General castration vaccine gene of livestock and poultry and recombination carrier
The application is the applying date: 2000.6.23, application number: 00107831.3, and title: the dividing an application of animal's castration vaccine gene and engineering body.
(1) technical field
Animal's castration vaccine gene of the present invention and recombination carrier are used to produce the domestic animals and fowls castration with luteinizing hormone releasing hormone (LHRH) genetic engineering subunit vaccine, belong to the biotechnology high-tech area.
(2) technical background
Luteinizing hormone releasing hormone (Luteinizing hormore releasing hormore, LHRH) be by a kind of decapeptide hormone of animal hypothalamus excretory, its main biological function is synthetic and secretion metakentrin (LH) and a follicle stimulating hormone (FSH) of control anterior lobe of hypophysis cell, these hormones can promote the normal development of sexual gland and sexual organ, keep the animal reproduction function.But the property associated hormone level of castration vaccine immunoregulation animal endocrine system, suppress the animality allelotaxis, make animal forfeiture sexual behaviour and sexual function, thereby prevent chaotic mating (causing the drove degeneration) and fight, promote growth of animal, improve that trunk is formed and meat (make Fresh ﹠ Tender in Texture and prevent smell of mutton), the raising price of deed.Its mechanism is after doing the vaccine immunity animal by LHRH synthetic antigen or recombinant antigen, to form LHRH antibody in vivo, in and endogenous LH RH, thereby significantly reduce sex hormone levels such as testosterone and oestrogenic hormon, reach the purpose of gentle castration.Compare with the traditional operation castration; the vaccine castration is not only simple and easy to do; give in the management and bring great convenience; be particularly suitable for large-scale cultivation and herd drove; and the castration that can prevent to perform the operation cause hemorrhage, infect and stress cause subtract food and weight loss; the vaccine castration is applicable to large animal or animalcule animalcule operations such as (difficulty) chickens, female or buck, children's age and adult animals, livestock and poultry and other animals in addition, moreover the vaccine castration can realize reversibility control by supporting technology.
Impel animal to produce the antibody of anti-LHRH by immunization method, with in and the physiological action of LHRH, thereby the growth that suppresses sexual gland is to reach the purpose of castration, its feasibility is confirmed by domestic and international many scholars, but great majority research all concentrates on synthetic peptide vaccine, though immune effect is remarkable, can't enter practical application because of cost is too high eventually.The color equality of king is expressed the LHRH/HBsAg fusion rotein in silkworm baculovirus, but also because of expression yields poorly, and purifying technique is loaded down with trivial details and fail to apply.
(3) summary of the invention
Technical problem the objective of the invention is the designing animal castration vaccine gene, structure can efficiently express the animal's castration vaccine recombination carrier of LHRH fusion rotein, can be used to develop high yield, high-quality, efficient, low-cost, technology is easy, be fit to scale production, easy to use, and safe, noresidue, the animal's castration recombinant vaccine of no potentially dangerous, immune animal substitutes traditional operation castration.
Technical scheme animal's castration vaccine gene provided by the present invention, its general formula is:
5 '------framework guarantees base, and------restriction enzyme site--protectiveness base--3 ' wherein, protectiveness base can be that A, T, G, C are optional to terminator to the LHRH gene to restriction enzyme site to the protectiveness base;
Restriction enzyme site is meant the point of contact of Restriction Enzymes such as Nco I, EcoR I, HindIII, Xho I, BamH I;
Framework guarantees that base can be that A, T, G, C are optional;
The LHRH gene is meant domestic animal LHRH gene, or poultry LHRH gene, or LHRH gene and the series connection of poultry LHRH gene.
Above-mentioned animal's castration vaccine gene, it is as follows to exemplify concrete gene order:
Domestic animal is used castration vaccine LHRH gene order---L1:
5′-GG
CCATGGCTGAGCATTGGTCTTATGGCCTGCGCCCAGGT
NcoI
TAATGAA
CTCGAGCA-3′
Terminator Xho I
Poultry is used castration vaccine LHRH gene order---L2:
5′-GG
CCATGGCTGAGCACTGGTCTTACGGCCTGCAGCCGGGT
NcoI
TAATGAA
CTCGAGCA-3′
Terminator Xho I
1 of the general castration vaccine LHRH of poultry/fowl gene order---L3:
5′-GG
CCATGGCTGAACACTGGTCCTACGGTCTGCGTCCGGGT
NcoI
GGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTG
GTCTTACGGTCTGCGCCCGGGT
TAATGAA
CTCGAGCA-3′
Terminator XhoI
2 of the general castration vaccine LHRH of poultry/fowl gene order---L4:
5′-GG
CCATGGCTGAACACTGGTCCTACGGTCTGCGTCCGGGT
Nco?IGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGGGTGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACACTGGTCCTACGGTCTGCGTCCGGGTGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGGGT
TAATGAA
CTCGAGCA-3′
Terminator Xho I
With the recombination carrier that above-mentioned animal's castration vaccine gene makes up, pET-32c LHRHn-N/X recombinant expression plasmid is to make up acquisition by the following method:
1.LHRH the annealing of gene fragment
With segmental normal chain of the animal's castration vaccine gene of synthetic and minus strand, being dissolved into concentration with the sterilization ultrapure water respectively is the 100pmol/ μ l solution of (being equivalent to 1.82 μ g/ μ l), respectively get 2 μ l and add mixing in the 72 μ l ultra-pure water, put and slowly cool to room temperature in the boiling water bath behind the 2min ,-20 ℃ frozen standby;
2.LHRH the enzyme of gene is cut
With NcoI and XhoI the LHRH gene after annealing is carried out double digestion, enzyme is cut product and is directly used in ligation;
3.pET-32c the extraction of plasmid, enzyme are cut and are reclaimed
After the extraction of pET-32c plasmid, the pET-32c plasmid is carried out double digestion with NcoI and XcoI.Get 10 μ l enzymes and cut product and carry out 1% agarose gel electrophoresis, reclaim enzyme and cut big fragment, put and freeze 5min in the liquid nitrogen, and melt in rearmounted 37 ℃ of water-baths, the centrifugal 10min of 10000r/min, it is ℃ frozen standby to draw supernatant-20;
4. connect
DNA ligation system is as follows:
The PET-32c double digestion reclaims product 2.5 μ l
The LHRH gene enzyme is cut product 7.5 μ l
Be used for immediately transforming behind 16 ℃ of reactions of DNA Ligation Kit Solution I 10 μ l said mixtures 30min;
5. the preparation of bacillus coli DH 5 alpha competent cell;
6. transform
Get 10 μ l connection product and transform 200 μ l bacillus coli DH 5 alpha competent cells, get the LB agar plate that the coating of 200 μ l converted products contains Amp 50 μ g/ml, flat board is put in 37 ℃ of incubators and was cultivated 18 hours, single bacterium colony after picking transforms, extract plasmid after inoculating the LB meat soup enlarged culturing that contains Amp, be recombination carrier pET-32c LHRHn-N/X recombinant plasmid.
Beneficial effect animal's castration vaccine gene provided by the present invention and recombination carrier thereof, can efficiently express LHRH-Trx fusion rotein (expression amount is more than 30%), be used to produce domestic animals and fowls castration luteinizing hormone releasing hormone (LHRH) genetic engineering subunit vaccine.Because birds have an amino acid different with mammiferous LHRH, made up the recombinant expression plasmid (L1, L2, L3, L4) of expressing birds, mammals and the alternate placed in-line LHRH gene of different quantities birds/mammals respectively.Through verification test, recombination carrier provided by the present invention conforms in every respect to industrialized requirement at expression amount, immunogenicity, production simplicity, castration validity, security, cost etc.Make vaccine with it, produce simple and easy, with low cost, safe and effective.In 4 kinds of plasmids, the L1 expression product is effective to domestic animal, and L2 is effective to poultry, and L3 and L4 domestic animals and fowls are general, and the effectiveness of aspects such as L4 immunity generation phase and immune duration is better than L3 again, can be selected according to various application need.
Adopt this project body to produce each 3 batches in L1, L2, L3 and L4 seedling sample under laboratory condition, it expresses stable yield, and the expression product protein content all reaches more than 30% of bacterial protein amount.Expression product is all stable to have good immunogenicity, shows: the LHRH standard antibody generation specific reaction of (1) expression product and Sigma company; (2) can effectively excite the high LHRH antibody of tiring of generation behind the immune animal, specific reaction takes place with LHRH in this antibody capable in vitro tests.Immune mouse is 210 altogether, 50 of rabbits, 30 of native chickens, 640 of pigs, 6 of cats, 4 of dogs all can effectively excite antibody behind the immune animal, observation in sexual maturing period, in each side Comprehensive Assessments such as sexual behaviour, sexual function, sex hormone level, sexual organ development's inhibition, effectively castration is obviously improved meat, and can obviously promote weightening finish and improve the price of deed.With the buck is example, and the average testicular weight of immune group is 1.32 ± 0.38g, and the average testis of control group heavily is 3.18 ± 0.47g, and histological observation confirms, the atrophy of immune group parenchyma of testis does not have sperm more and forms ability (sperm is arranged individually, but do not have vigor during biopsy).
(4) description of drawings
Fig. 1. recombinant plasmid pET-32c LHRH
nThe structure of (L1, L2, L3, L4)-N/X
Fig. 2. different IP TG concentration is induced LHRH
1The influence of-Trx (L1) expressing fusion protein output
1.?0mM?IPTG 2.?0.05mM?IPTG 3.?0.1mM?IPTG
4.?0.5mM?IPTG 5.?1.0mMIPTG 6.?2.0mM?IPTG
7,8,9. 2.0mM IPTG (different induction time) M. protein molecular weight sign
Fig. 3. repeatedly transform and express LHRH
3-Trx (L3) the equal efficient stable of fusion rotein output (1mMIPTG induces 4h)
Rabbit testis size variation behind Fig. 4 .LHRH1-Trx (L1) fusion protein immunization
1,2.LHRH-Trx (L1) fusion rotein intradermal injection group 3,4.LHRH-Trx fusion rotein intramuscular injection group
5,6.PET-32c carrier proteins immune group 7,8. blank group
Fig. 5 .LHRH
1Rabbit testicular histology behind-Trx (L1) fusion protein immunization changes
A. normal control rabbit testis tissue section B. expression product immunize rabbit testis tissue section
(5) embodiment
Embodiment:
1.LHRH the design of gene and synthetic
Aminoacid sequence design gene according to birds, mammals LHRH adds respectively at 5 ' end and 3 ' end
Two restriction enzyme sites of last NcoI and XhoI and protectiveness base are used the automatic dna synthesizer synthetic gene.
1.1. domestic animal is used vaccine LHRH gene order---L1:
5′-GG
CCATGGCTGAGCATTGGTCTTATGGCCTGCGCCCAGGT
NcoI
TAATGAA
CTCGAGCA-3′
Terminator XhoI
1.2. poultry is used vaccine LHRH gene order---L2:
5′-GG
CCATGGCTGAGCACTGGTCTTACGGCCTGCAGCCGGGT
NcoI
TAATGAA
C?TCGAGCA-3′
Terminator XhoI
1.3. 1 of the general vaccine LHRH of poultry/fowl gene order---L3:
5′-GG
CCATGGCTGAACACTGGTCCTACGGTCTGCGTCCGGGT
NcoIGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGGGT
TAATGAA
CTCGAGCA-3′
Terminator XhoI
1.4. 2 of the general vaccine LHRH of poultry/fowl gene order---L4:
5′-GG
CCATGGCTGAACACTGGTCCTACGGTCTGCGTCCGGGT
NcoIGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGGGTGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACACTGGTCCTACGGTCTGCGTCCGGGTGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGGGT
TAATGAA
CTCGAGCA-3′
Terminator XhoI
2.LHRH gene clone (Fig. 1)
2.1.LHRH the annealing of gene fragment
With segmental normal chain of the animal's castration vaccine gene of synthetic and minus strand, being dissolved into concentration with the sterilization ultrapure water respectively is the 100pmol/ μ l solution of (being equivalent to 1.82 μ g/ μ l), respectively get 2 μ l and add mixing in the 72 μ l ultrapure waters, put and slowly cool to room temperature in the boiling water bath behind the 2min ,-20 ℃ frozen standby.
2.2.LHRH the enzyme of gene is cut
With NcoI and XhoI the LHRH gene after annealing is carried out double digestion.Enzyme is cut product and is directly used in ligation.
2.3.pET-32c the extraction of plasmid, enzyme are cut and are reclaimed
The extraction alkaline lysis of pET-32c plasmid, work such as reference literature [U.S.] J. Sa nurse Brooker, the method that " molecular cloning experiment guide " introduced.With NcoI and XhoI the pET-32c plasmid is carried out double digestion.Get 10 μ l enzymes and cut product and carry out 1% agarose gel electrophoresis, reclaim enzyme and cut big fragment, put and freeze 5min in the liquid nitrogen, and melt in rearmounted 37 ℃ of water-baths, the centrifugal 10min of 10000r/min, it is ℃ frozen standby to draw supernatant-20.
2.4. connect
DNA ligation system is as follows:
The pET-32c double digestion reclaims product 2.5 μ l
The LHRH gene enzyme is cut product 7.5 μ l
Be used for immediately transforming behind 16 ℃ of reactions of DNA Ligation Kit Solution I 10 μ l said mixtures 30min.
2.5. the preparation of competent cell
Work such as reference literature [U.S.] J. Sa nurse Brooker, the method that " molecular cloning experiment guide " introduced prepares the bacillus coli DH 5 alpha competent cell.
2.6. transform
Get 10 μ l connection product and transform 200 μ lDH5 α competent cells, work such as concrete operations reference literature [U.S.] J. Sa nurse Brooker, the method that " molecular cloning experiment guide " introduced is carried out.Get the LB agar plate that the coating of 200 μ l converted products contains Amp 50 μ g/ml, establish the competent cell contrast (positive control) that unconverted competent cell contrast (negative control) and pET-32c plasmid transform simultaneously.Flat board is put in 37 ℃ of incubators and was cultivated 18 hours.
2.7. the enzyme of recombinant plasmid is cut screening
PET-32c plasmid multiple clone site has EcoRI and HandIII restriction enzyme site, and these two restriction enzyme sites should disappear after inserting the LHRH gene, and NcoI and XhoI restriction enzyme site still exist.Principle in view of the above, single bacterium colony after picking transforms, inoculation is extracted plasmid after containing the LB meat soup enlarged culturing of Amp, carries out single endonuclease digestion with HindIII, EcoRI, NcoI and XhoI respectively, selects the disappearance of HindIII and EcoRI restriction enzyme site and positive colony that NcoI and XhoI restriction enzyme site still exist.
2.8. the sequencing of recombinant plasmid
Select the recombinant plasmid of cutting evaluation through enzyme, as sequencing primer, company limited carries out sequencing by precious biotechnology (Dalian) with T7 Terminater primer.
3.pET-32c LHRH
nThe expression of-N/X recombinant plasmid in e. coli bl21 (DE3)
3.1.BL21 (DE3) preparation of competent cell
The same 1.2.5 of method.
3.2. transform
Extract in a small amount through the recombinant plasmid of sequencing and pET-32c plasmid transformed into escherichia coli BL21 (DE3) competent cell respectively with alkaline lysis, method is with 2.6.
3.3. the expression of recombinant plasmid in BL21 (DE3)
Picking recombinant plasmid transformed colony inoculation 5ml contains the LB meat soup of Amp 50 μ g/ml, and 37 ℃ of shaking overnight incubation (rotating speed is 250rpm, down together) are inoculated in 30ml by 1% inoculum size to contain in the LB meat soup of Amp 50 μ g/min next day, are cultured to OD in 37 ℃ of shaking tables
600Reach about 0.5, take out 1ml bacterium liquid and put the centrifugal 1min of 2000r/min in the Eppendorf pipe, it is frozen standby in-20 ℃ to abandon supernatant, as inducing preceding contrast, all the other cultures adding final concentrations are that the IPTG of 1mM carried out abduction delivering 3-4 hour, get 1ml and induce the bacterium liquid same centrifugal supernatant of abandoning in back to keep precipitation.Simultaneously pET-32c plasmid transformed bacteria is operated in contrast equally.
3.4.SDS polyacrylamide gel electrophoresis (SDS-PAGE)
To induce preceding thalline, induce back recombinant plasmid transformed bacterium and induce back pET-32c vector plasmid transformed bacteria precipitation to add isopyknic 2 * carrier buffer with distilled water is resuspended, boil 5min, respectively get 10 μ l and carry out discontinuous SDS-PAGE (concentrating glue 5%, separation gel 13%).After electrophoresis finished, gel dyeed with Xylene Brilliant Cyanine G (R250).Carry out the band gray scale scanning with the gel imaging treatment system, measure the ratio of expressed fusion protein and bacterial protein.
3.5. the solubility of expressing protein
By 1% inoculum size inoculation 100ml LB meat soup, 37 ℃ of shaking tables are cultured to OD with LHRH-pET-32c plasmid transformed bacteria overnight culture
600During=0.5 left and right sides, add IPTG to final concentration 1mM, after continuing to cultivate 4h, the centrifugal supernatant of abandoning, all bacterial sediment is resuspended with 10ml PBS (pH7.4), ultrasonic disruption (ice bath) 5min, ultrasonic power is 240W, supernatant is transferred in another container after centrifugal, and precipitation is resuspended with 10ml PBS, respectively get 50 μ l supernatants and the precipitation suspension add isopyknic 2 * load sample buffer, carry out SDS-PAGE; Simultaneously, pET-32c plasmid transformed bacteria being carried out above-mentioned same operation compares.Establish the full bacterium contrast of not using ultrasonic treatment in addition.Gel is carried out the content that gray scale scanning is determined target protein.
4.LHRH-Trx the immunogenicity of fusion rotein is identified
4.1. experimental animal
200 of mouse, 50 of rabbits, 30 of native chickens, 600 of pigs, 6 of cats, 4 of dogs.
4.2. immunization protocol:
With preparation such as freund's adjuvant and white-oil adjuvant vaccine, by immunization routes such as intradermal injection and intramuscular injection injection animal, immunizing dose 0.2-2ml does not wait with expression product, and the apparent motion object is great little and decide.Generally immunity before the animality maturation.
4.3. immune animal sexual function and sexual organ inspection
4.3.1. sexual function inspection
After sexual maturing period, experimental animal and different in nature healthy adult animal of the same race are closed situations such as foster, observation sexual behaviour, sex character and fecundity.
4.3.2. sexual gland, sexual organ inspection
Analyse inspection, gather testis, ovary, one is put in the neutral formalin fixing immediately, does the tissue slice analysis, and it two is weighed, measures size and check that testis has or not sperm and motility of sperm etc.
Interpretation of result:
1. the four kinds of recombinant plasmids that can stablize, efficiently express the LHRH-Trx fusion rotein
4 kinds of recombinant expression plasmids of expressing birds, mammals and the alternate placed in-line LHRH fusion rotein of different quantities birds/mammals have been made up.Sequential analysis shows that gene is synthetic and it is correct to insert.Plasmid transformed into escherichia coli repeatedly after preserving, the immunogenicity of expression amount and expression product is all very stable, and expression level is all the time at more than 30% of bacterial protein.
2. the expression product of solubility
Realized the solubility expression of LHRH-Trx fusion rotein, almost completely there be (but not inclusion body) in expression product with soluble form.With the osmotic shock method LHRH fusion rotein and pET-32c carrier proteins are extracted, bacterium can discharge the LHRH-Trx fusion rotein after height oozes processing singlely in LHRH reorganization as a result, and purity reaches more than 90%, and pET-32c empty carrier albumen still is present in the thalline and can not discharges.For extracting and the purifying expression product prepares vaccine great convenience is provided.
3. expression product has very strong LHRH antigenicity
Expression product and LHRH antibody have good reactivity, and this reaction can be blocked by the LHRH standard substance; Immune animal can effectively excite LHRH antibody, in and endogenous LH RH, thereby significantly reduce sex hormone levels such as testosterone and FSH, reach the purpose of gentle castration, and vaccine immunity can prevent to perform the operation that castration causes is hemorrhage, infects and stress cause subtracts food and weight loss.