CN1472324A - Encoding DNA sequence and amino sequence of sunflower gama tocopherol methyl transferases and use thereof - Google Patents

Abstract

A DNA sequence and amino acid sequence for coding the gamma-tocophenol methyltransferas of sunflower, the plant, yeast or bacterium as the expression carrier of said sequences, the plant cells transferred from said plant expression carrier, their transgenic plants and progeny bacteria with high alpha-tocopherol level, the yeast or bacteria transferred from said expression carrier, and the gamma tocopherol methyltransferase of sunflower generated by said yeast or bacteria are disclosed.

Description

Dna sequence dna and the aminoacid sequence and the application thereof of coding sunflower gama tocopherol methyl transferases

The technical field biological technical field.

The background technology vitamin-E be a class by photosynthetic organism synthetic fat-soluble antioxidants such as plants, be the essential nutritional factor of humans and animals.V _ECan protect unsaturated fatty acids in the cytolemma to avoid the destruction of free radical, this performance for multiple important physical function in the humans and animals body is significant, for example, keep normal immunologic function, reduce the murder by poisoning of metal, ozone and smoking, influence prostaglandin(PG) and arachidonic metabolism, suppress (Skrypin and Kagan, Biochem.Biophys.Acta 815:209 1995 such as hematoblastic aggegation; Kagan, N.Y.Acad.Sci.p121,1989; Gomez-Fernandez et al., Ann.N.Y.Acad.Sci.p109,1989).V _EShortage and multiple disease-related, as immune deficiency, cancer, cardiovascular disorder, cataract, sacroiliitis etc.

People find have 8 kinds to have different V from photosynthetic organism _EActive molecule, be respectively α-, β-, γ-, Delta-Tocopherol (tocopherols) and corresponding tocotrienols (tocotrienols), the wherein activity of alpha-tocopherol the highest (seeing Table 1).Although human body is identical to the absorption of various tocopherols, have only alpha-tocopherol can optionally be kept and be distributed in the human body whole body.Studies show that alpha-tocopherol accounts for more than 90% of total tocopherol in animal body, so alpha-tocopherol the most important concerning humans and animals (Traber and Sies, Annu.Rev.Nutr.16:321-347,1996).The unknown d-δ of the relative biological activity of biological activity kind (%) d-α-Tocopherol 100d-β-Tocopherol 50d-γ-Tocopherol 10d-δ-Tocopherol 3d-α-Tocotrienol 30d-β-Tocotrienol 5d-γ of table 1. tocopherol and tocotrienols-Tocotrienol-Tocotrienol the unknown

V _EThe intake that recommend every day is 10-13.4IU (a 7-9mg alpha-tocopherol).In general, contained V in the vegetable food of every day _ECan satisfy above requirement.Yet studies show that, take in an amount of V more every day _E(100-1000IU) can reduce the generation of cardiovascular disorder and certain cancers, improve body's immunological function, slow down the development of some chronic diseases.Obviously, common food can not provide so a large amount of V _E

At present, the medicinal V of people _EBe to extract purifying from vegetables oil such as soybean mostly, price is higher.Therefore, every day oral supplementation V _EBe not that most of people can bear.

Alpha-tocopherol is a lipophilic molecule, so the main source of the vegetables oil tocopherol that to be people required.About 60% V in the diet _EDerive from vegetables oil.But it is found that, the ratio of alpha-tocopherol is lower in the various plants oil, the content of its biosynthetic precursor Gamma-Tocopherol is but than higher (seeing Table 2), this shows catalysis alpha-tocopherol synthetic final step key enzyme gama-tocopherol methyl transferase (γ-tocopherol methyltransferase, the content in these tissues of γ-TMT) or active low.Therefore overexpression γ-TMT may improve the content of alpha-tocopherol.This achieves success in transgenic arabidopsis.

1998, David Shintani and Dean DellaPenna cloned the γ-TMT gene of Arabidopis thaliana first.They use the EST library of γ-TMT protein sequence search Arabidopis thaliana of photosynthetic bacterium Synechocystis PCC6803, have obtained the Arabidopis thaliana EST clone 165H5T7 of homology 66%, and the expression product of EST 165H5T7 in intestinal bacteria has γ-TMT activity.Obtained the γ-TMT gene of Arabidopis thaliana thus.

The γ of Arabidopis thaliana-albumen of being made up of 348 amino acid of TMT genes encoding, (this is relevant with its methyl transferase activity for S-adenosylmethione, SAM) binding site wherein to contain 2 S-adenosylmethionines.In addition, infer chloroplast transit peptides of being made up of 47 amino acid of its aminoterminal band, this may be relevant with the anabolism of alpha-tocopherol in the plant chloroplast.But γ-TMT is catalysis gama-tocopherol methyl generation alpha-tocopherol not only, but and catalysis Delta-Tocopherol generation 5,8-dimethyl tocol.

David Shintani and Dean DellaPenna place the γ-TMT gene of Arabidopis thaliana arabidopsis thaliana transformation under the driving of seed-specific expression promoter DC3.Make the alpha-tocopherol content in the Arabidopis thaliana seed that changes γ-TMT gene improve more than 80 times, the V in the seed than the contrast of changeing empty plasmid pDC3 _EActivity is 9 times of contrast seed.This is for improving other plant V _EContent provides a valid approach.

Contain abundant alpha-tocopherol in the summary of the invention sunflower oil, account for 96% (table 2) of total tocopherol.Therefore, Sunflower Receptacle may exist active stronger γ-TMT or its γ-TMT high-caliber expression.For this reason, the present invention clones γ-TMT gene from Sunflower Receptacle, provides gene for improveing other crop quality.

The ratio of different bearing phenol and tocotrienols (%) in table 2. plant tissue and the oil

α-T β-T γ-T δ-T α-T-3 β-T-3 γ-T-3 δ-T-3 Sunflower Receptacle ¹(seed oil) 96 2 2-----cottonseed ¹(seed oil) 40-58 1----Semen Brassicae campestris ²(seed oil) 25-75-----peanut ²(seed oil) 33-67-----corn ²(seed oil) 22 3 68 7----corn ²(Wholegrain) 11-69-4 7 9-soybean ¹(seed/oil) 71 70 22----wheat germ ¹(oil) 72 25---3--palm ¹(seed/oil) 25---30-40 5 paddy rice ²(Wholegrain) 50-50-----romaine lettuce ¹(leaf) 53-47-----Cauliflower ²44-56-----

Annotate: T and T-3 represent tocopherol and tocotrienol respectively.( ¹McLaughlin，P.J，Weihrauch，J.c.”Vitamin?E?content?of?foods”，J.Am.Diet.Ass.75：647-665，1979 ²Bauernfein，J.“Tocopherols?in?foods”，In?Vitamin?E：A?Comprehensive?Treatise，L.J?Machlin?ed.，MarcelDekker，Inc.New?York?pp99-168)

Soybean, rape, cottonseed, peanut, corn, wheat germ are main edible oil sources.As can be seen from Table 2, the content of alpha-tocopherol is lower in the soybean oil, and instrument is 7% of total tocopherol, and its precursor Gamma-Tocopherol but is 10 times of alpha-tocopherol, therefore account for 70% of total tocopherol, import γ-TMT gene and may significantly improve VE level in the soya-bean oil.Also but the Delta-Tocopherol of catalysis content 22% is transformed into active higher 5,8-dimethyl tocol (biological activity 50% sees Table 1 relatively) simultaneously.V in the while soya-bean cake _EThe raising of level also will increase its nutritive value as feed.In like manner, γ-TMT gene of the promoters driven of seed-specific expression promoter or constitutive expression is imported the V that rape, cottonseed, peanut, corn, wheat then can improve these edible oils _ELevel.γ-TMT gene importing paddy rice, romaine lettuce, Cauliflower then can be improved the V of grain, vegetables _ELevel.

In addition, sunflower gama-TMT also may be used for the conversion of external Gamma-Tocopherol.Such as synthetic V _EIn the process, utilize in sunflower gama-TMT catalysis synthetic product Gamma-Tocopherol, improve V to the conversion of alpha-tocopherol _ELevel.

The present invention has synthesized primer Primer1 (SEQ NO3), Primer2 (SEQ NO4) according to the sequence of known Arabidopis thaliana and purple perilla γ-TMT gene according to the sequences Design of conserved regions.(with 10 days seedling leaves of Sunflower Receptacle is material with Sunflower Receptacle cDNA library, Smart cDNA Library Construction Kit test kit with Clontech company makes up) be template, with primer CDSIII/3 ' PCR Primer (SEQ NO5) in the test kit and Primer1 (SEQ NO3), 5 ' PCR Primer (SEQNO6) and Primer2 (SEQ NO4) carry out pcr amplification, have obtained 3 ' end and 5 ' terminal sequence of sunflower gama-TMT gene respectively.Obtained γ-TMT gene (SEQ NO1) of Sunflower Receptacle thus.

The γ of Sunflower Receptacle-TMT genes encoding head of district 1026bp, 342 amino acid (SEQ NO2) of encoding.It comprises chloroplast(id) localization signal peptide and mature protein coding region and 27 amino acid whose unknown function sequence three parts of N end of C end.The homology of its maturation protein aminoacid sequence and Arabidopis thaliana γ-TMT gene mature protein coding region reaches 72.3%.

Being suitable for γ-TMT gene in plant of the present invention or the bacterial expression vector starts the promotor that this DNA sequences encoding transcribes and comprises composing type, induction type, tissue or organ specificity or specific promotor of etap in vegetable cell, yeast and bacterium.For example, they include but not limited to cauliflower mosaic virus (CaMV) 35S or 19S promotor, Radix Dauci Sativae embryo specific expression promoter DC3, mannopine synthetic enzyme (MAS) promotor, rouge alkali synthetase and octopine synthase promoter, maize alcohol dehydrogenase promotor, diphosphoribulose carboxylase/oxygenase small subunit promotor and the Ubi that is suitable for expressing, Emu, ActinI promotor etc. in monocotyledons; Promotors such as the GAL1 that expresses in the yeast, CUP1, PGK, AOX1, GAP; The P that expresses in the bacterium _E, promotor such as tac, trc, T7.

In addition, also should comprise the terminator that is derived from cauliflower mosaic virus or rouge alkali synthetase (Nos) gene or other genes on γ of the present invention-TMT gene efficient plant expression vector being applicable to.

Use methods known in the art, can be with the γ that is suitable in vegetable cell, yeast and bacterium, expressing provided by the invention-TMT gene construct, be connected to any can the carrier of self-replacation in vegetable cell, yeast or bacterial cell on.Such carrier comprises and for example is derived from colibacillary plasmid vector pUC18, pUC19 (Yanisch-perron etc., Gene, 33:103-119,1985), plant expression vector pBI101, the pBI121, (Jefferson etc. of pBI131 system, EMBO J., 16:3901,1987) and pCAMBIA1301 (Hajdukiewicz etc., Plant Mol Biol, 25:989-994,1994; Hiei etc., The Plant J., 6:271-282,1994) etc.; Yeast expression carrier pYES2, pYEX, pA0815, pPIC3.5K, pPICZ/ α, pGAPZ/ α; Bacterial expression vector pLEX, pKK223-2, pET-5, pEZZ18, pRSET, pMAL, pGEX etc.

Certainly, as previously mentioned, select and identify for correct, but above-mentioned recombinant expression vector of the present invention also should contain selectable marker gene by the plant transformed cell.The both sides of employed selectable marker gene can have adjusting sequence separately, to impel their expression in plant.The selective marker that is suitable for is known in the art.Foreign gene and other genes of coding selective marker can be contained in the same expression vector, perhaps are contained in when transforming in the simultaneously applied different carriers.

Should be pointed out that every application γ described in the invention-constructed any expression vector of TMT gene includes within the present invention.These expression vectors comprise following implementation:

1), makes up the expression vector of multivalent genetic and change plant, yeast or bacterium over to other one or more gene recombination;

2) with other one or more gene fusion, construction of expression vector also changes plant over to, yeast or bacterium;

3) collaborative mutually with other one or more genes, make up plant or bacterial expression vector respectively, import same kind of plant, yeast or bacterial receptor simultaneously or step by step.

For in vegetable cell, express external source γ-TMT gene in the particularly whole strain plant, to improve whole strain plant and seed and offspring's tocopherol content, must use appropriate means will carry in the recombinant expression vector conversion of γ-TMT gene or transduce appropriate host cell or the plant materials.

With recombinant vectors importing host plant or its intracellular many methods of carrying foreign gene all is well known to those skilled in the art.These methods include, but are not limited to: 1) agriculture bacillus mediated conversion method (Agrobacterium-mediatedtransformation); 2) physics method is as particle bombardment (Particle bombardment or Particle gun or Genegun), electric shocking method (Electroporation), microinjection (Microinjection), supersonic method (Ultrasonic), laser microbeam method (Laser microwave), silicon carbide fiber mediated method (Silicon carbide fiber), electrophoretic method (Eleetrophoretic transfection) etc.; 3) chemical method is as the conversion method of PEG mediation, liposome-mediated conversion method etc.; 4) germplasm system conversion method is as pollen-mediated method, pollen tube passage method (ovary injection), infusion method etc.; 5) with conversion methods that virus vector was mediated such as cauliflower mosaic virus (CaMV), geminivirus infection (Geminiviruses) or RNA viruses etc.

Therefore, γ-the dna sequence dna of TMT gene, aminoacid sequence the present invention relates to encode, the high-efficiency plant and the bacterial expression vector that comprise said dna sequence dna, with the method for said expression vector transformed plant cells, tissue and whole strain plant and bacterium, and the transgenic plant of consequent tocopherol content and the yeast or the bacterium that can produce sunflower gama-TMT.

The invention provides and obtain high V _EThe method of plant, this method comprises:

1) makes up the plant expression vector that comprises said γ-TMT gene;

2) with any feasible method the plant expression vector that obtains in the step 1) is imported in the vegetable cell, and thus obtained transgenic plant and offspring thereof, comprise the vegetables oil that plant organ, tissue and the seed and products thereof of any part change as alpha-tocopherol content.

Therefore, use plant, yeast or the bacterial expression vector of γ of the present invention-TMT gene, import in any plant tissue or cell, yeast or the bacterium with any method well known by persons skilled in the art, and transgenic plant that obtain therefrom and offspring's seed and plant part and transformed yeast or bacterium thereof, include within the present invention.Do the parent with these transgenic plant,, also include within the present invention by plant, strain or the kind of hybridizing or transformation produced.

The clone of clone's 1.1 sunflower gamas of embodiment embodiment 1, sunflower gama-TMT gene-TMT gene 3 ' terminal sequence

With Sunflower Receptacle cDNA is template, uses primer CDSIII/3 ' PCR Primer (SEQ NO5) and Primer1 (SEQ NO3) to increase, and reaction conditions is:

94 ℃ 2 minutes (1 circulation)

94 ℃ 30 seconds, 54 ℃ 30 seconds, 72 ℃ 1 minute 30 seconds (36 circulations)

72 ℃ 10 minutes (1 circulation)

Amplified production separates with agarose electrophoresis, reclaims the purpose band, is connected with pMD18-T carrier (Takara company) and checks order.1.2 the clone of sunflower gama-TMT gene 5 ' terminal sequence

With Sunflower Receptacle cDNA is template, increases with primer 5 ' PCR Primer (SEQ NO6) and Primer2 (SEQ NO4), and reaction conditions is:

94 ℃ 2 minutes (1 circulation)

94 ℃ 30 seconds, 54 ℃ 30 seconds, 72 ℃ 1 minute 30 seconds (36 circulations)

72 ℃ 10 minutes (1 circulation)

Amplified production separates with agarose electrophoresis, reclaims the purpose band, is connected to pMD18-T carrier and order-checking.1.3 the acquisition of sunflower gama-TMT gene order

5 ' terminal sequence and the splicing of 3 ' terminal sequence are promptly got sunflower gama-TMT gene order.

According to sunflower gama-TMT gene complete sequence design primer Primer3 (SEQ NO7) and Primer4 (SEQ NO8), and increase, reaction conditions is:

94 ℃ 2 minutes (1 circulation)

94 ℃ 30 seconds, 54 ℃ 30 seconds, 72 ℃ 1 minute 30 seconds (36 circulations)

72 ℃ 10 minutes (1 circulation)

Amplified production separates with agarose electrophoresis, reclaims the purpose band, is connected to pMD18-T carrier and order-checking, and choosing is the clone correctly, called after pTMT.The structure of embodiment 2, γ-TMT gene plant expression cassette

Comprise following gene expression regulation element in the constructed γ-TMT expression casette of present embodiment: CaMV 35S promoter, the enhanser that doubles, Ω sequence and the Kozak sequence of 5 ' end, the multi-joint terminator sequence of 3 ' end, cutting sequence, NOS terminator.PTMT cuts through PstI and SmaI enzyme, and recovery γ-TMT gene fragment (about 1050bp) is also cloned between the PstI and HpaI site of pTQ4A.Recombinant plasmid called after pT Ω 4A-TMT.The structure of embodiment 3, γ-TMT gene plant expression vector:

PT Ω 4A-TMT reclaims fragment cloning between the corresponding site of pBI121 with EcoRI and HindIII double digestion, obtains plant expression vector pBTMT.Here it is constructed γ-TMT gene plant expression vector pBTMT.Embodiment 4, freeze-thaw method transform agrobacterium tumefaciens: 1. the single bacterium colony of picking Agrobacterium LBA4404 from the flat board, be inoculated in 5ml YEB substratum, and 28 ℃, 250rpm shake the bacterium overnight incubation; 2. get 2ml bacterium liquid, add 50ml YEB substratum, 28 ℃, 250rpm shake bacterium and are cultured to OD ₆₀₀About 0.6; 3. bacterium liquid is gone in the 50ml centrifuge tube, ice bath 30 minutes, 5000rpm is centrifugal 5 minutes then; 4. abandon supernatant, precipitation 2ml 20mM CaCl ₂Suspend, every part of 100ul branch installs in the 1.5ml centrifuge tube, preserves standby in the liquid nitrogen; 5. get 2ug pBTMT plasmid DNA, join in the 100ul competent cell, mixing, ice bath 5 minutes; 6. centrifuge tube was put in the liquid nitrogen freezing 5 minutes, and gone in 37 ℃ of water-baths temperature rapidly and bathed 5 minutes; 7. add 1ml YEB substratum, 28 ℃, 250rpm shake bacterium and cultivated 4-5 hour; 8. get an amount of bacterium liquid and coat and contain on the antibiotic YEB flat board, cultivated 24-48 hour for 28 ℃.Embodiment 5, Agrobacterium tumefaciens mediated transformation of tobacco: the 1. activation of Agrobacterium: the single bacterium colony of picking Agrobacterium from the flat board, be inoculated into 5ml YEB liquid nutrient medium (Kan 100mg/L, pH5.5) in, thermal agitation is cultured to OD ₆₀₀Be 0.4～0.5 (about 3～4h), the centrifugal 5min of 5000rpm, thalline is resuspended with MS liquid nutrient medium (pH5.8), to OD ₆₀₀Be 0.1～0.2; 2. cultivate altogether: the leaf piece that will infect is placed on the tobacco bud division culture medium (MS+IAA 0.5mg/L+6-BA 2mg/L) that is covered with 2 metafiltration paper, 25 ℃ of dark cultivations 4 days; 3. the screening of resistant buds: will transfer on the resistant buds screening culture medium (MS+IAA 0.5mg/L+6-BA 2mg/L+Kan 100mg/L+Carb 500mg/L) through the tobacco explant of cultivating altogether, and can sprout after 2～3 weeks; 4. take root: when treating resistant buds length, it is transferred on the root media (MS+Kan 100mg/L+Carb 500mg/L), promptly have adventive root to form after 1～2 week to the 1cm left and right sides.Expression and the enzyme biopsy of embodiment 6, γ-TMT gene in intestinal bacteria surveyed:

With primer Primer5 (SEQ NO9) and Primer6 (SEQ NO10), with pTMT is the coding region that template amplification obtains the TMT maturation protein, and amplified production is cut rear clone between the corresponding site of coli expression carrier pREST A (invitrogen company) through XhoI and EcoRI enzyme.Obtain prokaryotic expression carrier pRTMT.With its transformed into escherichia coli BL21 (DE3).With the negative contrast of empty expression vector pREST A.Positive bacteria through 37 ℃ of shaking culture to OD ₆₀₀Be 0.6 o'clock, adding IPTG is 1mmol/L to final concentration, and the thalline of centrifugal collection 500mL nutrient solution is resuspended in 5mL ultrasonic wave damping fluid (10mmol/L HEPES pH7.8 behind 37 ℃ of abduction delivering 3h; 5mmol/L DTT; 0.24mol/L sorbitol; 1mmol/LPMSF), use ultrasonic disruption instrument smudge cells on ice.Add TritonX-100 in the homogenate to final concentration 1%, put 30min on ice after, 4 ℃ 30, the centrifugal 30min of 000g gets supernatant and is used for the enzyme biopsy and surveys.

50mmol/L Tris is arranged, pH8.5 in the 125uL enzyme biopsy survey system; 5mmol/L DTT; 0.64mmol/L γ-tocopherol; 1.28mmol/L SAM, sample 60ul, the chloroform of adding 500ul 2: 1 (v/v) behind 25 ℃ of incubation 1.5h: the physiological saline stopped reaction of methyl alcohol (containing the 1mg/mL butylated hydroxytoluene) and 125uL 0.9%.With centrifugal behind the violent vortex 1min of sample, change lower floor's chloroform over to new pipe and vacuum place to go chloroform mutually, with 20uL acetic acid ethyl dissolution exsiccant fluid, point sample is educated on the TLC plate (gel GF 254 plate), exhibition layer in methylene dichloride.Drying at room temperature TLC plate is observed chromatogram down in UV-light (253nm).

In enzymatic reaction 0,20,40,60,80,100, behind the 120min, take out the 20uL reaction solution respectively, stopped reaction and carry out thin-layer chromatography and separate is indicated the position corresponding to the alpha-tocopherol bands of a spectrum under UV-light as stated above.Scrape and reach each band, add the vibration of 2mL dehydrated alcohol, leave standstill 5min, 12, the centrifugal 5min of 000g changes supernatant liquor over to cuvette, and in cup, respectively add 0.5% α, α '-two pyridine solution 0.5mL and 0.2% three greening ferrous solution 0.5mL, mixing is measured the absorption value (seeing Table 3) of 520nm after adding three greening iron 2min.

The spectral absorption value that table 3. γ-TMT enzyme biopsy is surveyed

0min 20min 40min 60min 80min 100min 120min

A ₅₂₀/pRTMT 0 0.0354 0.0646 0.0977 0.096 0.0951 0.0947

A ₅₂₀/pRESTA 0 0.0020 0.0023 0.0021 0.0023 0.0026 0.0023

From the light absorption value of 520nm as can be seen, in containing the reaction solution of γ-TMT, along with the carrying out of reaction, A ₅₂₀Value increases gradually, reaches the highest during to 60min, slightly descend afterwards, and control group does not have this variation.This shows that the γ-TMT that expresses in the bacterium has participated in the methylation reaction of Gamma-Tocopherol, has enzymic activity.

DNASEQ NO1 ( γ-TMT ) ：1 GCCCATTACG GCCGGGGACG TGCCATTGTT GACACACGTC ACCACCACCA CCGCCAAATT61 CACCACTCAC TCACACAACC TGCTATGGCT ACGACGGCAG TTGGCGTATC GGCGACGCCG121 ATGACGGAGA AGCTGACGGC GGCAGATGAT GACCAGCAGC AGCAGAAGCT CAAAAAAGGA181 ATCGCAGAGT TCTACGACGA ATCCTCAGGT ATGTGGGAGA ACATATGGGG AGAACACATG241 CATCACGGAT ATTATAACTC CGACGACGTC GTTGAACTCT CCGATCACCG TTCTGCTCAG301 ATCCGTATGA TTGAACAAGC CCTAACGTTC GCCTCTGTTT CAGATGATCC GGAAAAGAAA361 CCTAAAACCA TAGTTGATGT CGGGTGTGGT ATAGGAGGTA GCTCAAGGTA TCTAGCAAGA421 AAATACGGAG CCGAATGTCA CGGAATCACC CTCAGCCCTG TGCAAGCTGA GAGAGNTAAT481 GCCCTTGCTG CGGCCCAAGG GTTGGCCGAT AAGGTTTCAT TTCAAGTTGC TGATGCTTTA541 AACCAGCCGT TTCCTGATGG AAAGTTTGAC CTTGTTTGGT CAATGGAGAG TGGAGAGCAC601 ATGCCTGACA AACTTAAGTT TGTTAGTGAG TTGACTCGGG TGGCTGCCCC CGGAGCCACC661 ATTATCATAG TTACATGGTG CCACAGAGAT CTTAACCCCG GAGAAAAATC CCTTCGCCCC721 GAGGAAGAAA AAATCTTGAA TAAGATTTGT TCCAGCTTTT ATCTTCCCGC TTGGTGTTCT781 ACAGCTGATT ATGTAAAGTT ACTAGAATCC CTTTCTCTTC AGGACATAAA ATCCGCAGAC841 TGGTCTGGCA ATGTGGCCCC ATTTTGGCCT GCTGTAATAA AAACAGCATT GTCTTGGAAG901 GGCATTACTT CATTGCTACG TAGTGGTTGG AAGTCCATAA GAGGGGCAAT GGTAATGCCA961 CTAATGATTG AAGGATTTAA GAAGGATGTA ATAAAATTCT CCATCATTAC ATGCAAAAAG1021 CCTGAATAASEQ NO2 ( γ-TMT ) ：1 AHYGRGRAIV DTRHHHHRQI21 HHSLTQPAMA TTAVGVSATP41 MTEKLTAADD DQQQQKLKKG61 IAEFYDESSG MWENIWGEHM81 HHGYYNSDDV VELSDHRSAQ101 IRMIEQALTF ASVSDDPEKK121 PKTIVDVGCG IGGSSRYLAR141 KYGAECHGIT LSPVQAERXN161 ALAAAQGLAD KVSFQVADAL181 NQPFPDGKFD LVWSMESGEH201 MPDKLKFVSE LTRVAAPGAT221 IIIVTWCHRD LNPGEKSLRP241 EEEKILNKIC SSFYLPAWCS261 TADYVKLLES LSLQDIKSAD281 WSGNVAPFWP AVIKTALSWK301 GITSLLRSGW KSIRGAMVMP321 LMIEGFKKDV IKFSIITCKK341 PE^*SEQ NO3 (Primer1)：5’ ATAGTTGATGTCGGGTGTGG 3’SEQ NO4 (Primer2)：5’ GGCATGTGCTCTCCACTCTCCAT 3’SEQ NO5 (CDSIII/3’PCR Primer)：5’ ATTCTAGAGGCCGAGGCGGCCGACATG 3’SEQ NO6 (5’PCR Primer)：5’ AAGCAGTGGTATCAACGCAGAGT 3’SEQ NO7 (Primer3)：5’ GCCCATTACGGCCGGGGACGTG 3’SEQ NO8 (Primer4)：5’ TTATTCAGGCTTTTTGCATGTAAT 3’SEQ NO9 (Primer5)：5’ GCCTCGAGGCCCATTACGGCCGGGGACGTG 3’SEQ NO10 (Primer6)：5’ GCGAATTCTTATTCAGGCTTTTTGCATGTAAT 3’

Claims (15)

1. the dna sequence dna of the sunflower gama tocopherol methyl transferases of encoding is characterized in that this dna sequence dna has the dna sequence dna shown in SEQ NO 1, the aminoacid sequence shown in its coding SEQ NO2;

2. the dna sequence dna of claim 1, wherein said dna sequence dna comprises the homologous sequence of this dna sequence dna;

3. the dna sequence dna of claim 1, wherein said dna sequence dna comprises the partial sequence of this dna sequence dna;

4. the aminoacid sequence of the sunflower gama tocopherol methyl transferases of encoding is characterized in that this aminoacid sequence has the aminoacid sequence shown in SEQNO2;

5. the aminoacid sequence of claim 4, wherein said aminoacid sequence comprises the homologous sequence of this aminoacid sequence;

6. the aminoacid sequence of claim 4, wherein said aminoacid sequence comprises the partial sequence of this aminoacid sequence;

7. a mosaic gene is characterized in that this mosaic gene comprises the dna encoding sequence of claim 1 to 3;

8. a carrier that is used for transformed plant cells is characterized in that this carrier comprises the mosaic gene of claim 7;

9. a transformed plant cells is characterized in that this transformed plant cells contains the carrier of claim 8;

10. one kind transforms plant, it is characterized in that this conversion plant comes from the transformed plant cells of claim 9;

11. the conversion plant of claim 10, wherein said conversion plant includes but not limited to transform plant and offspring thereof, and organ, tissue and the cell and products thereof that comprise plant seed, whole plant, plant materials are as vegetables oil;

12. the conversion plant of claim 11, wherein said conversion plant has the high content of alpha-tocopherol level;

13. one kind is used for transform bacteria or zymic carrier, it is characterized in that this carrier comprises claim 1,2,3 and 7 dna encoding sequence;

14. transform bacteria or yeast is characterized in that this transform bacteria or yeast contain the carrier of claim 13;

15. the transform bacteria of claim 14 or yeast, wherein said transform bacteria or yeast can produce sunflower gama tocopherol methyl transferases;