CN1405312A

CN1405312A - Recombinant virus capable of specific killing tumor relating to EB virus and constructing method thereof

Info

Publication number: CN1405312A
Application number: CN01105247A
Authority: CN
Inventors: 钱其军; 车小燕; 岑信棠; 吴孟超
Original assignee: WEIJIAN BIOTECHNOLOGY CO Ltd ZHONGSHAN
Current assignee: WEIJIAN BIOTECHNOLOGY CO Ltd ZHONGSHAN
Priority date: 2001-01-18
Filing date: 2001-01-18
Publication date: 2003-03-26
Also published as: WO2002056917A1

Abstract

The invention provides a kind of proliferation-type reformed virus which can exceptionally kill the relative tumor cells of EB virus and its structure method. Insert a certain order-mode action component in upriver area of EB virus's gene to make it able to proliferate only in EB virus's latent infected or infected cells, and synchronously insert the destination gene in the non-proliferation necessary area in the proliferated virus gene group in the tumor cells to make it high-effectively expressed in the tumor cells, so as to kill EB virus's latent infected or nifected cells.

Description

A kind of recombinant virus and construction process thereof of energy specific killing tumor relating to EB virus

The present invention relates to life science, be specifically related to a kind ofly can and express late gene in the tumour cell internal breeding of Epstein-Barr virus infection or latent infection, and in the negative normal cell of Epstein-Barr virus, do not breed and do not express the reorganization cytolytic virus of late gene, and the method for structure and propagation.

Malignant tumour seriously jeopardizes human life and health.At present to the conventional treatment of malignant tumour still for operation and put, chemotherapy, this conventional treatment is still not very good to the curative effect of thumping majority tumour, for the thumping majority chemotherapeutics, its therapeutic index is still lower, and promptly its therapeutic dose and toxicity dose are comparatively approaching.So this treatment plan usually with tangible toxic action, comprises life-threatening bone marrow depression etc.Therefore, research selectively killing tumour cell and not influence Normocellular method extremely important to oncotherapy, the method of this selectively killing tumour cell mainly depends on the specific marker of tumour cell, and its curative effect is decided by also whether strictness is limited in the tumour cell this tumor marker.

Human tumor about 15% is relevant with virus, virus latent infection in tumour cell that several are relevant with people's tumour, in normal cell then the latent infection rate hang down to reach very much viral load very little.(be called for short Epstein-Barr virus routinely as Epstein-Barr virus, be designated as EBV, down with) at Barkitt ' but s lymphoma and do not break up equal latent infection in the nasopharyngeal carcinoma all cells, its virogene EBNA-1 all expresses in above-mentioned tumour cell, then very low in normal cell, in its peripheral blood in the mononuclearcell positive rate be 10 ^-5-10 ^-6, in other normal cell of adult, almost all be negative.And for example but HPV virus is at the equal latent infection of 90% cervical cancer cell, and its cervical cancer cell is all expressed the E6 and the E7 gene of HPV virus usually, and this gene expression rate in normal cell is extremely low or negative.Therefore, in the tumour patient relevant with this virus, its viral protein can be used as extraordinary tumor marker.People are with the specific target target of the viral protein on these tumour cells as immunotherapy, but because in tumour generation and evolution, for escaping the immunity monitoring, the a lot of variation takes place in tumour cell, express and the downward modulation of angtigen presentation ability as a lot of tumour cell MHC1 genoids, lack the second signal that immunocyte stimulates, thereby effectively activating cells poison T cell is killed tumour cell, therefore immunotherapy curative effect clinically and very undesirable.

Gene therapy is a kind of new treatment malignant tumour method of rising in recent years.Two kinds of its gene transfection method partitivirus method and non-viral methods.The virus method adopts retrovirus, adenovirus, adeno-associated virus, hsv and vaccinia virus usually.Retrovirus has higher transfection efficiency external, but virus titer is on the low side, and transfection efficiency is lower in vivo, and can only infect the cell of division stage, has the karyomit(e) of being integrated into simultaneously, has the shortcoming of the possibility of canceration.Adeno-associated virus has the ability of transfection division and resting cell, endurable expression.Non-viral method comprises methods such as liposome and particle gun, and its rotaring redyeing gene expression time is shorter, and transfection efficiency is lower.Adenovirus is a most commonly encountered diseases poisonous carrier in the present therapy of tumor, has been widely used in the human body gene treatment plan, has the characteristics of easy production and purifying, and it reaches external all effectively transfection division and resting cell, non-carcinogenesis in vivo.

The major obstacle of therapy of tumor is can not be effectively with all tumour cells of goal gene specificity transfection at present, and the curative effect of gene therapy and tumour cell are subjected to the quantity of gene transfection closely related, the virus carrier system of all tumour cells of therefore, research and development specificity transfection is most important in therapy of tumor.

In recent years, risen the research of the virus of tumour-specific propagation in the world, difference according to tumour cell and some biological characteristics of normal cell, can only be through the virus of transforming specifically at tumour cell internal breeding, cracking tumour cell, discharge virion then, other tumour cell of subinfection again, propagation, cracking once more, so produce scale effect, because virus can permeate into each tissue of whole body and internal organs, thereby can infect all tumour cells, thus kill the tumour of part and transfer, and do not influence normal cell.

Typical example has three, first is the adenovirus ONYX-015 of E1B 55Kda albumen inactivation, its dominant mechanism is: Many researchers finds that P53 cuts much ice in tumour canceration process, P53 sudden change or inactivation can make the cell of dna damage continue division and duplicate, and just canceration may take place when other gene also produces sudden change.P53 also is the antiviral major protein of host cell, in normal cell, can activate P53 behind the virus infected cell, breed necessary gene E1A district as adenovirus and can cause cellular abnormality propagation and activate P53 simultaneously, finally cause apoptosis, virus replication is stopped.Yet under the thumping majority situation, normal cell apoptosis immediately do not occur after infecting adenovirus, the major cause adenovirus still exists and closes the albumen that activates the P53 function is E1B 19Kda and two albumen of 55Kda, the former acts on the P53 downstream, stop apoptosis, the latter combines with P53 and stops P53 to activate, so wild-type adenovirus can be survived in normal cell and duplicated propagation.The albumen that lacks E1B district 55Kda when adenovirus, in normal cell, has normal function owing to P53, therefore, be activated very soon, thereby make apoptosis, adenovirus can not effectively be duplicated and breed, stop thereby make to infect, and in the tumour cell of P53 sudden change or inactivation, behind the virus infection, P53 can not be activated, and therefore lacks the adenovirus of E1B, still reproducible and propagation, make virus massive duplication in tumour cell, finally cause oncolysis death, and other tumour cell of the virus infection of release new, this makes all tumour cells all infected and dead.Sudden change all has obvious curative effects with parafunctional tumour to P53 to reach external ONYX-015 in vivo, finds that simultaneously ONYX-015 and chemotherapeutics 5-fluor-uracil (5-Fu) cis-platinum have the obvious synergistic effect.Finished the II clinical trial phase in March, 1999, for invalid patients with head and neck behind the 30 routine conventional treatmenies, use this viral combined conventional chemotherapy, the result shows: 19 routine tumours are dwindled (accounting for 63%) over half, 8 routine tumours disappear fully (accounting for 27%) wherein, only there is 17% patient invalid, followed up a case by regular visits to the 1-11 month up till now, no case was recurrence, and there is not tangible toxic action (1.Bischoff JR, Kirn DH, Williams A, et al.Anadenovirus mutant that replicaties selective in p53-deficientes humancells.Science 1996,274,373-376.2.Heise C, Sampson-Johannes A, Williams A, et al.Onyx-015, an E1b gene-attenuated adenovirus, causestumor-specific cytolysis and antitumoral efficacy that can be augmentedby standard chemotherapeutic agents.Nature Medicine, 1997,3,639-645.3.McCormic k.Cytopathic for therapy and prophylaxis of neoplasia.1998, United States Patent 5,801,029.4.McCormick.Cytopathic for therapyand prophylaxis of neoplasia.1997, United States Patent 5,677,178.5.McCormick.Cytopathic for therapy and prophylaxis of neoplasia.1998, United States Patent 5,846,945.6.McCormick.Cytopathic fortherapy and prophylaxis of neoplasia.1999, United States Patent5,856,181).

Another successful example is from the research to simple sore exanthema virus.Simple sore exanthema virus has significantly has a liking for the neurocyte characteristic, its ribonucleotide reductase and Thymine deoxyriboside kinases (HSV-TK) are the necessary gene of viral dna replication in resting cell, this does not then need above-mentioned two genes as the tumour cell viral dna replication in the cell of growth fast, this is because exist the Nucleotide of sufficient amount at the cell of growth fast, therefore, under the situation that lacks HSV-TK, also can make virus replication, because normal axoneure is in stationary phase, the intracranial tumors cell then is in vegetative period.Therefore, people such as Martuza RL use the simple property sore exanthema virus of disappearance HSV-TK and treat glioma, and it is at the external glioma cell that also effectively dissolves growth.In nude mouse, use this virus direct injection glioma cell or other central nerve neuroma and can make obviously breeding of virus, and suppress tumor growth.This experiment is confirmed in the normal rat 9L of immunologic function colloid carcinoma model by other study group subsequently.Began to carry out I clinical trial phase (Mineta T, Rabkin SD, YazakiT in 1998, ea al.Attenuated multi-mutated herpes simplex virus-1 for thetreatment of malignant gliomas.Nature Med, 1995,1,938-943).The 3rd example is from reports such as Rodriguez R, use prostate gland characteristic antigen (PSA) promotor and insert adenovirus 5 types propagation institute's indispensable gene (E1A) upstream, called after CN706, this viral e1a gene is expressed and controlled by the strictness of PSA promoter, in the cell strain LNCaP of the prostate cancer of secreting PSA, e1a gene is expressed and is descended 99%, its adenovirus then multiplication capacity obviously reduces, the virus titer that is produced hangs down 150 times than the prostate cancer cell strain LNCaP of secretion PSA, and this shows that adenovirus CN706 can duplicate and breed quite specifically in the cell strain of secretion PSA.Give in the nude mouse and can effectively kill 1 * 10 with the disposable injection of this virus ⁹The LNCaP tumour cell of individual secretion PSA also disappears the PSA secretion, and then invalid to the DU145 that does not secrete PSA, this research is at present carried out the I clinical trial phase in the U.S..Replicative adenovirus (the 1.Rodriguez R that some tissue specificity of eukaryotic cell activates cis-acting elements control early genes is used in this research, Schuur ER, Lim HY, et al.Prostate attenuated replication competent adenovirus (ARCA) CN706:Aselective cytotoxic for prostate-specific antigen-positive prostate cancercells.Cancer Res, 1997,57,2559-2563.2.Henderson, et al.Tissue specificand tumor growth supperssion by adenovirus comprising prostate specificantigen.1999, United States Patent 5,871,726.3.Henderson, et al.Tissuespecific viral vectors.1997, United States Patent 5,698,443).

But do not see up to now, the report of the virus of proliferation of using ebv infection or latent infection cell-specific activated cis-acting elements control early genes as yet

The object of the present invention is to provide the proliferous type recombinant virus and the construction process thereof of class energy specific killing tumor relating to EB virus, promptly should virus can optionally in the tumour cell of ebv infection or latent infection, duplicate and breed, and do not duplicate substantially in the normal cell of Epstein-Barr virus feminine gender and do not breed substantially, thereby specificity suppresses or kills the tumour cell of ebv infection or latent infection.

The proliferous type recombinant virus of energy specific killing tumor relating to EB virus provided by the invention, non-propagation must be inserted with goal gene in the zone in its modification virus genome.This goal gene is a kind of of (1) cancer suppressor gene, (2) blood vessel suppressor gene, (3) cytokine gene, (4) prodrug conversion enzyme gene and (5) apoptosis gene.

The goal gene that above-mentioned recombinant virus provided by the invention carries is (1) cancer suppressor gene, and cancer suppressor gene can suppress growth of tumour cell, and cancer suppressor gene comprises with next gene: P53, Rb, NF1, VHL and APC.

The goal gene that above-mentioned recombinant virus provided by the invention carries is (2) blood vessel suppressor gene, the blood vessel suppressor gene suppresses tumor neogenetic blood vessels and forms, the nutrition supply of tumour cell capable of blocking, thus cause tumour cell dead because of under-nutrition, and the obvious atrophy of tumour and even disappear is fully taken off.Suppress tumor neovasculature formation simultaneously, also reach the purpose of the path of blocking-up metastases.The blood vessel suppressor gene comprises with next gene: endostatin gene, vasculogenesis chalone gene is for the former middle Kringle1-4 structure of plasma fibrin lyase, Kringle1-5 structure, Kringle1-3 structure and Kringle1-3 add Kringle5 structure, interferon-' alpha ' gene, interferon-beta gene, interferon-gene, thrombospondin gene, platelet factor 4 gene, plasminogen activating factors inhibitor (PAI) gene, interleukin 12 and Zeta protein gene.Contain the coding coding sequence of secretory signal peptide in the blood vessel suppressor gene.This coding sequence of secretory signal peptide can be any in following: Angiostatin self signal peptide, M-becomes knurl protein signal peptide, immunoglobulin (Ig) K chain signal peptide.

The goal gene that above-mentioned recombinant virus provided by the invention carries is (3) cytokine gene, cytokine gene has immune cell activated, increase hemopoietic function etc., cytokine gene comprises with next gene: interleukin II, interleukin 12, granuno-mono-colong stimulating factor, tumour necrosis factor, interferon-' alpha ', interferon-beta, interferon-, Light and Flt3 part.

The goal gene that above-mentioned recombinant virus provided by the invention carries is (4) prodrug conversion enzyme gene, and the prodrug conversion enzyme gene can make the nontoxicity medicine be transformed into drug toxicity, thereby strengthens killing and wounding tumour cell.The prodrug conversion enzyme gene comprises with next gene: hsv thymidine kinase, varicella zoster virus thymidine kinase and coli cytosine deaminase.

The goal gene that above-mentioned recombinant virus provided by the invention carries is (5) apoptosis gene, and apoptosis gene can cause the eukaryotic cell apoptosis, and apoptosis gene comprises with next gene: ICE, capase-3, capase-8, capase-9.

Along with virus is duplicated in tumour cell, the goal gene copy number increases, and makes tumour cell efficiently express goal gene.

The genetic transcription activated is regulated and is subjected to trans-acting factor (as transcription factor) and the interactional influence of cis-acting elements.When lacking or some transcription factor occurring, can influence the gene transcription level.When host cell be infected by the virus or latent infection after, virus can make transit cell record regulatory factor change, thereby helps the duplicating and breed of expression of gene, virus of virus.The present invention uses some cis-acting elements control goal gene of virogene, makes this goal gene specificity at this virus infection or latent infection cell inner expression, and does not express or low expression level in the negative cell of virus.The indispensable gene of using some cis-acting elements control virus multiplication of this virus and duplicating, thereby the virus multiplication indispensable gene can only be expressed in the cell of above-mentioned virus infection, cause the virus can only be, and in the negative cell of above-mentioned virus, do not breed substantially in the cell internal breeding of above-mentioned virus infection or latent infection.Virus vector after this modification can be used to kill the special target cell by certain viral infection or latent infection in some cell mixture, can optionally in this kind target cell, breed by the virus after modifying, thereby the virus that this target cell is bred is optionally killed; In vitro culture or mix with cell complexes by the virus after will modifying in animal body, virus can only be bred target cell, that is to say except target cell, and other cell can not be killed by this virus.Since viral in target cell internal breeding and amplification, thus this target cell in the cell mixing is killed, and in case target cell is destroyed, virus no longer can be bred again.

The present invention adopts the single-minded response element of cell to be made up of ebv infection or latent infection cell-specific activation cis-acting elements, the reporter gene of its cis-acting elements Epstein-Barr virus Orip associating Bam HI C-promotor control, expression amount at Epstein-Barr virus latent infection cell (the EBNA-1 positive) cell compares high about 1000 times of Epstein-Barr virus feminine gender (EBNA-1 feminine gender) expression amount, the same reporter gene of using cis-acting elements Epstein-Barr virus Orip associating basic promotor of hsv thymidine kinase (mini-HSV-TK) or the basic promotor of SV40 (mini-SV40 promotor) control, at the expression amount of Epstein-Barr virus latent infection cell (the EBNA-1 positive) cell than doubly at the high 100-1000 of Epstein-Barr virus feminine gender (EBNA-1 feminine gender) expression amount.

The proliferous type recombinant virus of the energy specific killing tumor relating to EB virus cell that the present invention proposes, it has at least a necessary expression of gene of virus multiplication controlled by ebv infection or latent infection cell-specific activated cis-acting elements.It is inserted certain cis-acting elements and is constituted by zone between the transcription initiation site of virus multiplication indispensable gene and coding initiation site.This cis-acting elements specificity activates in the cell of ebv infection or latent infection, produces transcriptional activity, and does not activate in the cell of Epstein-Barr virus feminine gender, can not produce transcriptional activity.This cis is made element and is contained one of following order at least: the Orip in the Epstein-Barr virus, family of 30bp repeats (being designated as FR) among the Epstein-Barr virus Orip, Epstein-Barr virus Bam HI C-promotor, Orip associating Epstein-Barr virus Bam HI C-promotor in the Epstein-Barr virus, the FR associating basic promotor of hsv thymidine kinase (mini-HSV-TK) or basic promotor of SV40 (mini-SV40 promotor) and specificity activated cis-acting elements in ebv infection or latent infection cell among the Epstein-Barr virus Orip.Above-mentioned virus multiplication is necessary to be viral early expression gene, as the early early stage expressing gene ICE4 of hsv.

Among the present invention, above-mentioned virus can adopt adenovirus.Its virus multiplication indispensable gene contains the early expression gene with next adenovirus at least: E1A, E1B, E2, E4.

The proliferous type recombinant virus of the specific killing tumor relating to EB virus cell that the present invention proposes can be formed mixture with chemotherapeutic agent (as cis-platinum, 5-fluor-uracil, ametycin, carbon platinum, endoxan etc.), biotoxin (as snake venom toxin), monoclonal antibody (as anti-nasopharyngeal cancer cell antibody etc.), and it is as the antitumor drug better effects if.

The proliferous type recombination adenovirus construction method of the specific killing tumor relating to EB virus cell that the present invention proposes is as follows, give the cell that can produce recombinant adenovirus with two carrier cotransfections that contain adenovirus left arm and right arm respectively, has adenovirus propagation nonessential region insertion goal gene in the carrier in these two adenovirus carriers at least, has adenovirus early expression gene E1A in the carrier at least in these two adenovirus carriers simultaneously, E1B, certain cis-acting elements is inserted in the zone between E2 and E4 district transcription initiation site and the coding initiation site, this cis-acting elements specificity activates in the cell of ebv infection or latent infection, produce transcriptional activity, and in the cell of Epstein-Barr virus feminine gender, do not activate, can not produce transcriptional activity.This cis is made element and is contained one of following order at least: the Orip in the Epstein-Barr virus, FR among the Epstein-Barr virus Orip, Epstein-Barr virus Bam HI C-promotor, Orip associating Epstein-Barr virus Bam HI C-promotor in the Epstein-Barr virus, FR associating basic promotor of hsv thymidine kinase (being designated as mini-HSV-TK) or the basic promotor of SV40 (being designated as the mini-SV40 promotor) among the Epstein-Barr virus Orip, and in ebv infection or latent infection cell specificity activated cis-acting elements.

Zone between specificity activated cis-acting elements insertion adenovirus early gene transcription initiation site in ebv infection or the latent infection cell and the coding initiation site can be finished by the following method: between adenovirus early gene transcription initiation site and coding initiation site, do a restriction enzyme site in the zone by polymerase chain reaction (PCR) technology, cut by enzyme, above-mentioned cis-acting elements is inserted this site, thereby make adenovirus early gene be controlled by ebv infection or latent infection cell-specific activated cis-acting elements.

Human adenovirus has 6 different subgenus, is divided into A, B, C, D, E and F.They are also inequality to close preferendum, tumorigenicity and the history of disease of host cell.The present invention is further specified the present invention as illustration with 5 types (Ad5) in the adenovirus C subgenus, but is not limited to this illustration.Adenoviral gene is divided into two classes, and early gene and late gene, early gene comprise E1A, E1B, E2 and E4.The E1a gene is promptly expressed (0-2 hour) behind virus infection, be to express adenovirus protein the earliest, and it is that other early genes protein expression is necessary as the trans-activation transcription regulaton factor, simultaneously other viral promotors of its trans-activation.Therefore, lack the expression of e1a gene, the indispensable gene product that adenovirus DNA duplicates can not produce, and adenovirus can not effectively be duplicated and breed.

The E1b gene transcription is subjected to the proteic activation of E1A, and it is necessary from nucleus transporte to cells slurry that its protein function is late viral genes mRNA, and E1B genetic expression disappearance can not cause viral late gene expression good and can not close the synthetic of host cell proteins.

The E4 gene is positioned at the virus genomic right side not to be held, and its open reading frame 3 (ORF3) and ORF6 can improve the level of adenovirus major late gene mRNA.Lack ORF3 and ORF6 protein function, its virus titer is than wild titre low 10 ⁶Doubly.

Adenovirus system is made up of two carriers, a carrier provides the left arm part of adenovirus, another carrier provides right arm, these two carriers have the homologous recombination district of 500nt at least, yet its transfectional cell produces recombinant adenovirus, and carrier system plasmid pXC1 (Mckinnon, Gene 1982,19:39-42), contain wild-type Ad5 left arm.PBHG10 provides shortage E3 district Ad5 right arm or pBHGE3 that Ad5 right arm (containing the E3 district) is provided.

The transcription initiation site of Ad5 E1A lays respectively at about 560nt of viral genome and 610nt with the coding initiation site, inserts certain viral cis-acting elements in this zone, as the Orip associating BamH I C promotor of Epstein-Barr virus.At first, using polymerase chain reaction (PCR) technology makes up a restriction endonuclease sites in this zone, and the PCR primer will be restricted to the Ad5 genome or carry in the plasmid of Ad5 portion gene group, be the primer of background if any pBR322.Application contains EcoR I site pBR322 sequence and contains Xba I site Ad5 sequence, by secondary stack PCR method, creates a unique new restriction enzyme site in this zone, and this definite site will be used to insert viral cis-acting elements.

Similar scheme also is used to insert viral cis-acting elements, regulates the E1B promotor of E1b Ad5, is positioned at 1636 to Sub-1701nt to the single height of Sp1 is affine for recognizate and a TATAbox form this zone by one.By inserting viral cis-acting elements, will offer E1B and transcribe at cell-specific in this zone.

The present invention also proposes aforementioned proliferous type recombinant virus enrichment procedure, be about to the cells of mamma animals that recombinant virus (as recombinant adenovirus) infects ebv infection or latent infection, thereby recombinant virus is bred in the cells of mamma animals of ebv infection or latent infection specifically.

Use can only allow adenovirus propagation and cause necrocytosis target cell in the adenovirus of the special target cell internal breeding of ebv infection or latent infection.In vitro culture or mix with cell complexes by the adenovirus after will modifying in animal body, adenovirus can only be in the cell internal breeding of infection of EB poison or latent infection, that is to say extracellular except ebv infection or latent infection, other cells can not be killed by this adenovirus, because adenovirus is in the cell internal breeding and the amplification of ebv infection or latent infection, thereby this ebv infection in the cell mixing or the cell of latent infection are killed, in case the cell of this ebv infection or latent infection is destroyed, adenovirus no longer can be bred again.

The present invention proposes above-mentioned recombinant virus practical application.For example this recombinant virus (as recombinant adenovirus) is used for the tumour cell of Infection in Vitro ebv infection or latent infection, causes cytotoxicity.The growth of tumour cell that recombinant virus (for example recombinant adenovirus) is used to suppress ebv infection or latent infection.The tumour cell that recombinant virus (for example recombinant adenovirus) is used for interior selectively killing ebv infection of body or latent infection.

The present invention has following beneficial effect

1. the invention provides the proliferous type recombinant virus of class treatment Epstein-Barr virus related neoplasms,

Experimentation on animals proves that this recombinant virus can be used for treating the Epstein-Barr virus related neoplasms,

Comprise nasopharyngeal carcinoma, He Jiejin lymphomas, Burkitt lymphomas, cancer of the stomach etc.

2. the invention provides the proliferous type recombinant virus of class treatment Epstein-Barr virus related neoplasms

Construction process.Should method is simple can be used for making up multiple treatment Epstein-Barr virus phase

Close the proliferous type recombinant virus of tumour.

3. the invention provides a kind of reach in vivo killing in vitro Epstein-Barr virus latent infection or infection

Tumour cell and do not influence the Normocellular method of Epstein-Barr virus feminine gender.

Example 1: the structure that contains the carrier of Epstein-Barr virus cis-acting elements

With pCAT-Basic is carrier is carrier, in its multiple clone site, insert the family of 30bp repeats (FR among the Epstein-Barr virus Orip, be positioned at Epstein-Barr virus 7337-8190bp) the associating basic promotor of SV40 (mini-SV40), pCAT-Basic is available from Promega company.Use family of 30bp repeats and mini-SV40 promotor among the round pcr amplification Epstein-Barr virus Orip.The former template epstein barr virus dna extracts from lymphoma cell strain B95-8, and it extracts the operation instructions of viral DNA method referring to the QIAamp Blood of QIAGEN company test kit.The latter's template is pCAT-Control (purchasing the company in Promega).The primer of FR among the Epstein-Barr virus Orip is:

Prime1:5 '-primer (containing Hind III and AgeI restriction enzyme site) GGG AAG CTTACC GGT GCA TGC AGG AAA AGG ACA AGC

Primer2:3 '-primer (containing part mini-SV40 promoter sequence) GAG ATGCAG ATC AAT GGC ACC CCG GGG AAT ACC

The primer of mini-SV40 promotor is

Primer3:5 '-primer (containing the FR sequence among the part of O rip) GTG CCA TTG ATCTGC ATC TCA ATT AGT CAG

Primer4:3 '-primer (containing Sal I and Age I restriction enzyme site) GCT AAA GTCGAC ACC GGT AAG CTT TTT GCA AAA GCC TAG

(method is referring to PCR Protools Current Methodsand Applications to use twice stack round pcr, White BA chief editor, Humana Press Inc.1993 publication-document 1) FR sequence among the Epstein-Barr virus Orip and mini-SV40 promotor are produced promoter, fusion, its promoter, fusion PCR fragment is used Hind III and Sal I double digestion insert in pCAT-Basic carrier Hind III and the Sal I site (method referring to the molecular cloning experiment guide, scientific publication 1992 publication-documents 2).This fragment is carried out dna sequencing, and its promoter, fusion sequence is entirely true, is designated as CHEB-FRSV40.

With pbluescript II KS (+) is carrier is carrier (purchasing the ATCC company in the U.S.), in its multiple clone site, insert the family of 30bp repeats (FR among the Epstein-Barr virus Orip, be positioned at Epstein-Barr virus 7337-8190bp) the associating basic promotor of HSV-TK (mini-TK), pbluescript II is available from Promega company.Use family of 30bp repeats and mini-SV40 promotor among the round pcr amplification Epstein-Barr virus Orip.The former template epstein barr virus dna extracts from lymphoma cell strain B95-8, and it extracts the operation instructions of viral DNA method referring to the QIAamp Blood of QIAGEN company test kit.The latter's template is pTAL-Luc (purchasing the company in Clontech).

The primer of FR among the Epstein-Barr virus Orip is:

Primer 5:5 '-primer (containing the XhoI restriction enzyme site) GGG CAT CTC GAG GCATGC AGG AAA AGG ACA AGC

Primer 6:3 '-primer (containing part mini-HSV-TK promoter sequence) AGT CGGGGC GGC AAT GGC ACC CCG GGG AAT ACC

The primer of mini-HSV-TK promotor is

Primer 7:5 '-primer (containing the FR sequence among the part of O rip) GGT GCC ATT GCCGCC CCG ACT GCA TCT GC

Primer8:3 '-primer (containing Xba I restriction enzyme site) TTT TCT AGA CTT CTG CTTCAT CCC CGT G

Use twice stack round pcr (method is the same) FR sequence among the Epstein-Barr virus Orip and mini-TK promotor are produced promoter, fusion, its promoter, fusion PCR fragment is used in Xho I and Xba I double digestion insertion pbluescript II KS (+) carrier (purchasing the ATCC company in the U.S.) Xho I and the Xba I site (method is referring to document 2).This fragment is carried out dna sequencing, and its promoter, fusion sequence is entirely true, is designated as CHEB-FRTK.

Example 2: carry the Epstein-Barr virus cis-acting elements control E1A of Endostatin or vasculogenesis chalone and the structure of the attenuation adenoidism poisonous carrier that E1B expresses.

The pXC.1 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), and pXC.1 contains 5 type adenoviral sequence bp22-5790.New, a unique Age I restriction enzyme site is founded at the 552bp place in this carrier, and this site is positioned at the preceding 12bp of E1A initiation codon, and its method adopts two round pcrs (method is referring to aforementioned documents 1) of positional mutation.Its primer is respectively

Primer9:5 '-primer (containing EcoR I restriction enzyme site) TTC AAG AAT TCT CATGTT TG

Primer10:3 '-primer (insert an A, thereby produce an Age I restriction enzyme site) CAG TCA CCG GTG TCG GAG C

Primer11:5 '-primer (insert a T, thereby produce an Age I restriction enzyme site) GCT CCG ACA CCG GTG ACT GA

Primer12:3 '-primer (containing Xba I restriction enzyme site) TTC TCT AGA CAC AGGTGA TG adopts two round pcrs of positional mutation, PCR product fragment is inserted in the pGEM-T-easy carrier (method is referring to Promega company process specifications), called after pGEM-T-E1a.This fragment is carried out dna sequencing, and its sequencing result shows: insert T in pXC.1 plasmid bp552 site, thereby produce a new Age I restriction enzyme site, other sequence is identical with pXC.1.Use EcoR I and Xba I double digestion pGEM-T-E1A and pXC.1 plasmid, insert in the pXC.1 plasmid among the EcoR I and BamH I site cutting out fragment among the pGEM-T-E1A, make T of 552 insertions among the pXC.1, thereby produce an Age I restriction enzyme site, this site is positioned at the preceding 12bp of E1A initiation codon, with this plasmid called after pXC.1-Age I.

CHEB cuts with Age I enzyme respectively, its endonuclease bamhi inserts respectively in the pXC-Age I plasmid in the Age I restriction enzyme site, use primer 24 and 19 respectively and carry out pcr amplification, expand and 2050bp, this shows that the family of 30bp repeats among the Epstein-Barr virus Orip unites mini-SV40 promotor forward insertion pXC-Age I plasmid Age I site, be adenovirus 5 12bp places, type E1A upstream from start codon district, called after pXC-FRSVE1A.For confirming that further the family of 30bp repeats among the Epstein-Barr virus Orip unites mini-SV40 promotor forward insertion pXC-Age I plasmid Age I site, the present invention adds Xba I with pXC-FRSVE1A carrier application EcoR I and makes double digestion, reclaim the 2823bp fragment, insert pBluescript II SK carrier EcoR I and Xba I restriction enzyme site and check order, the result confirms that the family of 30bp repeats among the Epstein-Barr virus Orip unites mini-SV40 promotor forward insertion pXC-Age I plasmid Age I site.

The pXC.1 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), and pXC.1 contains 5 type adenoviral sequence bp22-5790.A plurality of restriction enzyme sites are founded at the 1686bp place in this carrier, comprise Bgl II, BamH I, Xho I and Xba I, and this restriction enzyme site is between E1B transcription site and initiation codon, and its method adopts two round pcrs (method is referring to above-mentioned document 1) of positional mutation.Its primer is respectively

Primer13:5 '-primer (containing Hind III and Hpa I restriction enzyme site) TTT TGCAAG CTT GTT AAC GCC TTT GTT TGC TGA

Primer14:3 '-primer (producing four restriction enzyme sites) CTC GAG GGA TCC AGATCT GCG CAT TAT ATA CCC TTT AAG

Primer15:5 '-primer (producing four restriction enzyme sites) AGA TCT GGA TCC CTC GAGTGA TCT AGA GGG CTA ATC TTG GTT ACA TC

Primer16:3 '-primer (containing Kpa I restriction enzyme site) CCA GAA AAT CCA GCAGGT AAC adopts two round pcrs of positional mutation, PCR product fragment is cut through Hind III and Kpn I enzyme, insert Hind III and Kpn I enzyme point of contact in the pUC19 carrier, pUC19 purchases the ATCC company in the U.S., called after pUC-E1B.This fragment is carried out dna sequencing, and its sequencing result shows: insert Bgl II, BamH I, Xho I and Xba I restriction enzyme site in E1b transcription initiation site and coding initiation site, other sequence is identical with pXC.1.

With CHEB-FRTK Xho I and Xba I double digestion, its fragment is inserted XhoI and Xba I restriction enzyme site among the pUC-E1B, promptly the family of 30bp repeats that forward inserts among the Epstein-Barr virus Orip in E1B transcription initiation site and coding initiation site unites the mini-TK promotor, name pUC-E1B-FRTK, use primer 28 and 23 and carry out pcr amplification, expand and 1159bp, this show among the Epstein-Barr virus Orip FR associating mini-TK promotor forward insert pUC plasmid Xho I and Xba I site.

The structure of the gland carrier of the E1 district disappearance of example 3. carrier's Endostatin (endostatin) genes

The pCA13 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), pCA13 contains 5 type adenoviral sequence bp22-5790 and lacks E1 district 342 to 3523bp fragments, has inserted Human cytomegalic inclusion disease virus (HCMV) IE promotor in E1 disappearance district (299-+72) and SV40 poly A tailing signal.Use polymerase chain reaction,PCR (PCR) technology human endostatin (endostatin) gene, extracted total RNA in fresh normal people's hepatic tissue, make reverse transcription reaction with random primer, at amplification human endostatin (endostatin) gene, and with twice polymerase chain reaction,PCR (PCR) technology (method is referring to document 1) before gene, adds M-become knurl albumen (Oncostatin-M) signal peptide and signal peptide before, gene end up introducing EcoRI and two restriction enzyme sites of XbaI.

Primer17：GGG?GAA?TTC?ACC?ATG?GGG?GTA?CTG?CTC?ACA?CAG?AGGACG?CTG?CTC?AGT?CTG?GTC?CTT?GCA?CTC

Primer18：CTG?CTC?AGT?CTG?GTC?CTT?GCA?CTC?CTG?TTT?CCA?AGCATG?GCG?AGC?CAC?CGC?GAC?TTC?CAG

Primer19：GCT?CTA?GAC?TAT?TAC?TTG?GAG?GCA?GTC?ATG?AAG?CTGTTC?TCA?ATG?CAT?AGC?ACG?ATG?TAG?GCG?TG

Primer18 and primer19 carry out the pcr amplification first time, reclaim the 615bp fragment, with primer17 and primer19 the 615bp fragment is carried out the pcr amplification second time again, reclaim the 647bp fragment, using EcoR I+Xba I cuts enzyme, will this gene insert in pbluescriptIIKS (+) carrier (purchasing ATCC company) and check order in the U.S., its sequencing result as follows:

GAATTCACCATGGGGGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTCCTGTTTCCAAGCATGGCGAGCCACAGCCACCGCGACTTCCAGCCGGTGCTCCACCTGGTTGCGCTCAACAGCCCCCTGTCAGGCGGCATGCGGGGCATCCGCGGGGCCGACTTCCAGTGCTTCCAGCAGGCGCGGGCCGTGGGGCTGGCGGGCACCTTCCGCGCCTTCCTGTCCTCGCGCCTGCAGGACCTGTACAGCATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCATCGTCAACCTCAAGGACGAGCTGCTGTTTCCCAGCTGGGAGGCTCTGTTCTCAGGCTCTGAGGGTCCGCTGAAGCCCGGGGCACGCATCTTCTCCTTTAACGGCAAGGACGTCCTGAGGCACCCCACCTGGCCCCAGAAGAGCGTGTGGCATGGCTCGGACCCCAACGGGCGCAGGCTGACCGAGAGCTACTGTGAGACGTGGCGGACGGAGGCTCCCTCGGCCACGGGCCAGGCCTCCTCGCTGCTGGGGGGCAGGCTCCTGGGGCAGAGTGCCGCGAGCTGCCATCACGCCTACATCGTGCTATGCATTGAGAACAGCTTCATGACTGCCTCCAAGTAATAGTCTAG

Its EcoR I+Xba I is downcut, and directed the insertion among the pCA13 carrier EcoR I+Xba I named pCA13-human endostatin.

Example 4, carry the structure of gland carrier of the E1 district disappearance of vasculogenesis chalone (angiostatin) gene

Use polymerase chain reaction,PCR (PCR) technology vasculogenesis chalone (angiostatin) gene, extracted total RNA in fresh normal people's hepatic tissue, do to carry out first round PCR behind the reverse transcription reaction with random primer, and introduce EcoR I and two restriction enzyme sites of Xho I in gene ending with twice polymerase chain reaction,PCR (PCR) technology (method is referring to document 1)

primer20：5’-AGCGAATTCCAAAATGGAACATAAGG-3’

EcoR I plasma fibrin lyase is former: 49-67

Primer21：5’-ACACTTTTCCTTGACCTGATTTCAG-3’

The plasma fibrin lyase is former: 348-343+111-94

primer22：5’-CTGAAATCAGGTCAAGGAAAAGTGTATCTCTCA

GAGTGC-3’

The plasma fibrin lyase is former: 94-111+343-363

primer23：5’-AGCCTCGAGCTATTACGCTTCTGTTCCTGAG-3’

Xho I (2 Stop) plasma fibrin lyase is former: 1431-1416

Primer20 and primer21, primer22 and primer23 carry out the PCR reaction first time respectively, and its reaction product is mixed, and carry out once more the PCR reaction with prime20 and primer23, reclaim the 1168bp fragment.Use EcoR I+Xho I enzyme cut, will this gene insert in pbluescript IIKS (+) carrier (purchasing ATCC company) and check order in the U.S., its sequencing result as follows:

GAATTCCAAAATGGAACATAAGGAAGTGGTTCTTCTACTTCTTTTATTTCTGAAATCAGGTCAAGGAAAAGTGTATCTCTCAGAGTGCAAGACTGGGAATGGAAAGAACTACAGAGGGACGATGTCCAAAACAAAAAATGGCATCACCTGTCAAAAATGGAGTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACACCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCCAGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAAAATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAAATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCCCAACAAGCGCTGGGAACTTTGCGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGGTCCCACCTACCAGTGTCTGAAGGGAACAGGTGAAAACTATCGCGGGAATGTGGCTGTTACCGTTTCCGGGCACACCTGTCAGCACTGGAGTGCACAGACCCCTCACACACATAACAGGACACCAGAAAACTTCCCCTGCAAAAATTTGGATGAAAACTACTGCCGCAATCCTGACGGAAAAAGGGCCCCATGGTGCCATACAACCAACAGCCAAGTGCGGTGGGAGTACTGTAAGATACCGTCCTGTGACTCCTCCCCAGTATCCACGGAACAATTGGCTCCCACAGCACCACCTGAGCTAACCCCTGTGGTCCAGGACTGCTACCATGGTGATGGACAGAGCTACCGAGGCACATCCTCCACCACCACCACAGGAAAGAAGTGTCAGTCTTGGTCATCTATGACACCACACCGGCACCAGAAGACCCCAGAAAACTACCCAAATGCTGGCCTGACAATGAACTACTGCAGGAATCCAGATGCCGATAAAGGCCCCTGGTGTTTTACCACAGACCCCAGCGTCAGGTGGGAGTACTGCAACCTGAAAAAATGCTCAGGAACAGAAGCGTAATAGCTCGAG

Its EcoR I+Xho I is downcut, and directed the insertion among the pCA13 carrier EcoR I+Xho I named pCA13-human angiostatin.

Example 5: carry the Epstein-Barr virus cis-acting elements control E1A of Endostatin or vasculogenesis chalone and the construction of recombinant adenovirus containing that E1B expresses:

Application Bgl II enzyme respectively cuts pCA13-human endostatin and pCA13-humanangiostatin, reclaim 1237bp respectively and (contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contain human endostatin gene and SV40poly A tailing signal that M-becomes the knurl protein signal peptide) and 1758bp (Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), people's blood vessel generates and suppresses and SV40 poly A tailing signal), be inserted into Bgl II restriction enzyme site among the pUC-E1B-FRTK, use the both forward and reverse directions that round pcr is verified its insertion respectively: its Bgl II upstream primer

primer24：GTT?AAC?GCC?TTT?GTT?TGC?TGA

Increase with human endostatin 5 ' and 3 '-primer respectively

Primer25 human endostatin 5 '-primer (be arranged in M-and become knurl protein signal peptide and human endostatin gene 110-131bp) TCC ACC TGG TTG CGC TCA ACA G

Primer26 human endostatin 3 '-primer (be arranged in M-and become knurl protein signal peptide and human endostatin gene 577-600bp) AGC ACG ATG TAG GCG TGA TGG C

Generating chalone 5 ' and 3 '-primer with people's blood vessel respectively increases

Primer27 people's blood vessel generates chalone 5 '-primer (be positioned at people's blood vessel and generate chalone 11-32bp) ATG GAA CAT AAG GAA GTG GTT C

Primer28 people's blood vessel generates chalone 3 '-primer (be positioned at people's blood vessel and generate chalone 823-842bp) AGG AGT CAC AGG ACG GTA TC

Its primer24 and the primer26 1122bp that can increase, show that containing Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contains human endostatin gene and SV40 poly A tailing signal forward insertion pUC-E1B-FRTK Bgl II restriction enzyme site that M-becomes the knurl protein signal peptide, called after pUC-E1B-FRTK-endostatin1.Its primer24 and the primer25 818bp that can increase shows and contains Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), containing M-becomes the human endostatin gene and the SV40poly A tailing signal of knurl protein signal peptide oppositely to insert pUC-E1B-FRTK Bgl II restriction enzyme site.Called after pUC-E1B-FRTK-endostatin2.

Its primer24 and the primer28 1364bp that can increase, show and contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), people's blood vessel generates the chalone gene and SV40poly A tailing signal forward inserts pUC-E1B-FRTK Bgl II restriction enzyme site, called after pUC-E1B-FRTK-angiostatin1.Its primer24 and the primer27 1440bp that can increase, show and contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), people's blood vessel generates the chalone gene and SV40 poly A tailing signal oppositely inserts pUC-E1B-FRTKBgl II restriction enzyme site, called after pUC-E1B-FRTK-angiostatin2.

Use Hpa I and Kpn I double digestion pUC-E1B-FRTK-endostatin1, pUC-E1B-FRTK-endostatin2, pUC-E1B-FRTK-angiostatin1 and pUC-E1B-FRTK-angiostatin2, reclaim fragment, insert Hpa I and Kpn I restriction enzyme site among the pXC-FRSVE1A respectively, respectively called after pXC-FRSVE1A-FRTKE1B-endostatin1, pXC-FRSVE1A-FRTKE1B-endostatin2, pXC-FRSVE1A-FRTKE1B-angio-statin1 and pXC-FRSVE1A-FRTKE1B-angiostatin2.

Example 6: the reorganization of carrying the Epstein-Barr virus cis-acting elements control E1A and the attenuation replicative adenovirus that E1B expresses of Endostatin or vasculogenesis chalone.

293 cell strains are purchased in Canadian Microbix Biosystem Inc. (Toronto), are to transform the human embryonic kidney cell by the 5 type adenovirus DNAs of shearing to form, and it contains and expresses 5 type adenovirus E 1 districts, and adenovirus DNA has high transfection efficiency to it.The plasmid that will contain 5 type adenovirus left arms is united plasmid co-transfection 293 cells that contain 5 type adenovirus right arms, can produce the adenovirus with infectivity by homologous recombination.By the thin strain of Lipofectamine cotransfection to 293, its concrete grammar is referring to the operation instructions of GIBCO BRL company with pXC-FRSVE1A-FRTKE1B-endostatin1, pXC-FRSVE1A-FRTKE1B-endostatin2, pXC-FRSVE1A-FRTKE1B-angiostatin1 and pXC-FRSVE1A-FRTKE1B-angiostatin2 and the plasmid pBHG10 that contains 5 type adenovirus right arms for we.PBHG10 purchases in Canadian Microbix BiosystemsInc. (Ontario), contains 5 type adenovirus right arms, but disappearance E3 district.Virus plaque appearred behind the cotransfection in 9-14 days, through three virus plaque purifying, promptly get the adenovirus that E1A and E1B are subjected to Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and the control of Orip FR associating mini-HSV-TK promotor, and carrier's Endostatin or vasculogenesis chalone, difference called after EBV FRSVEIA-FRTKE1B-endostatin1, EBVFRSVEIA-FRTKE1B-endostatin2, EBV FRSVEIA-FRTKE1B-angiostatin1 and FRSVEIA-FRTKE1B-angiostatin2 are designated as CNHKEBV-endostatin1 respectively, CNHKEBV-endostatin2, CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2.

Being listed as follows of the recombinant virus that makes up by aforesaid method:

Virus Name contains Ad5 left arm plasmid and contains the Ad5 right side

Arm plasmid EBV FRSVEIA-FRTK CNHKEBV-pXC-FRSVE1A-FRTKE1B-

PBHG10E1B-endostatin1 endostatin1 endostatin1EBV?FRSVEIA-FRTK CNHKEBV- pXC-FRSVE1A-FRTKE1B-

PBHG10E1B-endostatin2 endostatin2 endostatin2EBV?FRSVEIA-FRTK CNHKEBV- PXC-FRSVE1A-FRTKE1B-

PBHG10E1B-angiostatin1 angiostatin1 angiostatin1EBV?FRSVEIA-FRTK CNHKEBV- PXC-FRSVE1A-FRTKE1B-

PBHG10E1B-angiostatin2 angiostatin2 angiostatin2

Adenovirus is breeding in a large number in 293 cells, uses the method large-scale purification adenovirus (concrete grammar is published referring to aforementioned documents 2) of caesium chloride density gradient centrifugation.EBV FRSVEIA-FRTKE1B-endostatin1 (CNHKEBV-endostatin1) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and Orip FR associating mini-HSV-TK promotor respectively, and at a newly-built Bgl II restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, forward inserts and contains Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72) in this restriction enzyme site, contain human endostatin gene and SV40 poly A tailing signal gene order that M-becomes the knurl protein signal peptide, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.EBV FRSVEIA-FRTK E1B-endostatin2 (CNHKEBV-endostatin2) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and Orip FR associating mini-HSV-TK promotor respectively, and at a newly-built Bgl II restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, in this restriction enzyme site, oppositely insert and contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contain human endostatin gene and SV40 poly A tailing signal gene order that M-becomes the knurl protein signal peptide, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.

EBV FRSVEIA-FRTK E1B-angiostatin1 (CNHKEBV-angiostatin1) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and OripFR associating mini-HSV-TK promotor respectively, and at a newly-built Bgl II restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, forward inserts and contains Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72) in this restriction enzyme site, contain people's blood vessel and generate chalone gene and SV40 poly A tailing signal gene order, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.EBV FRSVEIA-FRTK E1B-angiostatin2 (CNHKEBV-angiostatin2) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and Orip FR associating mini-HSV-TK promotor respectively, and at a newly-built Bgl II restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, in this restriction enzyme site, oppositely insert and contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contain people's blood vessel and generate chalone gene and SV40poly A tailing signal gene order, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.

Example 7: the Epstein-Barr virus cis-acting elements of carrier's Endostatin or people's blood vessel generation chalone is controlled the external tumor cell proliferation at epstein barr infection or latent infection of the attenuation replicative adenovirus of E1A and E1B expression, is duplicated and efficiently express human endostatin or people's blood vessel generation chalone factor and specific killing tumour cell.

CNHKEBV-endostatin1, CNHKEBV-endostatin1, CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2 are infected the lymphoma cell strain Jijoye, 293 and the normal people inoblast of ebv infection respectively, and cell is by 2 * 10 ⁵6 orifice plates are inoculated in/hole, infect recombinant adenovirus CNHKEBV-endostatin1, CNHKEBV-endostatin1, CNHKEBV-angiostatin1, CNHKEBV-angiostatin2 and wild-type 5 type adenovirus 4 * 10 respectively ⁵Pfu uses 293 cell strains and measures its virus titer after 48 hours, concrete grammar is referring to aforementioned documents 2, and the result is:

Normal one-tenth fiber finer

293 Jijoye

Born of the same parents' wild-type 5 type glands

Virus 1 * 10 ⁵7 * 10 ⁴5 * 10 ⁴

CNHKEBV-

1×10 ⁵ 4×10 ⁵ 3×10 endostatin1

CNHKEBV-

1×10 ⁵ 4×10 ⁵ 4×10 endostatin2

CNHKEBV-

1×10 ⁵ 2.5×10 ⁵ 2×10 angiostatin1

CNHKEBV-

1×10 ⁵ 2.5×10 ⁵ 2×10 ² angiostatin1

The lymphoma cell strain Jijoye and the normal people inoblast that infect ebv infection are infected recombinant adenovirus CNHKEBV-endostatin1, CNHKEBV-endostatin2, CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2 respectively, MOI is 1, hatched 1 hour for 37 ℃, infect back 7 days collecting cells, use QIAamp DNA Bloodmini kit (German QIAGEN company) and extract viral DNA, method is referring to QIAGEN company operation instructions.Use Nhe I and Xho I double digestion, the agarose electrophoresis with 0.8% goes to nylon membrane with it, uses ³²P labelling human 5 type adenovirus 1178bp BstXI add Xho I fragment (being positioned at adenovirus nt4611-5789), carry out souther blot hybridization, contrast (method is referring to document 2) with pXC.1 as viral copy number, CNHKEBV-endostatin1, CNHKEBV-endostatin2, CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2 are respectively 5 * 10 at Jijoye and fibroblastic each the cell virus copy number of normal people ⁴, 5 * 10 ⁴, 4 * 10 ⁴, 4 * 10 ⁴And 0,0,0,0.The DNA that above-mentioned CNHKEBV-endostatin1 and CNHKEBV-endostatin2 are extracted uses Bgl II enzyme respectively and cuts, and the agarose electrophoresis with 1% goes to nylon membrane with it, usefulness ³²P is labelling human Endostatin cDNA fragment (EcoR I and Xba I double digestion pCA13-humanendostatin respectively, reclaim 637bp) as probe, carry out souther blot hybridization, contrast (method is referring to document 2) with pCA13-human endostatin as viral copy number, CNHKEBV-endostatin1 and CNHKEBV-endostatin2 are respectively 5 * 10 at Jijoye and fibroblastic each the cell virus copy number of normal people ⁴, 5 * 10 ⁴And＜10,＜10.

The DNA that above-mentioned CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2 are extracted uses Bgl II enzyme respectively and cuts, and the agarose electrophoresis with 1% goes to nylon membrane with it, usefulness ³²P is labelling human vasculogenesis chalone cDNA fragment (EcoR I and Xba I double digestion pCA13-human angiostatin respectively, reclaim 1168bp) as probe, carry out souther blot hybridization, contrast (method is referring to document 2) with pCA13-human angiostatin as viral copy number, CNHKEBV-angiostatin1 and CNHKEBV-angiostatin2 are respectively 4 * 10 at Jijoye and fibroblastic each the cell virus copy number of normal people ⁴, 4 * 10 ⁴And＜10,＜10.

Example 8: carrier's Endostatin or people's blood vessel generate the tumor cell transplantation knurl at SCID mouse interior therapeutic ebv infection or latent infection of the Epstein-Barr virus cis-acting elements control E1A and the attenuation replicative adenovirus that E1B expresses of chalone

Lymphoma cell strain Jijoye cell 5 * 10 with the SCID mouse hypodermic inoculation ebv infection in age in 4-5 week ⁷, give 5 * 10 after two weeks ⁸Pfu proliferous type recombinant adenovirus CNHK101 treatment or with the contrast adenovirus Ad5-LacZ of same dose, its not treatment group and the back tumour bodies increase of contrast adenovirus treatment 4 week of group be more than 3 times, and treatment is organized then tumour and obviously dwindled the completely dissolve of part tumour.

Example 9: the structure of gland carrier that carries the E1 district disappearance of interleukin 12 fusion gene

The pCA14 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), pCA14 contains 5 type adenoviral sequence bp22-5790 and lacks E1 district 342 to 3523bp fragments, has inserted Human cytomegalic inclusion disease virus (HCMV) IE promotor in E1 disappearance district (299--+72) and SV40 poly A tailing signal.

Use polymerase chain reaction,PCR (PCR) technology amplification interleukin 12 fusion gene, extracted total RNA in fresh normal human T-cell, do to carry out first round PCR behind the reverse transcription reaction with random primer, and introduce Sal I restriction enzyme site in gene ending with twice polymerase chain reaction,PCR (PCR) technology (method is referring to 1)

primer29：TTT?GTC?GAC?CAT?GGG?TCA?CCA?GCA?GTT?GGT?CAT

Primer30：AGA?TCC?GCC?GCC?ACC?GCC?ACC?ACT?GCA?GGG?CAC?AGA

TGC?CCA

Primer31：GGT?GGC?GGT?GGC?GGC?GGA?TCT?AGA?AAC?CTC?CCC?GTG

GCC?ACT

Primer32：TAT?AAA?GTC?GAC?TCA?TTA?GGA?AGC?ATT?CAG?ATA?GCT

CG

Primer29 and primer30, primer31 and primer32 carry out the PCR reaction first time respectively, and its reaction product is mixed, and carry out once more the PCR reaction with prime29 and primer32, reclaim the 1610bp fragment.Use Sal I enzyme and cut, this gene is inserted in pbluescriptIIKS (+) carrier (purchasing the ATCC company in the U.S.) check order, its sequencing result is correct.

Its Sal I is downcut, insert among the pCA14 carrier S al I, use BamH I enzyme and cut identified gene to insert both forward and reverse directions, its BamH I enzyme is cut visible 1422bp and 6919bp, this shows that hIL-12 fusion gene forward inserts in the pCA14 carrier, name pCA14-humanIL-12.

Example 10: the Epstein-Barr virus cis-acting elements control E1A of carrier's interleukin 12 and the construction of recombinant adenovirus containing that E1B expresses:

Use the partially digested pCA14-human IL-12 of Bgl II, reclaim 2191bp respectively and (contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), people IL-12 fusion gene and SV40 poly A tailing signal), be inserted into Bgl II restriction enzyme site among the pUC-E1B-FRTK, use the both forward and reverse directions that round pcr is verified its insertion respectively: its Bgl II upstream primer

primer24：GTT?AAC?GCC?TTT?GTT?TGC?TGA

Primer29 and primer32 with human interleukin 12 increases respectively

Its primer24 and the primer32 2122bp that can increase, show that containing Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contains people IL12 fusion gene and SV40poly A tailing signal forward insertion pUC-E1B-FRTK Bgl II restriction enzyme site, called after pUC-E1B-FRTK1-IL12.Its primer24 and the primer29 2122bp that can increase shows that containing Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contains people IL12 fusion gene and SV40 poly A tailing signal oppositely inserts pUC-E1B-FRTK Bgl II restriction enzyme site.Called after pUC-E1B-FRTK2-IL12.

Use Hpa I and Kpn I double digestion pUC-E1B-FRTK1-IL12 and pUC-E1B-FRTK2-IL12, reclaim fragment, insert HpaI and Kpn I restriction enzyme site among the pXC-FRSVE1A respectively, respectively called after pXC-FRSVE1A-FRTKE1B1-IL12, pXC-FRSVE1A-FRTKE1B2-IL12.

Example 11: the reorganization of carrying the Epstein-Barr virus cis-acting elements control E1A and the attenuation replicative adenovirus that E1B expresses of interleukin 12 fusion gene.

293 cell strains are purchased in Canadian Microbix Biosystem Inc. (Toronto), are to transform the human embryonic kidney cell by the 5 type adenovirus DNAs of shearing to form, and it contains and expresses 5 type adenovirus E 1 districts, and adenovirus DNA has high transfection efficiency to it.The plasmid that will contain 5 type adenovirus left arms is united plasmid co-transfection 293 cells that contain 5 type adenovirus right arms, can produce the adenovirus with infectivity by homologous recombination.By the thin strain of Lipofectamine cotransfection to 293, its concrete grammar is referring to the operation instructions of GIBCO BRL company with pXC-FRSVE1A-FRTKE1B1-IL12 and pXC-FRSVE1A-FRTKE1B2-IL12 and the plasmid pBHG10 that contains 5 type adenovirus right arms for we.PBHG10 purchases in Canadian MicrobixBiosystems Inc. (Ontario), contains 5 type adenovirus right arms, but disappearance E3 district.Virus plaque appearred behind the cotransfection in 9-14 days, through three virus plaque purifying, promptly get the adenovirus that E1A and E1B are subjected to Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and the control of OripFR associating mini-HSV-TK promotor, and carrier's interleukin 12 fusion gene, called after EBV FRSVEIA-FRTKE1B1-IL12 and FRSVEIA-FRTKE1B2-IL12 are designated as CNHKEBV1-IL12 and CNHKEBV2-IL12 respectively respectively.

Contain the Ad5 right side

Virus Name contains Ad5 left arm plasmid

Arm plasmid EBV FRSVEIA-FRTK pXC-FRSVE1A-

CNHKEBV1-IL12 PBHG10

E1B1-IL12 FRTKE1B1-IL12EBV?FRSVEIA-FRTK pXC-FRSVE1A-

CNHKEBV2-IL12 PBHG10

E1B2-IL12 FRTKE1B2-IL12

Adenovirus is breeding in a large number in 293 cells, uses the method large-scale purification adenovirus (method is referring to document 2) of caesium chloride density gradient centrifugation.EBV FRSVEIA-FRTK E1B1-IL12 (CNHKEBV1-IL12) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and Orip FR associating mini-HSV-TK promotor respectively, and at a newly-built BglII restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, forward inserts and contains Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72) in this restriction enzyme site, contain human interleukin 12 fusion gene and SV40 poly A tailing signal gene order, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.EBV FRSVEIA-FRTK E1B2-IL12 (CNHKEBV2-IL12) is 5 type adenovirus, between E1A and E1B transcription initiation site and coding initiation site, insert Epstein-Barr virus cis-acting elements Orip FR associating mini-SV40 promotor and Orip FR associating mini-HSV-TK promotor respectively, and at a newly-built BglII restriction enzyme site after the E1A terminator codon and between the Orip FR associating mini-HSV-TK promotor upstream, in this restriction enzyme site, oppositely insert and contain Human cytomegalic inclusion disease virus (HCMV) IE promotor (299--+72), contain human interleukin 12 fusion gene and SV40 poly A tailing signal gene order, with 28133-30818bp (E3 district partial sequence) disappearance, other dna sequence dnas of virus are identical with 5 type adenovirus simultaneously.

Example 12: the external tumor cell proliferation of the attenuation replicative adenovirus that the Epstein-Barr virus cis-acting elements of carrier's interleukin 12 fusion gene control E1A and E1B express, duplicate and efficiently express human interleukin 12 and specific killing tumour cell at epstein barr infection or latent infection.

CNHKEBV1-IL12 and CNHKEBV2-IL12 are infected the lymphoma cell strain Jijoye, 293 and the normal people inoblast of ebv infection respectively, and cell is by 2 * 10 ⁵6 orifice plates are inoculated in/hole, infect recombinant adenovirus CNHKEBV1-IL12, CNHKEBV2-IL12 and wild-type 5 type adenovirus 4 * 10 respectively ⁵Pfu uses 293 cell strains and measures its virus titer after 48 hours, concrete grammar is referring to aforementioned documents 2, and the result is:

Normal one-tenth fiber finer

293 Jijoye

Born of the same parents' wild-type 5 type adenovirus 1 * 10 ⁵7 * 10 ⁴5 * 10 ⁴CNHKEBV1-IL12 1 * 10 ⁵3 * 10 ⁵2 * 10CNHKEBV2-IL-12 1 * 10 ⁵2 * 10 ⁵3 * 10

The lymphoma cell strain Jijoye and the normal people inoblast that infect ebv infection are infected recombinant adenovirus CNHKEBV1-IL12 and CNHKEBV2-IL12 respectively, MOI is 1, hatched 1 hour for 37 ℃, infect back 7 days collecting cells, use QIAamp DNA Blood minikit (German QIAGEN company) and extract viral DNA, method is referring to QIAGEN company operation instructions.Use Nhe I and Xho I double digestion, the agarose electrophoresis with 0.8% goes to nylon membrane with it, uses ³²P labelling human 5 type adenovirus 1178bp BstXI add Xho I fragment (being positioned at adenovirus nt4611-5789), carry out souther blot hybridization, contrast as viral copy number with pXC.1 that (method is referring to the molecular cloning experiment guide, scientific publication 1992 is published), CNHKEBV1-IL12 and CNHKEBV2-IL12 are respectively 5 * 10 at Jijoye and fibroblastic each the cell virus copy number of normal people ⁴, 5 * 10 ⁴, and＜10,＜10.The DNA that above-mentioned CNHKEBV1-IL12 and CNHKEBV2-IL12 are extracted uses Bgl II enzyme respectively and cuts, and the agarose electrophoresis with 1% goes to nylon membrane with it, usefulness ³²P is labelling human Endostatin cDNA fragment (EcoR I and Xba I double digestion pCA14-human IL12 respectively, reclaim 637bp) as probe, carry out souther blot hybridization, contrast as viral copy number with pCA13-human endostatin that (method is referring to the molecular cloning experiment guide, scientific publication 1992 is published), CNHKEBV1-IL12 and CNHKEBV2-IL12 are respectively 5 * 10 at Jijoye and fibroblastic each the cell virus copy number of normal people ⁴, 5 * 10 ⁴And＜10,＜10.

Claims

1. the proliferous type recombinant virus of an energy specific killing tumor relating to EB virus cell, it is characterized in that non-propagation must be inserted with goal gene in the zone in its modification virus genome, this goal gene is a kind of of cancer suppressor gene, blood vessel suppressor gene, cytokine gene, prodrug conversion enzyme gene and apoptosis gene.

2. recombinant virus according to claim 1 is characterized in that described cancer suppressor gene comprises with next gene: P53, P21, Rb, NF1, VHL and APC.

3. recombinant virus according to claim 1, it is characterized in that described blood vessel suppressor gene comprises with next gene: endostatin gene, vasculogenesis chalone gene is the former middle Kringle1-4 structure of plasma fibrin lyase, the Kringle1-5 structure, Kringle1-3 structure and Kringle1-3 add the Kringle5 structure, the interferon-' alpha ' gene, the interferon-beta gene, the interferon-gene, the thrombospondin gene, the platelet factor 4 gene, plasminogen activating factors inhibitor (PAI) gene, interleukin 12 and Zeta protein gene.

4. recombinant virus according to claim 3 is characterized in that containing the coding coding sequence of secretory signal peptide in the described blood vessel suppressor gene blood vessel suppressor gene.This coding sequence of secretory signal peptide can be any in following: Angiostatin self signal peptide, M-becomes knurl protein signal peptide, immunoglobulin (Ig) K chain signal peptide.

5. recombinant virus according to claim 1 is characterized in that described cytokine gene comprises with next gene: interleukin II, interleukin 12, granuno-mono-colong stimulating factor, tumour necrosis factor, interferon-' alpha ', interferon-beta, interferon-, Light and Flt3 part.

6. recombinant virus according to claim 1 is characterized in that described prodrug conversion enzyme gene comprises with next gene: hsv thymidine kinase, varicella zoster virus thymidine kinase and coli cytosine deaminase.

7. recombinant virus according to claim 1 is characterized in that described apoptosis gene comprises with next gene: ICE, capase-3, capase-8, capase-9.

8. recombinant virus according to claim 1, it is characterized in that being inserted with certain cis-acting elements by zone between the transcripting start point of virus multiplication indispensable gene and the coding initiation site, this cis-acting elements contains one of following order at least: the Orip in the Epstein-Barr virus, FR among the Epstein-Barr virus Orip, Epstein-Barr virus BamHI C-promotor, Orip associating Epstein-Barr virus BamHI C-promotor in the Epstein-Barr virus, FR associating basic promotor of hsv thymidine kinase or the basic promotor of SV40 among the Epstein-Barr virus Orip, specificity activated cis-acting elements in ebv infection or latent infection cell, the virus multiplication indispensable gene is an early genes.

9. recombinant virus according to claim 8 is characterized in that described this proliferous type recombinant virus is an adenovirus, and this adenovirus propagation indispensable gene contains the early expression gene with next adenovirus at least: E1A, E1B, E2, E4.

10. the construction process of the proliferous type recombinant virus of an energy specific killing tumor relating to EB virus cell, it is characterized in that giving the cell that can produce recombinant adenovirus with two carrier cotransfections that contain adenovirus left arm and right arm respectively, have in these two adenovirus carriers that the non-propagation required area of adenovirus inserts certain goal gene in the carrier at least, has adenovirus early gene E1A in the carrier at least in these two adenovirus carriers simultaneously, E1B, E2, express the zone between E4 district transcription initiation site and the coding initiation site and insert certain cis-acting elements, this cis is made element and is contained one of following order at least: the Orip in the Epstein-Barr virus, FR among the Epstein-Barr virus Orip, Epstein-Barr virus Bam HIC-promotor, Orip associating Epstein-Barr virus Bam HI C-promotor in the Epstein-Barr virus, FR associating basic promotor of hsv thymidine kinase or the basic promotor of SV40 among the Epstein-Barr virus Orip, and in ebv infection or latent infection cell specificity activated cis-acting elements.

11. the construction process of a kind of recombinant virus according to claim 10, it is characterized in that between adenovirus early gene transcription initiation site and coding initiation site, doing a restriction enzyme site in the zone by polymerase chain reaction technology, cut by enzyme, above-mentioned cis-acting elements is inserted this site, make adenovirus early gene be controlled by ebv infection or latent infection cell-specific activated cis-acting elements.

12. the enrichment procedure of the proliferous type recombinant virus of an energy specific killing tumor relating to EB virus cell, it is characterized in that cells of mamma animals, recombinant virus is bred in the cells of mamma animals of ebv infection or latent infection specifically recombinant virus infection ebv infection or latent infection.

13. one kind as claimed in claim 1 can specific killing tumor relating to EB virus the application of proliferous type recombinant virus of cell, it is characterized in that this recombinant virus is used for the tumour cell of Infection in Vitro ebv infection or latent infection causing cytotoxicity.

14. one kind as claimed in claim 1 can specific killing tumor relating to EB virus the application of proliferous type recombinant virus of cell, it is characterized in that this recombinant virus is used to suppress the growth of the tumour cell of ebv infection or latent infection.

15. one kind as claimed in claim 1 can specific killing tumor relating to EB virus the application of proliferous type recombinant virus of cell, it is characterized in that this recombinant virus is used for optionally killing in the body tumour cell of ebv infection or latent infection.

16. an antitumor drug is characterized in that this medicine is by the proliferous type recombinant virus of wanting 1 described energy specific killing tumor relating to EB virus as right and the mixture that chemotherapeutics, biotoxin, monoclonal antibody are formed.

17. antitumor drug according to claim 16 is characterized in that said chemotherapeutic agent is a kind of of cis-platinum, 5-fluor-uracil, ametycin, carbon platinum, endoxan.

18. antitumor drug according to claim 16 is characterized in that said biotoxin is a kind of of snake venom toxin, diphtheria toxin.

19. antitumor drug according to claim 16 is characterized in that said monoclonal antibody is a nasopharyngeal carcinoma cell antibody.