CN1448405A - Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof - Google Patents
Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof Download PDFInfo
- Publication number
- CN1448405A CN1448405A CN 02116263 CN02116263A CN1448405A CN 1448405 A CN1448405 A CN 1448405A CN 02116263 CN02116263 CN 02116263 CN 02116263 A CN02116263 A CN 02116263A CN 1448405 A CN1448405 A CN 1448405A
- Authority
- CN
- China
- Prior art keywords
- trail
- protein
- glu
- ser
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The human truncated recombinant soluble TRAIL-170 protein is one TRAIL protein segment including amino acids 112-281. In the first stage of protein structure, there are proline in N terminal, glycine in C terminal, 11 arginines, 6 histidines, 11 lysined and 1 cysteine, isoelectric point PI=9.27, and it is one alkali protein. In its second stage structure, the protein includes two beta layer parallel but opposite in direction. The protein has cDNA sequence comprising 510 nucleotides and encodes 170 amino acids. The protein can induce the tumor cells to die obviously kill and/or inhibit tumor cells in animal body. Compared with TRAIL95-281 segment used internationally, the human truncated recombinant soluble TRAIL-170 protein of the present invention has the features of small molecular weight and high activity and has wide application foreground in preparing tumor treating medicine.
Description
Invention field
The invention belongs to biological technical field, particularly a kind of human truncated recombination soluble TRAIL-170 albumen and the application in the preparation anti-tumor medicine thereof.
Background technology
TRAIL (TNF-Related Apoptosis Inducing Ligand)/Apo-2L be find nineteen ninety-five can induce the kinds of tumor cells generation apoptotic cells factor, belong to one of TNF superfamily member.People's trail protein belongs to II type transmembrane protein, and its primary structure is made up of 281 amino acid, and molecular weight is 32kDa, and wherein cytoplasmic domain has 17 amino acid, and striding the film district has 21 amino acid, and extracellular region then has 243 amino acid.
The distribution of trail protein is very extensive, and expression is all arranged on myocardial cell, lymphocyte, splenocyte, thymocyte, prostatic cell, ovary and small intestine cells, but does not then express on normal liver cell, brain cell and testicular cell.The extracellular region of TRAIL can be isolated and become the cytokine of solubility by metalloprotease, biological function studies confirm that, soluble TRAIL protein can be induced the tumour cell and the viral cell transformed generation apoptosis of different sources, comprises intestinal cancer, mammary cancer, melanoma, lung cancer, kidney, central nerve neuroma, leukemia, skin carcinoma and multiple myeloma cells etc.The animal whole body uses the soluble TRAIL of reorganization, can induce tumour cell generation apoptosis, the tumor growth inoculated to be subjected to press down, improve the survival time of tumor animal, and do not find any toxic side effect in the experiment in the body of rodents and other primate.
The recombinant soluble TRAIL that generally uses in the world comprises the fragment of an amino acid 95～281 at present.This protein molecular weight is big, tumor killing cell is active low, and the protein concn of inducing 50% apoptosis rate is more than 200ng/ml.
Summary of the invention
The object of the present invention is to provide a kind of little, active high human truncated recombination soluble TRAIL-170 albumen of molecular weight that has;
Another object of the present invention is to the application of this human truncated recombination soluble TRAIL-170 albumen in the preparation anti-tumor medicine.
Technical scheme of the present invention is as follows:
Human truncated recombination soluble TRAIL-170 albumen provided by the invention is one and comprises the proteic fragment of amino acid/11 12～281TRAIL, in prlmary structure of protein, N-terminal is a proline(Pro), C-terminal is a glycine, contain 11 arginine, 6 Histidines, 11 Methionins, a halfcystine, iso-electric point PI=9.27 is a basic protein; Comprise two antiparallel β lamellas in the proteic secondary structure of human truncated recombination soluble TRAIL-170; This proteic cDNA sequence is made up of 510 Nucleotide, 170 amino acid of encoding.
The proteic cDNA sequence of this human truncated recombination soluble TRAIL-170 is a sequence 1;
The proteic aminoacid sequence of this human truncated recombination soluble TRAIL-170 is a sequence 2.
The application of human truncated recombination soluble TRAIL-170 albumen provided by the invention in the preparation anti-tumor medicine promptly can be used for preparing anti-tumor medicine.
Human truncated recombination soluble TRAIL-170 albumen provided by the invention is inducing apoptosis of tumour cell significantly, kills or/and suppress the growth of animal body inner tumour cell; With the TRAIL that generally uses in the world
95～281Fragment compares, TRAIL
112～281Have that molecular weight is little, the characteristics of the active height of tumor killing cell (protein concn of inducing 50% apoptosis rate is about 10ng/ml), compare TRAIL
95～281Proteic tumor killing cell is active high 20 times, is a potential antitumor drug that is worth exploitation.
Proteic being prepared as follows of human truncated recombination soluble TRAIL-170 of the present invention:
1. make up the pGEX-4T-TRAIL-170 plasmid vector
According to known people TRAIL cDNA sequence, designed two oligonucleotide primers of upstream and downstream, upstream primer is: CGG AAT TCC CCT AGT GAG AGA AAG AGG; Downstream primer is: CGG AAT TCTTAA CCA ACT AAA AAG GCC CC; With pSectagA-TRAIL is template, is the TRAIL cDNA fragment of 510bp with the PCR method amplification length; With the PCR product reclaim, purifying, connect with T4 DNA Ligase and to spend the night, be cloned in the pGEX-4T carrier, be built into pGEX-4T-TRAIL170 plasmid vector (Fig. 1, Fig. 1 are the structure synoptic diagram of pGEX-4T-TRAIL170 plasmid vector);
2. this plasmid is transformed DH5 α bacterium, screening positive clone, obtain the bacterial strain of expressing human truncated recombination soluble TRAIL-170 plasmid, from bacterial strain, extract plasmid, the plasmid that obtains is checked order and dna sequence analysis on 3100 sequenators, and the result proves: 421～930 base sequences in the TRAILcDNA full length sequence of the cDNA sequence of this plasmid and Gene Bank login are identical;
The pGEX-4T-TRAIL-170 plasmid is transformed the BL21 intestinal bacteria, add IPTG (50 μ M), 30 ℃ of shaking culture 4 hours, the centrifugal 10min of 6000rpm, abandon supernatant, PBS suspendible bacterial precipitation adds N,O-Diacetylmuramidase (100 μ g/ml), ultrasonic treatment thalline behind the ice bath, the centrifugal 30min of 16000rpm collects supernatant, crosses gsh-Sepharose-4B post, cut through the zymoplasm enzyme again, collect the protein solution that cuts down; This protein solution is human truncated recombination soluble TRAIL-170 albumen of the present invention; Through the SDS-PAGE electrophoresis showed, the TRAIL-170 purity of protein of gained is more than 85%, see Fig. 2, Fig. 2 is the electrophorogram of human truncated recombination soluble TRAIL-170 albumen of the present invention at colibacillary expression and purifying, among Fig. 2,1 is inductive BL21 bacterial strain not, 2 is inductive BL21 bacterial strain, 3 is inclusion body, 4 is the TRAIL-170 albumen of purifying, and 5 is GST albumen, and 6 is middle molecular weight protein standard, as shown in Figure 2, human truncated recombination soluble TRAIL-170 purity of protein of the present invention is more than 85%;
After measured, the proteic biological characteristics of human truncated recombination soluble TRAIL-170 of the present invention is:
Human truncated recombination soluble TRAIL-170 albumen of the present invention is a fragment that comprises amino acid/11 12-281 trail protein, in prlmary structure of protein, N-terminal is a proline(Pro), C-terminal is a glycine, contain 11 arginine, 6 Histidines, 11 Methionins, a halfcystine, iso-electric point PI=9.27 is a basic protein; Comprise two antiparallel β lamellas in this proteic secondary structure; The proteic cDNA sequence of this human truncated recombination soluble TRAIL-170 is made up of 510 Nucleotide, 170 amino acid of encoding;
The proteic cDNA sequence of human truncated recombination soluble TRAIL-170 of the present invention is a sequence 1;
The proteic aminoacid sequence of inventor's truncated recombination soluble TRAIL-170 is a sequence 2.
Appended drawings 1 is the structure synoptic diagram of pGEX-4T-TRAIL-170 plasmid vector; Accompanying drawing 2 is the electrophorogram of human truncated recombination soluble TRAIL-170 albumen of the present invention at colibacillary expression and purifying;
1 for inductive BL21 bacterial strain 2 not be inductive BL21 bacterial strain
3 is that inclusion body 5 is GST albumen
4 is the human truncated recombination soluble TRAIL-170 albumen of the present invention of purifying
6 is that middle molecular weight protein standard accompanying drawing 3-1 to Fig. 3-8 is the protein induced Jurkat apoptosis of human truncated recombination soluble TRAIL-170 of the present invention
The Flow cytometry synoptic diagram, present dose-dependently relation; Human truncated recombination soluble of the present invention
TRAIL-170 albumen treatment group is the apoptosis of inducing tumor cell significantly; Wherein: accompanying drawing 3-1: with the Jurkat cell control group of TRAIL-170 albumen processing, the apoptosis rate of cell is not 21.5%; The Jurkat apoptosis that accompanying drawing 3-2:100ng/ml TRAIL-170 albumen is handled, apoptosis rate is 89.55%; The Jurkat apoptosis that accompanying drawing 3-3:50ng/ml TRAIL-170 albumen is handled, apoptosis rate is 86.55%; The Jurkat apoptosis that accompanying drawing 3-4..25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 82.53%; The Jurkat apoptosis that accompanying drawing 3-5:12.5ng/ml TRAIL-170 albumen is handled, apoptosis rate is 79.53%; The Jurkat apoptosis that accompanying drawing 3-6:6.25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 66.68%; The Jurkat apoptosis that accompanying drawing 3-7:3.125ng/ml TRAIL-170 albumen is handled, apoptosis rate is 57.19%; The Jurkat apoptosis that accompanying drawing 3-8:1.56ng/ml TRAIL-170 albumen is handled, apoptosis rate is 45.53%; Accompanying drawing 4-1 to Fig. 4-8 is that the apoptotic fluidic cell of the protein induced MCF7 of human truncated recombination soluble TRAIL-170 of the present invention detects synoptic diagram; Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention is the apoptosis of inducing tumor cell significantly; Accompanying drawing 4-1: with the MCF7 cell control group of TRAIL-170 albumen processing, the apoptosis rate of cell is not 6.36%; The MCF7 apoptosis that accompanying drawing 4-2:1000ng/ml TRAIL-170 albumen is handled, apoptosis rate is 67.01%; The MCF7 apoptosis that accompanying drawing 4-3:500ng/ml TRAIL-170 albumen is handled, apoptosis rate is 55.29%; The MCF7 apoptosis that accompanying drawing 4-4:250ng/ml TRAIL-170 albumen is handled, apoptosis rate is 48.85%; The MCF7 apoptosis that accompanying drawing 4-5:100ng/ml TRAIL-170 albumen is handled, apoptosis rate is 44.35%; The MCF7 apoptosis that accompanying drawing 4-6:50ng/ml TRAIL-170 albumen is handled, apoptosis rate is 40.13%; The MCF7 apoptosis that accompanying drawing 4-7:25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 23.05%; The MCF7 apoptosis that accompanying drawing 4-8:12.5ng/ml TRAIL-170 albumen is handled, apoptosis rate is 17.81%; Accompanying drawing 5 is the tumor weight ratio of PBS group and human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention
Than synoptic diagram; Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention can significantly suppress little
The growth of mouse interior tumor cell, p=0.049＜0.05; Accompanying drawing 6 is the tumour size ratio of PBS group and human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention
Than synoptic diagram; Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention can significantly suppress little
The growth of mouse interior tumor cell, p=0.023＜0.05.
Embodiment
The human truncated recombination soluble TRAIL-170 albumen of purifying is handled various tumor cell line, as Jurkat clone (human T lymphocyte leukemia cell), MCF-7 clone (human breast cancer cell), KU-8 clone (people's penile cancer cell), U937 clone (human medullary leukemia cell), NCI-H929 clone and IM-9 clone (human myeloma cell), be apoptotic detection index with FITC-Annexin V and PI dyeing, the situation of flow cytometry TRAIL-170 inducing apoptosis of tumour cell, the result proves, TRAIL-170 has the effect of killing tumor cell widely, but different types of tumors cell sensitivity is different, wherein, Jurkat clone and MCF-7 clone are the highest to the susceptibility of TRAIL-170, the TRAIL170 protein concentration of inducing Jurkat cell 50% apoptosis rate about 10ng/ml, see accompanying drawing 3-1 to accompanying drawing 3-8 and accompanying drawing 4-1 to accompanying drawing 4-8;
Accompanying drawing 3-1 to Fig. 3-8 is the protein induced Jurkat cell of human truncated recombination soluble TRAIL-170 of the present invention
The Flow cytometry synoptic diagram of apoptosis presents the dose-dependently relation; Wherein: accompanying drawing 3-1: with the Jurkat cell control group of TRAIL-170 albumen processing, the apoptosis rate of cell is not 21.5%; The Jurkat apoptosis that accompanying drawing 3-2:100ng/ml TRAIL-170 albumen is handled, apoptosis rate is 89.55%; The Jurkat apoptosis that accompanying drawing 3-3:50ng/ml TRAIL-170 albumen is handled, apoptosis rate is 86.55%; The Jurkat apoptosis that accompanying drawing 3-4:25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 82.53%; The Jurkat apoptosis that accompanying drawing 3-5:12.5ng/ml TRAIL-170 albumen is handled, apoptosis rate is 79.53%; The Jurkat apoptosis that accompanying drawing 3-6:6.25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 66.68%; The Jurkat apoptosis that accompanying drawing 3-7:3.125ng/ml TRAIL-170 albumen is handled, apoptosis rate is 57.19%; The Jurkat apoptosis that accompanying drawing 3-8:1.56ng/ml TRAIL-170 albumen is handled, apoptosis rate is 45.53%;
Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention is the apoptosis of inducing tumor cell significantly;
Accompanying drawing 4-1 to Fig. 4-8 is that the apoptotic fluidic cell of the protein induced MCF7 of human truncated recombination soluble TRAIL-170 of the present invention detects synoptic diagram; Accompanying drawing 4-1 wherein: the MCF7 cell control group of handling with TRAIL-170 albumen, the apoptosis rate of cell is not 6.36%; The MCF7 apoptosis that accompanying drawing 4-2:1000ng/ml TRAIL-170 albumen is handled, apoptosis rate is 67.01%; Accompanying drawing 4-3; The MCF7 apoptosis that 500ng/ml TRAIL-170 albumen is handled, apoptosis rate are the MCF7 apoptosis that 55.29% accompanying drawing 4-4:250ng/ml TRAIL-170 albumen is handled, and apoptosis rate is 48.85%; The MCF7 apoptosis that accompanying drawing 4-5:100ng/ml TRAIL-170 albumen is handled, apoptosis rate is 44.35%; The MCF7 apoptosis that accompanying drawing 4-6:50ng/ml TRAIL-170 albumen is handled, apoptosis rate is 40.13%; The MCF7 apoptosis that accompanying drawing 4-7:25ng/ml TRAIL-170 albumen is handled, apoptosis rate is 23.05%; The MCF7 apoptosis that accompanying drawing 4-8:12.5ng/ml TRAIL-170 albumen is handled, apoptosis rate is 17.81%;
Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention is the apoptosis of inducing tumor cell significantly;
Animal for research: the Balb/C mouse, totally 10, be divided into two groups, 5 every group, one group is the PBS negative control, another group is TRAIL-170 albumen treatment group; Murine myeloma cell (SP2/0 cell, 4 * 10 with vitro culture
6/ only) together with TRAIL-170 albumen (100 μ g/ are only) or PBS, it is subcutaneous to be injected in mouse back, after 5 days with dosage TRAIL-170 albumen or PBS booster shots, put to death mouse after 21 days, measure the size and the weight that form tumour, the result shows, PBS group mouse back all has tumor growth, and size evenly, and the mouse that TRAIL-170 albumen is handled has not bearing tumor of two backs, a tumour is less, the size of two tumours is organized with PBS, and two groups data are carried out the t check, proves that the two has significant difference, see accompanying drawing 5 and accompanying drawing 6, accompanying drawing 5 compares synoptic diagram for the tumor weight of PBS group and human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention; Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention can significantly suppress the growth of mouse interior tumor cell, p=0.049＜0.05; Accompanying drawing 6 compares synoptic diagram for the tumour size of PBS group and human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention; Human truncated recombination soluble TRAIL-170 albumen treatment group of the present invention can significantly suppress the growth of mouse interior tumor cell, p=0.023＜0.05; Illustrate that TRAIL-170 albumen can bring into play the tumor killing cell effect in vivo, suppress growth of tumor.
TRAIL-170cDNA1：cccctagtga gagaaagagg tcctcagaga gtagcagctc acataactgggaccagagga agaagcaaca cattgtcttc tccaaactcc aagaatgaaaaggctctggg ccgcaaaata aactcctggg aatcatcaag gagtgggcattcattcctga gcaacttgca cttgaggaat ggtgaactgg tcatccatgaaaaagggttt tactacatct attcccaaac atactttcga tttcaggaggaaataaaaga aaacacaaag aacgacaaac aaatggtcca atatatttacaaatacacaa gttatcctga ccctatattg ttgatgaaaa gtgctagaaatagttgttgg tctaaagatg cagaatatgg actctattcc atctatcaagggggaatatt tgagcttaag gaaaatgaca gaatttttgt ttctgtaacaaatgagcact tgatagacat ggaccatgaa gccagttttt tcggggcctttttagttggc
TRAIL-1702：Pro Leu Val Arg Glu Arg Gly Pro Gln Arg Val Ala Ala His IleThr Gly Thr Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn SerLys Asn Glu Lys Ala Leu Gly Arg Lys Ile Asn Ser Trp Glu SerSer Arg Ser Gly His Ser Phe Leu Ser Asn Leu His Leu Arg AsnGly Glu Leu Val Ile His Glu Lys Gly Phe Tyr Tyr Ile Tyr SerGln Thr Tyr Phe Arg Phe Gln Glu Glu Ile Lys Glu Asn Thr LysAsn Asp Lys Gln Met Val Gln Tyr Ile Tyr Lys Tyr Thr Ser TyrPro Asp Pro Ile Leu Leu Met Lys Ser Ala Arg Asn Ser Cys TrpSer Lys Asp Ala Glu Tyr Gly Leu Tyr Ser Ile Tyr Gln Gly GlyIle Phe Glu Leu Lys Glu Asn Asp Arg Ile Phe Val Ser Val ThrAsn Glu His Leu Ile Asp Met Asp His Glu Ala Ser Phe Phe GlyAla Phe Leu Val Gly
Claims (3)
1. human truncated recombination soluble TRAIL-170 albumen, it is characterized in that, this albumen comprises a fragment of amino acid/11 12-281 trail protein, in prlmary structure of protein, N-terminal is a proline(Pro), and C-terminal is a glycine, contains 11 arginine, 6 Histidines, 11 Methionins, a halfcystine, iso-electric point PI=9.27 is a basic protein; Comprise two antiparallel β lamellas in this proteinic secondary structure; The proteic cDNA sequence of TRAIL-170 is made up of 510 Nucleotide, 170 amino acid of encoding.
2. by people's truncated recombination soluble TRAIL-170 albumen claimed in claim 1; ,TRAIL-170cDNA：cccctagtga gagaaagagg tcctcagaga gtagcagctc acataactgggaccagagga agaagcaaca cattgtcttc tccaaactcc aagaatgaaaaggctctggg ccgcaaaata aactcctggg aatcatcaag gagtgggcattcattcctga gcaacttgca cttgaggaat ggtgaactgg tcatccatgaaaaagggttt tactacatct attcccaaac atactttcga tttcaggaggaaataaaaga aaacacaaag aacgacaaac aaatggtcca atatatttacaaatacacaa gttatcctga ccctatattg ttgatgaaaa gtgctagaaatagttgttgg tctaaagatg cagaatatgg actctattcc atctatcaagggggaatatt tgagcttaag gaaaatgaca gaatttttgt ttctgtaacaaatgagcact tgatagacat ggaccatgaa gccagttttt tcggggcctttttagttggc
TRAIL-170：Pro Leu Val Arg Glu Arg Gly Pro Gln Arg Val Ala Ala His IleThr Gly Thr Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn SerLys Asn Glu Lys Ala Leu Gly Arg Lys Ile Asn Ser Trp Glu SerSer Arg Ser Gly His Ser Phe Leu Ser Asn Leu His Leu Arg AsnGly Glu Leu Val Ile His Glu Lys Gly Phe Tyr Tyr Ile Tyr SerGln Thr Tyr Phe Arg Phe Gln Glu Glu Ile Lys Glu Asn Thr LysAsn Asp Lys Gln Met Val Gln Tyr Ile Tyr Lys Tyr Thr Ser TyrPro Asp Pro Ile Leu Leu Met Lys Ser Ala Arg Asn Ser Cys TrpSer Lys Asp Ala Glu Tyr Gly Leu Tyr Ser Ile Tyr Gln Gly GlyIle Phe Glu Leu Lys Glu Asn Asp Arg Ile Phe Val Ser Val ThrAsn Glu His Leu Ile Asp Met Asp His Glu Ala Ser Phe Phe GlyAla Phe Leu Val Gly
The 3 one kinds of described human truncated recombination soluble TRAIL-170 of claim 1 albumen application in the preparation anti-tumor medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02116263 CN1189481C (en) | 2002-03-28 | 2002-03-28 | Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02116263 CN1189481C (en) | 2002-03-28 | 2002-03-28 | Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1448405A true CN1448405A (en) | 2003-10-15 |
| CN1189481C CN1189481C (en) | 2005-02-16 |
Family
ID=28680659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02116263 Expired - Fee Related CN1189481C (en) | 2002-03-28 | 2002-03-28 | Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1189481C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1958794B (en) * | 2005-11-03 | 2010-05-05 | 成都地奥九泓制药厂 | Method for preparing mutant code cDNA of apoptosis induction ligand related to human tumor necrosis factor, and application |
| CN102370987A (en) * | 2010-08-26 | 2012-03-14 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| WO2013037090A1 (en) * | 2011-09-16 | 2013-03-21 | 北京沙东生物技术有限公司 | Fusion protein comprising circularly permuted form of trail/apo2l, coding gene and use thereof |
| CN101365951B (en) * | 2005-08-16 | 2013-09-11 | 健泰科生物技术公司 | Apoptosis sensitivity to apo2l/trail by testing for 'galnac-t14 expression in cells/tissues |
-
2002
- 2002-03-28 CN CN 02116263 patent/CN1189481C/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101365951B (en) * | 2005-08-16 | 2013-09-11 | 健泰科生物技术公司 | Apoptosis sensitivity to apo2l/trail by testing for 'galnac-t14 expression in cells/tissues |
| CN1958794B (en) * | 2005-11-03 | 2010-05-05 | 成都地奥九泓制药厂 | Method for preparing mutant code cDNA of apoptosis induction ligand related to human tumor necrosis factor, and application |
| CN102370987A (en) * | 2010-08-26 | 2012-03-14 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| CN102370987B (en) * | 2010-08-26 | 2013-05-29 | 复旦大学 | Injection liposome entrapping antineoplastic pharmaceutical composition |
| WO2013037090A1 (en) * | 2011-09-16 | 2013-03-21 | 北京沙东生物技术有限公司 | Fusion protein comprising circularly permuted form of trail/apo2l, coding gene and use thereof |
| CN103534273A (en) * | 2011-09-16 | 2014-01-22 | 北京沙东生物技术有限公司 | Fusion protein comprising circularly permuted form of TRAIL/APO2L, coding gene and use thereof |
| US9289468B2 (en) | 2011-09-16 | 2016-03-22 | Beijing Sunbio Biotech Co. Ltd. | Fusion protein comprising circularly permuted form of trail/Apo2L, coding gene and use thereof |
| CN103534273B (en) * | 2011-09-16 | 2020-05-12 | 北京沙东生物技术有限公司 | Cyclized allosteric TRAIL/APO2L and coding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1189481C (en) | 2005-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101319247B (en) | IL-2 selective agonists and antagonists | |
| US5582822A (en) | Treatment of leukemia using interleukin 2 | |
| DK164174B (en) | A SUBSTANTLY PURE, NON-GLYCOLIZED HUMAN INTERLEUKIN-2 PROTEIN, PROCEDURE FOR THE PREPARATION OF THIS PROTEIN AND PHARMACEUTICAL PRODUCT CONTAINING THIS PROTEIN | |
| AU724940B2 (en) | Protein which induces interferon-gamma production by immunocompetent cell | |
| JP2831012B2 (en) | Use of recombinant colony stimulating factor-1 | |
| NZ259584A (en) | Cancer treatment using interleukin 10 activated peripheral blood mononuclear cells optionally combined with il-10 alone or in combination with il-2 or alpha interferon (alpha-ifn), to stimulate peripheral blood mononuclear cells | |
| CN1267223A (en) | Carcinostatic agents | |
| CN1448405A (en) | Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof | |
| CN101671390B (en) | Human interferon alpha derivatives and preparation and use of pegylated products thereof | |
| CN1448404A (en) | Human truncated recombinant soluble TRAIL-180 protein and application thereof in preparing tumor treatment medicine | |
| JPS63264500A (en) | Novel polypeptide and production thereof | |
| HU207099B (en) | Process for purifying reduced non glycosylated, recombinant human il and pharmaceutical composition comprising same | |
| US5871725A (en) | Use of IL-10 to stimulate peripheral blood mononuclear cell cytolytic activity | |
| EP0969859A1 (en) | The use of proteins extractable from animal organs for the preparation of medicaments for the treatment of pathological conditions characterized by hyperproduction of tumor necrosis factor (tnf) | |
| CN107083366A (en) | Express adoptive immunity cell of hirudin and its production and use | |
| CN1239516C (en) | Tumor necrosis factor relative cell death inducing ligand extracellular region mutation polypeptide and its prepn and use | |
| Miyakawa et al. | Characteristics of macrophage activation by gamma interferon for tumor cytotoxicity in peritoneal macrophages and macrophage cell line J774. 1 | |
| CN1298883A (en) | Preparing process and application of recombined human interleukin-11 | |
| JP2589094B2 (en) | Antineoplastic agent | |
| JP2004002251A (en) | Physiologically active complex | |
| CN1316436A (en) | Process for preparing water-soluble slow-releasing recombination protein | |
| CN101891826B (en) | Targeted hIL-10 recombinant protein and application thereof | |
| EP1033997B1 (en) | Method of mobilizing hematopoietic stem cells | |
| CN100335499C (en) | C-terminal amino acid lactone modified extrasin alpha-1 and its uses | |
| EP0318765A1 (en) | A modified gamma interferon dna sequences encoding it and process for producing it |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050216 Termination date: 20130328 |