CN1417223A - CR1 gene related to cell reconstitution, conduction and death - Google Patents
CR1 gene related to cell reconstitution, conduction and death Download PDFInfo
- Publication number
- CN1417223A CN1417223A CN02153656A CN02153656A CN1417223A CN 1417223 A CN1417223 A CN 1417223A CN 02153656 A CN02153656 A CN 02153656A CN 02153656 A CN02153656 A CN 02153656A CN 1417223 A CN1417223 A CN 1417223A
- Authority
- CN
- China
- Prior art keywords
- gene
- cell
- primer
- seq
- apoptosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a human functional gene, especially CR-1 gene related to cell reconstitution, conduction and death. The gene is obtained through the comprehensive technological process of cDNA selection, EST location, genome DNA sequence analysis, PCR reaction and cloning end expanding, etc. Experiments including Northern and Western cross breeding detection of CR-1 gene expression in tumor cell, RNA interference immunohitochemistry detection of the expressino of CR-1 in myocardial tissue of myocardial disease patient, systemic research of the expression of CR-1 interacted protein and CR-1 gene in coliform bacteria and euaryotice cell, etc. show that the gene may be used as the target site in clinical diagnosis and treatment of myocardial disease and tumors.
Description
Technical field:
The present invention relates to a kind of human functional gene, particularly relate to the gene relevant with cell reconstitution, conduction and apoptosis, illustrate the Regulation Mechanism of this gene, especially the effect in myocardial cell's reconstruct, tumor cell proliferation and apoptosis, the diagnosis and the control that can be cardiac muscle and tumor disease provide effective means.
Background technology:
Cell reconstitution, conduction and apoptosis are relevant with many human diseasess, as think that at present myocardial cell's reconstruct and apoptosis play an important role in heart failure; The conduction of cell information is relevant with the generation of apoptosis and tumour.Research and cell reconstitution, conduction and apoptosis-related genes or regulatory gene are for the diagnosis of human diseases with treat that especially myocardosis and tumour are significant, as myocardium development gene MyoD and Myogenin regulation and control myocardial cell's propagation and differentiation; Study of tumor suppressor genes Rb and P107 generegulation cardiac muscle are grown; Transmit relevant G protein gene with cell signal, relevant as the overexpression inhibition apoptosis of Bcl-2 with the tumour generation; Pass through regulation and control serine kinase enzymic activity with the protein bound RAS albumen of film G, suppress apoptosis, cause cell reconstitution and vicious transformation takes place.In recent years studies show that of relevant signal pathway, phosphoric acid acyl inositol 3 ' kinases (PI3 ' K) be inhibitor of apoptosis protein kinases (AKT) with apoptosis-related, tyrosine phosphorylation enzyme shp2 can regulate RAS activation AKT, makes rat embryo fibroblast cell reconstruct; And the cancer suppressor gene PTEN that suppresses serine kinase can antagonism AKT with the generation of prevention or treatment tumour.But, do not see the report that has individual gene and cell reconstitution, conduction and apoptosis that dependency is all arranged so far as yet.Therefore, provide a kind of and cell reconstitution, conduction and the related gene of apoptosis, may have pleiotropy, as cardiac muscle or the diagnosis of tumour illness or the target position of treatment.Goal of the invention:
The objective of the invention is to illustrate with myocardial cell's reconstruct and with tumour cell information and conduct and apoptosis-related genes CR-1, disclose its Regulation Mechanism, blocking-up stimulates the signal conduction of myocardial cell's reconstruct and apoptosis and tumour cell effectively, for diagnosis with prevent and treat cardiovascular and tumor disease is opened up valuable treatment means.
Summary of the invention:
The present invention is by adopting a kind of special cDNA cloning process [true Sciences63 of Life (17): 1555-1562,1998], the promptly comprehensive cDNA of employing selects, the EST location, genomic dna sequence is analyzed, PCR reaction and clone terminal extension technology etc., EST (expressed sequence tag) database to NCBI is retrieved, from two EST clone (AX014823) (AX013073) synthetic primers, with people's skeletal muscle cDNA library as template, obtain 755bp cDNA fragment through PCR, 142 amino acid whose albumen of this cDNA fragment coding, this albumen is named as CR-1.The present invention studies the function of CR-1 gene by the following technical solutions: 1), with Western blot at protein level, prove that CR-1 has higher expression in human liver cancer cell 7721; 2), with RNAi (RNA perturbation technique), make the significantly downward modulation on rna level of CR-1 gene, cause liver cancer cell 7721 apoptosis, illustrate that CR-1 is relevant with the generation of tumour; 3), adopt yeast two-hybrid system, the myomesin 1 (skelemin) that prove CR1 and participate in Muscle contraction albumen myoglobulin heavy chain is (XM012744), myosin regulates light chain MRLC2 (AF363061), participate in the interaction such as existence such as β-Hydratase, phosphoenolpyruvate (XM008524) gene of etc.ing of muscle line shape flesh M band prozyme system.Known MRLC2 phosphorylation plays a crucial role in Muscle contraction, also plays an important role in the Actin muscle of nonmuscle cells and myosin interact.Report was once arranged, in the myocardial hypertrophy patient, detected the MRLC2 transgenation.Prompting CR-1 can and shrink in the unit and play important regulation in regulation and control muscle cell reconstruct; (XM010886) there are interaction in CR-1 and eukaryotic translation initiation factor 3 subunits 5 (eIF3subunit 5).Eukaryotic translation initiation factor plays an important role in tumor growth, and usually the eukaryotic initiation factor high expression level will speed up the cell growth, causes cell to enter the cell cycle in early days and quickens its propagation and differentiation.The interaction of CR-1 and eIF3 subunit 5 discloses itself and tumorigenic dependency.In addition, the present invention shows that also there are interaction in CR-1 and MRIP-1 and MRIP-2.MRIP-1 gene (AF359283) is made up of 875 amino acid, includes Ras, PH and contain the ADP ribose factor (Arf GAP) territory and three ankyrin tumor-necrosis factor glycoproteinss that zinc refers to; 663 amino acid of MRIP-2 gene (AF411132) coding.MRIP-1 and MRIP-2 have tangible homology, and both all contain similar but different PH, Arf GAP, ankyrin functional domain, and the N end of different is MRIP-1 contains the Ras functional domain, and the N of MRIP-2 end contains Semen Myristicae esterification (myristoylated) sequence.The yeast two-hybrid experiment further is positioned CR-1 and the proteic interaction of MRIP-1 for the Ras territory, and Ras subfamily gtpase protein such as P21 Ras are the sub-switches of a component, regulates cell proliferation and differentiation by getting in touch between control after birth acceptor and the signal pathway; 4), adopt the immunohistochemical methods method, the expression of research CR-1 gene in cardiac muscular tissue proves that the CR-1 gene expresses lower in ACUTE MYOCARDIAL INFARCTION IN THE AGED patient's cardiac muscular tissue.In sum, β-Hydratase, phosphoenolpyruvate that CR-1 gene of the present invention can be regulated the myomesin 1 of light chain, myoglobulin heavy chain with myosin in the muscle tissue and participate in the ATP energy metabolism the combine composition and the contraction of regulation and control muscle cell are relevant with the generation of myocardial cell's reconstruct or skeletal muscle disease; The CR-1 gene can participate in the conduction of cell information simultaneously, regulates the proliferation and differentiation and the apoptosis of cell, and is relevant with the generation of tumour.The invention still further relates to the expression of CR-1 gene in intestinal bacteria and eukaryotic cell and the preparation method of CR-1 antibody.The invention effect:
The present invention has obtained a new CR-1 gene from human genome, methods such as using yeast double cross, Western, Northern, RNAi, immunohistochemical methods have been studied the effect of CR-1 in cell reconstitution, conduction and apoptosis, in yeast and intestinal bacteria, set up the expression of CR-1, this gene and expression product thereof for be used for the cardiac muscle and the diagnosis of tumour illness or treatment provide may and foundation.
As to the further specifying of invention, but do not limit the scope of the invention by the following examples.
The clone of embodiment 1CR-1 gene:
The present invention has adopted a kind of special cDNA cloning process, and [Life Sciences 63 (17): 1555-1562,1998], the promptly comprehensive cDNA of employing selects, the EST location, genomic dna sequence is analyzed, technology such as PCR reaction and the terminal extension of clone, combination according to related several key elements is retrieved EST (the expressed sequence tag) database of NCBI, the result shows, there are two EST clones (AX014823) (AX013073) to contain 671 base pairs, this sequence and any known protein sequence are all inequality, then two primers have been synthesized
Primer A:AGCGCGGTGAAGCGGGGGTGGGATCTG (SEQ ID No1)
Primer B:ATAACTTTATTTGCCTTTGGTGG (SEQ ID No2)
(available from Clontech company) is template with human skeletal muscle cDNA library, adopts primer A and primer B to carry out the PCR reaction.The PCR condition be 93 ℃ 2 minutes, thereupon with 93 ℃ 30 seconds, 62 ℃ of 30 seconds and 72 ℃ carried out 30 circulations in 1 minute, last 72 ℃ were extended 4 minutes, and agarose electrophoresis has shown the PCR product of one~0.6Kb, further the method for extending with end products (promptly synthetic two primers, one of them primer is from 0.6Kb PCR product, another primer carries out primary and secondary PCR from the cDNA carrier library), obtained the cDNA fragment (SEQID No 3) of a 756bp.The coding region of this cDNA is 145-570bp, 142 the amino acid whose albumen (SEQ ID No 4) of encoding, this sequence is that the 43bp place has a terminator sequence (TAG) before the coded protein initiation site, has further proved the accuracy of this albumen initiation site.At 3 ' of cDNA-terminal 726bp place (AATAAA) sequence is arranged, shown the integrity of this cDNA.This unnamed gene is CR-1 (cell regulating factor Cell Regulator 1).
SEQ?ID?No?3
gagtagttct?cctgggtccg?ctctgcgggc?ttctgggaga?tg
tagtttct?ggtctgtagg?60
caggacggaa?ggagcggggg?aggcccctta?cgcaaactac?aattcccggc?ggggagcgcg120
gtgaagcggg?ggtgggatct?gaac
atggcg?gcggtggtag?ctgctacggc?gctgaagggc180
cggggggcga?gaaatgcccg?cgtcctccgg?gggattctcg?caggagccac?agctaacaag240gcttctcata?acaggacccg?ggccctgcaa?agccacagct?ccccagaggg?caaggaggaa 300cctgaacccc?tatccccgga?gctggaatac?attcccagaa?agaggggcaa?gaaccccatg 360aaagctgtgg?gactggcctg?ggccatcggc?ttcccttgtg?gtatcctcct?cttcatcctc 420accaagcggg?aagtggacaa?ggaccgtgtg?aagcagatga?aggctcggca?gaacatgcgg 480ttgtccaaca?cgggcgagta?tgagagccag?aggttcaggg?cttcctccca?gagtgccccg 540tcccctgatg?ttgggtctgg?ggtgcagacc?tgaggagcgc?tgcgaccctc?ctaggctatt 600gactgttaag?tcctcaggtt?tggcccagat?tccagttcgt?gcctctgagg?tccaccagag 660ggcgcatgaa?gcccaggctg?ttgccaaacc?ctaccctgcc?ccacaccaag?gagccagcca 720aaggca
aata?aagttattga?gtgtttagta?gaaagg 756 SEQ?ID?No?4MAAVV?AATAL?KGRGA?RNARV?LRGIL?AGATA?NKASH?NRTRA?LQSHS?SPEGK 50EEPEP?LSPEL?EYIPR?KRGKN?PMKAV?GLAWA?IGFPC?GILLF?ILTKR?EVDKD?100RVKQM?KARQN?MRLSN?TGEYE?SQRFR?ASSQS?APSPD?VGSGV?QT 142
Embodiment 2 usefulness Western hybridization detects the expression of CR-1 albumen in kinds of tumor cells: cultivate cos7 cercopithecus aethiops renal epithelial cell with 5ml RPMI-1640 (Gibco company product) nutrient solution respectively at the 25ml Tissue Culture Flask in the carbonic acid gas incubator, 7721 human liver cancer cells, 7402 human liver cancer cells, HT29 people's rectum cancer cell, the A549 human lung carcinoma cell, K562 people's chronic leukemia cell, reach about 90% to fraction of coverage, with cell harvesting in 1 * PBS of 5ml precooling (in the present embodiment all ingredients and routine operation method according to " molecular cloning experiment guide " second edition in explanation preparation), centrifugal 5 minutes collecting cells of 3000rpm.Add 1: 1 freshly prepared lysate of cell volume, ice was educated 1 hour.4 ℃ 10,000rpm collected supernatant in centrifugal 15 minutes in new pipe, Xylene Brilliant Cyanine G method protein quantification.Get each sample equivalent total protein and add isopyknic 2 times of sample-loading buffers respectively, the boiling water thermally denature is the 15%SDS-PAGE gel electrophoresis after 5 minutes, changes pvdf membrane.Film at first is dipped in and contained in 5% (w/v) skim-milk TBS-T solution on the room temperature shaker platform incubation sealing 2 hours, with TBS-T (1M Tris HCl at pH 7.5 20ml, 5M NaCl 26.7ml, Tween 20 1ml are in 1 L water) the room temperature rinse, the sealing bag of packing into, be incubated overnight TBS-T room temperature rinse 3 times in room temperature with 1: the 500 anti-CR1 antibody of rabbit.Pack in the new sealing bag, with 1: 5,000 two anti-(the anti-HRP-horseradish peroxidase of rabbit) incubation, TBS-T room temperature rinse 3 times.ECL method (operating by the Santa Cruz Biotechnology company description of product) detects.The result show CR-1 albumen in cell 7721, express the highest, secondly be 7402, in cells such as HT29, express lower (Fig. 1).
It is the RNA of a two strands that RNA disturbs (RNAi), but its induced sequence PTGS specifically, thus the expression of suppressor gene.
Synthetic oligodeoxynucleotidecombination:
5′GATCCGAGCCACAGCTAACAAGGCTTTTTTAAGCCTTGTTAGCTGTGGCTCT?3′(SEQ?ID?NO5)
5′CTAGAGAGCCACAGCTAACAAGGCTTAAAAAAGCCTTGTTAGCTGTGGCTCG?3′(SEQ?ID?NO6)
A pair of primer mixes also annealing, be cloned into pBSKU6 carrier (Liu waits 2000 the 10th volumes of high-tech communication the 8th phase 6-9 page or leaf quietly) and (Ren-Huan Xu BRAIN RESEARCH 899<2001 〉, 10-19).
Synthetic primer:
Primer C:5 ' ATAACGCGTCCCGGGTGGTAAACCGTGCA3 ' (SEQ ID NO7)
Primer D:5 ' TTAACGCGTGAGCTCAAGGTCGGGCAGGAA3 ' (SEQ ID NO8)
Pcr amplification goes out to be embedded with the segmental U6 section of RNAi from the pBSKU6 carrier that makes up, the Mlu I site of subclone to pEGFP-C1 (CLONTECH company) carrier.
With product LipofectAMINE 2000 Reagent of GIBCO company, by its specification sheets provide step with the pEGFPC1-U6-RNAi transfection to liver cancer 7721 cells (Shanghai cell institute of Chinese Academy of Sciences cell bank), carry total RNA with the Trizol of bio-engineering corporation (Sangon) reagent after 2-3 days.Adopt primer mark system of Clontech company, with CR-1 coding region gene α-
32As probe, carry out Northern hybridization behind the P-dATP mark, with the 7721 cells contrast that does not have transfection.The result shows, uses the RNAi technology, makes the CR-1 gene significantly reduce (Fig. 2) at rna level.
Cell after the transfection with two weeks of G418 (nutrient solution that contains G418 100 μ g/ml changed liquid once in 2 days) screening, choose positive colony.7721 cells of former strain of 7721 cells and transfection pEGFPC1-U6-RNAi obtain cell suspension with 0.25% trypsinase, 0.02%EDTA digestion respectively, centrifugal collecting cell, with citrate buffer solution (0.25mol/L sucrose, the 40mmol/L citric acid, PH7.6) re-suspended cell dropwise adds with 75% ice-cold ethanol again, handled 30 minutes, wash twice with PBS, add 37 ℃ of water-baths of stationary liquid (propidium iodide 20 μ g/ml, RNAseA 50 μ g/ml) 30 minutes.Behind the 200 order nylon net filters, flow cytometer (FACSCalibur of U.S. Becton Dickinson company) detects.The result shows, it is 17.65% that 7721 cells of transfection pEGFPC1-U6-RNAi enter the G0-G1 phase, entering the G2-M phase is 61.11%, and the contrast of untransfected is respectively 43.32% and 35.74%, 7721 cells that transfection pEGFPC1-U6-RNAi is described are stagnated in G2 phase (Fig. 3), and the 7721 apoptosis numbers of transfection pEGFPC1-U6-RNAi are 29.76% (contrast of untransfected is 4.44%), cause that 7721 cells have apoptosis (Fig. 4) largely after showing transfection pEGFPC1-U6-RNAi.
According to two primers of CR-1 sequences Design, primer E contains BamH I restriction enzyme sites
GGATCC, primers F contains Sal I restriction enzyme sites
GTCGAC, be used for two ends insertion pGBKT7 carrier and (, Cat:#K1612-1), and guarantee that frame is correct available from Clontech company.
Primer E:ATTA
GGATCCAAATGGCGGCGGTGGTAGCTGCT (SEQ ID No9)
Primers F: AATT
GTCGACTCAGGTCTGCACCCCAGACCC (SEQ ID No10)
With the CR-1 cDNA that has cloned is template, adopts Clontech Advantage eDNA PCR kit to carry out PCR, and reaction conditions is 98 ℃ of warm starts 2 minutes; 94 ℃ of sex change 30 seconds; 62 ℃ of renaturation 30 seconds, 72 ℃ were extended 45 seconds, carried out 30 circulations, and reaction system is 50 microlitres.Reclaim the PCR product from glue, enzyme is cut the back and is linked to each other with the pGBKT7 plasmid vector that BamH I-Sal I enzyme is cut, and obtains the pGBKT7/CR-1 recombinant plasmid.Describe according to CLONTECH MATCHMAKER GAL4Two-Hybrid System 3 specification sheetss, the fresh competent cell of preparation yeast AH109, transform the pGBKT7/CR-1 plasmid with the PEG/LiAc method, on the SD substratum that lacks tryptophane, cultivate, obtain transformant for expressing the engineering yeast AH109/BD-CR1 of bait protein CR-1.
Employing is structured in people's skeletal muscle cDNA library (U.S. Clontech company, Cat:#HY4047AH) the interactional with it albumen of screening on the pACT2 carrier.Constructed pGBKT7/CR-1 recombinant plasmid is described a large amount of engineering yeast AH109/BD-CR1 that transform, screening about 4 * 10 on the SD substratum that lacks VITAMIN B4, Histidine, leucine and tryptophane according to CLONTECH MATCHMAKERGAL4 Two-Hybrid System 3 specification sheetss
6Transformant obtains 94 positive colonies altogether.Positive colony is transferred on the filter paper, according to CLONTECH MATCHMAKER GAL4 Two-Hybrid System 3 specification sheetss description carrying out beta-galactosidase enzymes method analysis, there are 57 clones to be blue phenotype, show that its beta-galactosidase gene is expressed as the positive.The positive colony yeast again through same beta-galactosidase enzymes method analysis conclusive evidence, extracts plasmid DNA then after the line separation and purification.After plasmid DNA transforms AH109/BD-CR1 once more and carries out analysis that beta-galactosidase gene expresses, finally determine totally 18 in the albumen that works with bait protein CR-1, its encoding gene can be divided into 7 types through restriction analysis.The aminoacid sequence retrieval NCBI gene pool that dna sequencing and using is obtained, the result shows, the dna fragmentation 1 that the clone obtains and translation initiation factor 3 subunits 5 (eIF3 subunit 5) (XM010886) gene identity are 95% (Fig. 5-1); The myomesin 1 (skelemin) of dna fragmentation 2 and myoglobulin heavy chain (XM012744) gene identity is 86-91% (Fig. 5-2); Dna fragmentation 3 is 98% (Fig. 5-3) with myosin light chain MRLC2 (AF363061) gene identity; Dna fragmentation 4 is 96% (Fig. 5-4) with β-Hydratase, phosphoenolpyruvate (XM008524) gene identity that participates in muscle line shape flesh M band prozyme system, with some new albumen interaction is arranged in addition; Dna fragmentation 5 is 98% (Fig. 5-5) with the consistence of MRIP-1 (AF359283) gene.Utilize yeast-two hybrid technique piecewise analysis CR-1 albumen and the concrete interaction domain of MRIP1 albumen:
The domain analyses of MRIP1 sequence shows that MRIP-1 contains 3 structural domains: RAS reticular activating system (RAS)-reticular activating system is the class gtp binding protein relevant with film; The PH structural domain, its multiple existing various eucaryon signal proteins that are, function mainly is the combination that participates in various membrane structures; Arf (the ADP ribose factor) Gap as a kind of phosphide of gtp binding protein adjusting after birth, works in cell signal transmission and vesica transportation (Fig. 6).According to these 3 synthetic following primers of structural domain design,
Primer G:ATTACATATGGCGGCGGTGGTAGCTG (containing Nde I site) (SEQ ID No11)
Primer H:AATTCTCGAGGGTCTGCACCCCAGACCCA (containing Xho I site) (SEQ ID No12)
Primer I: ATTAGAATTCATGTTCGGCGGCGCGGGGCC (containing EcoR I site) (SEQ ID No13)
Primer J:ATTAGTCGACATTAGTAGTCGCTGAAGGCGCTGC (containing Sal I site) (SEQ ID No14)
Primer K:ATTAGAATTCTCGTCCTCAGTCCCCTCCAC (containing EcoR I site) (SEQ ID No15)
Primer L:ATTAGTCGACATTAGCCTGGGGGCAGGGAAGTGG (containing Sal I site) (SEQ ID No16)
Primer M:ATTAGAATTCATGCAGCACCCTGCCAGTG (containing EcoR I site) (SEQ ID No17)
Primer N:ATATGTCGACATTATAGGAGGCTAGGACTAC (containing Sal I site) (SEQ ID No18)
With clone CR1 cDNA as template, the CR-1 PCR product that contains Nde I and Xho I restriction enzyme site with primer G and H with the condition pcr amplification of embodiment 4, be connected to pGADT7 carrier (available from Clontech company) and obtain the pGADT7/CR-1 recombinant plasmid, transformed yeast bacterium AH109, on the leucic SD substratum of shortage, obtain transformant, with this engineering yeast AH109/AD-CR1 as the expression bait protein.
With clone MRIP1 cDNA as template, the MRIP1 PCR product that contains EcoR I and Sal I restriction enzyme site with the condition pcr amplification of embodiment 4, obtain the MRIP1-a fragment of 900bp with primer I and J amplification, obtain the MRIP1-b fragment of 648bp with primer K and L amplification, obtain the MRIP1-c fragment of 1083bp with primer M and N amplification, clone's PCR fragment is connected to pGBKT7 carrier (available from Clontech company) and obtains recombinant plasmid pGBKT7/MRIP1-a, pGBKT7/MRIP1-b, pGBKT7/MRIP1-c after enzyme is cut.3 recombinant plasmids are transformed engineering yeast AH109/AD-CR1 respectively, on the SD substratum that lacks VITAMIN B4, Histidine, leucine and tryptophane, screen transformant, only on the conversion flat board of pGBKT7/MRIP1-a, obtain positive colony, illustrate that CR1 albumen is interactional with the generation of MRIP1 albumen by MRIP1-a fragment (wherein comprising complete RAS structural domain), present embodiment shows that it is to realize by the RAS structural domain of MRIP-1 that the information of acceptor institute media on the CR-1 participation film is conducted this ability.Embodiment 5 usefulness pGEX systems are at expression in escherichia coli CR-1 gene:
Synthesized the primer that contains BamH I and EcoR I restriction enzyme site according to the CR-1 sequences Design,
Primer O:GTG
GGATTCACATGGCGGCGGTGGTAGCTGCT (containing BamH I site) (SEQ ID No 19)
Primer P:GCA
GAATTCTCAGGTCTGCACCCCAGACCCAAC (containing EcoR I site) (SEQ ID No 20)
With primer O and P, with clone CR-1 cDNA as template, with the condition pcr amplification of embodiment 4 two ends have the CR-1 PCR product of BamH I and EcoR I restriction enzyme site, after gel recovery, enzyme are cut, be connected on the pGEX-5X-1 carrier (Amersham Pharmacia company) that contains gst gene, the recombinant plasmid pGEX-5X/CR-1 after the connection is transferred to the e. coli bl21 competent cell.The positive transformant overnight incubation in the LB liquid nutrient medium that contains penbritin (Amp) 100 μ g/ml that contains pGEX-5X/CR-1 is inoculated in the large volume substratum with dilution in 1: 100 then, and culturing cell is to optical density(OD) 600nm (OD
600) be 0.5-0.8, adding IPTG (isopropylthio-β-D galactoside) subsequently is 1mM to final concentration, continuation culturing cell 3 hours.Centrifugal subsequently (6000 * g 10 minutes), collecting cell.Use the ultrasonic degradation thalline then, the centrifugal insolubles of removing adds 50% gsh-sepharose 4B in supernatant liquor, 4 ℃ were reacted 1 hour, centrifugal collection sepharose 4B, with the PBS buffer solution elution repeatedly after, from sepharose 4B, reclaim glutathione s-transferase (GST) fusion rotein GST-CR-1.SDS-PAGE glue with 10% carries out electrophoresis, identifies that the molecular weight size of expressing protein is about 43kDa (Fig. 7-1).Because the molecular weight of GST is about 28kDa, so the molecular weight of CR-1 is speculated as 15kDa, (SEQ ID NO.4) infers that its theoretical value is about 15.4kDa from the CR-1 sequence.Carry out Western with CR-1 antibody and detect, prove the target protein GST-CR-1 albumen (Fig. 7-2) of 43kDa fusion rotein for expressing.The GST-CR-1 fusion rotein is available specific protease Xa factor cutting from gsh-sepharose 4B, obtains the CR-1 albumen of purifying.
The expression CR-1 gene of embodiment 6 usefulness pET systems in intestinal bacteria:
According to the synthetic following primer of CR-1 sequences Design,
Primer Q:ATTA
GAATTCATGGCGGCGGTGGTAGCTGCT (containing EcoR I site) (SEQ ID No21)
Primer R:AATT
CTCGAGGGTCTGCACCCCAGACCCA (containing Xho I site) (SEQ ID No22)
Primer S:ATTACATATGGCGGCGGTGGTAGCTG (containing Nde I site) (SEQ ID No23)
Primer T:ATATGCGGCCGCTCAGGTCTGCACCCCAGACCCAA (containing Not I site) (SEQ ID No24)
With primer Q and R, with clone CR-1 cDNA as template, with the condition pcr amplification of embodiment 4 two ends have the CR-1 PCR product of EcoR I and Xho I restriction enzyme site, after gel recovery, enzyme are cut, be connected on pET-24a (+) carrier (Novagen company), the recombinant plasmid called after pET-CR1-NC that makes up, its N end and C end of expressing target protein has T7-Tag and 6 * His-Tag mark respectively; Adopt same template and carrier,, cut through EcoR I and Not I enzyme and to be connected on pET-24a (+) carrier with primer Q and T amplification CR-1 gene, construction recombination plasmid called after pET-CR1-N, its N end of expressing target protein has the T7-Tag mark; With primer R and S amplification CR-1 gene, cut through Nde I and Xho I enzyme and to be connected on pET-24a (+) carrier, construction recombination plasmid called after pET-CR1-C, its C end of expressing target protein has 6 * His-Tag mark; With primer S and T amplification CR-1 gene, cut through Nde I and NotI enzyme and to be connected on pET-24a (+) carrier, construction recombination plasmid called after pET-CR1, its N end and C end of expressing target protein does not all have mark.Recombinant plasmid makes up correct through T7 promotor and the two-way order-checking proof of T7 terminator primer.
4 kinds of recombinant plasmids that make up are used conventional heat shock method transformed into escherichia coli BL21-CodonPlus -RIL (Stratagene company) cell respectively, on the LB culture plate that contains kantlex (Km) 50 μ g/ml, paraxin (Cm) 50 μ g/ml, screen transformant.Picking transformant inoculation 1ml contains the LB liquid nutrient medium of kantlex (Km) 50 μ g/ml, paraxin (Cm) 50 μ/ml, 37 ℃ of 200rpm overnight incubation.Get 50 μ l bacterium liquid transferred speciess in 1ml LB liquid nutrient medium, 37 ℃ of 220rpm cultivated 3 hours.To cell optical density(OD) 600nm (OD
600) be 0.5-0.8, add subsequently IPTG (isopropylthio-β-D galactoside) to final concentration be 1mM.Continued culturing cell 3 hours, centrifugal subsequently (6000 * g 8 minutes) collecting cell.The washing of 1 * PBS damping fluid is once used the ultrasonic degradation thalline then, and 5000 * g removed remaining thalline in centrifugal 8 minutes, 5 minutes centrifugal collection inclusion bodies of 12000 * g.SDS-PAGE glue with 10% carries out electrophoresis, identifies expressing protein.The result shows, have only the plasmid pET-CR1-NC of N end and C end tape label or the plasmid pET-CR1-N of N end tape label can obtain to express, the plasmid of tape label (being pET-CR1 and pET-CR1-C) can not obtain to express (Fig. 8) and N end and C hold not tape label or N to hold not.
The preparation of embodiment 7CR-1 antibody:
Synthesized oligopeptides with the 125th of CR-1 to 142 amino acids sequence FRASSQSAPSPDVGSGVQT (SEQ ID NO.25), as antigen, immunizing rabbit 3 months is got serum, obtains polyclonal antibody.This antibody can be special with bacterium in the GST-CR-1 fusion rotein of expressing combine (Fig. 7-2), also can combine with the CR-1 that expresses in the eukaryotic cell, might be used for the diagnosis or the treatment of cardiac muscle and tumour illness.The expression of embodiment 8CR-1 in finishing red methanol yeast system:
Synthesized the primer that contains EcoR I and Not I restriction enzyme site according to the CR-1 sequences Design,
Primer U:ATTA
GAATTCATGGCGGCGGTGGTAGCTGCT (containing EcoR I restriction enzyme site) (SEQ ID No26)
Primer V:ATAT
GCGGCCGCTCAGGTCTGCACCCCAGACCCAA (containing Not I restriction enzyme site) (SEQ ID No27)
With primer U and V, with clone CR-1 cDNA as template, with the condition pcr amplification of embodiment 4 two ends have the CR-1 PCR product of EcoR I and Not I restriction enzyme site, reclaim, after enzyme cuts, be connected on the pPIC9 carrier (Invitrogen company) that contains α-Factor gene through gel.The recombinant plasmid that makes up is justified through 3 ' AOX1 and the order-checking of 5 ' AOX1 primer.Recombinant plasmid is cut with Bgl II enzyme, reclaims the 6.0kb fragment.This fragment electricity is transformed complete red methanol yeast GS115 (Invitrogen Corporation) competence (various culture medium prescriptions are seen the Pichia Expression Kit of Invitrogen company, Cat:#K1710-01 products catalogue in competent preparation of yeast GS115 and the present embodiment).On the MD substratum in biochemical incubator 30 ℃ cultivate and to obtain transformant in 3 days.On the MM solid medium, 30 ℃ of biochemical incubators were cultivated 3 days with the transformant dibbling, and it is normal to grow on the picking MD substratum, poky Mut on the MM substratum
sPhenotypic cloning, called after GS115-CR1
sWith recombination yeast GS115-CR1
sInoculation liquid BMGY substratum 10ml, 30 ℃ of 250rpm overnight incubation are to cell optical density(OD) 600nm (OD
600) be 2-6,3500 * g collected thalline in centrifugal 4 minutes, was resuspended in 50ml BMMY liquid nutrient medium, made cell optical density(OD) 600nm (OD
600) be that 1.0,30 ℃ of 250rpm cultivate.Per 24 hours add 100% methyl alcohol to final concentration is 0.5%, sampling 1ml.Sample 10000 * g collected supernatant in centrifugal 4 minutes, and Tricholroacetic Acid to the final concentration of adding 60% is 20%, ice bath 2 hours, centrifugal 15 minutes supernatant discarded of 4 ℃ of 10000 * g.Precipitation is resuspended in 95% washing with alcohol once, adds 30 μ l, 1 * sample-loading buffer at last, and thermally denature is 5 minutes in the boiling water bath, the acrylamide gel electrophoresis of last sample 15%, the dyeing of Xylene Brilliant Cyanine G method.Observation obtains 25kD specific expression protein band (Fig. 9), and this specific expression protein size conforms to the calculated value 25.25kD of fusion rotein α-Factor-CR1.
The expression of embodiment 9CR-1 in cardiac muscle:
The muscular tissue of coring is made paraffin section, with twice of dimethylbenzene dewaxing; Respectively handled 2 minutes with dehydrated alcohol, 95% ethanol, 90% ethanol, 80% ethanol, 70% ethanol in succession, water flushing back PBS wash 3 times each 5 minutes; 3%H
2O
2(methyl alcohol dilution 30%H
2O
2) handled 10 minutes, to eliminate the endogenous superoxide; PBS washes 3 times, and each 5 minutes, PBS washed 3 times 37 ℃ of insulations of 0.1% trypsinase, each 5 minutes to repair antigen in 20 minutes.Carry out immunohistochemical staining then: 10% sheep blood serum sealing (PBS dilutes sheep blood serum), room temperature 20 minutes; Drip CR-1 antibody (1: 200, contain 1% sheep blood serum PBS dilution), 4 ℃ are spent the night, and PBS washes 3 times, each 5 minutes; Drip two anti-goat anti-rabbit igg HRP-horseradish peroxidases (1: 5000), PBS washes 3 times, each 5 minutes; DAB-3 ' 3 ' diaminobenzidine dyeing 2-3min (DAB matching while using, DAB3mg+H
2O
23 μ l), bubble is washed; Haematoxylin dyeing 3 minutes, washing; 1% hydrochloride alcohol differentiation 30 seconds, washing; Dehydration: in succession 80% ethanol 1 minute, 90% ethanol 1 minute, 95% ethanol 1 minute, dehydrated alcohol 4 minutes, handle with dimethylbenzene and to make transparent in twice each 20 minutes; 1 in resinene glue, add the Cover Glass mounting, mirror is observed down, Figure 10-1 can see the expression (Figure 10-2) of CR-1 in the expression (Figure 10-1) of CR-1 in young man's normal myocardium tissue and the ACUTE MYOCARDIAL INFARCTION IN THE AGED patient cardiac muscular tissue, and CR-1 expresses variant in both tissues as seen from the figure.
Description of drawings: Fig. 1. Western hybridization detects the expression of CR-1 albumen in kinds of tumor cells,
Wherein:
1:Marker is respectively 97,66,43,31,20,14KD;
2:HT29 people's rectum cancer cell;
3:cos7 cercopithecus aethiops renal epithelial cell;
The 4:7402 human liver cancer cell;
The 5:7721 human liver cancer cell;
The 6:A549 human lung carcinoma cell;
The Northern blot result of CR-1 RNA behind 7:K562 people's chronic leukemia cytological map 2. 7721 liver cancer cell transfection pEGFPC1-U6-RNAi, β-actin in the Northern blot experiment as the interior mark of mRNA level detection, wherein:
1:7721 human liver cancer cell transfection pEGFPC1-U6-RNAi group,
The contrast of 2:7721 human liver cancer cell untransfected group;
3:7721 human liver cancer cell transfection group, mark in β-actin;
4:7721 human liver cancer cell untransfected group, mark in β-actin; Fig. 3-1. 7721 human liver cancer cell transfection pEGFPC1-U6-RNAi organize, and flow cytometer detects the cell cycle result, wherein:
A: it is 17.65% that cell enters the G0-G1 phase
B: it is the 7721 human liver cancer cell untransfected groups of 61.11% Fig. 3-2. that cell enters the G2-M phase, and flow cytometer detects the cell cycle result, wherein:
A: it is 43.32% that cell enters the G0-G1 phase
B: it is that 35.74% Fig. 4-1. 7721 human liver cancer cell transfection pEGFPC1-U6-RNAi organize that cell enters the G2-M phase, and it is 29.76% that flow cytometer detects the apoptosis number; The 7721 human liver cancer cell untransfected groups of Fig. 4-2., flow cytometer detect the apoptosis number be 4.44% Fig. 5-1. with CR-1 protein-interacting gene fragment 1 and translation initiation factor 3 subunits 5 (eIF3 subunit 5) genes (XM010886) homology relatively.Fig. 5-2. compare with CR-1 protein-interacting gene fragment 2 and myoglobulin heavy chain myomesinl gene (XM012744) homology.Fig. 5-3. compare with CR-1 protein-interacting gene fragment 3 and myosin light chain MRLC2 gene (AF363061) homology.Fig. 5-4. compare with CR-1 protein-interacting gene fragment 4 and β-enolase gene (XM008524) homology.Fig. 5-5. compare with CR-1 protein-interacting gene fragment 5 and MRIP-1 gene (AF359283) homology.Fig. 6. carry out the domain analyses result of MRIP1-1 aminoacid sequence in http://smart.embl-heidelberg.de website.Fig. 7-1. use the pGEXT system at expression in escherichia coli CR-1 gene, purpose fusion rotein CR1-GST size is about 41KD, and the GST size is about 26KD.Wherein:
Molecular weight of albumen standard Marker:97,66,43,31,20,14KD;
1. empty carrier pGEX-5X-1 transformant is not induced;
2. empty carrier pGEX-5X-1 transformant is induced;
3.pGEX-5X/CR-1 transformant is not induced;
4.pGEX-5X/CR-1 transformant was induced 1 hour;
5.pGEX-5X/CR-1 transformant was induced 4 hours.Fig. 7-2. use pGEXT system, the Western detected result of the expression product of CR-1 gene in intestinal bacteria.Wherein, Marker, 1,2,3,4, the equal corresponding diagram 7-1 of 5 each band.Fig. 8. use the pET system at expression in escherichia coli CR-1 gene, wherein:
Molecular weight of albumen standard Marker:97,66,43,31,20,14KD;
1. empty carrier pET-24a (+) transformant is induced 4 hours sampling bacterial proteins;
2.pET-CR1 transformant is not induced 4 hours sampling bacterial proteins;
3.pET-CR1 transformant is induced 4 hours sampling bacterial proteins;
4.pET-CR1-NC transformant is not induced 4 hours sampling bacterial proteins;
5.pET-CR1-NC transformant is induced 4 hours sampling bacterial proteins;
6.pET-CR1-C transformant is not induced 4 hours sampling bacterial proteins;
7.pET-CR1-C transformant is induced 4 hours sampling bacterial proteins;
8.pET-CR1-N transformant is not induced 4 hours sampling bacterial proteins;
9.pET-CR1-N transformant is induced 4 hours sampling bacterial proteins.The expression of Fig. 9 .CR-1 in finishing red methanol yeast system, purpose fusion rotein α-Factor-CR1 size is about 25KD, wherein:
Molecular weight of albumen standard Marker:97,66,43,31,20,14KD;
1. finish red methanol yeast empty carrier recombination and integration strain GS115-pPIC9, induce supernatant contrast in 3 days;
2. contain the complete red methanol yeast recombination and integration strain GS115-CR1s of CR-1, induce 1 day supernatant;
3. contain the complete red methanol yeast recombination and integration strain GS115-CR1s of CR-1, induce 2 days supernatants;
4. the complete red methanol yeast recombination and integration strain GS115-CR1 that contains CR-1
s, induce 3 days supernatants; Expression (SABC) the testing result sequence table of CR-1 in the routine ACUTE MYOCARDIAL INFARCTION IN THE AGED patient of expression (SABC) testing result Figure 10 of CR-1 in the routine young normal subjects tissue of Figure 10-1.-2. a cardiac muscular tissue:<110〉Inst. of Medicinal Biological Technology, Chinese Academy of Medical Sciences<120〉the CR-1 gene relevant with cell reconstitution, conduction and apoptosis<160〉2<170〉PatentIn version 3.1<210〉1<211〉756<212〉DNA<213〉Homo sapiens<220〉<221〉CDS<222〉(145) .. (570)<223〉<400〉1
gagtagttct?cctgggtccg?ctctgcgggc?ttctgggaga?tgtagtttct?ggtctgtagg 60
caggacggaa?ggagcggggg?aggcccctta?cgcaaactac?aattcccggc?ggggagcgcg 120
gtgaagcggg?ggtgggatct?gaac?atg?gcg?gcg?gtg?gta?gct?gct?acg?gcg 171
Met?Ala?Ala?Val?Val?Ala?Ala?Thr?Ala
1 5ctg?aag?ggc?cgg?ggg?gcg?aga?aat?gcc?cgc?gtc?ctc?cgg?ggg?att?ctc 219Leu?Lys?Gly?Arg?Gly?Ala?Arg?Asn?Ala?Arg?Val?Leu?Arg?Gly?Ile?Leu10 15 20 25gca?gga?gcc?aca?gct?aac?aag?gct?tct?cat?aac?agg?acc?cgg?gcc?ctg 267Ala?Gly?Ala?Thr?Ala?Asn?Lys?Ala?Ser?His?Asn?Arg?Thr?Arg?Ala?Leu
30 35 40caa?agc?cac?agc?tcc?cca?gag?ggc?aag?gag?gaa?cct?gaa?ccc?cta?tcc 315Gln?Ser?His?Ser?Ser?Pro?Glu?Gly?Lys?Glu?Glu?Pro?Glu?Pro?Leu?Ser
45 50 55ccg?gag?ctg?gaa?tac?att?ccc?aga?aag?agg?ggc?aag?aac?ccc?atg?aaa 363Pro?Glu?Leu?Glu?Tyr?Ile?Pro?Arg?Lys?Arg?Gly?Lys?Asn?Pro?Met?Lys 60 65 70gct?gtg?gga?ctg?gcc?tgg?gcc?atc?ggc?ttc?cct?tgt?ggt?atc?ctc?ctc 411Ala?Val?Gly?Leu?Ala?Trp?Ala?Ile?Gly?Phe?Pro?Cys?Gly?Ile?Leu?Leu?75 80 85 90ttc?atc?ctc?acc?aag?cgg?gaa?gtg?gac?aag?gac?cgt?gtg?aag?cag?atg 459Phe?Ile?Leu?Thr?Lys?Arg?Glu?Val?Asp?Lys?Asp?Arg?Val?Lys?Gln?Met
95 100 105aag?gct?cgg?cag?aac?atg?cgg?ttg?tcc?aac?acg?ggc?gag?tat?gag?agc 507Lys?Ala?Arg?Gln?Asn?Met?Arg?Leu?Ser?Asn?Thr?Gly?Glu?Tyr?Glu?Ser
110 115 120cag?agg?ttc?agg?gct?tcc?tcc?cag?agt?gcc?ccg?tcc?cct?gat?gtt?ggg 555Gln?Arg?Phe?Arg?Ala?Ser?Ser?Gln?Ser?Ala?Pro?Ser?Pro?Asp?Val?Gly
125 130 135tct?ggg?gtg?cag?acc?tgaggagcgc?tgcgaccctc?ctaggctatt?gactgttaag 610Ser?Gly?Val?Gln?Thr
140tcctcaggtt?tggcccagat?tccagttcgt?gcctctgagg?tccaccagag?ggcgcatgaa 670gcccaggctg?ttgccaaacc?ctaccctgcc?ccacaccaag?gagccagcca?aaggcaaata 730aagttattga?gtgtttagta?gaaagg 756<210>2<211>142<212>PRT<213>Homo?sapiens<400>2Met?Ala?Ala?Val?Val?Ala?Ala?Thr?Ala?Leu?Lys?Gly?Arg?Gly?Ala?Arg1 5 10 15Asn?Ala?Arg?Val?Leu?Arg?Gly?Ile?Leu?Ala?Gly?Ala?Thr?Ala?Asn?Lys
20 25 30Ala?Ser?His?Asn?Arg?Thr?Arg?Ala?Leu?Gln?Ser?His?Ser?Ser?Pro?Glu
35 40 45Gly?Lys?Glu?Glu?Pro?Glu?Pro?Leu?Ser?Pro?Glu?Leu?Glu?Tyr?Ile?Pro?50 55 60 65Arg?Lys?Arg?Gly?Lys?Asn?Pro?Met?Lys?Ala?Val?Gly?Leu?Ala?Trp?Ala
70 75 80Ile?Gly?Phe?Pro?Cys?Gly?Ile?Leu?Leu?Phe?Ile?Leu?Thr?Lys?Arg?Glu
85 90 95Val?Asp?Lys?Asp?Arg?Val?Lys?Gln?Met?Lys?Ala?Arg?Gln?Asn?Met?Arg
100 105 110Leu?Ser?Asn?Thr?Gly?Glu?Tyr?Glu?Ser?Gln?Arg?Phe?Arg?Ala?Ser?Ser
115 120 125Gln?Ser?Ala?Pro?Ser?Pro?Asp?Val?Gly?Ser?Gly?Val?Gln?Thr
130 135 140
Claims (5)
1, the CR-1 gene relevant with cell reconstitution, conduction and apoptosis is characterized in that said CR-1 gene forms (coding region among the SEQ ID No3) by 425 Nucleotide, 142 amino acid (SEQ ID No4) of encoding.
2, the application in Muscle contraction, cell signaling and the apoptosis dependency is expressed, participated in to the CR-1 gene in detecting tumour cell.
3, the preparation of CR-1 gene expression product, it is characterized in that adopting the method for expressed fusion protein, contain glutathione s-transferase gene carrier pGEX system or contain the pET serial carrier of Tag mark as utilization, or with eukaryon expression plasmid system such as pPIC9, transformed into escherichia coli or eukaryotic cell, expression product detects with CR-1 antibody, uses the specific protease cleavage of fusion proteins, carries out purifying.
4, the preparation of CR-1 antibody is characterized in that adopting CR-1 gene expression product or synthetic oligopeptides as antigen, and immunizing rabbit obtains antibody.
5, the application of CR-1 antibody in preparation and cardiac muscle or tumour relative disease diagnostic reagent or therapeutical agent.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB021536562A CN1226410C (en) | 2002-08-06 | 2002-12-03 | CR1 gene related to cell reconstitution, conduction and death |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN02125958.5 | 2002-08-06 | ||
CN02125958A CN1392259A (en) | 2002-08-06 | 2002-08-06 | CR1 gene ralative to cell reconstitution, conduction and death |
CNB021536562A CN1226410C (en) | 2002-08-06 | 2002-12-03 | CR1 gene related to cell reconstitution, conduction and death |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1417223A true CN1417223A (en) | 2003-05-14 |
CN1226410C CN1226410C (en) | 2005-11-09 |
Family
ID=25741155
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB021536562A Expired - Fee Related CN1226410C (en) | 2002-08-06 | 2002-12-03 | CR1 gene related to cell reconstitution, conduction and death |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1226410C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102368070A (en) * | 2011-07-01 | 2012-03-07 | 上海永昶医学诊断用品有限公司 | Kit for detecting content of MR-1S (Myofibrillogenesis Regulator-1S) in human plasma and preparation method thereof |
-
2002
- 2002-12-03 CN CNB021536562A patent/CN1226410C/en not_active Expired - Fee Related
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102368070A (en) * | 2011-07-01 | 2012-03-07 | 上海永昶医学诊断用品有限公司 | Kit for detecting content of MR-1S (Myofibrillogenesis Regulator-1S) in human plasma and preparation method thereof |
Also Published As
Publication number | Publication date |
---|---|
CN1226410C (en) | 2005-11-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5885794A (en) | Recombinant production of vertebrate activin receptor polypeptides and identification of receptor DNAs in the activin/TGF-β superfamily | |
CN101553568A (en) | Neukinase, a downstream protein of neuregulin | |
CA2375386A1 (en) | Lipocalin family protein | |
US20040058358A1 (en) | Lipid metabolism transcription factor | |
US5882926A (en) | Excitatory amino acid transporter gene and uses | |
JPH07502883A (en) | Novel cyclophilins, related proteins and uses | |
US5470966A (en) | Neural α-catenin | |
CN1417223A (en) | CR1 gene related to cell reconstitution, conduction and death | |
CA2560011A1 (en) | Cospeptin, cosmedin and their uses | |
CN112111496A (en) | ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein | |
Zhang et al. | Molecular structure, expression, and function analysis of BAFF gene in Chinese sucker, Myxocyprinus asiaticus | |
CN108715851A (en) | A kind of Epinephelus coioides are ingested regulation and control related gene AgRP1 and its application | |
US6475752B1 (en) | Mammalian imidazoline receptor | |
KR20040088019A (en) | Differentially expressed genes associated with obesity and type 2 diabetes | |
US7544485B2 (en) | Baldness related gene and the polypeptide encoded thereby, and uses | |
CN1392259A (en) | CR1 gene ralative to cell reconstitution, conduction and death | |
CN116574711A (en) | Preparation and application of Amphioxus immune related AmphiERK5 protein | |
CN1324403A (en) | PRV-1 gene and the use thereof | |
WO2000037637A1 (en) | Novel protein and dna thereof | |
CN1313297A (en) | Human protein able to suppress growth of cancer cells and its coding sequence | |
CN1377408A (en) | The PRV-1 gene and use thereof | |
CN1385441A (en) | Novel human lymphokine, its coding sequence and use | |
CN1288057A (en) | Coded novel human angiotensin II-1 receptor related protein gene, and application and prepn. method therefor | |
CN1388132A (en) | Cell death inducing protein and its coding sequence and use | |
CN116574167A (en) | Preparation and application of Amphioxus immune related Amphip38 protein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20051109 Termination date: 20151203 |
|
EXPY | Termination of patent right or utility model |