CN1472328A - Production of agartose -4, 6 - Google Patents
Production of agartose -4, 6 Download PDFInfo
- Publication number
- CN1472328A CN1472328A CNA031125794A CN03112579A CN1472328A CN 1472328 A CN1472328 A CN 1472328A CN A031125794 A CNA031125794 A CN A031125794A CN 03112579 A CN03112579 A CN 03112579A CN 1472328 A CN1472328 A CN 1472328A
- Authority
- CN
- China
- Prior art keywords
- agarase
- manufacture method
- agarose
- fine jade
- agartose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
A process for preparing neoagarotetraose or neoagarohexaose includes such steps as hydrolyzing the agarose to obtain different types of neoagaroligose, and chromatographic separating to obtain the products with different degrees of polymerization. It features that the transgenic agarase used for said hydrolysis is exprssed by recombinant colibacillus DH5alpha-pET24-agaA. Its advantages are short period and low cost.
Description
Technical field
The present invention relates to a kind of agaropectin oligose, particularly relate to a kind of manufacture method of agartose-4, 6.
Background technology
The agar-agar main chain is by 3 of 1,3 β-D-galactopyranose that connects and 1,4 connection, and 6-inner ether-α-L-galactopyranose alternately is formed by connecting repeatedly.In recent years,, it is found that the agaropectin oligose of different polymerization degree had important pharmaceutical use,, be expected to develop into marine drug of new generation as antitumor, anti-ageing, prevent diabetes etc. along with the develop rapidly of glycobiology and chemical research.Traditional agaropectin oligose preparation method is the chemical diluent acid-hydrolysis method of agar-agar, and the condition of this method is wayward, and cracked molecular weight of product heterogeneity, and the productive rate of the pure product of oligosaccharides is not high.Specificity with agarase edman degradation Edman substrate is strong, and technology is easy to control, helps the preparation of single oligosaccharide, for condition has been created in the research and the application and development of the structure activity relationship of agaropectin oligose.Therefore, the traditional chemical degradation method of enzyme liberating method replacement prepares agaropectin oligose has become trend.Different agarases according to the mode of action can be divided into α-agarase and β-agarase two big classes, and the former cracking α-1,3 glycosidic link generates fine jade oligosaccharides series; Latter's cracking β-1,4 glycosidic link generates new fine jade oligosaccharides series.But the agarase that obtains from marine microorganism so far is because active low, and poor specificity has seriously hindered the structure activity study of agarose compounds and even carrying out in a deep going way of further application and development.Up to the present, realize the isolating β-agarase (Morrice from Pseudomonas atlantica that has only of industrialization production, 1983), but produce new fine jade oligosaccharides cost height, cost an arm and a leg with it, range of application also only limits in the scientific effort, has hindered the exploitation and the application of agar oligosaccharide greatly.
Summary of the invention
The object of the present invention is to provide a kind of manufacture method of agartose-4, 6, it can remedy
The above-mentioned deficiency of prior art.
A kind of manufacture method of agartose-4, 6, comprise the new fine jade oligosaccharides that agarose is hydrolyzed to different sizes, and with the new fine jade oligosaccharides of chromatographic separation different polymerization degree, it is characterized in that the agarase that described hydrolysis is used expressed by intestinal bacteria recombinant strain DH5 α-pET24-agaA.
The agarase that the present invention uses is transgene product, can obtain in a large number, and it is 4,6 new fine jade oligosaccharides that enzymolysis product 85%-95% concentrates on the polymerization degree, and action time is short, and mild condition is with low cost, is suitable for scale operation.
Embodiment
1 can efficiently express the structure of the intestinal bacteria recombinant strain DH5 α-pET24-agaA of agarase
According to agarase gene agaA complete sequence design upstream primer (5 ' GGAATTCCATATGAAAGGATTCACTAAG3 ') and downstream primer (5 ' CCGCTCGAGCTGGAATTTAAAACGTTG3 '), total DNA with the other Zymomonas mobilis CY24 of vacation is a template, utilizes pcr amplification to obtain agarase gene complete sequence.The condition of this PCR is: 94 ℃ of pre-sex change 3min, carry out 30 circulations with 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 60s subsequently, and extend 10min at 72 ℃ at last.Agarose electrophoresis shows that there is a specific band at the 1.36kb place, it downcut is reclaimed the back and coli expression carrier pET-24a (+) is connected from sepharose, to connect product according to the Calcium Chloride Method of standard and change among the intestinal bacteria E.coli DH5 α, screening has the transformant of amicillin resistance.Alkaline lysis method of extracting plasmid with standard, cut through NdeI and XhoI enzyme and to obtain 1.36kb and two fragments of 5.3kb, identical with agarase gene agaA full length fragment respectively with expression vector pET-24a (+) size, proof agarase full length sequence has been cloned among the expression vector pET-24a (+), has obtained to efficiently express the intestinal bacteria recombinant strain DH5 α-pET24-agaA of agarase.
The preparation of 2 agarases
The above-mentioned intestinal bacteria recombinant strain DH5 α-pET24-agaA mono-clonal of picking is seeded in 2ml and contains in the liquid LB substratum that concentration is 30 μ g/ml kantlex, and 37 ℃ of 200r/min shaking culture are spent the night.Be seeded to 100ml by 1: 50 volume ratio and contain in the liquid LB substratum that concentration is 50 μ g/ml kantlex, 37 ℃ of 200r/min shaking culture are to OD
600Be 0.4-1.0, adding IPTG is 1mM to final concentration, and 3h is cultivated in continuation, and 4 ℃ of centrifugal 30min of 5000 * g collect supernatant liquors.In ice-water bath, progressively add saturation ratio and be 60% solid ammonium sulfate powder, and add rotor and stir, adding the back continues to stir 1 hour, in 12000 * g, 4 ℃ of centrifugal 15min, collecting precipitation promptly gets agarase enzyme liquid with 0.2M phosphate buffered saline buffer (pH7.0) dissolving of original fermented solution 1/10th volumes, is stored in-20 ℃.
The manufacturing of 3 agartose-4, 6s
The agarose water is made into the colloidal sol that concentration expressed in percentage by weight is 0.1-0.5, add the above-mentioned agarase enzyme of 0.5%-2% (volume percent) liquid, in 25 ℃-40 ℃ incubation 1-12 hour, it is back with 10000 * g to spend the night in 4 ℃, 4 ℃ of centrifugal 10min, it is 0.22 μ m or 0.45 μ m millipore filtration that supernatant liquor is crossed the aperture, rotary evaporation dissolves with the 0.2-0.5M ammonium hydrogencarbonate aqueous solution to doing the back, separate in the enterprising circumstances in which people get things ready for a trip spectrum of Bio-Gel-P2, elution buffer is the 0.2-0.5M ammonium hydrogencarbonate aqueous solution, obtain the new fine jade oligosaccharides of different polymerization degree, through desalination respectively, after the freeze-drying, be oligosaccharides product of the present invention, wherein new fine jade tetrose productive rate is 30%, new fine jade six sugar yields are 32%, and purity all reaches more than 95%.
Claims (5)
1, a kind of manufacture method of agartose-4, 6, comprise the new fine jade oligosaccharides that agarose is hydrolyzed to different sizes, and with the new fine jade oligosaccharides of chromatographic separation different polymerization degree, it is characterized in that the agarase that described hydrolysis is used expressed by intestinal bacteria recombinant strain DH5 α-pET24-agaA.
2, manufacture method as claimed in claim 1 is characterized in that described agarose is made into the colloidal sol of 0.1%-0.5%, reacts in water-bath after adding agarase enzyme liquid.
3, manufacture method as claimed in claim 1 is characterized in that the preliminary purification product that a described agarase is the transgenosis agarase, and its consumption is the 0.5%-2% of agarose sol volume.
4, manufacture method as claimed in claim 1, described chromatographic separation is a filler with Bio-Gel-P2, is elutriant with the ammonium hydrogencarbonate.
5, manufacture method as claimed in claim 1 is characterized in that described enzyme digestion reaction temperature is 25 ℃-40 ℃, reaction times 1-12 hour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03112579 CN1243104C (en) | 2003-06-17 | 2003-06-17 | Production of agartose -4, 6 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03112579 CN1243104C (en) | 2003-06-17 | 2003-06-17 | Production of agartose -4, 6 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1472328A true CN1472328A (en) | 2004-02-04 |
| CN1243104C CN1243104C (en) | 2006-02-22 |
Family
ID=34152499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03112579 Expired - Fee Related CN1243104C (en) | 2003-06-17 | 2003-06-17 | Production of agartose -4, 6 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1243104C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194435A (en) * | 2013-04-09 | 2013-07-10 | 中国海洋大学 | Beta-agarase and applications thereof |
| CN104498563A (en) * | 2015-01-15 | 2015-04-08 | 福建省绿麒食品胶体有限公司 | Gracilaria agaro-oligosaccharide and preparation method thereof |
| CN105506032A (en) * | 2016-02-25 | 2016-04-20 | 福建省绿麒食品胶体有限公司 | Preparation method and application of Gracilaria agar oligosaccharide promoting growth of Lactobacillus bulgaricus |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102214973B1 (en) * | 2019-06-04 | 2021-02-10 | 다인바이오 주식회사 | Manufacturing method of agar for raw material of neoagarooligosaccharide mixture and use thereof |
-
2003
- 2003-06-17 CN CN 03112579 patent/CN1243104C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194435A (en) * | 2013-04-09 | 2013-07-10 | 中国海洋大学 | Beta-agarase and applications thereof |
| CN103194435B (en) * | 2013-04-09 | 2014-07-09 | 中国海洋大学 | Beta-agarase and applications thereof |
| CN104498563A (en) * | 2015-01-15 | 2015-04-08 | 福建省绿麒食品胶体有限公司 | Gracilaria agaro-oligosaccharide and preparation method thereof |
| CN105506032A (en) * | 2016-02-25 | 2016-04-20 | 福建省绿麒食品胶体有限公司 | Preparation method and application of Gracilaria agar oligosaccharide promoting growth of Lactobacillus bulgaricus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1243104C (en) | 2006-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295043B (en) | Alginate lyase, and preparation method and application thereof | |
| Inoue et al. | Characterization of an alginate lyase, FlAlyA, from Flavobacterium sp. strain UMI-01 and its expression in Escherichia coli | |
| CN107641621B (en) | Glycosidase composition and method for preparing icariin by enzyme method | |
| AU2020327339B2 (en) | Method for synthesizing lacto-N-biose | |
| CN104312996B (en) | Alpha-L-rhamnosidase Rha1 as well as expressed gene and application of alpha-L-rhamnosidase Rha1 | |
| Singh et al. | Enzymatic approaches for the synthesis of high fructose syrup | |
| CN105441415B (en) | A kind of preparation method and applications of Pullulan enzymatic mutant PulB-d99-D436H | |
| CN108588149B (en) | A fructus crataegi syrup and its preparation method | |
| JP4998991B2 (en) | Method for producing cellulase | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN116640744B (en) | Chitosanase OUC-CsnA4-S49I, application thereof and method for preparing chitosan oligosaccharide | |
| CN105274153B (en) | Method for increasing yield of itaconic acid produced by fermenting aspergillus terreus | |
| CN108384769B (en) | High-temperature-resistant complex enzyme and application thereof | |
| CN103160483B (en) | Beta-glucosidase, as well as expression gene and application thereof | |
| CN104004732B (en) | A kind of chitosanase and its preparation method and application | |
| CN1243104C (en) | Production of agartose -4, 6 | |
| CN112980815B (en) | alpha-L-fucosidase OUCJdch-16 and application thereof | |
| CN101979644A (en) | Method for preparing N-acetylneuraminic acid by one-step catalysis of fusion protein | |
| CN112795605A (en) | Method for preparing glucosamine through enzyme catalysis | |
| Lou et al. | Purification and Characterization of a Novel α-L-Rhamnosidase from Papiliotrema laurentii ZJU-L07 and Its Application in Production of Icariin from Epimedin C | |
| CN112592914A (en) | Special green alga polysaccharide lyase and production process thereof | |
| CN115141841A (en) | Pichia pastoris mutant strain and application thereof in production of alginate lyase | |
| CN113736762B (en) | alpha-L-rhamnosidase mutant and application thereof in preparation of pullulan | |
| CN115851469A (en) | Pichia pastoris strain for high yield of alginate lyase | |
| CN111471667B (en) | Chitosanase Csn-PT and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060222 |