CN1465402A - Recombination protein vaccine for preventing animal aphtha virus infection - Google Patents
Recombination protein vaccine for preventing animal aphtha virus infection Download PDFInfo
- Publication number
- CN1465402A CN1465402A CNA021413363A CN02141336A CN1465402A CN 1465402 A CN1465402 A CN 1465402A CN A021413363 A CNA021413363 A CN A021413363A CN 02141336 A CN02141336 A CN 02141336A CN 1465402 A CN1465402 A CN 1465402A
- Authority
- CN
- China
- Prior art keywords
- ala
- vaccine
- leu
- mouth disease
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides a recombinant protein vaccine. It is a fusion protein formed by fusion of BCG vaccine chaperone cohort 10 and "0" type foot-and-mouth disease virus VPI antigen. Said invention includes: amino acid sequence of said recombinant protein vaccine and its coding nucleotide sequence; "0" type foot-and-mouth disease virus VP1 protein and nucleotide sequence of its total coding zone; expression vector of coding nucleotide of fusion protein formed by fusion of BCG vaccine chaperone cohort 10 and "0" type foot-and-mouth disease virus VPI antigen, host cell containing said expression vector and preparation method of said recombinant protein vaccine.
Description
Invention field
The present invention relates to a kind of genetic engineering field, relate to genetic engineering recombinant protein vaccine (hereinafter being also referred to as " genetic engineering recombiant protein " sometimes) particularly, particularly relate to a kind of merging and the recombinant protein vaccine that forms of preventing that the animal foot and mouth disease virus infects by bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 antigen; The encode nucleotide sequence (hereinafter being also referred to as " gene " sometimes) of this recombinant protein vaccine; The nucleotide sequence of " O " type foot and mouth disease virus VP1 albumen and full coding region thereof; Bacillus calmette-guerin vaccine cpn10 and the proteic amalgamation mode of " O " type foot and mouth disease virus VP1; Contain that coding is merged by bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 antigen and the expression vector of the nucleotide of the recombinant protein vaccine that forms; The host cell that contains this expression vector, and the preparation method of this recombinant protein vaccine; The invention still further relates to this genetic engineering recombiant protein and be used for preventing the purposes of the vaccine product that the animal foot and mouth disease virus infects and the vaccine product that contains this genetic engineering recombiant protein in preparation.
Background of invention
Foot and mouth disease is the contagious disease of being suffered from altogether by the cloven-hoofed animal that foot and mouth disease virus (FMDV) infection causes, the most susceptible animal of FMDV is cattle, Babalus bubalis L., pig, camel, sheep, deer etc.Symptoms such as blister macule heating can appear, walk lamely and occur in the animal that catches a foot and mouth disease on skin and skin mucosa, pernicious foot and mouth disease also can cause ill domestic animal heart paralysis and dead rapidly.This disease transmission scope is big, and speed is fast, in case outburst must be catched and killed ill domestic animal and suspicious infection animal rapidly, and thorough disinfection is carried out in the epidemic-stricken area.Each eruption and prevalence of foot and mouth disease all means enormous economic loss.For example, the loss that causes in the foot and mouth disease of Great Britain and France outbursts of 1951-1952 is unexpectedly up to 1.43 hundred million pounds.Therefore, countries in the world are all classified it as a class infectious disease and are taken seriously, and adopt vigorous measures and prevent.
The pathogen of foot and mouth disease is a foot and mouth disease virus, and it is a kind of filter micro ribonucleic acid (ssRNA) virus.Foot and mouth disease virus generally can be divided 7 types: A, C, O, Asia I and South Africa one to three type.Tell a lot of hypotypes among each type again.It is generally acknowledged, can not induce mutual immunity between the various foot and mouth disease virus.
The genome of FMD virus has 7500-8000 base approximately, and the nucleocapsid protein (also claiming glutelin, viral capsid protein VP) of virus divides four parts, is followed successively by VP4, VP2, VP3, VP1.Wherein, VP1 albumen can be induced the humoral immunoresponse(HI) of protectiveness, and the peptide section that is made of the 135-158 amino acids wherein has stronger immunogenicity, can induce high-caliber protein antibodies and virucidin; Peptide section between the 141-159 is considered to the strong antigen determinant of B cell and T cell recognition.In nineteen eighty-two, Pfaff E, Mussgay M, Bohm HO etc. prove for the first time, can produce neutrality antibody (Pfaff E, Mussgay M, the BohmHO of foot-and-mouth disease virus resistant with protective effect according to the little peptide of one section sequence synthetic on the VP1 glutelin of FMDV, Antibodies against a preselected peptide recognize andneutralize foot and mouth disease virus, EMBO J 1982; 1 (7): 869-74).Thereafter, in the experiment of Cavia porcellus, pig, sheep, also find, only the peptide section that has merged the sweet enzyme of beta galactose at the proteic 141-160 amino acids of the VP1 of FMDV N-terminal can not produce persistent immunogenicity, yet, by (for example: with hepatitis B core antibody) mode is expressed in (as KLH) on some carriers, can obviously improve the immunogenicity of the little peptide of this section with certain fusion rotein with the proteic 141-160 amino acids of VP1.The recombiant protein of VP1 gene code is induced body to produce omnibearing immunne response in animal body and (is shown as and produce specific neutralizing antibody, cytotoxic T cell (CTL) and helper T cell (Th), foot and mouth disease virus is had preventive effect.
Cpn10 (Chaperonin 10) is a member of molecular chaperones extended familys.The cpn10 aminoacid sequence of people, cattle, Mus has nearly 100% homology.Experiment finds that the bacillus calmette-guerin vaccine cpn10 can induce the antibody at " O1Lausanne " type foot and mouth disease virus in the Cavia porcellus body.The histone structure of the C-end of this cpn10 peptide section is similar to the epi-position of " O " property foot and mouth disease virus, this may be that cpn10 brings out a kind of mechanism (the Amadori M of body to the foot and mouth disease virus protective immunological reaction, Archetti IL, Scaccaglia P, Chaperonin 10 ofmycobacterium tuberculosis induces a protective immune response tofoot-and-mouth disease virus) .Arch Virol 1999; 144 (5): 905-19).
Summary of the invention
An aspect of of the present present invention provides a kind of genetic engineering recombiant vaccine, and it merges bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 antigen and produce, and the foot and mouth disease virus infection of animal is had preventive effect.
Another aspect of the present invention provides a kind of coding " O " type antigenic full structural gene sequence of foot and mouth disease virus VP1 and by the amino acid whose sequence of its encoded protein matter.
Another aspect of the present invention provides a kind of nucleotide sequence and aminoacid sequence of this recombiant protein of encoding.
Another aspect of the present invention provides a kind of expression vector that contains this nucleotide sequence.
Another aspect of the present invention provides a kind of host cell that contains this expression vector.
Another aspect of the present invention provides a kind of method of preventing the recombinant vaccine of foot and mouth disease virus infection with bacillus calmette-guerin vaccine cpn10 gene fusion foot and mouth disease virus VP1 genes produce.
Another aspect of the present invention relates to this genetic engineering recombiant protein is used for preventing the vaccine product that the foot and mouth disease virus of animal infects in preparation purposes.
Another aspect of the present invention relates to the vaccine product that contains this genetic engineering recombiant protein.
Therefore, the inventor is through secular a large amount of research just, solved technical barrier of the prior art, the bacillus calmette-guerin vaccine cpn10 is linked to each other with " O " type foot and mouth disease virus VP1 antigen has first formed brand-new genetic engineering recombiant protein pioneeringly, thus the vaccine that the foot and mouth disease virus that provides brand-new being used to prevent animal infects.
In addition, it is pointed out that on the basis of the application's contextual disclosure that aspect and other creative beneficial effect that other has substantive distinguishing features of the present invention are conspicuous to those skilled in the art.
Brief Description Of Drawings accompanying drawing 1: the preparation process flowchart illustrations of recombinant protein vaccine of the present invention.Accompanying drawing 2: foot and mouth disease virus (FMDV) VP1 antigen nucleotide sepharose electrophoresis figure, wherein swimming lane
The 1st, Mark, TaKaRa Code No:A1022, DL 2000; Swimming lane 2 is FMDV-
VP1(639bp)。Accompanying drawing 3: Expression of Fusion Protein and purification SDS-PAGE electrophoretogram (34.5kDa), wherein swimming lane
The 1st, purified target protein, swimming lane 2 is blanks, swimming lane 3 is Mark,
TaKaRa Code No:C302, swimming lane 4 are expressing proteins of genes of interest.Accompanying drawing 4:Chaperonin10 nucleotide sepharose electrophoresis figure, wherein swimming lane 1 is Mark, TaKaRa
Code No:A1022, DL 2000; Swimming lane 2 is caperonin (303bp).Accompanying drawing 5: antigen-4 fusion protein gene nucleotide enzyme action sepharose electrophoresis figure, wherein swimming lane 1 is PET28+VP1
Endonuclease bamhi (about 650 bp of clip size), swimming lane 2 is Mark, TaKaRa Code No:
A1033，DL?1500。Accompanying drawing 6: the design of graphics of integrative gene expression vector, wherein Fig. 6 (1) is a genes of interest on the expression vector
Insert segmental position and restriction enzyme site, Fig. 6 (2) is the plasmid after the expression vector establishment success
Collection of illustrative plates.
The specific embodiment
In the context of the present invention, employed term generally has the implication of those of ordinary skill in the art's common sense unless otherwise indicated.Especially, following term has following implication:
Recombinant protein vaccine: utilize technique for gene engineering, to have strong immunogenic one or more gene fragment clones on protokaryon or eukaryotic expression vector, change expression vector over to antibacterial or eukaryotic cell (yeast cells or mammalian cell), utilize the strong immunogenic one or more genetic fragment encoded protein matter of having of this antibacterial or eukaryotic cell production to be called recombinant protein vaccine.This vaccine can induce body to produce the memory lymphocyte (T lymphocyte and bone-marrow-derived lymphocyte) of antigenic specificity after being applied to body, the lymphocyte of these Memorability can be bred rapidly after touching corresponding pathogen, be reacted, and the mode by producing antibody or the mode of specific killing cell suppress maybe that this kills and wounds pathogen.
Cpn10 (Chaperonin10): be the heatshock protein that a kind of molecular weight of separating from bacillus calmette-guerin vaccine is 10kDa, it has the nucleotide sequence shown in SEQ ID NO 14, the aminoacid sequence shown in the SEQ IDNO 15.
Foot and mouth disease virus VP1 antigen: be the part of FMD virus coat protein, it can induce body to produce the foot and mouth disease virus neutralizing antibody with protective effect.In the present invention, it has the nucleotide sequence shown in the SEQ IDNO 1, the aminoacid sequence shown in the SEQ ID NO 2.
The foot and mouth disease virus of animal (FMDV) infects: be the contagious disease of being suffered from altogether by the cloven-hoofed animal that FMDV causes, the most susceptible animal is cattle, pig, sheep, deer etc.FMDV is a kind of filter micro ribonucleic acid (ssRNA) virus, and the virion genome comprises 7500-8000 base approximately.FMDV mainly propagates in the mode of saliva, and the speed of propagation is very fast, it is large-area popular easily to form.
The invention provides a kind of recombinant protein vaccine, it is the fusion rotein that is formed with the fusion of " O " type foot and mouth disease virus VP1 antigen by the bacillus calmette-guerin vaccine cpn10, wherein the bacillus calmette-guerin vaccine cpn10 can be positioned at the aminoterminal of this fusion rotein, and " O " type foot and mouth disease virus VP1 antigen is positioned at the c-terminus of this fusion rotein.In the recombinant protein vaccine of the present invention, the antigenic encoding gene of described " O " type foot and mouth disease virus VP1 preferably has the nucleotide sequence shown in the SEQ ID NO:1, should preferably have the aminoacid sequence shown in the SEQ ID NO:2 by " O " type foot and mouth disease virus VP1 antigen, and the bacillus calmette-guerin vaccine cpn10 preferably has the aminoacid sequence shown in the SEQ ID NO:15.Recombinant protein vaccine of the present invention preferably has the aminoacid sequence shown in the SEQ ID NO:4, and its encoding gene preferably has the nucleotide sequence shown in SEQ ID NO:3.
Recombinant protein vaccine of the present invention has and is selected from following arbitrary aminoacid sequence:
1) aminoacid sequence shown in the SEQ ID NO:4; With
2) by under tight hybridization conditions with coding 1) the coded aminoacid sequence of nucleotide sequence of nucleotide sequence hybridization of aminoacid sequence.
The present invention also provides the nucleotide sequence of the recombinant protein vaccine of the present invention of encoding, and this nucleotide sequence can have and is selected from following arbitrary sequence:
1) nucleotide sequence shown in the SEQ ID NO:3; With
2) by under tight hybridization conditions with 1) the nucleotide sequence of nucleotide sequence hybridization.
" O " type foot and mouth disease virus is from inner mongolia Jinyu Group bio-pharmaceuticals factory, and the antigenic nucleotide sequence of its VP1 obtains (sequence is shown in SEQ ID NO:5-11) by the primer that we design voluntarily by reverse transcription reaction and archaeal dna polymerase chain reaction.The bacillus calmette-guerin vaccine cpn10 is a kind of genetic fragment that derives from bacillus calmette-guerin vaccine, (its gene coded sequence and aminoacid sequence can be respectively as SEQ ID NO:3 after forming fusion rotein with " O " type foot and mouth disease virus VP1 antigen for it, shown in 4), can bring out the neutrality antibody of body generation at FMDV.
Recombinant protein vaccine of the present invention can pass through methods known in the art, list of references Nilsson C for example, Sutter G, Walther-Jallow L, et al.Immunization with recombinantmodified vaccinia virus Ankara can modify mucosal simian immunodeficiencyvirus infection and delay disease progression in macaques (Ankara viral vaccine of recombinant modified can be controlled the infection of permanent and monkey mucosa-immune defective virus and postpone the progress of disease).J Gen Virol 2002 Apr; 83 (Pt 4): 807-18. is described to be produced, and following embodiment has at length exemplified a kind of method of producing recombinant protein vaccine of the present invention.
Therefore, the present invention also provides the expression vector of the nucleotide sequence that contains above-mentioned coding recombinant protein vaccine of the present invention; The host cell that contains this expression vector, it can be the various prokaryotic cells of this area routine, eukaryotic cell or mammalian cell; And the gene engineering preparation method of this recombinant protein vaccine.
In addition, the invention still further relates to this genetic engineering recombiant protein and be used for preventing purposes of vaccine product of infection of animal foot and mouth disease virus and the vaccine product that contains this genetic engineering recombiant protein in preparation.It will be appreciated by persons skilled in the art that these vaccine products can prepare with the known various conventional methods in this area.
Recombinant protein vaccine of the present invention can be given animal inoculation by hypodermic mode, and the dosage of inoculation is 100-500 μ g.For stiffening effect, can carry out 1 time booster immunization in 14 or 21 days in the immunity back first time.
Below in conjunction with concrete preparation embodiment and biology effect embodiment, and the present invention is described in further detail with reference to accompanying drawing.Should be understood that these embodiment just in order to demonstrate the invention, but not limit the scope of the invention by any way.
Embodiment
In following embodiment, various processes of Xiang Ximiaoshuing and method are not conventional methods as known in the art, for example Molecular Cloning one book (J.Sambrook, Cold Spring HarborLaboratory Press, Molecular cloning, 1989) described method.
Bacillus calmette-guerin vaccine derives from Changchun Biological Products Institute.Adopt potato culture (StarchPotato Code No:C250-1, Sigma packing Beijing ancient cooking vessel state biology) to cultivate bacillus calmette-guerin vaccine, the temperature of cultivation is 37-39 ℃, and the bacillus calmette-guerin vaccine that grows presents the lurid Mycoderma of shriveling.Collect Mycoderma, therefrom extract bcg genomic dna.
The method of extracting bcg genomic dna is with reference to Molecular Cloning one book (J.Sambrook, from mammal separation of high molecular weight DNA (Isolat ion of high-molecular-weight DNA from mammalian cells), 9.16-9.22, ColdSpring Harbor Laboratory Press, Molecular cloning, 1989).
Adopt PCR method to separate cpn10 structural gene from bacillus calmette-guerin vaccine.5 ' the end primer sequence that adopts is 5 ' CCATGGCGAAGGTGAACATCAA 3 ' (SEQ ID NO:12), and 3 ' end primer sequence is 5 ' CTAGAATTCCTTGGAAACGACGGCCAGC 3 ' (SEQ ID NO:13).
Described PCR operation sequence is: add following reagent in one 500 μ l microcentrifugal tubes:
Template cDNA 5 μ l (mmol/L)
10 * PCR buffer, 5 μ l
(500mmol/L?KCl，100mmol/L?Tris-Cl，
15mmol/L?MgCl
2)
dNTPs(10mmol/L) 1μl
5 ' end and 3 ' each 0.5 μ l of end primer (0.01mmol/L)
Taq archaeal dna polymerase (5u/ μ l) 0.25 μ l
Add deionized water to final volume 50 μ l
Mix the back and add 3 in mineral oil
Reaction condition: 94 ℃, 30 "; 55 ℃, 1 '; 72 ℃, behind 2 ', 30 cycle periods, 72 ℃ were extended 10 minutes.Sequence is shown in SEQ ID No:14.Example 2: adopt TA cloning process clone PCR products
TA clone's carrier be PMD18-TVector (pMD 18-TVector Code No:D504A, TaKaRa).Method is as follows: the recovery of a DNA: (following recovery reagent is all from the precious biological engineering company limited of DaLian, China, TaKaRa-DNA reclaims test kit Code No:D301) 1 with the PCR product with 1% agarose gel electrophoresis (1xTAE, 150-200mA, 20 minutes); 2 downcut the gel contain dna fragmentation from agarose gel, put into a centrifuge tube; 3 add the sol solutions B of 3 times of volumes, and 45-55 ° of water-bath 10min melts glue fully; 4 solution B that will contain dna gel move in the Filter column static 2 minutes of room temperature; 5 add 500 ml soln C in Filter column, eluting once: centrifugal 60 seconds of 5000g, abandon filtrate; 6 add 500 ml soln C once more in Filter column, the same centrifugal behind the eluting, abandon filtrate; 7 with Filter column as for dry 30-60 under the room temperature minute, add solution D 30-50 milliliter, static 2 minutes of room temperature; Centrifugal 1 minute of 812000g, the filtrate of collection being contained the solution D of dna fragmentation; Preserve for 9-20 ℃ and collect liquid, standby.Two coupled reactions:
1 gets 3-5ul supernatant electrophoresis, and observes electrophoresis band under uviol lamp, compares with marker (10ng/ul), estimates to reclaim DNA concentration; 2 coupled reaction system Insert DNA (SEQ ID NO 14) 0.05-0.3pmol
pMD18-TVector 0.5-1ul
Solution?I 5ul
(Ligation?Solutionl?Code?No：D504A，TaKaRa)
DH
2O adds to 10ul
16 ℃ of reactions conversion in 1 hour three:
The method that transforms is: the 100ul competent cell is put on ice melted, add 3ul DMSO then, after the mixing, add 10 μ l coupled reaction liquid (containing recombiant plasmid), gentle mixing was put 30 minutes on ice; 42 ℃ 45 seconds, put back to rapidly then in the ice 1-2 minute; Add 1ml LB culture fluid, 37 ℃ of speed with 225rpm are swayed and were cultivated 1 hour; 4,000Xg centrifugal 10 seconds abandon supernatant, with the resuspended thalline of 200ul LB culture fluid; Bacterium liquid is laid on contains on the suitable antibiotic LB agar culture plate, smoothen, room temperature was placed 10 minutes, was inverted in 37 ℃ of incubators and cultivated 12-16 hour.
The preparation method of competent cell is: escherichia coli GM109 (JM109 Code No:Y001, Beijing ancient cooking vessel state biology) is rule on the LB agar culture medium, cultivated 12-16 hour for 37 ℃; Get a single bacterium colony in 2ml LB culture medium from agar plate next day, and 37 ℃ with 225rpm speed concussion cultivation 12-16 hour; Get the above-mentioned culture of 1ml and be inoculated in the 100ml LB culture medium, it is about 0.5 (about 3 hours) that 37 ℃ of speed concussions with 225rpm are cultivated until the OD value; With bacterium liquid ice bath 2 hours, then 2,500Xg collected thalline in centrifugal 20 minutes for 4 ℃; Add ice-cold Trituration buffer (100mmol/L CaCl2, the 70mmol/L MgCl of 100ml
2, the 40mmol/L sodium acetate, pH5.5), mixing was put 45 minutes on ice; 1800Xg, 4 ℃ centrifugal 10 minutes, abandon supernatant, add the ice-cold Trituration buffer suspension cell of 10ml; By every part of 200ul packing, can preserve 1-2 week for 4 ℃.If need long preservation, but glycerol adding to final concentration is 15%, put-70 ℃ standby.
Four identify: carry out the order-checking of DNA by Beijing ancient cooking vessel state biotech development center.Sequencing result errorless (concrete sequence is referring to SEQ ID No:14, and its sepharose electrophoresis figure sees accompanying drawing 4).
Five strains and preservation: the recombiant plasmid stored frozen is in-20 ℃.The bacterial strain that contains recombiant plasmid is stored in-20 ℃ or-70 ℃ in containing 20% glycerol culture fluid.
(J.Sambrook according to a conventional method, polyacrylamide gel electrophoresis (Polyacrylamidegel electrophoresis) 1.21-1.32, Cold Spring Harbor LaboratoryPress, Molecular cloning, 1989) extract plasmid, adopt the terminal cessation method of two deoxidations, carry out sequencing inserting fragment.The acquisition of embodiment 3. " O " type foot and mouth disease virus RNA:
Utilize Trizol reagent (U.S. Gibco company product) to extract the RNA of the foot and mouth disease virus (inner mongolia Jinyu Group bio-pharmaceuticals factory) in the cell culture fluid; Concrete step is as follows:
1. the cell culture fluid that 300ul is contained foot and mouth disease virus mixed the back room temperature static 10 minutes, centrifugal 10 minutes of 10000Xg with the 600ul dehydrated alcohol.
2. abandon supernatant, with 1ml Trizol reagent cell lysis precipitation, shake mixing after, incubated at room 10 minutes.
3. added 200ul chloroform concussion mixing 15 seconds, room temperature 3 minutes.
4.10000Xg, 4 ℃ centrifugal 15 minutes, water is transferred in another centrifuge tube, add the 500ul isopropyl alcohol, mixed under the room temperature of back precipitation 10 minutes, 10000Xg, centrifugal 10 minutes.
5. abandon supernatant, add 1ml 75% ethanol, 8000Xg, centrifugal 10 minutes.
6. abandon supernatant, air evaporation residual ethanol under the room temperature, colourless, transparent FMD viral RNA is attached to the test tube bottom.Embodiment 4. adopts reverse transcription reaction and two-wheeled PCR to obtain the VP1 antigen nucleotide sequence of " O " type foot and mouth disease virus.One. the Auele Specific Primer that adopts reverse transcription reaction to obtain the cDNA reverse transcription reaction of " O " type foot and mouth disease virus is designed voluntarily by us, 65 ℃ of of water-baths 10 minutes of sequence is:5 ' AAAGGCCCAGGGTTGGACTC 3 ' (SEQ ID NO:5) reverse transcription method:1. add in the viral RNA precipitation of extracting:Auele Specific Primer (10uM) 1ulDEPC-water 9ul mixes rearmounted, and ice bath is 2 minutes then.2. add following reagent in the mentioned solution: 5 * reverse transcriptase buffer solution 4ul (AMV RT 5 * Reaction Buffer and Solutions Code No:M5 101; Promegacorporation USA) Rnasin 0.25ul (Rnasin Ribonuclease Inhibitor Promega corporation USA) dNTPs (10mmol/L) 4.0ul reverse transcriptase 0.5ul (AMV-RT Code No:M5101, Promega corporation USA) DEPC-water to final volume is that 20ul mixes rear 37 ℃ of water-baths 1 hour. 3. above-mentioned reactant liquor is moved into 68 ℃ of water-baths 10 minutes ( deactivation reverse transcriptase ) ,-20 ℃ of preservations.The sequence that two .PCR react 1. first round PCR ( template is the cDNA for the foot and mouth disease virus of acquisition in " reaction one " ) primer 1 is: the sequence of 5 ' GGCTGATTACGCGTACAC 3 ' ( SEQ ID NO:6 ) primer 1 ' is: the sequence of 5 ' AAAGGCCCAGGGTTGGACTC 3 ' ( SEQ ID NO:7 ) the synthetic product of first round PCR is: 5 'CGCGTCCGACGTCGCCGAAACCACAAACGTGCAGGGATGGGTCTGCTTGTTCCAGATAACACACGGGAAAGCCGACGGCGATGCTCTGGTTGTGCTAGCTAGTGCTGGCAAAGACTTTGACCTACGCCTACCGGTTGACGCCCGCACGCAGACCACCTCTGCGGGCGAGTCCGCGGACCCCGTTACCGCCACCGTTGAGAATTACGGTGGTGAGACACAGGTCCAGAGACGCCAGCACACGGATATCTCGTTTATACTAGACAGATTTGTGAAAGTCACACCAAAAGACCAAATCAATGTGCTGGACCTGATGCAGATCCCTGCCCACACTTTAGTAGGGGCCCTCCTGCGGACGGCCACCTACTACTTCTCCGACTTGGAGTTGGCTGTCAAACACGAGGGTGATCTCACCTGGGTTCCGAACGGGGCCCCTGAGACAGCTTTGGACAACACCACCAACCCAACAGCTTACCACAAAGCACCACTCACGCGACTGGCCTTGCCTTACACGGCCCCACACCGCGTCTTAGCGACCGTCTACAACGGAGGTTGTAAGTACAGTGACGCCCGCGTGAGCAACGTGAGGGGTGACCTTCAAGTGTTGGCTCAGAAGGCAAAAAGAGCTCTGCCCACCTCCTTTAACTATGGTGCCATTAAGGCAACCCGGGTGACTGAGTTACTCTACCGAATGAAGAGAGCCGAGACATACTGCCCCAGGCCCCTTCTTGCCATTCAACCGAGTGACGCTAGACACAAGCAGAAGATCGTGGCACCCGCAAAACAGCTTCTGAACTTCGACCTCCTCAAGCTGGCGGGAGACGTC
The sequence that 3 ' (SEQ ID NO:8) 2 second takes turns PCR (template is the synthetic product of first round PCR) primer 2 is: 5 ' GAATTCACCACCTCTGCGGG 3 ' (SEQ ID NO:9) primer 2 ' sequence be that the sequence of 5 ' AAGCTTCAGAAGCTGTTTTGC 3 ' (SEQ ID NO:10) product is: 5 '
GAATTCACCACCTCTGCGGGCGAGTCCGCGGACCCCGTTACCGCCACCGTTGAGAATTACGGTGGTGAGACACAGGTCCAGAGACGCCAGCACACGGATATCTCGTTTATACTAGACAGATTTGTGAAAGTCACACCAAAAGACCAAATCAATGTGCTGGACCTGATGCAGATCCCTGCCCACACTTTAGTAGGGGCCCTCCTGCGGACGGCCACCTACTACTTCTCCGACTTGGAGTTGGCTGTCAAACACGAGGGTGATCTCACCTGGGTTCCGAACGGGGCCCCTGAGACAGCTTTGGACAACACCACCAACCCAACAGCTTACCACAAAGCACCACTCACGCGACTGGCCTTGCCTTACACGGCCCCACACCGCGTCTTAGCGACCGTCTACAACGGAGGTTGTAAGTACAGTGACGCCCGCGTGAGCAACGTGAGGGGTGACCTTCAAGTGTTGGCTCAGAAGGCAAAAAGAGCTCTGCCCACCTCCTTTAACTATGGTGCCATTAAGGCAACCCGGGTGACTGAGTTACTCTACCGAATGAAGAGAGCCGAGACATACTGCCCCAGGCCCCTTCTTGCCATTCAACCGAGTGACGCTAGACACAAGCAGAAGATCGTGGCACCC
GCAAAACAGCTTCTGAAGCTTWhat 3 ' (SEQ ID NO:11) these sequences were represented is " O " type foot and mouth disease virus VP1 gene order that two ends add restriction enzyme site.
The reaction condition of PCR is: 94 ℃, and 30 "; 55 ℃, 1 '; 72 ℃, behind 2 ', 30 cycle periods, 72 ℃ were extended 10 minutes.
Embodiment 5. makes up bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 genetic fragment
The encoding gene of bacillus calmette-guerin vaccine cpn10 and the PCR product of foot and mouth disease virus VP1 gene are connected (method is with example 2) respectively with the Ta carrier, will connect the reorganization Ta plasmid difference transformed into escherichia coli (method for transformation is with example 2) of product (contain the bacillus calmette-guerin vaccine cpn10 and contain " O " type foot and mouth disease virus VP1 gene).
The sequencing result of bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 gene shows, resulting bacillus calmette-guerin vaccine cpn10 is in full accord with " O " type foot and mouth disease virus VP1 gene and design, and concrete sequence is referring to SEQ ID NO:14 and SEQ ID NO:16.
With NcoI (Nco I Code No:D1160A, TaKaRa, together following) and EcoRI (EcoRICode No:D1040A, TaKaRa, down with) derive from the cpn10 junctional complex of embodiment 5 37 ℃ of digestion, with EcoRI and HindIII (HindIII Code No:D1060A, TaKaRa, down with) derive from " O " type foot and mouth disease virus VP1 junctional complex of embodiment 5 37 ℃ of digestion, the time is 2 hours.Digestion product separates through agarose gel electrophoresis.Electrophoretic condition is: 1% agarose gel, 1 * TAE buffer, 150-200mA, electrophoresis 0.5-1 hour.20 * TAE buffer: 0.8mol/L Tris base, 0.4mol/L NaOAc, 0.04mol/LNa
2EDTA transfers pH 8.3 with glacial acetic acid.
Under uviol lamp, observe and downcut the DNA electrophoresis band (containing Chaperonin10 and foot and mouth disease virus VP1 gene respectively) on the agarose gel.Purification reclaims dna fragmentation, and (method is with embodiment 2, and electrophoretogram is seen accompanying drawing 2; Accompanying drawing 4)
The structure of embodiment 6 bacillus calmette-guerin vaccine cpn10s and " O " type foot and mouth disease virus VP1 antigen fusion gene
The dna fragmentation that reclaims is cloned into respectively through restricted enzyme NcoI and EcoRI; The upstream of 6 polyhistidyls (histidine) codon of procaryotic cell expression carrier pET-28a (+) plasmid (U.S. Novagen company) of EcoRI and HindIII digestion.
The digestion reaction that contains bacillus calmette-guerin vaccine cpn10 plasmid DNA: (10 * K buffer Lot:A1018, TaKaRa) 1 μ l restricted enzyme NcoI (10 units/μ l), 1 μ l restricted enzyme EcoRI (10 units/μ l), 1 μ l mixed back 37 ℃ of incubation 30-120 minutes with distilled water polishing to 10 μ l plasmid DNA 1 μ g10 * buffer.
The digestion reaction that contains " O " type foot and mouth disease virus VP1 plasmid DNA:
10 * buffer (10 * M buffer Lot:A1032, TaKaRa) 1 μ l
Restricted enzyme HindIII (10 units/μ l) 1 μ l
Restricted enzyme EcoRI (10 units/μ l) 1 μ l
With distilled water polishing to 10 μ l
Mixed back 37 ℃ of incubation 30-120 minutes.
Coupled reaction:
Plasmid DNA (0.5 μ g/ μ l) 2 μ l
DNA inserts fragment (300ng/ μ l) 5 μ l
10 * connection buffer
(T4Ligation?Solution?Lot：CA2901，TaKaRa) 1μl
The T4 dna ligase
(T4?Ligation?Code?No：D2011A，TaKaRa)
1μl
With distilled water polishing to 10 μ l
Mix rearmounted 14-16 ℃ water-bath 6-12 hour.
Reorganization pET-28a (+) plasmid that will contain bacillus calmette-guerin vaccine cpn10-" O " type foot and mouth disease virus VP1 fusion gene is transformed into escherichia coli expression bacterium BL21 (BL21 (DE3) Code No:Y016, Beijing ancient cooking vessel state biology descend together).
Identify: the fusion gene that contains bacillus calmette-guerin vaccine cpn10-" O " type foot and mouth disease virus VP1 on pET-28a (+) plasmid is carried out the order-checking of DNA by Beijing ancient cooking vessel state biotech development center.Sequencing result is errorless.(concrete sequence is referring to SEQ ID No:16).
Method (HindIII, EcoRI) with enzyme action is identified the fusion gene that contains bacillus calmette-guerin vaccine cpn10-" O " type foot and mouth disease virus VP1 on pET-28a (+) plasmid, the result excises the fragment of the about 650bp of size, confirms " O " type foot and mouth disease virus VP1 successful connection.(accompanying drawing 5)
The expression of embodiment 7 bacillus calmette-guerin vaccine cpn10s and " O " type foot and mouth disease virus VP1 fusion gene
In 50ml LB culture medium, in the 250ml conical flask, it is 0.6 that 37C water-bath concussion is cultured to OD600 with the microbionation of single bacterium colony.It is 1mM that adding IPT6 makes its final concentration, and 37C water-bath concussion was cultivated 2-3 hour.Conical flask is in 5 minutes on ice, centrifugal 5 minutes of 4C (5000xg).Supernatant is abandoned in suction, collects antibacterial, immediately use or frozen.
The preparation 1. of embodiment 8 bacillus calmette-guerin vaccine cpn10s and the proteic purification of samples of " O " type foot and mouth disease virus VP1 gene fusion is resuspended in antibacterial in the cell pyrolysis liquid; Cell pyrolysis liquid: 20mM Tris, 0.5M NaCl
5mM imidazole 0.1mM PMSF transfers pH to cause 7.92. adding 10mM MgSO
4, in cell pyrolysis liquid, hatch 30min to remove DNA on ice with 20ug/ml Dnase I (Beijing ancient cooking vessel state biology descends together for DnaseI Code No:C082, Roche packing); 3.12000rpm centrifugal 15min collecting precipitation thing is washed once with cell pyrolysis liquid is centrifugal then; 4. precipitate is dissolved in the binding buffer liquid, hatched on ice 1-2 hour. binding buffer liquid: 20mM Tris, 0.5 M Nacl
5mMimidazole 6M urea transfers pH to cause the centrifugal 15min of 7.95.12000rpm and removes floccule.The preparation 1. of post is accurate to ideal capacity with post (ion exchange column, Pharmacia are down together), performs labelling with anti-water-color paintbrush; 2. adorn post with phosphate buffer, seal outlet then; Phosphate buffer: 20mM phosphate, pH7.2 1M Nacl compound method: solution A Na2Hpo4.12H2O 35.8g pair is heated up in a steamer water and is added to 100ml
Solution B NaH2po4.H2O 13.Sg pair is heated up in a steamer water and is added to 100ml
Solution C is added to solution B in the solution A gradually, and pH 3. begins to add chromatography media (Sepharose4B-Ni till 7.2 always
2+Pharmacia down together); 4. allow post begin to flow and add more medium, until medium level reaches the post level of labelling; 5. open outlet, add phosphate buffer, attack post limit sinks medium, continues attack till the post bed height is constant; 6. add more medium, repeat 1-6 step, when attack not when changing the volume of post bed, close the outlet of post.7. add phosphate buffer and be full of post, cover the loam cake of post, open outlet; 8. allow post begin with minimum 100 bed volumes/hour flow the shortest flowing 30 minutes; 9. if the volume of post medium needs to adjust, close the outlet of post, open the loam cake of post, add more medium, should wash post at least 30 minutes with Peak Flow Rate more then.Charging before chelating media can be used to purge process to medium with metal ion, must be its charging with selected metal ion.1. wash post with the distilled water of at least 5 bed volumes.2. the 20mM metal ion solution with 3-5 bed volume is added in the post.The preparation of 50mM nickel ion solution: NiSO
46H
2O 13.1g, two water that heat up in a steamer are added to 1000ml.3. wash post with the elution buffer of 5 bed volumes.Elution buffer: 20mM Tris, pH7.9
0.5M?NaCl
1M?imidazole
6M urea4. washes post with the binding buffer liquid of 10 bed volumes.Binding buffer liquid: 20mM Tris, pH7.9
0.5M?NaCl
5mM?imidazole
6M urea absorption
1. sample is added in the metalchelated post, and flows through the post bed by it with predetermined optimum flow rate;
2. wash post with the binding buffer liquid that contains the 16mM imidazoles, until the absorption value of effluent is got back to baseline values.Eluting
During with the eluent eluting, a peak value can occur, the continuation eluting, accesses the effluent of different periods with container, and carries out SDS electrophoresis (seeing accompanying drawing 3) not only dropping to up to absorption value, judges purification effect, and purity can reach more than 50%.
The imidazoles eluent: 20mM Tris, pH 7.9,0.5M NaCl
1M?imidazole，6M?urea。The vaccine immunity one of embodiment 8:C57 mice. material
1.C57 female mice (C57 mice, Test Animal Centre, Academy of Military Medical Sciences, P.L.A provide down with), 6-8 age in week
2. " cpn10-VP1 " fusion rotein (molecular biology teaching and research room of preclinical medicine institute of Jilin University provide down with)
3.PBS two. method
1. divide two groups at random with 20 mices, one group is cpn10-VP1 amalgamation protein vaccine immune group, one group is the PBS immune group, vaccine group: in 0,14,28 day, every Mus is injected " cpn10-VP1 " amalgamation protein vaccine 200ug (150ul), 1.3ug/ul altogether at two lower limb quadriceps femoris places; PBS group: the equivalent that uses the same method injection PBS.
2. apart from immune back 6 days for the third time, eyeball of mouse was got the about 1ml of blood, and 4000g separates supernatant after centrifugal 10 seconds.The C57 mouse antibodies that embodiment 9:ELISA detects after the immunity is tired
One. material
C57 mice (all ages of male 6-8), " cpn10-VP1 " fusion rotein, " HSP-VP1 " fusion rotein, PBS, bag are cushioned liquid 1%BSA, sheep anti-mouse igg-HRP (numbering: H005 Beijing ancient cooking vessel state biology, OPD-substrate buffer solution (OPD-substrate buffer solution CodeNo:P002 down together),, Beijing ancient cooking vessel state biology, down together)
Two. method
1. with " HSP-VP1 " fusion rotein (6.5ng/ml) behind the purification.Behind preliminary experiment, 1:80 is cushioned the liquid dilution with bag.
2. bag quilt: add 96 orifice plates, the 100ul/ hole.4 ℃, spend the night.
3. washing: washing liquid is washed plate 3 times, 5 minutes/time.
4. sealing: add the 1%BSA sealing, the 200ul/ hole.37 ℃, 1.5 hours.
5. washing: washing liquid is washed plate 3 times, 5 minutes/time.
6. application of sample: PBS immunity and each serum of 10 of " cpn10-VP1 " amalgamation protein vaccine immunized mice (immunization method is the same) are done 100,200,400,800,1600,3200 and 6400 times of dilutions, 100ul/ hole with sample diluting liquid.If multiple hole.37 ℃, 60 minutes.
7. add enzyme labelled antibody: sheep anti-mouse igg-HRP (0.1ml, 1: 1000) is diluted 500 times with washing liquid, the 100ul/ hole.37 ℃, 60 minutes.
8. washing: washing liquid is washed plate three times, 5 minutes/time.
9. colour developing: fresh preparation OPD-substrate buffer solution, 100ul/ hole.Room temperature lucifuge reaction 10 minutes.
10. stop: add 2mol/L H
2SO
4, the 50ul/ hole
11. survey A
490Experimental result and conclusion A
490OD value: blank: OD value: 0.005 ± 0.0005
Normal control group: dilution factor (1: 80) OD value: 0.213 ± 0.003
Immune group: dilution factor (1: 100) OD value: 3.564 ± 0.012
Dilution factor (1: 200) OD value: 2.531 ± 0.023
Dilution factor (1: 400) OD value: 1.971 ± 0.011
Dilution factor (1: 800) OD value: 1.003 ± 0.014
Dilution factor (1: 1600) OD value: 0.899 ± 0.012
Dilution factor (1: 3200) OD value: 0.719 ± 0.009
Dilution factor (1: 6400) OD value: 0.621 ± 0.006
Criterion: when detecting the immune serum antibody titer, when the OD value is higher than 2 times of matched group OD value when the different dilution factor of immune group, be judged as the positive with the ELISA method.According to above-mentioned standard, when the immune group dilution factor was 1: 1600, immune group OD improved more than 2 times than matched group OD, judges that in view of the above the potent antibodies of immune group was tired 1: 1600.
Experimental result shows: the antibody titer of vaccine immunity group is apparently higher than the PBS immune group.
Sequence table＜110〉Beijing enlightening Cheng Huayu Bioisystech Co., Ltd＜120〉recombinant protein vaccine and uses thereof＜130〉I020107＜160〉16＜170〉PatentIn version 3.1＜210 of infection of prevention animal foot and mouth disease virus〉1＜211〉639＜212〉DNA＜213〉Foot-and-mouth disease virus＜220〉＜221〉CDS＜222〉(1) .. (639)＜223〉＜400〉1acc acc tct gcg ggc gag tcc gcg gac ccc gtt acc gcc acc gtt gag 48Thr Thr Ser Ala Gly Glu Ser Ala Asp Pro Val Thr Ala Thr Val Glu1,5 10 15aat tac ggt ggt gag aca cag gtc cag aga cgc cag cac acg gat atc 96Asn Tyr Gly Gly Glu Thr Gln Val Gln Arg Arg Gln His Thr Asp Ile
20 25 30tcg?ttt?ata?cta?gac?aga?ttt?gtg?aaa?gtc?aca?cca?aaa?gac?caa?atc 144Ser?Phe?Ile?Leu?Asp?Arg?Phe?Val?Lys?Val?Thr?Pro?Lys?Asp?Gln?Ile
35 40 45aat?gtg?ctg?gac?ctg?atg?cag?atc?cct?gcc?cac?act?tta?gta?ggg?gcc 192Asn?Val?Leu?Asp?Leu?Met?Gln?Ile?Pro?Ala?His?Thr?Leu?Val?Gly?Ala
50 55 60ctc?ctg?cgg?acg?gcc?acc?tac?tac?ttc?tcc?gac?ttg?gag?ttg?gct?gtc 240Leu?Leu?Arg?Thr?Ala?Thr?Tyr?Tyr?Phe?Ser?Asp?Leu?Glu?Leu?Ala?Val65 70 75 80aaa?cac?gag?ggt?gat?ctc?acc?tgg?gtt?ccg?aac?ggg?gcc?cct?gag?aca 288Lys?His?Glu?Gly?Asp?Leu?Thr?Trp?Val?Pro?Asn?Gly?Ala?Pro?Glu?Thr
85 90 95gct?ttg?gac?aac?acc?acc?aac?cca?aca?gct?tac?cac?aaa?gca?cea?ctc 336Ala?Leu?Asp?Asn?Thr?Thr?Asn?Pro?Thr?Ala?Tyr?His?Lys?Ala?Pro?Leu
100 105 110acg?cga?ctg?gcc?ttg?cct?tac?acg?gcc?cca?cac?cgc?gtc?tta?gcg?acc 384Thr?Arg?Leu?Aia?Leu?Pro?Tyr?Thr?Ala?Pro?His?Arg?Val?Leu?Ala?Thr
115 120 125gtc?tac?aac?gga?agt?tgt?aag?tac?agt?gac?gcc?cgc?gtg?agc?aac?gtg 432Val?Tyr?Asn?Gly?Ser?Cys?Lys?Tyr?Ser?Asp?Ala?Arg?Val?Ser?Asn?Val
130 135 140agg?ggt?gac?ctt?caa?gtg?ttg?gct?cag?aag?gca?aaa?aga?gct?ctg?ccc 480Arg?Gly?Asp?Leu?Gln?Val?Leu?Ala?Gln?Lys?Ala?Lys?Arg?Ala?Leu?Pro145 150 155 160acc?tcc?ttt?aac?tat?ggt?gcc?att?aag?gca?acc?cgg?gtg?act?gag?tta 528Thr?Ser?Phe?Asn?Tyr?Gly?Ala?Ile?Lys?Ala?Thr?Arg?Val?Thr?Glu?Leu
165 170 175ctc?tac?cga?atg?aag?aga?gcc?gag?aca?tac?tgc?ccc?agg?ccc?ctt?ctt 576Leu?Tyr?Arg?Met?Lys?Arg?Ala?Glu?Thr?Tyr?Cys?Pro?Arg?Pro?Leu?Leu
180 185 190gcc?att?caa?ccg?agt?gac?gct?aga?cac?aag?cag?aag?atc?gtg?gca?ccc 624Ala?Ile?Gln?Pro?Ser?Asp?Ala?Arg?His?Lys?Gln?Lys?Ile?Val?Ala?Pro
195 200 205gca?aaa?cag?ctt?ctg 639Ala?Lvs?Gln?Leu?Leu
210<210>2<211>213<212>PRT<213>Foot-and-mouth?disease?virus<400>2Thr?Thr?Ser?Ala?Gly?Glu?Ser?Ala?Asp?Pro?Val?Thr?Ala?Thr?Val?Glu1 5 10 15Asn?Tyr?Gly?Gly?Glu?Thr?Gln?Val?Gln?Arg?Arg?Gln?His?Thr?Asp?Ile
20 25 30Ser?Phe?Ile?Leu?Asp?Arg?Phe?Val?Lys?Val?Thr?Pro?Lys?Asp?Gln?Ile
35 40 45Asn?Val?Leu?Asp?Leu?Met?Gln?Ile?Pro?Ala?His?Thr?Leu?Val?Gly?Ala
50 55 60Leu?Leu?Arg?Thr?Ala?Thr?Tyr?Tyr?Phe?Ser?Asp?Leu?Glu?Leu?Ala?Val65 70 75 80Lys?His?Glu?Gly?Asp?Leu?Thr?Trp?Val?Pro?Asn?Gly?Ala?Pro?Glu?Thr
85 90 95Ala?Leu?Asp?Asn?Thr?Thr?Asn?Pro?Thr?Ala?Tyr?Hi?s?Lys?Ala?Pro?Leu
100 105 110Thr?Arg?Leu?Ala?Leu?Pro?Tyr?Thr?Ala?Pro?His?Arg?Val?Leu?Ala?Thr
115 120 125Val?Tyr?Asn?Gly?Ser?Cys?Lys?Tyr?Ser?Asp?Ala?Arg?Val?Ser?Asn?Val
130 135 140Arg?Gly?Asp?Leu?Gln?Val?Leu?Ala?Gln?Lys?Ala?Lys?Arg?Ala?Leu?Pro145 150 155 160Thr?Ser?Phe?Asn?Tyr?Gly?Ala?Ile?Lys?Ala?Thr?Arg?Val?Thr?Glu?Leu
165 170 175Leu?Tyr?Arg?Met?Lys?Arg?Ala?Glu?Thr?Tyr?Cys?Pro?Arg?Pro?Leu?Leu
180 185 190Ala?Ile?Gln?Pro?Ser?Asp?Ala?Arg?His?Lys?Gln?Lys?Ile?Val?Ala?Pro
195 200 205Ala?Lys?Gln?Leu?Leu
210<210>3<211>945<212>DNA<213>Artificial<220><221>CDS<222>(1)..(945)<223><400>3atg?gcg?aag?gtg?aac?atc?aag?cca?ctc?gag?gac?aag?atc?ctc?gtg?cag 48Met?Ala?Lys?Val?Asn?Ile?Lys?Pro?Leu?Glu?Asp?Lys?Ile?Leu?Val?Gln1 5 10 15gcc?aac?gag?gcc?gag?acc?acg?acc?gcg?tcc?ggt?ctg?gtc?att?cct?gac 96Ala?Asn?Glu?Ala?Glu?Thr?Thr?Thr?Ala?Ser?Gly?Leu?Val?Ile?Pro?Asp
20 25 30acc?gcc?aag?gag?aag?ccg?cag?gag?ggc?acc?gtc?gtt?gcc?gtc?ggc?cct 144Thr?Ala?Lys?Glu?Lys?Pro?Gln?Glu?Gly?Thr?Val?Val?Ala?Val?Gly?Pro
35 40 45ggc?cgg?tgg?gac?gag?gac?ggc?gag?aag?cgg?atc?ccg?ctg?gac?gtt?gcg 192Gly?Arg?Trp?Asp?Glu?Asp?Gly?Glu?Lys?Arg?Ile?Pro?Leu?Asp?Val?Ala
50 55 60gag?ggt?gac?acc?gtc?atc?tac?agc?aag?tac?ggc?ggc?acc?gag?atc?aag 240Glu?Gly?Asp?Thr?Val?Ile?Tyr?Ser?Lys?Tyr?Gly?Gly?Thr?Glu?Ile?Lys65 70 75 80tac?aac?ggc?gag?gaa?tac?ctg?atc?ctg?tcg?gca?cgc?gac?gtg?ctg?gcc 288Tyr?Asn?Gly?Glu?Glu?Tyr?Leu?Ile?Leu?Ser?Ala?Arg?Asp?Val?Leu?Ala
85 90 95gtc?gtt?tcc?aag?gaa?ttc?acc?acc?tct?gcg?ggc?gag?tcc?gcg?gac?ccc 336Val?Val?Ser?Lys?Glu?Phe?Thr?Thr?Ser?Ala?Gly?Glu?Ser?Ala?Asp?Pro
100 105 110gtt?acc?gcc?acc?gtt?gag?aat?tac?ggt?ggt?gag?aca?cag?gtc?cag?aga 384Val?Thr?Ala?Thr?Val?Glu?Asn?Tyr?Gly?Gly?Glu?Thr?Gln?Val?Gln?Arg
115 120 125cgc?cag?cac?acg?gat?atc?tcg?ttt?ata?cta?gac?aga?ttt?gtg?aaa?gtc 432Arg?Gln?His?Thr?Asp?Ile?Ser?Phe?Ile?Leu?Asp?Arg?Phe?Val?Lys?Val
130 135 140aca?cca?aaa?gac?caa?atc?aat?gtg?ctg?gac?ctg?atg?cag?atc?cct?gcc 480Thr?Pro?Lys?Asp?Gln?Ile?Asn?Val?Leu?Asp?Leu?Met?Gln?Ile?Pro?Ala145 150 155 160cac?act?tta?gta?ggg?gcc?ctc?ctg?cgg?acg?gcc?acc?tac?tac?ttc?tcc 528His?Thr?Leu?Val?Gly?Ala?Leu?Leu?Arg?Thr?Ala?Thr?Tyr?Tyr?Phe?Ser
165 170 175gac?ttg?gag?ttg?gct?gtc?aaa?cac?gag?ggt?gat?ctc?acc?tgg?gtt?ccg 576Asp?Leu?Glu?Leu?Ala?Val?Lys?His?Glu?Gly?Asp?Leu?Thr?Trp?Val?Pro
180 185 190aac?ggg?gcc?cct?gag?aca?gct?ttg?gac?aac?acc?acc?aac?cca?aca?gct 624Asn?Gly?Ala?Pro?Glu?Thr?Ala?Leu?Asp?Asn?Thr?Thr?Asn?Pro?Thr?Ala
195 200 205tac?cac?aaa?gca?cca?ctc?acg?cga?ctg?gcc?ttg?cct?tac?acg?gcc?cca 672Tyr?His?Lys?Ala?Pro?Leu?Thr?Arg?Leu?Ala?Leu?Pro?Tyr?Thr?Ala?Pro
210 215 220cac?cgc?gtc?tta?gcg?acc?gtc?tac?aac?gga?agt?tgt?aag?tac?agt?gac 720His?Arg?Val?Leu?Ala?Thr?Val?Tyr?Asn?Gly?Ser?Cys?Lys?Tyr?Ser?Asp225 230 235 240gcc?cgc?gtg?agc?aac?gtg?agg?ggt?gac?ctt?caa?gtg?ttg?gct?cag?aag 768Ala?Arg?Val?Ser?Asn?Val?Arg?Gly?Asp?Leu?Gln?Val?Leu?Ala?Gln?Lys
245 250 255gca?aaa?aga?gct?ctg?ccc?acc?tcc?ttt?aac?tat?ggt?gcc?att?aag?gca 816Ala?Lys?Arg?Ala?Leu?Pro?Thr?Ser?Phe?Asn?Tyr?Gly?Ala?Ile?Lys?Ala
260 265 270acc?cgg?gtg?act?gag?tta?ctc?tac?cga?atg?aag?aga?gcc?gag?aca?tac 864Thr?Arg?Val?Thr?Glu?Leu?Leu?Tyr?Arg?Met?Lys?Arg?Ala?Glu?Thr?Tyr
275 280 285tgc?ccc?agg?ccc?ctt?ctt?gcc?att?caa?ccg?agt?gac?gct?aga?cac?aag 912Cys?Pro?Arg?Pro?Leu?Leu?Ala?Ile?Gln?Pro?Ser?Asp?Ala?Arg?His?Lys
290 295 300cag?aag?atc?gtg?gca?ccc?gca?aaa?cag?ctt?ctg 945Gln?Lys?Ile?Val?Ala?Pro?Ala?Lys?Gln?Leu?Leu305 310 315<210>4<211>315<212>PRT<213>Artificial<400>4Met?Ala?Lys?Val?Asn?Ile?Lys?Pro?Leu?Glu?Asp?Lys?Ile?Leu?Val?Gln1 5 10 15Ala?Asn?Glu?Ala?Glu?Thr?Thr?Thr?Ala?Ser?Gly?Leu?Val?Ile?Pro?Asp
20 25 30Thr?Ala?Lys?Glu?Lys?Pro?Gln?Glu?Gly?Thr?Val?Val?Ala?Val?Gly?Pro
35 40 45Gly?Arg?Trp?Asp?Glu?Asp?Gly?Glu?Lys?Arg?Ile?Pro?Leu?Asp?Val?Ala
50 55 60Glu?Gly?Asp?Thr?Val?Ile?Tyr?Ser?Lys?Tyr?Gly?Gly?Thr?Glu?Ile?Lys65 70 75 80Tyr?Asn?Gly?Glu?Glu?Tyr?Leu?Ile?Leu?Ser?Ala?Arg?Asp?Val?Leu?Ala
85 90 95Val?Val?Ser?Lys?Glu?Phe?Thr?Thr?Ser?Ala?Gly?Glu?Ser?Ala?Asp?Pro
100 105 110Val?Thr?Ala?Thr?Val?Glu?Asn?Tyr?Gly?Gly?Glu?Thr?Gln?Val?Gln?Arg
115 120 125Arg?Gln?His?Thr?Asp?Ile?Ser?Phe?Ile?Leu?Asp?Arg?Phe?Val?Lys?Val
130 135 140Thr?Pro?Lys?Asp?Gln?Ile?Asn?Val?Leu?Asp?Leu?Met?Gln?Ile?Pro?Ala145 150 155 160His?Thr?Leu?Val?Gly?Ala?Leu?Leu?Arg?Thr?Ala?Thr?Tyr?Tyr?Phe?Ser
165 170 175Asp?Leu?Glu?Leu?Ala?Val?Lys?His?Glu?Gly?Asp?Leu?Thr?Trp?Val?Pro
180 185 190Asn?Gly?Ala?Pro?Glu?Thr?Ala?Leu?Asp?Asn?Thr?Thr?Asn?Pro?Thr?Ala
195 200 205Tyr?His?Lys?Ala?Pro?Leu?Thr?Arg?Leu?Ala?Leu?Pro?Tyr?Thr?Ala?Pro
210 215 220His?Arg?Val?Leu?Ala?Thr?Val?Tyr?Asn?Gly?Ser?Cys?Lys?Tyr?Ser?Asp225 230 235 240Ala?Arg?Val?Ser?Asn?Val?Arg?Gly?Asp?Leu?Gln?Val?Leu?Ala?Gln?Lys
245 250 255Ala?Lys?Arg?Ala?Leu?Pro?Thr?Ser?Phe?Asn?Tyr?Gly?Ala?Ile?Lys?Ala
260 265 270Thr?Arg?Val?Thr?Glu?Leu?Leu?Tyr?Arg?Met?Lys?Arg?Ala?Glu?Thr?Tyr
275 280 285Cys?Pro?Arg?Pro?Leu?Leu?Ala?Ile?Gln?Pro?Ser?Asp?Ala?Arg?His?Lys
290 295 300Gln?Lys?Ile?Val?Ala?Pro?Ala?Lys?Gln?Leu?Leu305 310 315<210>5<211>20<212>DNA<213>Artificial<400>5aaaggcccag?ggttggactc 20<210>6<211>18<212>DNA<213>Artificial<400>6ggctgattac?gcgtacac 18<210>7<211>20<212>DNA<213>Artificial<400>7aaaggcccag?ggttggactc 20<210>8<211>861<212>DNA<213>Foot-and-mouth?disease?virus<400>8ggctgattac?gcgtacaccg?cgtccgacgt?cgccgaaacc?acaaacgtgc?agggatgggt 60ctgcttgttc?cagataacac?acgggaaagc?cgacggcgat?gctctggttg?tgctagctag 120tgctggcaaa?gactttgacc?tacgcctacc?ggttgacgcc?cgcacgcaga?ccacctctgc 180gggcgagtcc?gcggaccccg?ttaccgccac?cgttgagaat?tacggtggtg?agacacaggt 240ccagagacgc?cagcacacgg?atatctcgtt?tatactagac?agatttgtga?aagtcacacc 300aaaagaccaa?atcaatgtgc?tggacctgat?gcagatccct?gcccacactt?tagtaggggc 360cctcctgcgg?acggccacct?actacttctc?cgacttggag?ttggctgtca?aacacgaggg 420tgatctcacc?tgggttccga?acggggcccc?tgagacagct?ttggacaaca?ccaccaaccc 480aacagcttac?cacaaagcac?cactcacgcg?actggccttg?ccttacacgg?ccccacaccg 540cgtcttagcg?accgtctaca?acggaagttg?taagtacagt?gacgcccgcg?tgagcaacgt 600gaggggtgac?cttcaagtgt?tggctcagaa?ggcaaaaaga?gctctgccca?cctcctttaa 660ctatggtgcc?attaaggcaa?cccgggtgac?tgagttactc?taccgaatga?agagagccga 720gacatactgc?cccaggcccc?ttcttgccat?tcaaccgagt?gacgctagac?acaagcagaa 780gatcgtggca?cccgcaaaac?agcttctgaa?cttcgacctc?ctcaagctgg?cgggagacgt 840cgagtccaac?cctgggcctt?t 861<210>9<211>20<212>DNA<213>Artificial<400>9gaattcacca?cctctgcggg 20<210>10<211>21<212>DNA<213>Artificial<400>10aagcttcaga?agctgttttg?c 21<210>11<211>651<212>DNA<213>Foot-and-mouth?disease?virus<400>11gaattcacca?cctctgcggg?cgagtccgcg?gaccccgtta?ccgccaccgt?tgagaattac 60ggtggtgaga?cacaggtcca?gagacgccag?cacacggata?tctcgtttat?actagacaga 120tttgtgaaag?tcacaccaaa?agaccaaatc?aatgtgctgg?acctgatgca?gatccctgcc 180cacactttag?taggggccct?cctgcggacg?gccacctact?acttctccga?cttggagttg 240gctgtcaaac?acgagggtga?tctcacctgg?gttccgaacg?gggcccctga?gacagctttg 300gacaacacca?ccaacccaac?agcttaccac?aaagcaccac?tcacgcgact?ggccttgcct 360tacacggccc?cacaccgcgt?cttagcgacc?gtctacaacg?gaagttgtaa?gtacagtgac 420gcccgcgtga?gcaacgtgag?gggtgacctt?caagtgttgg?ctcagaaggc?aaaaagagct 480ctgcccacct?cctttaacta?tggtgccatt?aaggcaaccc?gggtgactga?gttactctac 540cgaatgaaga?gagccgagac?atactgcccc?aggccccttc?ttgccattca?accgagtgac 600gctagacaca?agcagaagat?cgtggcaccc?gcaaaacagc?ttctgaagct?t 651<210>12<211>22<212>DNA<213>Artificial<400>12ccatggcgaa?ggtgaacatc?aa 22<210>13<211>28<212>DNA<213>Artificial<400>13ctagaattcc?ttggaaacga?cggccagc 28<210>14<211>309<212>DNA<213>Bacille?calmette-Guerin<220><221>CDS<222>(1)..(309)<223><400>14atg?gcg?aag?gtg?aac?atc?aag?cca?ctc?gag?gac?aag?atc?ctc?gtg?cag 48Met?Ala?Lys?Val?Asn?Ile?Lys?Pro?Leu?Glu?Asp?Lys?Ile?Leu?Val?Gln1 5 10 15gcc?aac?gag?gcc?gag?acc?acg?acc?gcg?tcc?ggt?ctg?gtc?att?cct?gac 96Ala?Asn?Glu?Ala?Glu?Thr?Thr?Thr?Ala?Ser?Gly?Leu?Val?Ile?Pro?Asp
20 25 30acc?gcc?aag?gag?aag?ccg?cag?gag?ggc?acc?gtc?gtt?gcc?gtc?ggc?cct 144Thr?Ala?Lys?Glu?Lys?Pro?Gln?Glu?Gly?Thr?Val?Val?Ala?Val?Gly?Pro
35 40 45ggc?cgg?tgg?gac?gag?gac?ggc?gag?aag?cgg?atc?ccg?ctg?gac?gtt?gcg 192Gly?Arg?Trp?Asp?Glu?Asp?Gly?Glu?Lys?Arg?Ile?Pro?Leu?Asp?Val?Ala
50 55 60gag?ggt?gac?acc?gtc?atc?tac?agc?aag?tac?ggc?ggc?acc?gag?atc?aag 240Glu?Gly?Asp?Thr?Val?Ile?Tyr?Ser?Lys?Tyr?Gly?Gly?Thr?Glu?Ile?Lys65 70 75 80tac?aac?ggc?gag?gaa?tac?ctg?atc?ctg?tcg?gca?cgc?gac?gtg?ctg?gcc 288Tyr?Asn?Gly?Glu?Glu?Tyr?Leu?Ile?Leu?Ser?Ala?Arg?Asp?Val?Leu?Ala
85 90 95gtc?gtt?tcc?aag?gaa?ttc?tag 309Val?Val?Ser?Lys?Glu?Phe
100<210>15<211>102<212>PRT<213>Bacille?caalmette-Guerin<400>15Met?Ala?Lys?Val?Asn?Ile?Lys?Pro?Leu?Glu?Asp?Lys?Ile?Leu?Val?Gln1 5 10 15Ala?Asn?Glu?Ala?Glu?Thr?Thr?Thr?Ala?Ser?Gly?Leu?Val?Ile?Pro?Asp
20 25 30Thr?Ala?Lys?Glu?Lys?Pro?Gln?Glu?Gly?Thr?Val?Val?Ala?Val?Gly?Pro
35 40 45Gly?Arg?Trp?Asp?Glu?Asp?Gly?Glu?Lys?Arg?Ile?Pro?Leu?Asp?Val?Ala
50 55 60Glu?Gly?Asp?Thr?Val?Ile?Tyr?Ser?Lys?Tyr?Gly?Gly?Thr?Glu?Ile?Lys65 70 75 80Tyr?Asn?Gly?Glu?Glu?Tyr?Leu?Ile?Leu?Ser?Ala?Arg?Asp?Val?Leu?Ala
85 90 95Val?Val?Ser?Lys?Glu?Phe
100<210>16<211>951<212>DNA<213>Artificial<400>16atggcgaagg?tgaacatcaa?gccactcgag?gacaagatcc?tcgtgcaggc?caacgaggcc 60gagaccacga?ccgcgtccgg?tctggtcatt?cctgacaccg?ccaaggagaa?gccgcaggag 120ggcaccgtcg?ttgccgtcgg?ccctggccgg?tgggacgagg?acggcgagaa?gcggatcccg 180ctggacgttg?cggagggtga?caccgtcatc?tacagcaagt?acggcggcac?cgagatcaag 240tacaacggcg?aggaatacct?gatcctgtcg?gcacgcgacg?tgctggccgt?cgtttccaag 300gaattcacca?cctctgcggg?cgagtccgcg?gaccccgtta?ccgccaccgt?tgagaattac 360ggtggtgaga?cacaggtcca?gagacgccag?cacacggata?tctcgtttat?actagacaga 420tttgtgaaag?tcacaccaaa?agaccaaatc?aatgtgctgg?acctgatgca?gatccctgcc 480cacactttag?taggggccct?cctgcggacg?gccacctact?acttctccga?cttggagttg 540gctgtcaaac?acgagggtga?tctcacctgg?gttccgaacg?gggcccctga?gacagctttg 600gacaacacca?ccaacccaac?agcttaccac?aaagcaccac?tcacgcgact?ggccttgcct 660tacacggccc?cacaccgcgt?cttagcgacc?gtctacaacg?gaggttgtaa gtacagtgac 720gcccgcgtga?gcaacgtgag?gggtgacctt?caagtgttgg?ctcagaaggc?aaaaagagct 780ctgcccacct?cctttaacta?tggtgccatt?aaggcaaccc?gggtgactga?gttactctac 840cgaatgaaga?gagccgagac?atactgcccc?aggccccttc?ttgccattca?accgagtgac 900gctagacaca?agcagaagat?cgtggcaccc?gcaaaacagc?ttctgaagct?t 951
Claims (15)
1. recombinant protein vaccine, it is to be merged and the fusion rotein that forms by bacillus calmette-guerin vaccine cpn10 and " O " type foot and mouth disease virus VP1 antigen.
2. according to the described recombinant protein vaccine of claim 1, it has and is selected from following arbitrary aminoacid sequence:
1) aminoacid sequence shown in the SEQ ID No:4; With
2) by under tight hybridization conditions with coding 1) the coded aminoacid sequence of nucleotide sequence of nucleotide sequence hybridization of aminoacid sequence.
3. according to the described recombinant protein vaccine of claim 1, wherein said " O " type foot and mouth disease virus VP1 antigen has the aminoacid sequence shown in the SEQ ID NO:2.
4. according to the described recombinant protein vaccine of claim 1, wherein, the antigenic coded sequence of " O " type foot and mouth disease virus VP1 is to have the nucleotide sequence shown in the SEQ ID NO:1.
5. according to the described recombinant protein vaccine of claim 1, wherein, the bacillus calmette-guerin vaccine cpn10 is positioned at the aminoterminal of this fusion rotein, and " O " type foot and mouth disease virus VP1 antigen is positioned at the c-terminus of this fusion rotein.
6. according to the described recombinant protein vaccine of claim 1, it has the aminoacid sequence shown in the SEQ ID No:4.
7. the nucleotide sequence of any described recombinant protein vaccine in the claim 1 to 6 of encoding.
8. according to the described nucleotide sequence of claim 7, it has and is selected from following arbitrary sequence:
1) nucleotide sequence shown in the SEQ ID NO:3; With
2) by under tight hybridization conditions with 1) the nucleotide sequence of nucleotide sequence hybridization.
9. according to the described gene of claim 7, it has the nucleotide sequence shown in the SEQ ID NO:3.
10. the expression vector that contains each nucleotide sequence among the claim 7-9.
11. contain the host cell of claim 10 expression vector.
12. according to the described host cell of claim 11, it is prokaryotic cell, eukaryotic cell or mammalian cell.
13. a method for preparing each recombinant protein vaccine among the claim 1-6 comprises and cultivating as claim 9 or 10 described host cells.
14. each described recombiant protein is used for preventing the purposes of vaccine product of the infection of animal foot and mouth disease virus among the claim 1-6 in preparation.
15. a vaccine product that is used to prevent the infection of animal foot and mouth disease virus contains each described recombiant protein and carrier or excipient among the claim 1-6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02141336 CN1218749C (en) | 2002-07-05 | 2002-07-05 | Recombination protein vaccine for preventing animal aphtha virus infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02141336 CN1218749C (en) | 2002-07-05 | 2002-07-05 | Recombination protein vaccine for preventing animal aphtha virus infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1465402A true CN1465402A (en) | 2004-01-07 |
| CN1218749C CN1218749C (en) | 2005-09-14 |
Family
ID=34147764
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02141336 Expired - Fee Related CN1218749C (en) | 2002-07-05 | 2002-07-05 | Recombination protein vaccine for preventing animal aphtha virus infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1218749C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008145000A1 (en) * | 2007-05-28 | 2008-12-04 | Lanzhou Veterinary Research Institute Chinese Academy Of Agricultural Sciences | A foot-and-mouth disease virus double-effective vaccine vector, construction method and uses thereof |
| CN111925423A (en) * | 2014-11-07 | 2020-11-13 | 普莱柯生物工程股份有限公司 | Vaccine composition for resisting O-type foot-and-mouth disease and preparation method and application thereof |
-
2002
- 2002-07-05 CN CN 02141336 patent/CN1218749C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008145000A1 (en) * | 2007-05-28 | 2008-12-04 | Lanzhou Veterinary Research Institute Chinese Academy Of Agricultural Sciences | A foot-and-mouth disease virus double-effective vaccine vector, construction method and uses thereof |
| CN111925423A (en) * | 2014-11-07 | 2020-11-13 | 普莱柯生物工程股份有限公司 | Vaccine composition for resisting O-type foot-and-mouth disease and preparation method and application thereof |
| CN111925423B (en) * | 2014-11-07 | 2022-08-19 | 普莱柯生物工程股份有限公司 | Vaccine composition for resisting O-type foot-and-mouth disease and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1218749C (en) | 2005-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1345775A (en) | Polypeptide for preventing, diagnosis and treating hepatitis E virus and used as diagnostic reagent and vaccine | |
| CN101062410A (en) | Genetic engineering vaccine of enterohemorrhagic escherichia coli 0157:H7 and the preparing method thereof | |
| CN1903363A (en) | Mosaic type virus-like particle DNA vaccine | |
| CN1261896A (en) | Surface antigens and proteins useful in compositions for diagnosis and prevention of lyme disease | |
| CN1044479C (en) | Process for preparation of anti-thrombin polypeptides | |
| CN1259522A (en) | Novel protain from lobar pneumonia Actinomyces | |
| GB2191201A (en) | Flavivirus antigen and vaccine containing same | |
| CN1053196C (en) | Antigenic peptides for grouping hepatitis C virus, kit comprising the same and methods for its grouping using the same | |
| CN106117365B (en) | Anti-streptococcus suis is sick and with the active fusion protein of autoimmunity and its preparation and application | |
| CN1173204A (en) | Immunogens for stimulating mucosal immunity | |
| CN1304453A (en) | Vaccine-induced hepatitis B viral strain and uses thereof | |
| CN100342234C (en) | Indirect ELISA process for discriminating livestock infected with foot-and-mouth disease virus and livestock immunologically vaccinated with foot-and-mouth disease vaccine utilizing nonstructural prot | |
| CN1465402A (en) | Recombination protein vaccine for preventing animal aphtha virus infection | |
| CN1748791A (en) | Haemorrhagic E, coli 0157:H7 vaccine for human and livestock prevention and preparing method | |
| CN1047531A (en) | Classical swine fever virus vaccine and diagnosis | |
| CN109824767A (en) | Porcine epidemic diarrhea virus recombinates the preparation method of S2 albumen and its polyclonal antibody | |
| CN1185254C (en) | First hypervariable region antigen of hepatitis C and fusion antigen | |
| CN1298388C (en) | Herpes simplex virus II type DNA vaccine | |
| CN1273482C (en) | Hepatitis C virus tunic protein E2 gene capable of being total length expressed in E. coli, its coding protein and use | |
| CN1462636A (en) | Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage | |
| CN1847397A (en) | EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application | |
| CN111850003A (en) | Recombinant expression pasteurella multocida thiamine periplasm binding protein and application thereof | |
| CN1080957A (en) | Be applicable to the dna sequence dna and the coded polypeptide of diagnosis hepatitis disease | |
| CN1280310C (en) | Fusion protein with cold proventing and curing function and its encoding gene and use | |
| CN1136917C (en) | TB vaccine heat reversal protein65 and multiepi-position HER-2 Antigen fusion protein recombinat protein vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: JINYU BAOLING BIOPHARMACEUTICAL CO., LTD. |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20100906 Address after: 100088, A-337, Hua Hui Road, 6, Beijing, Haidian District, May Co-patentee after: Jinyu Baoling Bio-pharmaceutical Co., Ltd. Patentee after: Diweihuayu Bio-Technology Co., Ltd., Beijing Address before: 100088, A-337, Hua Hui Road, 6, Beijing, Haidian District, May Patentee before: Diweihuayu Bio-Technology Co., Ltd., Beijing |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050914 Termination date: 20180705 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |