constituent person are all only indicated once.Do not giving unnecessary details foregoing if no special instructions at used identical reagent thereafter.Embodiment 1 epitope gene artificial constructed
Epitope gene selected on the major outer membrane albumen is chained together, and make up the restriction enzyme site of EcoRI at aminoterminal, make up the restriction enzyme site of HindIII at c-terminus, obtain the encoding gene (below be referred to as " chlamy ") of the chlamydia trachomatis major outer membrane albumen epi-position that can activate the human T-cell.
Concrete grammar is: take turns the PCR circulation by 3 and carry out artificial constructed to selected epitope gene.Primer 3 and primer 4 be template and primer each other, carries out first round PCR; Being template with first round PCR product again, is primer with primer 2 and primer 5, carries out second and takes turns PCR; Taking turns the PCR product with second again is template, is primer with primer 1 and primer 6, carries out third round PCR.
：primer1 ( chlamy-1 ) 5’GAATTCCCGGCATACGGTCGTCATATGCAGGATGCTGAGATGTTCACCAACGCTGCTTGCATGGCT3’primer2 ( chlamy-2 ) 5’AACGCTGCTTGCATGGCTCTCAACATTTGGGACGAGCTCAACGTACTGTGCAACGCTGCTGAGTTT 3’primer3 ( chlamy-3 ) 5’TGCAACGCTGCTGAGTITACCATTAACAAGCCGAAAGGTTACGTAGGCAAAGAATTTCCGCTGGCTCTG 3’primer4 ( an-chlamy-3 ) 5’CTGCCATTCGTGGTAGTCGATAGATGCGTCCTTAGTACCGGTAGCTGCGTCCAGAGCCAGCGGAAATTC 3’primer5 ( an-chlamy-2 ) 5’GATGTACGGGGTAAACATGTTCAGACGATAAGACAGTGCCAGAGAAGCCTGCCATTCGTGGTAGTC 3’primer6 ( an-chlamy-1 ) 5’AAGCTTGTAGGTGTCTGCGTCGAAAGAAGCACGAGACCATTTAACACCGATGTACGGGGTAAACAT 3’
By primer 3 and primer 4 each other template and primer to carry out first round PCR reaction as follows: in a 500ul microcentrifugal tube, add following reagent:
Primer 3 2.5ul (10u mol/L)
Primer 4 2.5ul (10u mol/L)
10x PCR buffer (TakaRa company, composition is seen the description of product) 5 μ l
dNTPs(10mmol/L)1μl
Taq archaeal dna polymerase (TakaRa company) (5u/ μ l) 0.5 μ l
Add deionized water to final volume 50 μ l
Mix the back and add 3 in mineral oil
Reaction condition: 94 ℃, 1min; 55 ℃, 1min; 72 ℃, 1min, behind 30 cycle periods, 72 ℃ are extended 10min.It is as follows to form first round PCR product (product 1): (not writing out its complementary strand) TGCAACGCTGCTGAGTTTACCATTAACAAGCCGAAAGGTTACGTAGGCAAAGAATT TCCGCTGGCTCTGGACGCAGCTACCGGTACTAAGGACGCATCTATCGACTACCACG AATGGCAG
Second to take turns PCR circulation be template with product 1, is 5 ' end primer and 3 ' end primer with primer 2 and primer 5 respectively, and reaction system is as follows:
Product 1 1ul
10 (PCR buffer (containing magnesium chloride) 5 μ l
dNTPs(10mmol/L)1μl
Primer 2 and primer 5 each 2.5 μ lTaq archaeal dna polymerases (5u/ μ l), 0.3 μ l
Add deionized water to final volume 50 μ l
Mix the back and add 3 in mineral oil
Reaction condition: 94 ℃, 1 '; 55 ℃, 1 '; 72 ℃, 1 ', behind 30 cycle periods, 72 ℃ are extended 10min.It is as follows that PCR product (product 2) is taken turns in formation second: (not writing out its complementary strand) AACGCTGCTTGCATGGCTCTCAACATTTGGGACGAGCTCAACGTACTGTGCAACGC TGCTGAGTTTACCATTAACAAGCCGAAAGGTTACGTAGGCAAAGAATTTCCGCTGG CTCTGGACGCAGCTACCGGTACTAAGGACGCATCTATCGACTACCACGAATGGCAG GCTTCTCTGGCACTGTCTTATCGTCTGAACATGTTTACCCCGTACATC
Third round PCR circulation is a template with product 2, is 5 ' end primer and 3 ' end primer with primer 1 and primer 6 respectively, and reaction system is as follows:
Product 2 1ul
10 * PCR buffer (containing magnesium chloride), 5 μ l
dNTPs(10mmol/L)1μl
Primer l and primer 6 each 2.5 μ l
Taq archaeal dna polymerase (5u/ μ l) 0.3 μ l
Add deionized water to final volume 50 μ l
Mix the back and add 3 in mineral oil
Reaction condition: 94 ℃, 1min; 55 ℃, 1min; 72 ℃, 1min, behind 30 cycle periods, 72 ℃ are extended 10min.Form third round PCR product (end-product) SEQ ID No:1.
The agarose gel electrophoresis of three-wheel PCR product the results are shown in accompanying drawing 2.The TA clone of embodiment 2 epitope genes
Adopt TA cloning process (J.Sambrook, Cold Spring Harbor Laboratory Press, Molecular cloning, 1989) clone PCR products, TA clone's carrier is PMD 18-T Vector (a TakaRa company).Concrete grammar is as follows: the recovery of a DNA:
With third round PCR product with 2% agarose gel electrophoresis (1 * TAE, 150-200mA, 0.5 hour);
2. downcut the gel that contains dna fragmentation from agarose gel, put into a centrifuge tube;
3. add the sol solutions (Beijing ancient cooking vessel state company) of 3 times of volumes, 45-55 ℃ of water-bath 5-10min melts glue fully;
4. add 10ul glass milk (Beijing ancient cooking vessel state company), flick pipe end mixing, then at 45-55 ℃ of water-bath 5-10min, during every 2-3min mixing once;
5. the centrifugal 60sec of 5000g abandons supernatant;
6. add the 400ul rinsing liquid, flick pipe end mixing glass milk, the same then centrifugal, abandon supernatant;
7. add the 400ul rinsing liquid again, flick pipe end mixing glass milk, the same then centrifugal supernatant of abandoning, and with the sample injector Ex-all rinsing liquid of trying one's best; Room temperature is dried glass milk then;
8. add the 10-30ul aseptic double-distilled water glass milk is suspended 45-55 ℃ of water-bath 5-10min;
9. the centrifugal 2min of 10000g, it is standby to reclaim supernatant.Two coupled reactions:
1. get 3ul supernatant electrophoresis, and under uviol lamp, observe electrophoresis band, compare, estimate to reclaim DNA concentration with marker;
2. coupled reaction system:
Insert DNA (sequence is referring to SEQ ID NO:1) 0.05-0.3pmol
PMD18-TVect (TakaRa company) 0.5-1ul
SolutionI (TakaRa company) 5ul
DH 2O?????????????????????????????up?to?10ul
16 ℃ of reaction 1h three transform: the preparation method of competent cell is: (Novagen company) rules on the LB agar culture medium with e. coli jm109, cultivates 12-16h for 37 ℃; Get a single bacterium colony in 2ml LB culture medium from agar plate next day, and 37 ℃ with 225r/min speed concussion cultivation 12-16h; Get the above-mentioned culture of 1ml and be inoculated in the 100ml LB culture medium, it is about 0.5 (approximately 3h) that 37 ℃ of speed concussions with 225r/min are cultivated until the OD value; With bacterium liquid ice bath 2h, then 2,500g, 4 ℃ of centrifugal 20min collect thalline; The Trituration buffer that adding 100ml is ice-cold (100mmol/L CaCl2,70mmol/L MgCl2, the 40mmol/L sodium acetate, pH5.5), mixing is put 45min on ice; 1,800g, 4 ℃ of centrifugal 10min abandon supernatant, add the ice-cold Trituration buffer suspension cell of 10ml; By every part of 200ul packing, can preserve 1-2 week for 4 ℃.If need long preservation, but glycerol adding to final concentration is 15%, put-70 ℃ standby.
The method that transforms is: the 200ul competent cell is put on ice melted, add 3ul DMSO or beta-mercaptoethanol then, after the mixing, add 10 μ l coupled reaction liquid (containing recombiant plasmid), gentle mixing is put 30min on ice; 42 ℃ of 45sec put back to 1-2min in the ice then rapidly; Add 2ml LB culture fluid, 37 ℃ of velocity fluctuations with 225r/min are cultivated 1h; 4, the centrifugal 10sec of 000g abandons supernatant, with the resuspended thalline of 200ul LB culture fluid; Bacterium liquid is laid on contains on the suitable antibiotic LB agar culture plate, smoothen, room temperature is placed 20-30min, is inverted in 37 ℃ of incubators and cultivates 12-16h.
Four identify: with the method Preliminary Identification recombinant clone of digestion with restriction enzyme.And carry out the order-checking of DNA by Beijing ancient cooking vessel state biotech development center.Sequencing result errorless (concrete sequence is referring to SEQ ID No.1).The pMD-18-chlamy plasmid of reorganization discharges chlamy (300bp) fragment after with EcoRI and HindIII enzyme action and sees accompanying drawing 3.
Five strains and preservation: the recombiant plasmid stored frozen is in-20 ℃.The bacterial strain that contains recombiant plasmid is stored in-20 ℃ or-70 ℃ in containing 20% glycerol culture fluid.
Embodiment 3 obtains the encoding gene of mycobacterium tuberculosis 65KD heat shock protein (BCG HSP65) and it is cloned into pET28 (+) expression vector
The bacillus calmette-guerin vaccine mycobacterium tuberculosis derives from Changchun Biological Products Institute.Adopt the logical potato culture (Starch Potato Code NO C250-1 Beijing ancient cooking vessel state biology) of Soviet Union to cultivate the bacillus calmette-guerin vaccine mycobacterium tuberculosis, the temperature of cultivation is 37-39 ℃, and the bacillus calmette-guerin vaccine mycobacterium tuberculosis that grows presents the lurid Mycoderma of shriveling.Collect Mycoderma, therefrom extract bacillus calmette-guerin vaccine mycobacterium tuberculosis genomic DNA.
The method of extracting the mycobacterium tuberculosis genomic DNA is with reference to Molecular Cloning one book (J.Sambrook, from mammal separation of high molecular weight DNA (Isolation of high-molecular-weight DNA from mammalian cells), 9.16-9.22, Cold Spring HarborLaboratory Press, Molecular cloning, 1989).
By PCR from mycobacterium tuberculosis heat of dissociation shock protein 65 (HSP65) structural gene.5 ' end primer sequence is 5 ' CCATG GCC AAG ACA ATT GCG3 ', and 3 ' end primer sequence is 5 ' GAA TTC GCT AGC CAT ATG GAA ATC CAT GCC ACC CAT 3 '.
Described PCR operation sequence is: add each 0.5 μ lTaq archaeal dna polymerase (5u/ μ l), 0.25 μ l of following reagent: template cDNA 5 μ l (mmol/L) 10 * PCR buffer (containing magnesium chloride), 5 μ ldNTPs (10mmol/L) 1 μ l5 ' ends and 3 ' end primer (0.01 mmol/L) and add deionized water 3 reaction conditions of adding mineral oil to the final volume 50 μ l mixing in one 500 μ l microcentrifugal tube: 94 ℃, and 30sec; 55 ℃, 1min; 72 ℃, 2min, behind 30 cycle periods, 72 ℃ are extended 10min.
Adopt TA cloning process clone PCR products, the extraction of DNA, connection and method for transformation are seen embodiment 2
Digest reorganization pMD18-T carrier and the pET28a (+) (Novagen company) that contains HSP65 with restricted enzyme NcoI (TakaRa company) and EcoRI (TakaRa company), reaction system is as follows:
7 μ l plasmid DNA
1 μ l 10x buffer (TakaRa company)
1ul 0.1%BSA (TakaRa company)
0.5 μ l restricted enzyme NcoI (10 units/μ l)
0.5 μ l restricted enzyme EcoRI (10 units/μ l)
37℃4h
(method is seen embodiment 2 to pET28a (+) linear carrier behind extraction HSP65DNA insertion fragment and the enzyme action.The concentration of these two kinds of DNA of estimation under uviol lamp behind the electrophoresis.The reaction system that connects is as follows:
PET28a (+) linear plasmid DNA 5ul
HSP65DNA inserts fragment 3ul
10x T4DNA ligase buffer 1ul
16 ℃ of 12h of T4DNA ligase 1ul
Method for transformation after the connection is seen embodiment 2.Concrete sequence is referring to SEQ ID No:3 (1-1638bp).The enzyme action qualification result is seen accompanying drawing 4.Embodiment 4 makes up the gene that bacillus calmette-guerin vaccine heat shock protein 65-can activate human T-cell's chlamydia trachomatis major outer membrane albumen epitope polypeptide fusion rotein
HSP65 expression carrier pET28a (+) plasmid (seeing embodiment 3) has been inserted in extraction, and digest this recombiant plasmid and inserted the pMD18-T (seeing embodiment 2) of the chlamydia trachomatis major outer membrane albumen epitope gene (chlamy) that can activate the human T-cell with restricted enzyme EcoRI and HindIII (TakaRa company), reaction system is as follows:
8 μ g plasmids (the pMD 18-T of the pET28a of reorganization HSP65 or reorganization chlamy)
1 μ l 10x buffer (TakaRa company)
0.5 μ l restricted enzyme EcoRI (10 units/μ l)
0.5 μ l restricted enzyme HindIII (10 units/μ l) mixes back 37 ℃ of incubation 30-120min.
As above-mentioned, linear plasmid pET28a (+) and chlamy behind the extraction enzyme action that uses the same method insert fragment.And the two is connected:
Coupled reaction: plasmid DNA (0.5 μ g/ μ l) 3 μ lDNA insert fragment (sequence is referring to SEQ ID NO.2) (300ng/ μ l) 5 μ l10xT4DNA enzymes connection buffer 1 μ lT4 dna ligase 1 μ l and mix rearmounted 14-16 ℃ of water-bath 6-12h.
PET-28a (+) plasmid of should recombinating transforms the JM109 escherichia coli.Method is the same.
Bacillus calmette-guerin vaccine heat shock protein 65-can activate the order-checking of gene of human T-cell's chlamydia trachomatis major outer membrane albumen epitope polypeptide fusion rotein and be born by Beijing ancient cooking vessel state biotech development center, the result shows, resulting bacillus calmette-guerin vaccine heat shock protein 65 can activate the in full accord of human T-cell's the gene of chlamydia trachomatis major outer membrane albumen epitope polypeptide fusion rotein and design.PET-28a (+)-HSP65-chlamy plasmid of reorganization discharges chlamy (300bp) fragment after with EcoRI and HindIII enzyme action and sees accompanying drawing 5.
Embodiment 5 bacillus calmette-guerin vaccine heat shock proteins 65 can activate the expression of gene of human T-cell's chlamydia trachomatis major outer membrane albumen epitope polypeptide fusion rotein
The recombinant plasmid transformed that will finally obtain in embodiment 4 goes into to express among the bacterium BL21 (DE3) (Novagen company), and the microbionation of single bacterium colony is in 50ml LB culture medium, and in the 250ml conical flask, it is 0.6 that 37 ℃ of water-bath concussions are cultured to OD600.It is 01mM that adding IPTG makes its final concentration, and 2-3h are cultivated in 37 ℃ of water-baths concussions.Put conical flask in 5min on ice, 4 ℃ of centrifugal 5min (5000g).Supernatant is abandoned in suction, collects antibacterial, immediately use or frozen.Embodiment 6 bacillus calmette-guerin vaccine heat shock proteins 65 can activate the purification of human T-cell's chlamydia trachomatis major outer membrane albumen epitope polypeptide fusion rotein.The preparation of sample
1. antibacterial is resuspended in the cell pyrolysis liquid; Cell pyrolysis liquid: 20mM Tris, 0.5 M NaCl
5mMimidazole 0.1mM PMSF transfers pH to 7.9
2. add 10mM MgSO 4With 20ug/ml Dnase I (GIBCO company) in cell pyrolysis liquid, hatch 30min on ice and remove DNA;
3. the centrifugal 15min collecting precipitation of 12000r/min thing is washed once with cell pyrolysis liquid is centrifugal then;
4. precipitate is dissolved in the binding buffer liquid, hatches 1-2h on ice.Binding buffer liquid: 20mM Tris, 0.5M Nacl
5mM imidazole 6M urea transfers pH to 7.9
5. the centrifugal 15min of 12000r/min removes floccule.The preparation of post
Chromatographic column is accurate to ideal capacity 1., perform labelling with anti-water-color paintbrush;
2. adorn post with phosphate buffer, seal outlet then; Phosphate buffer: 20mM phosphate, pH7.2 1M NaCl compound method: solution A Na 2HPO 4.12H 2O 35.8g pair is heated up in a steamer water and is added to 100ml
Solution B NaH 2PO 4.H 2O 13.8g pair is heated up in a steamer water and is added to 100ml
Solution C is added to solution B in the solution A gradually, and pH is till 7.2 always
3. begin to add chromatography media (Ni 2+-Saphrose-4-B)
4. allow post begin to flow and add more medium, until medium level reaches the post level of labelling;
5. open outlet, add phosphate buffer, attack post limit sinks medium, continues attack till the post bed height is constant;
6. add more medium, repeat 1-6 step, when attack not when changing the volume of post bed, close the outlet of post.
7. add phosphate buffer and be full of post, cover the loam cake of post, open outlet;
8. allow post begin to flow the shortest mobile 30min with minimum 100 bed volume/h;
9. if the volume of post medium needs to adjust, close the outlet of post, open the loam cake of post, add more medium, should wash post 30min at least with Peak Flow Rate more then.Charge to medium with metal ion
Before chelating media can be used to purge process, must be its charging with selected metal ion.
1. wash post with the distilled water of at least 5 bed volumes
2. the 20mM metal ion solution with 3-5 bed volume is added in the post; The preparation NiSO of 50mM nickel ion solution 4.6H 2O 13.1g pair is heated up in a steamer water and is added to 1000ml.
3. wash post with the elution buffer of 5 bed volumes
Elution buffer: 20mM Tris, pH7.9
0.5M?Nacl
1M?imidazole
6M?urea
4. wash post with the binding buffer liquid of 10 bed volumes.
Binding buffer liquid: 20mM Tris, pH7.9
0.5M?NaCl
5mM?imidazole
6M urea absorption
1. sample is added in the metalchelated post, and flows through the post bed by it with predetermined optimum flow rate;
2. wash post with the binding buffer liquid that contains the 16mM imidazoles, until the absorption value of effluent is got back to baseline values.When eluting is used the eluent eluting, a peak value can occur, the continuation eluting, accesses the effluent of different periods with container, and carries out the SDS electrophoresis not only dropping to up to absorption value, judges that purification effect purity can reach more than 98%.SDS-PAGE behind the purification sees accompanying drawing 7.
The imidazoles eluent: 20mM Tris, pH 7.9,0.5M NaCl,
1M?imidazole，6M?urea。Embodiment 7 chlamydia culture purified one are cultivated
1. in 24 orifice plates, add Hela cell (immunity teaching and research room of new people school district preclinical medicine institute of Jilin University) 1-2 * 10 5Individual/hole, 1-2d is fused into fine and close monolayer.
Culture fluid IMDM (Iscove ' s modified Dulbecco ' s medium, hyclone GIBCO)+10% (TBD biotech development center, Tianjin) 100ug gentamycin/ml.
2. abandon or adopt culture fluid, strain (BJ Union Hospital, D type chlamydia trachomatis) is inoculated on the cell monolayer, 3000r/min/h under the room temperature removes the sucrose-phosphate that is used to preserve strain and transports liquid and (be called for short SPG:Sucrose sucrose 75g, KH 2PO 40.52g, Na 2HPO 41.22g, glutamic acid 0.72g, H 2O to 1 liter, pH7.4-7.6).
3. the cycloheximide that adds hyclone 100ug gentamycin/ml 1ug/ml of chlamydia growth-promoting media 1ml IMDM+10%.Inverted microscope can be seen down surpassing in 90% the cell and grows chlamydia behind the 48-72h, removes growth-promoting media, adds a little cold SPG, with suction pipe repeatedly pressure-vaccum cell is moved down.Born of the same parents' suspension is stored in-70 ℃ of refrigerators.
Purification (density tonsure centrifuging)
1. cell suspension is with ultrasonic Treatment (20 seconds)
2. the centrifugal 500g 15min of suspension gets supernatant for 4 ℃
3. supernatant is tiled on 8ml 35% (vol/vol) renographin (76%, Huaihai Pharmaceuticla Factory, Shanghai).
35% renographin 65%0.01M HEPES contains 0.1M NaCl
4. 4 ℃ of centrifugal 43000g 1h
5. precipitate is hanged again by SPG, concentrates in together mixing.
6. homomixture is laid down on the contrast agent of discontinuous density.
13ml 40%, and 8ml 44%, and 52%, 4 ℃ of centrifugal 43000g 1h of 5ml, EB are positioned on 44/52% the contrast agent interface.
7. collect 3 times of volume SPG dilutions, centrifugal 30000g 30min
8. precipitate is resuspended with SPG, is stored in-70 ℃.
Accompanying drawing 6 is seen in visible inclusion body growth behind Hela cell monolayer inoculation chlamydia trachomatis 48～72h.Behind embodiment 8 vaccine immunities, the protectiveness of mouse propagation road chlamydia infection is tested a material
1.C57 age in female mice (Chinese Military Medical Science Institute) 6-8 week
2.D type chlamydia
3. antigen HSP65 and can activate fusion rotein (to call in the following text " HSP65chlamy "), PBS two methods of human T-cell's chlamydia trachomatis major outer membrane albumen epi-position
1. divide two groups at random with 20 mices, one group is the vaccine immunity group, and one group is the PBS immune group, vaccine group in 0,14, every Mus of 21d injects 50ug altogether four axillary fossa places injections.And PBS organizes the equal-volume injection PBS that uses the same method.
2. at every Mus injection of 21d 5mg Progesterone
3. in 28d vagina inoculation chlamydia 1.5 * 10 4IFU
4. at 35d,, carry out histopathological examination with vagina, uterus, the fallopian tube taking-up of 20 Mus.The pathologic condition that compares vaccine immunity group and PBS immune group.Three pathological grading standards:
0 is normal
1+ minimal reaction (a spot of inflammatory cell)
2+ mild reaction (inflammatory cell increases, and thickens with matter between slight, and is diffused into fatty tissue on every side)
The medium reaction of 3+ (inflammatory cell significantly exists, with the removing that closes on fatty tissue)
4+ severe reaction (moderate extensively exists to serious reaction, and the removing of companion's affected tissue is with the many focuses necrosis that closes on fatty tissue).Three experimental results and conclusion PBS immune group: 10 routine reproductive system specimen ovaries and endometrium are all normal;
The inflammatory reaction of vagina: 7 examples are 3+, and 3 examples are 2+ vaccine immunity group: 10 routine reproductive system specimen ovaries and endometrium are all normal;
The inflammatory reaction of vagina: 2 examples are 2+, and 8 examples are 1+
Conclusion: the immunity behind this vaccine, the inflammation of the reproductive system of mice alleviates, vaccine has produced the certain protection effect.
The pathological section of inflammatory reactions at different levels is seen accompanying drawing 8,9,10.Behind embodiment 9 vaccine immunities, a material is tested in the mice vola
1.C57 male mice (Chinese Military Medical Science Institute), age in 6-8 week
2.D type chlamydia
3. antigen HSP65 and can activate fusion rotein (to call " HSP65chlamy " in the following text), the PBS of human T-cell's chlamydia trachomatis major outer membrane albumen epi-position.Two methods
1. divide two groups at random with 20 mices, one group is the vaccine immunity group, and one group is the PBS immune group, vaccine group in 0,14, every Mus of 21d injects 50ug altogether four axillary fossa places injections.And PBS organizes the equal-volume injection PBS that uses the same method.
2. at the left back sole of every mice of 28d vola subcutaneous injection 25ulPBS, right back sole subcutaneous injection 25ul 2 * 10 4The heat-inactivated CT of IFU (56 ℃ of 30min).
3. measure the thickness of sole at 72h.Three experimental results and conclusion
1.PBS group: left foot average thickness 2.8 ± 0.2cm, right crus of diaphragm average thickness 3.1 ± 0.4
2. vaccine group: left foot average thickness 2.95 ± 0.3, right crus of diaphragm average thickness 6.7 ± 0.2
Experimental result shows: after the right crus of diaphragm of the mice of vaccine immunity group had been injected CT-D, the degree of its swelling will be apparently higher than the left foot of having injected PBS, also apparently higher than the PBS immune group.Behind embodiment 10 vaccine immunities, CTL killing experiments one material
1.C57 male mice, age in 6-8 week
2.D type chlamydia
3. antigen HSP65 and can activate fusion rotein (to call " HSP65chlamy " in the following text), PBS two methods of human T-cell's chlamydia trachomatis major outer membrane albumen epi-position
1. divide two groups at random with 20 mices, one group is the vaccine immunity group, and one group is the PBS immune group, vaccine group in 0,14, every Mus of 21d injects 50ug altogether four axillary fossa places injections.And PBS organizes the equal-volume injection PBS that uses the same method.
2. the preparation of conditioned medium (condition medium): get a normal mouse, after disconnected neck is put to death, the alcohol disinfecting abdominal part, with taking out spleen through the utensil of disinfecting, put into aseptic plate, be transferred to super-clean bench, grind with clouded glass, with the complete culture solution splenocyte that suspends, filtered through gauze, 2500r/min, 5min, remove supernatant, resuspended with 0.83% ammonium chloride 1ml, 2min on ice, 2500r/min, 5min, remove supernatant,, it is moved in culture bottle with the complete culture solution splenocyte that suspends, and add 25ug concanavalin A, Con A (ConA), adding complete culture solution to cumulative volume again is 5ml.Cultivate 37 ℃ of 24h, 2500r/min, 5min collects supernatant and is conditioned medium.
3. the antigen of target cell loads and offers and Na 2 51CrO 4Labelling
1) will in the 100ml culture bottle, grow up to sparse monolayer about 2 * 10 6During individual cell, pour out culture fluid, add serum-free IMDM+10% conditioned medium, cultivate 16-24h.
2) 1ml 5 * 10 6The lipofectin that adds 5ul among the heat-inactivated CT EBs of IFU, mixing, 5min adds 1 then) in, 37 ℃ of 4h.
3) pour out liquid in the bottle,, add the 5ml complete culture solution with 0.25% pancreatin (Huamei Bio-Engrg Co.) digestion, counting, 1200r/min, 10min is resuspended in the 100ul complete culture solution, is transferred in the aseptic plastic pipe, and adds 100ul Na 2 51CrO 4(containing 200uCi) (PerkinElmer company), 1h is cultivated in concussion.
4) complete culture solution is washed 3-4 time.
5) with the concentration furnishing 1 * 10 of complete culture solution with cell 5Individual cell/ml.
4. spleen and the lymph node with vaccine immunity and PBS immunized mice takes out, grind, and the processing of splenocyte such as above-mentioned, and with spleen and lymphocytic nodal cell counting, furnishing 2 * 10 7Individual cell/ml.In 96 orifice plates, add spleen and lymphocyte 100ul, all establish 3 Concentraton gradient and be respectively 2 * 10 7, 1 * 10 7, 5 * 10 6, establish 3 multiple holes.
5. the B16 cell 100ul that labelling is good adds and contains in effector lymphocyte's the hole, and establishes the spontaneous release (target cell of 100ul+100ul complete culture solution) and the maximum release (target cell of 100ul+100ul 2mol hydrochloric acid) in 3 multiple holes in addition.
6.?37℃?5％CO 2，12-16h。
With 96 well culture plates with the centrifugal 5min of 150g.
8. get the 100ul supernatant, it is moved to plastic tube (being used for the γ counting)
9. measure the cpm value of each pipe with the γ calculating instrument.
10. the calculating of kill rate: kill rate=(experimental port value-spontaneous release aperture value/maximum release aperture value-spontaneous release aperture value) * 100% 3 experimental result and conclusion
Experimental result shows: the splenocyte of vaccine immunity group and lymphocyte have certain lethal effect to target cell, are under 100: 1 the situation imitating the target ratio, kill rate average out to 50-60%.And the kill rate average out to 5-10% of matched group.Embodiment 11 ELISA detect behind the immune vaccine C57 mouse antibodies material of tiring
C57 mice (all ages of male 6-8), chlamydia CT-D, PBS, bag are cushioned liquid 1%BSA, sheep anti-mouse igg-HRP (Beijing ancient cooking vessel state company), OPD-substrate buffer solution (0.2M Na 2HPO 425.7ml; 0.1M two methods citric acid 24.3ml)
1. the chlamydia behind the purification is placed 56 ℃ of water-baths, 30min.Behind preliminary experiment, the usefulness bag was cushioned liquid (Na in 1: 80 2CO 31.59g, NaHCO 32.93g add water to 1000ml) dilution.
2. bag quilt: add 96 orifice plates, the 100ul/ hole.4 ℃, spend the night.
3. washing: washing liquid is washed plate 3 times, 5min/ time.
4. sealing: add the 1%BSA sealing, the 200ul/ hole.40℃，1h。
5. washing: washing liquid is washed plate 3 times, 5min/ time.
6. application of sample: PBS immunity and each serum of 10 of vaccine immunity Mus (immunization method is the same) are done 100 times of dilutions, 100ul/ hole with sample diluting liquid.If multiple hole.40℃，30min。
7. add enzyme labelled antibody: sheep anti-mouse igg-HRP (Beijing ancient cooking vessel state biology, 0.1ml, 1: 1000) is diluted 500 times with washing liquid, the 100ul/ hole.40℃，30min。
8. washing: washing liquid is washed plate three times, 5min/ time.
9. colour developing: fresh preparation OPD-substrate buffer solution, 100ul/ hole.Room temperature lucifuge reaction 5-10min.
10. stop: add 2mol/L H 2SO 4, the 50ul/ hole.
11. survey A 490
Specimen Blank The PBS group The vaccine immunity group
?1 ?0.004 ?0 ?0.005 ?0.003±0.003 ?0.166 ?0.082 ?0.123 ?0.124±0.042 ?0.293 ?0.467 ?0.358 ?0.382±0.087
?2 ?0.077 ?0.143 ?0.201 ?0.140±0.062 ?0.327 ?0.542 ?0.410 ?0.426±0.11
?3 ?0.131 ?0.122 ?0.178 ?0.144±0.03 ?0.410 ?0.412 ?0.378 ?0.4±0.019
?4 ?0.83 ?0.120 ?0.141 ?0.115±0.029 ?0.418 ?0.322 ?0.438 ?0.393±0.062
?5 ?0.119 ?0.142 ?0.09 ?0.117±0.026 ?0.342 ?0.198 ?0.201 ?0.247±0.082
?6 ?0.100 ?0.123 ?0.175 ?0.133±0.038 ?0.211 ?0.105 ?0.156 ?0.157±0.053
?7 ?0.092 ?0.108 ?0.087 ?0.096±0.01 ?0.478 ?0.412 ?0.388 ?0.426±0.047
?8 ?0.115 ?0.141 ?0.176 ?0.144±0.031 ?0.378 ?0.422 ?0.398 ?0.399±0.022
?9 ?0.092 ?0.126 ?0.242 ?0.153±0.079 ?0.412 ?0.402 ?0.423 ?0.412±0.011
?10 ?0.087 ?0.125 ?0.092 ?0.101±0.017 ?0.510 ?0.378 ?0.469 ?0.452±0.068
Experimental result and conclusion
1 blank: 0.003 ± 0.0008;
2 PBS immune group: 0.1038 ± 0.0095;
3 vaccine immunity groups: 0.435 ± 0.012.
Experimental result shows: the antibody titer of vaccine immunity group is apparently higher than the PBS immune group
Sequence table＜110〉Beijing DiWeiHuaYu Biological Technology Co., Ltd＜120〉recombinant protein vaccine and uses thereof＜130 of the human chlamydia trachomatis infection of prevention〉＜160〉4＜170〉Patent Inversion 3.1＜210〉1＜211〉312＜212〉DNA＜213〉Chlamydia trachomatis＜220〉＜221〉CDS＜222〉(1) .. (312)＜223〉＜400〉1gaa ttc ccg gca tac ggt cgt cat atg cag gat gct gag atg ttc acc 48Glu Phe Pro Ala Tyr Gly Arg His Met Gln Asp Ala Glu Met Phe Thr1,5 10 15aac gct gct tgc atg gct ctc aac att tgg gac gag ctc aac gta ctg 96Asn Ala Ala Cys Met Ala Leu Asn Ile Trp Asp Glu Leu Asn Val Leu
20??????????????????25??????????????????30tgc?aac?gct?gct?gag?ttt?acc?att?aac?aag?ccg?aaa?ggt?tac?gta?ggc????144Cys?Asn?Ala?Ala?Glu?Phe?Thr?Ile?Asn?Lys?Pro?Lys?Gly?Tyr?Val?Gly
35??????????????????40??????????????????45aaa?gaa?ttt?ccg?ctg?gct?ctg?gac?gca?gct?acc?ggt?act?aag?gac?gca????192Lys?Glu?Phe?Pro?Leu?Ala?Leu?Asp?Ala?Ala?Thr?Gly?Thr?Lys?Asp?Ala
50??????????????????55??????????????????60tct?atc?gac?tac?cac?gaa?tgg?cag?gct?tct?ctg?gca?ctg?tct?tat?cgt????240Ser?Ile?Asp?Tyr?His?Glu?Trp?Gln?Ala?Ser?Leu?Ala?Leu?Ser?Tyr?Arg65??????????????????70??????????????????75??????????????????80ctg?aac?atg?ttt?acc?ccg?tac?atc?ggt?gtt?aaa?tgg?tct?cgt?gct?tct????288Leu?Asn?Met?Phe?Thr?Pro?Tyr?Ile?Gly?Val?Lys?Trp?Ser?Arg?Ala?Ser
85??????????????????90??????????????????95ttc?gac?gca?gac?acc?tac?aag?ctt????????????????????????????????????312Phe?Asp?Ala?Asp?Thr?Tyr?Lys?Leu
100<210>2<211>104<212>PRT<213>Chlamydia?trachomatis<400>2Glu?Phe?Pro?Ala?Tyr?Gly?Arg?His?Met?Gln?Asp?Ala?Glu?Met?Phe?Thr1???????????????5???????????????????10??????????????????15Asn?Ala?Ala?Cys?Met?Ala?Leu?Asn?Ile?Trp?Asp?Glu?Leu?Asn?Val?Leu
20??????????????????25??????????????????30Cys?Asn?Ala?Ala?Glu?Phe?Thr?Ile?Asn?Lys?Pro?Lys?Gly?Tyr?Val?Gly
35??????????????????40??????????????????45Lys?Glu?Phe?Pro?Leu?Ala?Leu?Asp?Ala?Ala?Thr?Gly?Thr?Lys?Asp?Ala
50??????????????????55??????????????????60Ser?Ile?Asp?Tyr?His?Glu?Trp?Gln?Ala?Ser?Leu?Ala?Leu?Ser?Tyr?Arg65??????????????????70??????????????????75??????????????????80Leu?Asn?Met?Phe?Thr?Pro?Tyr?Ile?Gly?Val?Lys?Trp?Ser?Arg?Ala?Ser
85??????????????????90??????????????????95Phe?Asp?Ala?Asp?Thr?Tyr?Lys?Leu
100<210>3<211>1980<212>DNA<213>Artificial<220><221>CDS<222>(1)..(1980)<223><400>3atg?gcc?aag?aca?att?gcg?tac?gac?gaa?gag?gcc?cgt?cgc?ggc?ctc?gag???????48Met?Ala?Lys?Thr?Ile?Ala?Tyr?Asp?Glu?Glu?Ala?Arg?Arg?Gly?Leu?Glu1???????????????5???????????????????10??????????????????15cgg?ggc?ttg?aac?gcc?ctc?gcc?gat?gcg?gta?aag?gtg?aca?ttg?ggc?ccc???????96Arg?Gly?Leu?Asn?Ala?Leu?Ala?Asp?Ala?Val?Lys?Val?Thr?Leu?Gly?Pro
20??????????????????25??????????????????30aag?ggc?cgc?aac?gtc?gtc?ctg?gaa?aag?aag?tgg?ggt?gcc?ccc?acg?atc??????144Lys?Gly?Arg?Asn?Val?Val?Leu?Glu?Lys?Lys?Trp?Gly?Ala?Pro?Thr?Ile
35??????????????????40??????????????????45acc?aac?gat?ggt?gtg?tcc?atc?gcc?aag?gag?atc?gag?ctg?gag?gat?ccg??????192Thr?Asn?Asp?Gly?Val?Ser?Ile?Ala?Lys?Glu?Ile?Glu?Leu?Glu?Asp?Pro
50??????????????????55??????????????????60tac?gag?aag?atc?ggc?gcc?gag?ctg?gtc?aaa?gag?gta?gcc?aag?aag?acc??????240Tyr?Glu?Lys?Ile?Gly?Ala?Glu?Leu?Val?Lys?Glu?Val?Ala?Lys?Lys?Thr65??????????????????70??????????????????75??????????????????80gat?gac?gtc?gcc?ggt?gac?ggc?acc?acg?acg?gcc?acc?gtg?ctg?gcc?cag??????288Asp?Asp?Val?Ala?Gly?Asp?Gly?Thr?Thr?Thr?Ala?Thr?Val?Leu?Ala?Gln
85??????????????????90??????????????????95gcg?ttg?gtt?cgc?gag?ggc?ctg?cgc?aac?gtc?gcg?gcc?ggc?gcc?aac?ccg??????336Ala?Leu?Val?Arg?Glu?Gly?Leu?Arg?Asn?Val?Ala?Ala?Gly?Ala?Asn?Pro
100?????????????????105?????????????????110ctc?ggt?ctc?aaa?cgc?ggc?atc?gaa?aag?gcc?gtg?gag?aag?gtc?acc?gag??????384Leu?Gly?Leu?Lys?Arg?Gly?Ile?Glu?Lys?Ala?Val?Glu?Lys?Val?Thr?Glu
115?????????????????120?????????????????125acc?ctg?ctc?aag?ggc?gcc?aag?gag?gtc?gag?acc?aag?gag?cag?att?gcg??????432Thr?Leu?Leu?Lys?Gly?Ala?Lys?Glu?Val?Glu?Thr?Lys?Glu?Gln?Ile?Ala
130?????????????????135?????????????????140gcc?acc?gca?gcg?att?tcg?gcg?ggt?gac?cag?tcc?atc?ggt?gac?ctg?atc??????480Ala?Thr?Ala?Ala?Ile?Ser?Ala?Gly?Asp?Gln?Ser?Ile?Gly?Asp?Leu?Ile145?????????????????150?????????????????155?????????????????160gcc?gag?gcg?atg?gac?aag?gtg?ggc?aac?gag?ggc?gtc?atc?acc?gtc?gag??????528Ala?Glu?Ala?Met?Asp?Lys?Val?Gly?Asn?Glu?Gly?Val?Ile?Thr?Val?Glu
165?????????????????170?????????????????175gag?tcc?aac?acc?ttt?ggg?ctg?cag?ctc?gag?ctc?acc?gag?ggt?atg?cgg??????576Glu?Ser?Asn?Thr?Phe?Gly?Leu?Gln?Leu?Glu?Leu?Thr?Glu?Gly?Met?Arg
180?????????????????185?????????????????190ttc?gac?aag?ggc?tac?atc?tcg?ggg?tac?ttc?gtg?acc?gac?ccg?gag?cgt??????624Phe?Asp?Lys?Gly?Tyr?Ile?Ser?Gly?Tyr?Phe?Val?Thr?Asp?Pro?Glu?Arg
195?????????????????200?????????????????205cag?gag?gcg?gtc?ctg?gag?gac?ccc?tac?atc?ctg?ctg?gtc?agc?tcc?aag??????672Gln?Glu?Ala?Val?Leu?Glu?Asp?Pro?Tyr?Ile?Leu?Leu?Val?Ser?Ser?Lys
210?????????????????215?????????????????220gtg?tcc?act?gtc?aag?gat?ctg?ctg?ccg?ctg?ctc?gag?aag?gtc?atc?gga??????720Val?Ser?Thr?Val?Lys?Asp?Leu?Leu?Pro?Leu?Leu?Glu?Lys?Val?Ile?Gly225?????????????????230?????????????????235?????????????????240gcc?ggt?aag?ccg?ctg?ctg?atc?atc?gcc?gag?gac?gtc?gag?ggc?gag?gcg??????768Ala?Gly?Lys?Pro?Leu?Leu?Ile?Ile?Ala?Glu?Asp?Val?Glu?Gly?Glu?Ala
245?????????????????250?????????????????255ctg?tcc?acc?ctg?gtc?gtc?aac?aag?atc?cgc?ggc?acc?ttc?aag?tcg?gtg??????816Leu?Ser?Thr?Leu?Val?Val?Asn?Lys?Ile?Arg?Gly?Thr?Phe?Lys?Ser?Val
260?????????????????265?????????????????270gcg?gtc?aag?gct?ccc?ggc?ttc?ggc?gac?cgc?cgc?aag?gcg?atg?ctg?cag??????864Ala?Val?Lys?Ala?Pro?Gly?Phe?Gly?Asp?Arg?Arg?Lys?Ala?Met?Leu?Gln
275?????????????????280?????????????????285gat?atg?gcc?att?ctc?acc?ggt?ggt?cag?gtg?atc?agc?gaa?gag?gtc?ggc??????912Asp?Met?Ala?Ile?Leu?Thr?Gly?Gly?Gln?Val?Ile?Ser?Glu?Glu?Val?Gly
290?????????????????295?????????????????300ctg?acg?ctg?gag?aac?gcc?gac?ctg?tcg?ctg?cta?ggc?aag?gcc?cgc?aag??????960Leu?Thr?Leu?Glu?Asn?Ala?Asp?Leu?Ser?Leu?Leu?Gly?Lys?Ala?Arg?Lys305?????????????????310?????????????????315?????????????????320gtc?gtg?gtc?acc?aag?gac?gag?acc?acc?atc?gtc?gag?ggc?gcc?ggt?gac?????1008Val?Val?Val?Thr?Lys?Asp?Glu?Thr?Thr?Ile?Val?Glu?Gly?Ala?Gly?Asp
325?????????????????330?????????????????335acc?gac?gcc?atc?gcc?gga?cga?gtg?gcc?cag?atc?cgc?cag?gag?atc?gag?????1056Thr?Asp?Ala?Ile?Ala?Gly?Arg?Val?Ala?Gln?Ile?Arg?Gln?Glu?Ile?Glu
340?????????????????345?????????????????350aac?agc?gac?tcc?gac?tac?gac?cgt?gag?aag?ctg?cag?gag?cgg?ctg?gcc?????1104Asn?Ser?Asp?Ser?Asp?Tyr?Asp?Arg?Glu?Lys?Leu?Gln?Glu?Arg?Leu?Ala
355?????????????????360?????????????????365aag?ctg?gcc?ggt?ggt?gtc?gcg?gtc?atc?aag?gcc?ggt?gcc?gcc?acc?gac?????1152Lys?Leu?Ala?Gly?Gly?Val?Ala?Val?Ile?Lys?Ala?Gly?Ala?Ala?Thr?Asp
370?????????????????375?????????????????380gtc?gaa?ctc?aag?gag?cgc?aag?cac?cgc?atc?gag?gat?gcg?gtt?cgc?aat?????1200Val?Glu?Leu?Lys?Glu?Arg?Lys?His?Arg?Ile?Glu?Asp?Ala?Val?Arg?Asn385?????????????????390?????????????????395?????????????????400gcc?aag?gcc?gcc?gtc?gag?gag?ggc?atc?gtc?gcc?ggt?ggg?ggt?gtg?acg?????1248Ala?Lys?Ala?Ala?Val?Glu?Glu?Gly?Ile?Val?Ala?Gly?Gly?Gly?Val?Thr
405?????????????????410?????????????????415ctg?ttg?caa?gcg?gcc?ccg?acc?ctg?gac?gag?ctg?aag?ctc?gaa?ggc?gac?????1296Leu?Leu?Gln?Ala?Ala?Pro?Thr?Leu?Asp?Glu?Leu?Lys?Leu?Glu?Gly?Asp
420?????????????????425?????????????????430gag?gcg?acc?ggc?gcc?aac?atc?gtg?aag?gtg?gcg?ctg?gag?gcc?ccg?ctg?????1344Glu?Ala?Thr?Gly?Ala?Asn?Ile?Val?Lys?Val?Ala?Leu?Glu?Ala?Pro?Leu
435?????????????????440?????????????????445aag?cag?atc?gcc?ttc?aac?tcc?ggg?ctg?gag?ccg?ggc?gtg?gtg?gcc?gag?????1392Lys?Gln?Ile?Ala?Phe?Asn?Ser?Gly?Leu?Glu?Pro?Gly?Val?Val?Ala?Glu
450?????????????????455?????????????????460aag?gtg?cgc?aac?ctg?ccg?gct?ggc?cac?gga?ctg?aac?gct?cag?acc?ggt?????1440Lys?Val?Arg?Asn?Leu?Pro?Ala?Gly?His?Gly?Leu?Asn?Ala?Gln?Thr?Gly465?????????????????470?????????????????475?????????????????480gtc?tac?gag?gat?ctg?ctc?gct?gcc?ggc?gtt?gct?gac?ccg?gtc?aag?gtg?????1488Val?Tyr?Glu?Asp?Leu?Leu?Ala?Ala?Gly?Val?Ala?Asp?Pro?Val?Lys?Val
485?????????????????490?????????????????495acc?cgt?tcg?gcg?ctg?cag?aat?gcg?gcg?tcc?atc?gcg?ggg?ctg?ttc?ctg?????1536Thr?Arg?Ser?Ala?Leu?Gln?Asn?Ala?Ala?Set?Ile?Ala?Gly?Leu?Phe?Leu
500?????????????????505?????????????????510acc?acc?gag?gcc?gtc?gtt?gcc?gac?aag?ccg?gaa?aag?gag?aag?gct?tcc?????1584Thr?Thr?Glu?Ala?Val?Val?Ala?Asp?Lys?Pro?Glu?Lys?Glu?Lys?Ala?Ser
515?????????????????520?????????????????525gtt?ccc?ggt?ggc?ggc?gac?atg?ggt?ggc?atg?gat?ttc?cat?atg?gct?agc?????1632Val?Pro?Gly?Gly?Gly?Asp?Met?Gly?Gly?Met?Asp?Phe?His?Met?Ala?Ser
530?????????????????535?????????????????540gaa?ttc?ccg?gca?tac?ggt?cgt?cat?atg?cag?gat?gct?gag?atg?ttc?acc?????1680Glu?Phe?Pro?Ala?Tyr?Gly?Arg?His?Met?Gln?Asp?Ala?Glu?Met?Phe?Thr545?????????????????550?????????????????555?????????????????560aac?gct?gct?tgc?atg?gct?ctc?aac?att?tgg?gac?gag?ctc?aac?gta?ctg?????1728Asn?Ala?Ala?Cys?Met?Ala?Leu?Asn?Ile?Trp?Asp?Glu?Leu?Asn?Val?Leu
565?????????????????570?????????????????575tgc?aac?gct?gct?gag?ttt?acc?att?aac?aag?ccg?aaa?ggt?tac?gta?ggc?????1776Cys?Asn?Ala?Ala?Glu?Phe?Thr?Ile?Asn?Lys?Pro?Lys?Gly?Tyr?Val?Gly
580?????????????????585?????????????????590aaa?gaa?ttt?ccg?ctg?gct?ctg?gac?gca?gct?acc?ggt?act?aag?gac?gca?????1824Lys?Glu?Phe?Pro?Leu?Ala?Leu?Asp?Ala?Ala?Thr?Gly?Thr?Lys?Asp?Ala
595?????????????????600?????????????????605tct?atc?gac?tac?cac?gaa?tgg?cag?gct?tct?ctg?gca?ctg?tct?tat?cgt?????1872Ser?Ile?Asp?Tyr?His?Glu?Trp?Gln?Ala?Ser?Leu?Ala?Leu?Ser?Tyr?Arg
610?????????????????615?????????????????620ctg?aac?atg?ttt?acc?ccg?tac?atc?ggt?gtt?aaa?tgg?tct?cgt?gct?tct?????1920Leu?Asn?Met?Phe?Thr?Pro?Tyr?Ile?Gly?Val?Lys?Trp?Ser?Arg?Ala?Ser625?????????????????630?????????????????635?????????????????640ttc?gac?gca?gac?acc?tac?aag?ctt?gcg?gcc?gca?ctc?gag?cac?cac?cac?????1968Phe?Asp?Ala?Asp?Thr?Tyr?Lys?Leu?Ala?Ala?Ala?Leu?Glu?His?His?His
645?????????????????650?????????????????655cac?cac?cac?tga?????????????????????????????????????????????????????1980His?His?His<210>4<211>659<212>PRT<213>Artificial<400>4Met?Ala?Lys?Thr?Ile?Ala?Tyr?Asp?Glu?Glu?Ala?Arg?Arg?Gly?Leu?Glu1???????????????5???????????????????10??????????????????15Arg?Gly?Leu?Asn?Ala?Leu?Ala?Asp?Ala?Val?Lys?Val?Thr?Leu?Gly?Pro
20??????????????????25??????????????????30Lys?Gly?Arg?Asn?Val?Val?Leu?Glu?Lys?Lys?Trp?Gly?Ala?Pro?Thr?Ile
35??????????????????40??????????????????45Thr?Asn?Asp?Gly?Val?Ser?Ile?Ala?Lys?Glu?Ile?Glu?Leu?Glu?Asp?Pro
50??????????????????55??????????????????60Tyr?Glu?Lys?Ile?Gly?Ala?Glu?Leu?Val?Lys?Glu?Val?Ala?Lys?Lys?Thr65??????????????????70??????????????????75??????????????????80Asp?Asp?Val?Ala?Gly?Asp?Gly?Thr?Thr?Thr?Ala?Thr?Val?Leu?Ala?Gln
85??????????????????90??????????????????95Ala?Leu?Val?Arg?Glu?Gly?Leu?Arg?Asn?Val?Ala?Ala?Gly?Ala?Asn?Pro
100?????????????????105?????????????????110Leu?Gly?Leu?Lys?Arg?Gly?Ile?Glu?Lys?Ala?Val?Glu?Lys?Val?Thr?Glu
115?????????????????120?????????????????125Thr?Leu?Leu?Lys?Gly?Ala?Lys?Glu?Val?Glu?Thr?Lys?Glu?Gln?Ile?Ala
130?????????????????135?????????????????140Ala?Thr?Ala?Ala?Ile?Ser?Ala?Gly?Asp?Gln?Ser?Ile?Gly?Asp?Leu?Ile145?????????????????150?????????????????155?????????????????160Ala?Glu?Ala?Met?Asp?Lys?Val?Gly?Asn?Glu?Gly?Val?Ile?Thr?Val?Glu
165?????????????????170?????????????????175Glu?Ser?Asn?Thr?Phe?Gly?Leu?Gln?Leu?Glu?Leu?Thr?Glu?Gly?Met?Arg
180?????????????????185?????????????????190Phe?Asp?Lys?Gly?Tyr?Ile?Ser?Gly?Tyr?Phe?Val?Thr?Asp?Pro?Glu?Arg
195?????????????????200?????????????????205Gln?Glu?Ala?Val?Leu?Glu?Asp?Pro?Tyr?Ile?Leu?Leu?Val?Ser?Ser?Lys
210?????????????????215?????????????????220Val?Ser?Thr?Val?Lys?Asp?Leu?Leu?Pro?Leu?Leu?Glu?Lys?Val?Ile?Gly225?????????????????230?????????????????235?????????????????240Ala?Gly?Lys?Pro?Leu?Leu?Ile?Ile?Ala?Glu?Asp?Val?Glu?Gly?Glu?Ala
245?????????????????250?????????????????255Leu?Ser?Thr?Leu?Val?Val?Asn?Lys?Ile?Arg?Gly?Thr?Phe?Lys?Ser?Val
260?????????????????265?????????????????270Ala?Val?Lys?Ala?Pro?Gly?Phe?Gly?Asp?Arg?Arg?Lys?Ala?Met?Leu?Gln
275?????????????????280?????????????????285Asp?Met?Ala?Ile?Leu?Thr?Gly?Gly?Gln?Val?Ile?Ser?Glu?Glu?Val?Gly
290?????????????????295?????????????????300Leu?Thr?Leu?Glu?Asn?Ala?Asp?Leu?Ser?Leu?Leu?Gly?Lys?Ala?Arg?Lys305?????????????????310?????????????????315?????????????????320Val?Val?Val?Thr?Lys?Asp?Glu?Thr?Thr?Ile?Val?Glu?Gly?Ala?Gly?Asp
325?????????????????330?????????????????335Thr?Asp?Ala?Ile?Ala?Gly?Arg?Val?Ala?Gln?Ile?Arg?Gln?Glu?Ile?Glu
340?????????????????345?????????????????350Asn?Ser?Asp?Ser?Asp?Tyr?Asp?Arg?Glu?Lys?Leu?Gln?Glu?Arg?Leu?Ala
355?????????????????360?????????????????365Lys?Leu?Ala?Gly?Gly?Val?Ala?Val?Ile?Lys?Ala?Gly?Ala?Ala?Thr?Asp
370?????????????????375?????????????????380Val?Glu?Leu?Lys?Glu?Arg?Lys?His?Arg?Ile?Glu?Asp?Ala?Val?Arg?Asn385?????????????????390?????????????????395?????????????????400Ala?Lys?Ala?Ala?Val?Glu?Glu?Gly?Ile?Val?Ala?Gly?Gly?Gly?Val?Thr
405?????????????????410?????????????????415Leu?Leu?Gln?Ala?Ala?Pro?Thr?Leu?Asp?Glu?Leu?Lys?Leu?Glu?Gly?Asp
420?????????????????425?????????????????430Glu?Ala?Thr?Gly?Ala?Asn?Ile?Val?Lys?Val?Ala?Leu?Glu?Ala?Pro?Leu
435?????????????????440?????????????????445Lys?Gln?Ile?Ala?Phe?Asn?Ser?Gly?Leu?Glu?Pro?Gly?Val?Val?Ala?Glu
450?????????????????455?????????????????460Lys?Val?Arg?Asn?Leu?Pro?Ala?Gly?His?Gly?Leu?Asn?Ala?Gln?Thr?Gly465?????????????????470?????????????????475?????????????????480Val?Tyr?Glu?Asp?Leu?Leu?Ala?Ala?Gly?Val?Ala?Asp?Pro?Val?Lys?Val
485?????????????????490?????????????????495Thr?Arg?Ser?Ala?Leu?Gln?Asn?Ala?Ala?Ser?Ile?Ala?Gly?Leu?Phe?Leu
500?????????????????505?????????????????510Thr?Thr?Glu?Ala?Val?Val?Ala?Asp?Lys?Pro?Glu?Lys?Glu?Lys?Ala?Ser
515?????????????????520?????????????????525Val?Pro?Gly?Gly?Gly?Asp?Met?Gly?Gly?Met?Asp?Phe?His?Met?Ala?Ser
530?????????????????535?????????????????540Glu?Phe?Pro?Ala?Tyr?Gly?Arg?His?Met?Gln?Asp?Ala?Glu?Met?Phe?Thr545?????????????????550?????????????????555?????????????????560Asn?Ala?Ala?Cys?Met?Ala?Leu?Asn?Ile?Trp?Asp?Glu?Leu?Asn?Val?Leu
565?????????????????570?????????????????575Cys?Asn?Ala?Ala?Glu?Phe?Thr?Ile?Asn?Lys?Pro?Lys?Gly?Tyr?Val?Gly
580?????????????????585?????????????????590Lys?Glu?Phe?Pro?Leu?Ala?Leu?Asp?Ala?Ala?Thr?Gly?Thr?Lys?Asp?Ala
595?????????????????600?????????????????605Ser?Ile?Asp?Tyr?His?Glu?Trp?Gln?Ala?Ser?Leu?Ala?Leu?Ser?Tyr?Arg
610?????????????????615?????????????????620Leu?Asn?Met?Phe?Thr?Pro?Tyr?Ile?Gly?Val?Lys?Trp?Ser?Arg?Ala?Ser625?????????????????630?????????????????635?????????????????640Phe?Asp?Ala?Asp?Thr?Tyr?Lys?Leu?Ala?Ala?Ala?Leu?Glu?His?His?His
645?????????????????650?????????????????655His?His?His

Claims (16)

1. recombinant protein vaccine, it is to be connected with the proteic epi-position of chlamydia trachomatis major outer membrane that can activate the human T-cell and the fusion rotein that forms by bacillus calmette-guerin vaccine heat shock protein 65.
2. according to the described recombinant protein vaccine of claim 1, it has and is selected from following arbitrary aminoacid sequence:
1) aminoacid sequence shown in the SEQ ID No:4; With
2) by under tight hybridization conditions with coding 1) the coded aminoacid sequence of nucleotide sequence of nucleotide sequence hybridization of aminoacid sequence.
3. according to the described recombinant protein vaccine of claim 1, the wherein said polypeptide that can activate human T-cell's the proteic epi-position of chlamydia trachomatis major outer membrane has the aminoacid sequence shown in the SEQ ID No:2.
4. according to the described recombinant protein vaccine of claim 1, wherein, bacillus calmette-guerin vaccine heat shock protein 65 is positioned at the aminoterminal of this fusion rotein, and the proteic epi-position of chlamydia trachomatis major outer membrane that can activate the human T-cell is positioned at the c-terminus of this fusion rotein.
5. according to the described recombinant protein vaccine of claim 1, it has the aminoacid sequence shown in the SEQ ID No:4.
6. the nucleotide sequence of any described recombinant protein vaccine in the claim 1 to 5 of encoding.
7. according to the described nucleotide sequence of claim 6, it has and is selected from following arbitrary sequence:
1) nucleotide sequence shown in the SEQ ID NO:3; With
2) by under tight hybridization conditions with 1) the nucleotide sequence of nucleotide sequence hybridization.
7. according to the described gene of claim 6, it has the nucleotide sequence shown in the SEQ ID NO:3.
8. the expression vector that contains each nucleotide sequence among the claim 5-7.
9. the host cell that contains claim 10 expression vector.
10. according to the described host cell of claim 9, it is prokaryotic cell, eukaryotic cell or mammalian cell.
11. a method for preparing each recombinant protein vaccine among the claim 1-5 comprises and cultivating as claim 9 or 10 described host cells.
12. each described recombiant protein is used for preventing the purposes of the vaccine product of human chlamydia trachomatis infection among the claim 1-5 in preparation.
13. according to the described purposes of claim 12, wherein said human chlamydia trachomatis infection is a urogenital infections.
14. a vaccine product that is used to prevent human chlamydia trachomatis infection contains each described recombiant protein and carrier or excipient among the claim 1-5.
15. according to the described vaccine product of claim 12, wherein said human chlamydia trachomatis infection is a urogenital infections.
CNB021419779A 2002-08-29 2002-08-29 Recombination protein for preventing human trachoma bedsnia infestation and its use Expired - Fee Related CN1243568C (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CNB021419779A CN1243568C (en) 2002-08-29 2002-08-29 Recombination protein for preventing human trachoma bedsnia infestation and its use
PCT/CN2003/000430 WO2004020471A1 (en) 2002-08-29 2003-06-03 Recombinant protein for preventing human chlamydia trachomatis and the uses thereof
AU2003246103A AU2003246103A1 (en) 2002-08-29 2003-06-03 Recombinant protein for preventing human chlamydia trachomatis and the uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB021419779A CN1243568C (en) 2002-08-29 2002-08-29 Recombination protein for preventing human trachoma bedsnia infestation and its use

Publications (2)

Publication Number Publication Date
CN1478549A true CN1478549A (en) 2004-03-03
CN1243568C CN1243568C (en) 2006-03-01

Family

ID=31954580

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB021419779A Expired - Fee Related CN1243568C (en) 2002-08-29 2002-08-29 Recombination protein for preventing human trachoma bedsnia infestation and its use

Country Status (3)

Country Link
CN (1) CN1243568C (en)
AU (1) AU2003246103A1 (en)
WO (1) WO2004020471A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006079291A1 (en) * 2005-01-27 2006-08-03 Changchun Huapu Biotechnology Co., Ltd. Artificial synthetic single strand deoxynucleotide and vaccine composition thereof and the use

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6225443B1 (en) * 1999-05-19 2001-05-01 Wisconsin Alumni Research Foundation Cytotoxic T lymphocyte epitopes of the major outer membrane protein of chlamydia trachomatis
CN100400099C (en) * 2001-01-04 2008-07-09 北京迪威华宇生物技术有限公司 Recombinant protein vaccine for preventing and treating human prostata cancer

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006079291A1 (en) * 2005-01-27 2006-08-03 Changchun Huapu Biotechnology Co., Ltd. Artificial synthetic single strand deoxynucleotide and vaccine composition thereof and the use

Also Published As

Publication number Publication date
AU2003246103A1 (en) 2004-03-19
CN1243568C (en) 2006-03-01
WO2004020471A1 (en) 2004-03-11

Similar Documents

Publication Publication Date Title
CN1222618C (en) Moraxella catarrhalis outer membrane protein-106 polypeptide, gene sequence and uses thereof
CN1191362C (en) Streptococcus antigens
CN1909924A (en) Mucosal vaccine adjuvants containing bacterial flegellins as an active component
CN1333832A (en) Compounds and methods for treatment and diagnosis of chlamydial infection
CN1184505A (en) Vaccines for plague
CN1171814A (en) Polynucleotide tuberculosis vaccine
CN1956730A (en) Recombinant protein carrying human papillomavirus epitopes inserted in an adenylate cyclase protein or fragment thereof, and therapeutic uses thereof
CN1267553C (en) Haemophilus transferrin receptor genes
CN1067382A (en) The expression of human papilloma virus&#39;s peptide and the application in causing immune composition
CN1317014A (en) Antibody for detecting microorganism
CN1798762A (en) Tuberculosis vaccine with improved efficacy.
CN1136778A (en) Sperm antigen corresponding to sperm zone binding protein autoantigenic epitope
CN1956727A (en) Polypeptides for inducing a protective immune response against staphylococcus aureus
CN101054582A (en) A-type kreotoxin receptor combination region Hc, coding protein and application thereof
CN1303438A (en) Method of cancer diagnosis using chimeric toxin
CN1259522A (en) Novel protain from lobar pneumonia Actinomyces
CN1705747A (en) Vector for anti-HPV vaccine and transformed microorganism by the vector
CN1259051A (en) Stabilized human papillomavirus formulations
CN1478549A (en) Recombination protein for preventing human trachoma bedsnia infestation and its use
CN1833723A (en) Chain coccus recombination subunit vaccine and prepn. thereof
CN1184319C (en) Chemosynthesized SARS virus S gene segement, its expression and application
CN1639569A (en) Methods and compositions for inducing an immune response
CN1737144A (en) Composite multiple epitope bivalent nucleic acid vaccine construction for foot-and-mouth disease
CN1189483C (en) Humanized CD3-resisting monoclonal antibody
CN1305525C (en) 0157 bacterium gene engineering multivalence subunit vaccine of human and sensitive animals and its preparing method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20060301

Termination date: 20090929