CN1473933A - Beet black withered virus as expression carrier of foreigh gene - Google Patents

Abstract

The present invention describes the whole nucleotide sequence of beet black scorch virus (BBSV). The cDNA cloning of BBSV whole genome may be transcribed under the control of eukaryotic and prokaryotic promoter to produce viral RNA with infection capacity to host plant. Taking the insertion of medusa green fluorescent protein gene as example, the present invention shows that obtained recombinant BBSV may be used as carrier for carrying virus to express exotic gene in plant.

Description

The shrivelled virus of beet black is as the expression of exogenous gene carrier

1. technical field

The present invention relates to the carrier that uses in a kind of genetically engineered.Concretely, be a kind of derive from virus can carry the carrier that foreign gene is expressed in plant.

2. background technology

Since the eighties in last century, found the shrivelled type beet of a kind of black virus disease successively in beet main producing regions such as Xinjiang of China, Ningxia, the Inner Mongol, Gansu, Heilungkiang, Jilin, bring tremendous loss [Cui Xingming etc. to production, Shihezi Agriculture College's journal, 10 (1), 73-78 (1988)].The symptom of this disease on beet mainly shows as upright blade upwards, produce the shrivelled scab of black between vein, the leaf margin curls inward, the a large amount of necrosis of root hair etc., to the harm of beet surpassed beet necrotic yellow vein virus (Beet necrotic yellow vein virus, BNYVV), and increase the weight of [Liu Jiexian etc. day by day, China's beet, (3), 30-31 (1995)].1989, only the Ningxia onset area just accounted for whole district beet producing region 69.2%, wherein, the total crop failure or the forfeiture use value account for 4.6%.The contriver is through 10 years of researches, proof causes that this sick pathogenic micro-organism is a kind of new virus first in the world, and name and be the shrivelled virus of beet black (Beet blackscorch virus, BBSV), also biology, serology, particle shape and the circulation way thereof etc. of BBSV are carried out deeply comprehensively research simultaneously, obtained a series of result of study.

Prove that now BBSV is that a kind of diameter is the ball-type virus of 28nm, the coat protein subunit is an one-component, and molecular weight is about 24.5kDa.Only infect beet under the natural condition, can infect 4 sections, 13 kind of plant under the artificial mechanism inoculation condition, as Chenopodium amaranticolor, New Zealand spinach and Ben Sheng cigarette etc.BBSV carries propagation by wild cabbage oil can bacterium (Olpidium brassicae) in the malicious mode of zoospore flagellated body tyre, on the serology only with tobacco necrosis virus (Tobacco necrotic virus, TNV) the willow isolate has more weak serological relation [Jiang Junxi etc., Agricultural University Of Jiangxi's journal, 21 (4), 525-528 (1999)].

The shrivelled virus of beet black is a kind of new virus of only finding in China, at world other countries or the regional similar report that does not also have about this disease.China is unique country that carries out BBSV research, but is confined to the research of the fundamental biological knowledges such as biology, morphology and serology of virus at present for the research of this virus.The present invention has described genomic nucleotide sequence of BBSV and constitutional features first, confirmed heterogeneic function on the genome, further viral genome is transformed on this basis, made it to become the virus vector that can carry foreign gene and can in plant, efficiently express.

3. summary of the invention

1. measure the full genome nucleotide sequence (SFQ ID NO 1) of this new virus of BBSV, determined genomic size of BBSV and structure.

Sequential analysis shows, the BBSV genome is strand ss (+) RNA that just anticipating, and is made up of 3641 Nucleotide, comprises 6 open reading frame (ORFs).Be positioned at the albumen P22 of the terminal 22kDa of ORF coding of RNA 5 ', this proteic amber terminator codon reads over that (Reading-through can produce the read-through protein P82 of 82kDa after R/T), is the RNA polymerase of the dependenc RNA of virus.Coat protein (CP) at the terminal 24.5kDa of ORF coding of BBSV RNA 3 '.Three little ORFs are arranged, encode respectively 4.2kDa albumen P4.2 and two 7kDa albumen P7a and P7b (see figure 1) between pol gene and coat protein gene.Through the GenBank retrieval relatively, though BBSV is the highest with the homology of the D strain system (TNV-D) of tobacco necrosis virus, the sequence identity degree also only is 61%.According to BBSV biology and serology performance, fungi propagation characteristic, genomic size and structure, nucleotide sequence homology, and the results of study such as satellite RNA component that in the individual separation thing, exist, the contriver names BBSV a kind of new virus that belongs to into tobacco necrosis virus.

2. made up the BBSV infectivity cDNA clone pUBF52 under the control of T7 promotor, it contains SEQ ID NO 1 nucleotide sequence and T7 promotor, the BBSV genome can access under the control of T7 promotor and transcribe, and produces to have again and infects active BBSV geneome RNA.

3. made up the BBSV infectivity cDNA clone pRBS2 under the control of CaMV 35S promoter, it contains SEQ IDNO 1 nucleotide sequence and CaMV 35S promoter, by the effect of 35 promotors, can make the cDNA of BBSV

In plant materials, transcribed, produce to have again and infect active BBSV geneome RNA.

4. utilize acquired BBSV infectivity cDNA clone pUBF52 and pRBS2,, confirmed the heterogeneic effect of BBSV genome, and their functional area is located the transformation that suddenlys change of virus genomic different zones.

5. BBSV genome functions gene is being carried out on the pinpoint basis, the genomic different zones of BBSV is carried out deletion mutantion or replaced sudden change [coat protein gene that the present invention has replaced BBSV with jellyfish green fluorescent protein (GFP) gene is an example], be not subjected under the prerequisite of obviously influence at infection ability that guarantees virus and the replication of self, the pathogenecity of attenuated virus constructs the virus expression carrier that can carry foreign gene on this basis.

6. infect, transform host plant, measured and utilized the effect of BBSV as the exogenous gene expression carrier.

With this a kind of new virus of only finding at present of BBSV in China, be transformed into and have the virus vector that can carry foreign gene, be convenient to characteristics such as operating, efficiency of infection is high, be used to utilize the plant production medical protein, on material, have originality.

4. description of drawings

The size of genomic structure of Fig. 1 .BBSV and proteins encoded

The pcr amplification of Fig. 2 .BBSV full-length cDNA A as a result is λ DNA/EcoR I+Hind III double digestion Marker; B is the pcr amplification product of the full-length cDNA of BBSV 3.64kb

The in-vitro transcription product A of BBSV infectivity cDNA clone pUBF52 is that the in-vitro transcription thing B of pUBF52 is BBSV RNA under the control of Fig. 3 T7 promotor

Active Northern blot detection is infected in Fig. 4 T7 promotor control outer transcript of BBSV infectivity cDNA clone body down, and wherein g is the BBSV genome; Sg1 is a subgene group 1; Sg2 be subgene group 2A for the control of T7 promotor down BBSV infectivity cDNA clone pUBF52 in-vitro transcription thing inoculation B for blank C for to inoculate with BBSV RNA

Fig. 5 T7 promotor control down the outer transcript of BBSV infectivity cDNA clone body infect active Western blot detect A for blank B for BBSV RNA inoculation C for the T7 promotor control in-vitro transcription thing inoculation of BBSV infectivity cDNA clone pUBF52 down

Fig. 6: 35S promoter control BBSV infectivity cDNA clone down infect active Northern blot detect 1 for blank 2 for the control of T7 promotor down the in-vitro transcription thing inoculation 3 of BBSV total length infectivity cDNA clone pUBF52 for be that BBSV infectivity cDNA under 35S promoter is controlled clones pUBS2 and inoculates with BBSV RNA inoculation 4 and 5

4 kinds of deletion mutants of Fig. 7 BBSV genome (pBDCP, pDCPn100, pDCPc6 and pDCP18) structural representation

The different deletion mutant in-vitro transcription of Fig. 8 BBSV genome thing infects active Northern blot and detects A: blank B: inoculum is the RNAC of BBSV: inoculum is BBSV full length cDNA clone in-vitro transcription thing D-G: inoculum is respectively the in-vitro transcription thing of BBSV coat protein gene deletion mutant (pBDCP, pDCPn100, pDCPc6 and pDCP18)

Fig. 9 observes the expression of jellyfish green fluorescent protein (GFP) gene in the BBSV virus vector with laser confocal microscope (Confocal), green is that the Chenopodium amaranticolor blade B that pUBF52 (contain the BBSV full-length cDNA, do not insert the GFP gene) in-vitro transcription thing is inoculated is that the Chenopodium amaranticolor blade C that pUB-GFP (by the control of T7 promotor) in-vitro transcription thing is inoculated is the Chenopodium amaranticolor blade of pRBS-GFP (by 35S promoter control) inoculation for the jellyfish green fluorescent protein A that expresses

5. the clone and the sequential analysis of the full genome cDNA of embodiment embodiment 1:BBSV

Isolated viral from the beet of the shrivelled symptom of beet main producing regions such as Ningxia, Xinjiang, the Inner Mongol, Gansu, Heilungkiang, Jilin performances black, friction inoculation Chenopodium amaranticolor (Chenopodium amaranticolor) and New Zealand spinach host plants such as (Tetragonia expansa), adopt ordinary methods such as PEG precipitation and differential centrifugation from the sick leaf of Chenopodium amaranticolor, to extract virus, through phenol-chloroform extracting, obtain the RNA of BBSV again.The agarose gel electrophoresis detected result, BBSV nucleic acid is ssRNA, size is about 3.6-3.7kb, experiment showed, terminal no Poly (A) tail of 3 of BBSV RNA ' preface through Oligo (dT) cellulose column wash-out.

According to the Standard operation procedure SOP of GIBCO BRL company, at first the RNA to BBSV Ningxia isolate carries out the PolyA tailing.With Oligo (dT) 12-18 is primer, adopts the Promega cDNA of company synthetic agent box, and it is synthetic that the viral RNA of tailing is carried out cDNA.The double-stranded cDNA of gained is cloned into the SmaI site of pGEM-7Z (+) after the processing of T4 DNA Polymerase flush end.Utilize T4 Polynucleotide kinase with γ- ³²P-ATP carries out end mark to viral RNA, carries out dot blot with recombinant plasmid, filters out 4 positive colonies---pGB212, pGB159, pGB327 and pGB146.Adopt two deoxidation cessation method of Sanger to carry out sequencing with ABI 377 dna sequencing instrument, wherein pGB212, pGB159, three positive colonies of pGB327 have 3 ' identical end.According to check order row, the synthetic new primer of design is proceeded the synthetic of cDNA, finally obtains the nearly full-length gene group of BBSV.Adopt the 5 ' RACE and the acquisition of 3 ' RACE test kit of Invitrogen company respectively and confirm BBSV genomic 5 ' and 3 ' end sequence, thereby obtain the genome full length sequence.

According to " molecular cloning experiment guide " described basic experimental methods of molecular biology, according to BBSV geneome RNA end sequence design primer BB-18 and BB-14, BBSV RNA with purification is a template, carry out reverse transcription--chain polymerization enzyme reaction (RT-PCR, 94 ℃ of sex change 1min, 52 ℃ of annealing 1min, 72 ℃ are extended 4min), can obtain the BBSV full-length cDNA (see figure 1) of 3641bp.

The sequence of primer BB-18 is: 5 '- TGTAATACGACTCACTATAGAAGAAACCTAACCAGTTCTCGTTGATCAGCGAT-3 ', and corresponding with the 1-34nt of SEQ ID NO 1, the t7 rna polymerase promoter sequence of underscore for introducing.

The sequence of primer BB-14 is: 5 '-TCC CCCGGGCCACCTGGAAGACCAGGTATAT-3 ', with the 3618-3641nt complementation of SEQ ID NO 1, the SmaI site of underscore for introducing

Related various test methods and the experimental technique of present embodiment is common practise, and according to described basic experimental methods of molecular biology such as " molecular cloning experiment guides ", those of ordinary skill in the art can both realize.Structure, the in-vitro transcription that embodiment 2:T7 promotor control BBSV infectivity cDNA down clones and infect determination of activity

According to BBSV RNA end sequence design primer BB-18 and BB-14, wherein 5 of the BB-18 primer ' end is introduced the T7 rna polymerase promoter sequence, and 5 of BB-14 primer ' end is introduced SmaI restriction enzyme site (not having this site in the BBSV complete sequence).BBSV RNA with purification is a template, and RT-PCR increases (72 ℃ are extended 4min for 94 ℃ of sex change 1min, 52 ℃ of annealing 1min), has obtained the BBSV full-length cDNA (Fig. 2) of 3.64kb.The PCR product through the T4DNA polysaccharase cut flat after, be connected into the SmaI site of carrier pUC18.Through Screening and Identification, obtained recombinant plasmid pUBF52.

After linearization of recombinant plasmid pUBF52 usefulness restriction endonuclease SmaI, be template with the linearizing DNA of about 100-200ng, carry out in-vitro transcription with t7 rna polymerase, can transcribe out the transcription product (Fig. 3) identical with BBSV viral RNA size.With in-vitro transcription thing frictional inoculation Chenopodium amaranticolor blade, after 3-4 days, can produce and the identical little withered spot of BBSV RNA inoculation, the morbidity severity reaches does not have significant difference yet, illustrating that the BBSV genome can access under T7 promotor control transcribes, and produces to have again and infects active BBSV geneome RNA.The in-vitro transcription thing of BBSV infectivity cDNA clone under the control of embodiment 3:T7 promotor infects active Northern blot and detects

Inoculate the Chenopodium amaranticolor blade respectively with pUBF52 in-vitro transcription thing and viral RNA, extract the total RNA of blade, the sex change agarose gel electrophoresis through 1% utilizes capillary tube technique after separating, and is transferred to Hybond-H through 20 * SSC ⁺On the nylon membrane.According to " molecular cloning experiment guide " described basic experiment method, with the terminal 0.3kb non-coding region of the BBSV 3 ' of digoxigenin labeled is probe, through prehybridization (42 ℃ prehybridization 5-6 hour), hybridization (42 ℃ of hybridization are more than 12 hours), wash steps such as film and colour developing and carry out Northern blot and detect, the result shows to also have two little subgene group bands (Fig. 4) except that BBSV geneome RNA (size is 3641bp) master tape.Illustrating that pUBF52 in-vitro transcription thing is the same with BBSV RNA can not only infect host plant, and can also duplicate in pin main body.The in-vitro transcription thing of BBSV infectivity cDNA clone under the control of embodiment 4:T7 promotor infects active Western blot and detects

Inoculate the Chenopodium amaranticolor blade respectively with pUBF52 in-vitro transcription thing and viral RNA, get 0.5-1.0 gram incidence of leaf after 3-4 days, grind in the liquid nitrogen, albumen sample-loading buffer (the 40mM Tris-Cl that adds 300 μ l, pH6.8,10% glycerine, 2%SDS, 5% beta-mercaptoethanol, 0.1% tetrabromophenol sulfonphthalein), vibration back boiling water bath 10 minutes, place cooled on ice immediately, the centrifuging and taking supernatant, after 12.5%SDS-PAGE glue separates, method with electrotransfer moves to protein transduction on the nitrocellulose filter (NC film), goat anti-rabbit igg with specific antiserum(antisera) of the homemade BBSV of contriver and alkaline phosphate ester enzyme labelling is first antibody and second antibody respectively, with NBT and BCIP is chromogenic substrate, pUBF52 in-vitro transcription thing and viral RNA are carried out Western blot detection at the intravital expression product of host plant, the result shows, in the Chenopodium amaranticolor blade of pUBF52 in-vitro transcription thing inoculation, can detect specific band (Fig. 5) with BBSV coat protein size consistent (24.5kDa), illustrate that pUBF52 in-vitro transcription thing can not only infect host plant, and can also in pin main body, duplicate and produce functional protein (as coat protein).BBSV infectivity cDNA clone under the control of embodiment 5:35S promotor infects active Northernblot and detects

According to SEQ ID NO 1 nucleotide sequence, design and synthesize primer BB-26 and BF-6, with pUBF52 is template, carries out pcr amplification (94 ℃ of sex change 1min, 52 ℃ of annealing 1min, 72 ℃ are extended 3min, carry out 30 circulations altogether), the BBSV full-length cDNA of acquisition 3641bp is after the processing of T4DNA Polymerase flush end, the clone enters the BalI site of the expression vector pRT103 that contains 35S promoter, obtains recombinant expression plasmid pRBS2.With the 35S promoter control plasmid pRBS2 down inoculation Chenopodium amaranticolor blade that directly rubs, the while is inoculated the Chenopodium amaranticolor blade respectively with the in-vitro transcription thing of pUBF52 (containing the T7 promotor) and BBSV RNA and compares.Extract the total RNA of blade after 4-5 days, behind the electrophoresis, RNA is transferred on the nylon membrane, according to the described basic experiment method of digoxin test kit, through prehybridization (42 ℃ prehybridization 0.5 hour), hybridization (hybridizing 4 hours for 42 ℃), wash steps such as film and colour developing and carry out Northern blot detection, the result shows that 35S promoter control BBSV infectivity cDNA clone and the BBSV infectivity cDNA of T7 promotor under controlling down clones the same, all the host plant Chenopodium amaranticolor to BBSV has infectivity, illustrate that the infectivity cDNA clone under the 35S promoter control can not only infect host plant, and can also in pin main body, duplicate (Fig. 6).

The sequence of primer BF-6 is: 5 '-GGGCACCTGGAAGACCAGGTA-3 ', and complementary mutually with the 3641-3618nt of SEQ ID NO 1

The sequence of primer BB-26 is: 5 '-AAGAAACCTAACCAGTTTCTCG-3 ', and infect active Northern blot with the corresponding embodiment 6:BBSV of the 1-22nt genome mutation body of SEQ ID NO 1 and detect

According to " molecular cloning experiment guide " described basic experimental methods of molecular biology, the coat protein gene (being positioned at the 2644-3342 base place of SEQ ID NO 1 nucleotide sequence) that will be positioned at BBSV genome 3 ' end is all or part of deleted, has obtained 4 kinds of deletion mutants of BBSV genome---pBDCP, pDCPn100, pDCPc6 and pDCP18 (Fig. 7).Take to make up the identical method of the full genome infectivity of BBSV cDNA clone, make up the infectivity cDNA clone of these 4 kinds of deletion mutants respectively.After the T7 RNA polymerase in-vitro transcription, the in-vitro transcription thing is inoculated Chenopodium amaranticolor respectively, extracts total RNA of inoculation blade after 3-4 days respectively, with α- ³²The terminal non-coding region of BBSV 3 ' of P mark is a probe, carries out Northern blot and detects, and the result shows the infectious clone of total length and the RNA band (Fig. 8) that 4 kinds of deletion mutants all can detect corresponding size.4 kinds of deletion mutants that the BBSV coat protein gene is described not only can be transcribed under the control of T7 promotor, produce to have again and infect active RNA, and can duplicate in pin main body.Embodiment 7: constructed BBSV carrier portability jellyfish green fluorescent protein (GFP) gene is also expressed in plant

Utilize the DNA recombinant technology, foreign gene [is example with jellyfish green fluorescent protein (GFP) gene] is inserted in the constructed BBSV virus vector, detect the reorganization BBSV carrier obtained and whether can carry virus with the gene of external source and in plant, express.

According to " molecular cloning experiment guide " described basic experimental methods of molecular biology, according to SEQ ID NO 1 nucleotide sequence, design and synthesize primer BB-20 and primer BB-21, with pUBF52 is template, carry out the inverse PCR amplification, through agarose gel electrophoresis, reclaim the amplified production of 5.9kb, carry out the flush end processing with the T4DNA polysaccharase again, the target DNA fragment that is obtained comprises carrier pUC18 sequence and the BBSV genome rest part except that coat protein gene (being positioned at the 2644-3342 base place of SEQ ID NO 1 nucleotide sequence).Nucleotide sequence [Cormack, B.P. etc., Gene, 173,33-38 (1996)] according to jellyfish green fluorescent protein (GFP) gene designs and synthesizes primer GFP1 and primer GFP2, obtains complete GFP gene through pcr amplification.Above-mentioned 5.9kb fragment is connected with the GFP fragment, obtains the recombinant plasmid pUB-GFP that jellyfish green fluorescent protein (GFP) gene was controlled and carried to the T7 promotor, wherein the coat protein gene on the BBSV genome is replaced by complete GFP gene.

Take identical strategy, the constructed 35S promoters control BBSV infectivity cDNA down of embodiment 5 is cloned pRBS2 replace transformation, acquisition is by 35S promoter control and carry the recombinant plasmid pRBS-GFP of jellyfish green fluorescent protein (GFP) gene, and wherein the coat protein gene on the BBSV genome is replaced by complete GFP gene.

The plasmid DNA of pRBS-GFP and the in-vitro transcription thing of pUB-GFP are inoculated Chenopodium amaranticolor respectively, carrying out Northern blot with the BBSV genomic probe of digoxigenin labeled and GFP gene probe respectively again after 3-4 days detects, the result shows that BBSV genome in constructed two kinds of BBSV carriers (pRBS-GFP and pUB-GFP) and GFP gene all can transcribe and duplicate in the inoculation plant.Chenopodium amaranticolor blade with the inoculation of laser confocal microscope (Confocal) scanning pUB-GFP in-vitro transcription thing, all can be observed the existence of green fluorescent protein, illustrate that the GFP gene can not only transcribe at two kinds of constructed BBSV virus vector, and can obtain expressing (Fig. 9) along with the genomic expression of BBSV.

The sequence of primer BB-20 is: 5 '-TTATTGACTATACTAGAAAGC-3 ', and complementary mutually with the 2643-2623nt of SEQ ID NO 1

The sequence of primer BB-21 is: 5 '-ATCCCACATCCTGGTGTGG-3 ', and corresponding with the 3342-3361nt of SEQ ID NO 1

The sequence of primer GFP1 is: 5 '-ATGAGTAAAGGAGAAGAA-3 ', and corresponding with the 1-18nt of GFP gene

The sequence of primer GFP2 is: 5 '-TTATTTGTATAGTTCATCC-3 ', and complementary mutually with the 717-698nt of GFP gene

6.SEQ the information sequence feature of ID NO 1:

(A) (length): 3641 base pairs

(B) type: nucleic acid

(C) chain: strand

( D ) ( ) ： ( 1 ) ：cDNA ( 2 ) ：SEQ ID NO 1：1 AAGAAACCTAACCAGTTTCTCGTTGATCAGCGATCATGGATTCAATCCCGTATGTGATCC61 TGCGCATACTCGATTTTATCTTCCACTCCATCTTCTTTCCATCTTTACTCTTTATCATCA121 ACCACAACACCACCATCCTGTGGGCATGTGCCTGTGCCTATGGGTTCTACCGTGCATTCC181 GCCTCATCTTCAAGATAAAGGTGGAAGTACACCCAGCCACCCGAGCCGTCTTCAAGGATA241 TGGTCACTCGCTTCCAGCGGGAGAGTATGTTCTCACCTGACGACGAAGTGCCGGAGGGCA301 TCCCTATCCACGAGGATGTTGACCTTGTTAGCGACCCCACACACAAAGATATTAAGAGGG361 TCCGTGCTAGCAGGCGAGTCTCTTATGCCGTGAGGGTTGCCCATGTAGCCAAGTCTAAGG421 TGGGATTGCTCGCCAATACCAAGGCGAATGAGCTGGTGTACTCCCGTCTTTGCCGAGACG481 AGATGGTTACCCACGGTGTGCGCCCATCGCACATTGCACACGCAGTGCCGCTTGCTGTCG541 CGGCCTGCTTCATACCGTTGGACAGTGATTTCCTTGCAGCTTCTATTAGAAACTGCGATG601 AGATGGAGGAGCGGAGGGCCGTACTAGGGCCCTCATATGGAAAATAGGGAGGCCTACTCT661 GCACCAGCGGGTTTACCACGCCTACTTGGCGTGGTAATCCAGAGGGTTTGCTGGTGAAGA721 GAGGACCACCTCTGGCCAAACCTAGGAAACTGTACCGTTTTTCTGGGTTTGGGACTCATA781 TACGGTACGGAGTGCACGATCACTCATTGGGCAATGTGCGGAAGGGACTTGTTGTGCGGC841 TATTCATGGTTGAAACCAAGGATGGCTTAGCTCCAACACCACAGCCCACCCTGGCGTGTA901 CGCCAAGTTATCCCGGTTTCATGACTGTTAGTGGCCAACCTAACCTCGACCACCAGATTA961 ACATACGAGCATTCTTCGGATTTTATTCTGGTCGCAAATTAGAGAGGTACCAACAGGCCG1021 TGGAGTCGTTAGCAATCCGCCCAATAGGGGTACAGGATGCTGGGCTTAGCACGTGTGTTA1081 AGGCTGAAAAATTAAACATCTCAGCCAAACCCGACCCGGCACCTAGGGTTATTCAGCCTA1141 GGTCGCCGAGGTACAATGTGGAAGTTGGACGGTTCCTCAGACACGCTGAGGAACATCTGT1201 TCGACGCCATCAACCGTGTGTATGGTGGGCGAACGGTATTCAAGGGGTTGAATGCCGATC1261 AGGCTGGCATGGAGATGCAAGCTATGTGGCAAGAATTCGACAATCCTGTGGGTATTGGTA1321 TGGATGCCTCTCGTTTCGACCAACACGTCTCTAAGGAGGCGTTGGAGTTTGAACACAAAA1381 TCTGGCTATCCATGTACCATGGGGCTGACAGGAAAACATTGTCGAAGCTGTTGGGGATGC1441 AAATCCACAACCGCGGTCTTGCCAGATGCCCTGATGGAGAAATCAGGTACACGGTTAAGG1501 GGTGTCGTATGTCTGGGGACATCAACACATCTTCTGGAAACTGCTATATCATGTGTGCTT1561 CGGTGCACAATTATTGCAGCCAGTTGGGTGTCAAGAGATTCAGGCTTGCCAACAATGGTG1621 ATGATTGCATGCTTGTCGTCGAAGCCAAGGATGAAGCACGTGTCAGGCAGGGACTCATCG1681 AGTATTATAGGGAATTGGGTTTCACCATGAAAGTGGAACCTACAGTCTATGAACTCGAGC1741 ACTTGGAGTTTTGCCAGACACGTCCAGTCCTTGTCGATGGGGCATATCGAATGGTGCGCA1801 ATCTTCACCAGGGCATGTGTAAGGATGTTCACTCCTTGCACGATCTTGGTAGTAGGAAAG1861 CTGCTGAAGCTCGGGTTTCAGCGGTTGGTACTGGAGGCCGCGTGATGAATGATGGAGTAC1921 CAGTGCTCAAATCATTCTTCATGCAGTTTCCCCTATCCTCTGGACCTAAAACCAAGTCTG1981 ACATGAGTGTACCGTTGCAGGAAGATTGGAAATACAAATTCAATCGGACTGGGTGTTTCA2041 AGAACTTGGCACCCACTCCACAATCCCGCTACTCATTTTGGCGTGCGTTTGGAGTGCTAC2101 CAGTAGAACAGATTGCCCTGGAGAATGGGTTTTCTCGTCTCAGCTTTGATAAGCTGGACC2161 AGGACACCCAGGAAGAAGTCAGCCTCCTCCAGTTCTCTGGGGCATGAAAACCTAACCACT2221 TTTCATGGAACAACAGCGGAGTGAACAACGTCGTGATCGTAGAGTGAGAAGTAGATCGGA2281 GGACAGGAAGTCTATGTCTGATGTAGGGCAATCTGCTGTCAATAGGGAAGCAGATGTCAA2341 GAAAGATATGGGTCCATCGGTTTCTATGACGGTGGTGGGGGAGAACGTAGAGTTTACACA2401 ACATTTCCACTTCTGAAATGAGCATCATTTATGTCGTACAGGAGAAGCCTTCTGGGTTTC2461 TCGTGTGGGCATTGGTTGTTGCAATTGTGTGCATTATTGGACTCTTATCGTACACTCCAC2521 CTGAAAGACTTAACCACTCTTATCACGAAAACAATCAGAAGACGCAATACATAACTATTG2581 GAGGAGCATCCACTAGTAAAGTTGCCACGAACTGAATTTTCTGCTTTCTAGTATAGTCAA2641 TAAATGGCACCTAAGCGCAATAAAGGAGGCAAGAAGTCCCGCATGTCCGATGAGACAGTG2701 CGGGCTCCTGCTGCAGGAGGCGTTGTACAACGCACACCTGGCATTCCTCCCCGCATTAGG2761 TCCACCACTATTGGTACGCGTGGCACCAACACTGAGCTGCTCGCTGGAGTGAATGTCGCT2821 GCGGCGGGAGCTTTCTCAGTTGTTGGCGCTGGTCTTTTCCCCAGCAACCTTGGTTGGCTC2881 AATGGGATTGCTTCCAATTATAGCAAATTTAGATGGCTTGCTATCAAGCTCATCTACATT2941 CCCATTGTTCCTACCACTACCGCTGGGGCAATGACCATGGCTTTAACGTATGATCCTGCT3001 GATGCTACGCCAACTAGTTTCCAACAAGTGCAACAGATGTATAACAGCATCACAGCACCT3061 GTCTGGGCTGGATTTGATGGAGCTACTGTTCAGCTGCTAGGGGAGAGACCAACAACTGGG3121 GCTGTGTGCATTGATGTGGATGTAAATCGGTTTGGATTTACATGGTACAGGTATGCTACG3181 CTTGCTGCCATTACCGCACTCACTGCAAATGATAGGAATCTTTATATTCCTAGTGTTGGC3241 AATGTGGCTACGTCTGGTGGTACTGCAGCCACCAATGTTGGCAATCTGATGATAAAGTAC3301 AGCATTGAGCTCATTGAGCCAATACCTGCTGCCATTAATTAGATCCCACATCCTGGTGTG3361 GTTAATCCAGTGAAAAATATTAGGAAATCCTTGGGATTCACACCCCAGGGAGGATGGCTT3421 GCATAGTGCAGGTATGTTGAGTTACACTATGAGGTATTGGTGCTGAATCCTGGTAAACAG3481 GCTTGACAGGTTTGGGTTGTTCCAGACCGATGTATTACCCAAGATACTCATGGTACTGTA3541 CTAGAAAACACTATGCGTGCGCACACGGCTGGCTATGTCCTATCATAGCTGGGGGCCCCG3601 GAGTGCGAAACCCTCTTATATACCTGGTCTTCCAGGTGCCC

Claims (7)

1. an isolated cDNA molecule is characterized in that, it comprise with SEQ ID NO 1 in from Nucleotide 1-3641 homology up to 70% nucleotide sequence.

2. the described cDNA molecule of claim 1, (Beet blackscorch virus BBSV), is the rna gene group sequence of BBSV to derive from the shrivelled virus of beet black.

3. plasmid vector, it contains SEQ ID NO 1 nucleotide sequence and is positioned at the T7 promotor of its upstream.It is characterized in that,, the cDNA of BBSV is transcribed outside virosome, produce to have again and infect active BBSV geneome RNA by the effect of T7 promotor.

4. plasmid vector as claimed in claim 3 is characterized in that: utilize the DNA recombinant technology, be inserted into foreign gene complete or in the BBSV genome that sudden change is transformed, and obtain expressing along with the genomic expression of BBSV; And BBSV is when carrying other alien genes, and the replication of self is not affected.

5. plasmid vector, it contains SEQ ID NO 1 nucleotide sequence and is positioned at the CaMV 35S promoter of its upstream.It is characterized in that: by the effect of 35S promoter, the cDNA of BBSV is transcribed in plant materials, produce to have again and infect active BBSV geneome RNA.

6. plasmid vector as claimed in claim 5, it is characterized in that: utilize the DNA recombinant technology, foreign gene is inserted into down complete of 35 promotors control or in the BBSV genome that sudden change is transformed, and obtains expression along with the genomic expression of BBSV; And BBSV is when carrying other alien genes, and the replication of self is not affected.

7. claim 5 or described any one carrier of claim 6 are changed over to the method for plant, foreign gene can be expressed in the transgenic plant that obtained.

Images