CN1381460A - Structure and usage of plasminogen activator (TPA) mutant - Google Patents

Abstract

A novel TPA mutant is prepared from original TPA through amplifying natural TPA amino acid 1-3 and 176-527 DNA sequence; changing the AAG CAC AGG AGG at 373-383 of nucleotide sequence to GCG GCC GCG GCG to configure the novel TPA mutant, and cloning it to colibacillus expression carrier for efficient expression in colibacillus; protein rematurization to obtain active TPA mutant; cloning it to specific gibberellin secretion-type expression carrier, and culturing the supernatant to obtain high-activity TPA mutant. It can be used in medicine to treat myocardial infarction and cerebral thrombus.

Description

The structure and the purposes of a kind of plasminogen activator (TPA) mutant

Thromboembolism treatment is the major progress of handling Acute Myocardial Infarction.(tissue plasminogenactivator TPA) is the physiological activator of fibrinolytic system in the blood in tissue plasminogen activator.Because TPA and thrombus stroma fibrin have stronger special avidity, can be that plasmin makes thrombolysis at the local effectively plasminogen activation of thrombus.Thrombolytics such as TPA and streptokinase, urokinase relatively have fibrinolysis, the curative effect advantages of higher that effect soon, does not cause whole body.(alteplase actilyse) has been successfully used to thrombotic diseases such as Acute Myocardial Infarction to the recombinant human TPA of the expressing cho cell of being produced by German Boehringer Ingelheim (Boehringer Ingelheim) for CHO-TPA, alteplase.But as thrombolytics, TPA also has weak point.As being removed fast by liver cell in vivo, in blood plasma, exist inhibitors of plasminogen activator inhibitor can suppress its activity fast.The transformation period of t-PA in blood very short (1-5 minute) needs heavy dose of (100mg) intravenous drip for keeping effective concentration when making clinical thromboembolism treatment, increased the danger that systemic fibrinolytic causes bleeding.Therefore develop that specificity is good, long half time, consumption novel t-PA little, easy to use receive publicity.

The TPA molecular structure is relevant with its specific functional performance.Natural TPA forms (Pennica D, etal.Nature 301:214,1983) by 527 amino acid, and finger regions (F, amino acid/11-99) and high scleroproein are in conjunction with relevant; (K1, amino acid/11 00-175) is the liver receptor combining site in kringle 1 district; Kringle2 district (K2, amino acid/11 76-261) is low scleroproein land; Proteolytic enzyme district (P, amino acid 262-527) is the PAI-1 binding site to the original specificity of plasmin; The carbohydrate district is the mediators of plasma clearance TPA.Several new plasminogen activators are all found to design on the basis at this.By natural tissues type plasminogen activator (TPA) molecule is carried out structure of modification, the reorganization varient K2P of tissue-type plasminogen activator, reteplase (reteplase), n-PA and TNK etc. have been developed.

(Weldenstrom M, et al.Gene.99:243-248,1991) such as Weldenstrom M have reported the expression of TPA mutant K2P (amino acid/11-5 and 174-527, Asn177Ser and Asn184Gln) in enterobacteria.KohnertU etc. have developed reteplase (Kohnert U, et al.Protein Engineering5:93,1992, the patent No.: EP 0 382 174 A1) on the basis of TPA mutant K2P.Reteplase is one to contain 355 amino acid whose single chain molecules, at expression in escherichia coli.It does not have carbohydrate chain, finger regions, epidermal growth factor subarea and kringle1 district, only contains kringle2 district and serine protease district (amino acid/11-3 and 176-527), and therefore the character of whole molecule change greatly.At first it and fibrinous combination rate be far below natural TPA, and be reversible combination, and unconjugated reteplase can enter blood clot, promotes fibrinolysis.Secondly, clearance rate is lower, and the transformation period is grown (18 minutes), keeps the needed dose of treatment level (20-40mg) thereby reduced, and can pass through intravenous administration (injecting in 2 minutes).Martin etc. (Martin U, et al.JACC 19:433,1992) have compared the external haemolysis piece activity of reteplase, alteplase (alteplase), melanoma TPA (melanoma TPA) and urokinase.The result shows that the maximum thrombolysis ability of reteplase and alteplase is close when concentration of equal value.Martin etc. studies show that, compare with alteplase, and the ability of reteplase dissolving platelet rich plasma grumeleuse and outmoded grumeleuse is lower.This is the hemorrhage reason of reteplase minimizing just, because the blood clot of sealing injured blood vessel wall is outmoded blood clot.Different with alteplase, reteplase is mainly removed by kidney.Clinical trial shows that reorganization varient reteplase (reteplase) blocked relevant total open rate coronarius in the time of 60 minutes and open fully rate is better than alteplase, and security is suitable.Based on the above-mentioned advantage of reteplase, U.S. FDA was ratified the reteplase listing in 1998.But still include the PAI-1 binding site in the reteplase structure, the PAI-1 in the blood of human body can combine with it and suppress its activity.Experiment in vitro shows that the PAI-1 of 5U/ml can make the reteplase inactivation of 5ng/ml.PAI-1 concentration is higher than the normal people in the thrombus disease human blood such as report myocardial infarction etc. and have, so must reduce the effect of reteplase, increases its consumption.

The objective of the invention is the constructional feature according to TPA, on the basis of reteplase PAI-1 site amino acid is suddenlyd change, structure has active and its active TPA mutant of new generation that is not suppressed by PAI-1 of TPA.(the Pennica D of reference literature to the effect that of the present invention, et al.Nature 301:214,1983) from human myeloma cell, separate total RNA, t-PA cDNA sequences Design primer by bibliographical information amplifies the full length coding region sequence with the RT-PCR method, clone carrier in pUC18, entirely true through checking order.Reference literature (Kohnert U, et al.Protein Engineering5:93,1992, the patent No.: EP 0 382 174 A1) amplifies the DNA (TPA amino acid/11-3 and 176-527) of reteplase with the PCR method, and clones in coli expression carrier.After process order-checking proof sequence is entirely true, with PAI-1 binding site among the reteplase DNA, the AAG CAC AGG AGG of nucleotide sequence 373-384 changes into GCGGCC GCG GCG, make corresponding amino acid KHRR sport AAAA, made up new TPA mutant, and cloned in coli expression carrier.After process order-checking proof sequence was entirely true, transformed into escherichia coli was efficiently expressed in intestinal bacteria.Expressing protein accounts for 30% of total tropina, exists with the inclusion body form.Through protein renaturation, obtained activated TPA mutant.With new TPA mutant, clone in than red yeast secretion type expression carrier, in culture supernatant, obtain the TPA mutant of high reactivity (2000U/ug).Set up t-PA Profibrinolysin hydrolytic activity and PAI-1 and suppressed measuring methods such as TPA activity.In intestinal bacteria and the active unrestraint of TPA after 15 minutes than the new TPA mutant 5ng/ml of red yeast expression and PAI-1 15U/ml room temperature reaction, and natural CHO-TPA activity all is suppressed.The preparation and purifying the anti-CHO-TPA antibody of rabbit.With immunoblotting be presented at intestinal bacteria and than the reteplase of red yeast expression sudden change physical efficiency by anti-CHO-TPA antibody recognition.

The dna sequence dna of new TPA mutant contains 1068 nucleic acid bases, comprises codon ATG, and concrete sequence (5 '-3 ') is as follows:

1 atgtcttaccaaggaaacagtgactgctactttgggaatgggtcagcctaccgtggcacg 60

61 cacagcctcaccgagtcgggtgcctcctgcctcccgtggaattccatgatcctgataggc 120

121 aaggtttacacagcacagaaccccagtgcccaggcactgggcctgggcaaacataattac 180

181 tgccggaatcctgatggggatgccaagccctggtgccacgtgctgaagaaccgcaggctg 240

241 acgtgggagtactgtgatgtgccctcctgctccacctgcggcctgagacagtacagccag 300

301 cctcagtttcgcatcaaaggagggctcttcgccgacatcgcctcccacccctggcaggct 360

361 gccatctttgccgcggccgcggcgtcgcccggagagcggttcctgtgcgggggcatactc 420

421 atcagctcctgctggattctctctgccgcccactgcttccaggagaggtttccgccccac 480

481 cacctgacggtgatcttgggcagaacataccgggtggtccctggcgaggaggagcagaaa 540

541 tttgaagtcgaaaaatacattgtccataaggaattcgatgatgacacttacgacaatgac 600

601 attgcgctgctgcagctgaaatcggattcgtcccgctgtgcccaggagagcagcgtggtc 660

661 cgcactgtgtgccttcccccggcggacctgcagctgccggactggacggagtgtgagctc 720

721 tccggctacggcaagcatgaggccttgtctcctttctattcggagcggctgaaggaggct 780

781 catgtcagactgtacccatccagccgctgcacatcacaacatttacttaacagaacagtc 840

841 accgacaacatgctgtgtgctggagacactcggagcggcgggccccaggcaaacttgcac 900

901 gacgcctgccagggcgattcgggaggccccctggtgtgtctgaacgatggccgcatgact 960

961 ttggtgggcatcatcagctggggcctgggctgtggacagaaggatgtcccgggtgtgtac 1020

1021?accaaggttaccaactacctagactggattcgtgacaacatgcgaccg?1068

The amino sequence of new TPA mutant following (M is initial methionine(Met)):

(M)1 SYQGNSDCYF?GNGSAYRGTH?SLTESGASCL?PWNSMILIGK?VYTAQNPSAQ51 ALGLGKHNYC?RNPDGDAKPW?CHVLKNRRLT?WEYCDVPSCS?TCGLRQYSQP101?QFRIKGGLFA?DIASHPWQAA?IFAAAAASPG?ERFLCGGILI?SSCWILSAAH151?CFQERFPPHH?LTVILGRTYR?VVPGEEEQKF?EVEKYIVHKE?FDDDTYDNDI201?ALLQLKSDSS?RCAQESSVVR?TVCLPPADLQ?LPDWTECELS?GYGKHEALSP251?FYSERLKEAH?VRLYPSSRCT?SQHLLNRTVT?DNMLCAGDTR?SGGPQANLHD301?ACQGDSGGPL?VCLNDGRMTL?VGIISWGLGC?GQKDVPGVYT?KVTNYLDWIR351?DNMRP

According to the present invention, the dna sequence dna of listed TPA mutant and the TPA mutant of the amino acid sequence coded Profibrinolysin hydrolytic activity that can in intestinal bacteria and yeast, give expression to thus, and its Profibrinolysin hydrolytic activity is not suppressed by PAI-1.Illustrate that nucleotide sequence 373-384 and its corresponding aminoacid sequence influence PAI-1 in conjunction with activity, and do not influence its Profibrinolysin hydrolytic activity.This sudden change type might become the novel biological engineering medicine of the treatment thrombotic diseases that activity is good, consumption is few.

Enforcement of the present invention has important social benefit and economic benefit to the treatment of thrombotic diseases such as the myocardial infarction of serious harm human health and cerebral thrombosis.Accompanying drawings specific implementation method of the present invention:

1.tPAmtPA-pET28a2.PAI-1TPAmtPA4A-pAC177-pET28a3.tPAPCR4.mtPA-pet28a5.mtPA4A-pAC177-pET28a6.TPASDS-PAGE7.TPA8.PAI-1CHO-TPATPA9. ( ) TPApPIC 9K/mtPA4A10. ( ) TPApPIC 9K/mtPA 4A11.TPAWestern-blot12. ( ) TPA13.PAI-1CHO-TPA ( ) TPA

Embodiment one: the expression materials and methods of tpA mutant in intestinal bacteria: 1. segmental preparation 1.1 templates of natural tpA clipped form, and contain puc18 plasmid (being made up by this laboratory) 1.2 design of primers of total length TPA cDNA sequence: upstream primer P1 (3 ' 33 nt of 5 ' CATGCC ATG GGG TCT TAC CAG GGA AAC AGT GAC) contains NdeI restriction enzyme site and ATG translation initiation codon and glycine password GGG; Downstream primer P2 (3 ', 28 nt of 5 ' CGG GAT CCT CAC GGT CGC ATG TTG TCA C) contains BamHI restriction enzyme site and TGA terminator codon.1.3 pcr amplification: amplified production is that the tPA gene fragment of clipped form contains natural tPA amino acid/11-3 and 176-527.2. the tPA construction of recombinant plasmid (Fig. 1) of clipped form: pcr amplification product is carried out the phenol extracting, with the pET28a carrier, carry out double digestion with NcoI/BamHI respectively then, it is disconnected to reclaim the enzyme section with 1% low melting-point agarose gel electrophoresis, the phenol extracting.The enzyme of DNA is cut, and connects and transform all to carry out with reference to the Sambrook method.Competent cell is homemade E.coliDH5a.3. the clone identifies: 3.1 enzymes are cut evaluation: the bacterium colony that conversion is grown carries out little upgrading grain, carries out preliminary evaluation with the NcoI/BamHI double digestion.3.2 sequential analysis: positive bacterium colony is shaken bacterium, middle upgrading grain, carry out sequence through automatic dna sequencer and examine.Called after mtPA-pET28a4. is to the reconstruction of recombinant plasmid mtPA-pET28a: 3 G that have more after the 4.1 removal ATG promotors: design 3 ', 30 nt of primer P3:5 ' CAT GCC ATG GCT TAC CAGGGA AAC AGT GAC.With the mtPA-pet28a recombinant plasmid is template, increases with P3 and P2, and product NcoI/BamHI double digestion is connected, transforms with the pET-28a of NcoI/BamHI double digestion again, and little upgrading granzyme is cut and identified and order-checking is examined.4.2 the G after the ATG promotor is sported T: 3 ', 29 nt of design primer P4:5 ' GGA GAT ATA CCA TGT CTTACC AGG GAA AC; 5 ' GTT TCC CTG GTA AGA CAT GGT ATA TCT CC3 ', 29 nt; Plasmid with 4.1 reconstructions is a template, carries out pcr amplification, reaction conditions with P4 and P5: 95 ℃, and 30s, 95 ℃ afterwards, 30s, 55 ℃/min, 68 ℃/3min, totally 12 circulations, product is put 2min on ice immediately, 1ul DpnI (20V) restriction endonuclease is added in the PCR product 37 ℃ of 1h.The PCR product 1ul that gets DpnI digestion transforms DH5 α competent cell, gets and transforms the little upgrading grain of bacterium colony, uses the NcoI/BamHI double digestion, and the sample that does not downcut band is and suddenlys change successfully, because of the NcoI site lacks, positive bacteria is dropped into the row order-checking examine.The quick positional mutation of called after tPA-pET28a5.: TPA mutant 5.1 templates that make up disappearance PAI-1 site: be TPA-pET28a recombinant plasmid 5.2 design of primers of this chamber structure: for removing the PAI-1 joint portion point in the natural tPA clipped form segment, a pair of primer of ad hoc meter.P3 (3 ', 42 nt of 5 ' GCT GCC ATC TTT GCC GCG GCC GCG GCG TCG CCC GGA GAG CGG).5.3 pcr amplification: reaction conditions is: 95 ℃ of 30s, 95 ℃ of 30s afterwards, 55 ℃/min, 68 ℃ of 12min, totally 18 circulations.Then product is put 2min cooling on ice.5.4 transform: add 1ul DpnI restriction endonuclease in pcr amplification product, mixing, is got the postdigestive PCR product of DpnI 1ul and is transformed the DH5a competent cell by 37 ℃/h.Called after mtPA4A-pET28a5.5 positional mutation is identified: enzyme is cut evaluation: the bacterium colony that conversion is grown carries out little upgrading grain, carries out preliminary evaluation with the SacII/BamHI double digestion.Sequential analysis: positive bacterium colony is shaken bacterium, and middle upgrading grain carries out sequence through automatic dna sequencer and examines.6.tPA the expression of mutant in colibacillus: 6.1 make up pAC177-pET28a expression vector (Fig. 2): with pACYC177 PvuI/BglI double digestion, reclaim the 1929bp segment, with mtPA4A-pet28a with the PvuI/BglI double digestion, reclaim the 4kb segment, connection piece is had no progeny and is transformed colibacillus TOP10 competent cell, and tossing on the Amp plate transforms the little upgrading grain of bacterium colony, identify with the XbaI/HindIII double digestion, the positive colony plasmid is transformed express bacterium BL21 (DE3) again.The expression of called after mtPA4A-pAC177-pET28a6.2tPA mutant in colibacillus, selecting the 37 ℃ of joltings in the 2 * YT substratum that contains Kan of single colony inoculation spends the night, next day in 1% ratio with bacterium liquid enlarged culturing when absorbance A 600 reaches 0.5-0.6, add results bacterium liquid behind IPTG (final concentration 1mmol/L) the abduction delivering 4h.6.3 express to identify: take a morsel induce before, induce back bacterium liquid to add the SDS sample buffer that contains DTT, 95 ℃ of 5min carry out SDS-PAGE and identify.6.4 renaturation, purifying

4000rpm collected thalline, the broken bacterium in ultrasonic wave 1 ' * 5 in centrifugal 3 minutes.12000rpm * 20 ' centrifugal collecting precipitation, and, inclusion body is dissolved in 50mM Tris-HCl, behind the pH8.0-8M urea 10mM DTT room temperature 30min with aforementioned washing lotion washing three times, be diluted in 50mM Tris-HCl at 1: 10, pH8.0-0.7M Arg-10mM GSSG-2mMGSH.Room temperature 4h, to 50mM Tris-HCl, the pH8.0 dialysed overnight, last Lysine affinity column, affinity column be with 50mMTris-HCl, the pH8.0 balance, use the column equilibration liquid Xian foreign protein that contains 0.5NaCl behind the upper prop, again to contain the balance liquid wash-out tPA of 0.2M 6-aminocaprolc acid.7.tPA activity determination method

The tPA (0.1-2.5ug/ul) that gets different amounts adds 0.1MTris-HCl, pH8.5-0.15%Tween-80 to 50ul, chromozymtpa (Boehrmger Mannheim) solution and 450ul damping fluid mixing with 50ul 4mM, 37 ℃ of different times, add 10% citric acid 250ul termination reaction, with water is that A405 is surveyed in contrast, calculates the tPA activity by following formula.

8.PAI-1 to the active restraining effect of TPA

Get tPA or its mutant 5ng in the 50ul reaction volume with 25 ℃ of reactions of the PAI-1 (Technoclone company/Austria) of different concns 15 minutes.Add Chromozymtpa substrate 50ul, 37 ℃ of reactions of damping fluid 450ul 30min, adding citric acid 250ul termination reaction is that A405 is surveyed in contrast with water.Result: the 1. segmental specificity of natural tPA clipped form

According to the primer of design, the amplification length of PCR product is 1kb.Actual amplified fragments is through agarose electrophoretic analysis consistent with design length (Fig. 3).2. evaluation 2.1 enzymes of recombinant plasmid (mtPA-pet28a) positive colony are cut evaluation: transform the little upgrading grain of bacterium colony, through the NcoI/BamHI double digestion, show two bands behind the agarose gel electrophoresis, one is pet28a empty carrier 5.4kb, the about 1kb of another mtpA meets expection size (Fig. 4).2.2 the nucleic acid sequence analysis of cloned sequence: show the in full accord of segment nucleotide sequence and bibliographical information of surveying through The sequencing results.3. Sequence Identification after the positional mutation

The sequencing results shows that the mutable site base sequence changes GCG GCC GCG GCG into by AAG CAC AGG AGG, has removed the PAI-1 binding site.4. the evaluation of prokaryotic expression recombinant plasmid

Transform the little upgrading grain of bacterium colony, through the XbaI/HindIII double digestion, show two bands behind the agarose gel electrophoresis, one is about 4.9Kb band, a band for the about 1Kb of mtpA4A (Fig. 5) for pAC177-pet28a.5. the expression of recombinant plasmid in intestinal bacteria

The full bacterium of abduction delivering is carried out SDS-PAGE,, the results are shown in Figure, be about 40 * 10 at molecular weight through Xylene Brilliant Cyanine G R-250 dyeing ³The visible dyeing protein band in D place, the TPA mutant accounts for 30% of bacterial protein.The TPA mutant mainly is present in (Fig. 6) in the precipitation with the inclusion body form.6. the active mensuration of expression product

The TPA mutant increases along with the increase of time the hydrolysis of substrate as seen from Figure 7, and is linear in 60min, and the hydrolytic activity that compares substrate with the CHO-TPA of equivalent is lower.7.PAI-1 to CHO-TPA and the active influence of TPA mutant

As seen from Figure 8, along with the increase of PAI-1 concentration, the activity of natural CHO-TPA reduces gradually, and the activity of natural CHO-TPA has dropped to 2.1% when PAI-1 concentration is 15U.And TPA mutant activity is not subjected to the inhibition of PAI-1, and when PAI-1 concentration was 15U, TPA mutant activity still remained on more than 100%.Embodiment two: the expression materials and methods material of tPA mutant in eukaryotic cell (yeast): cell and substratum: yeast strain GS115, colibacillus TOP 10F ', carrier pPIC9K and yeast culture base, protoplastis prepares reagent, and conversion reagent is all expressed test kit available from the multiple copied Pichia of invitrogen.Method: segmental preparation 1.1 templates of 1.tPA mutant: be the tPA mutant mtPA4A-pET28a1.2 design of primers of this chamber structure: upstream primer P5:(5 ' GCT ACG TAT CTT ACC AGG GAA ACA GTG AC 3 ', 29 nt), contain the SnaBI restriction enzyme site.3 ', 29 nt of downstream primer P6:(5 ' TCC CCT AGG TCA CGG TCG CAT GTT GTCAC), contain AvrII restriction enzyme site and TGA terminator codon.1.3 pcr amplification: amplified production is the tPA gene fragment (natural tPA amino acid/11-3 and 176-527) of clipped form, and wherein amino acid 296-299 has carried out the point location sudden change.2. the structure (Fig. 9) of yeast expression recombinant plasmid pPIC 9K/mtPA4A

Pcr amplification product is carried out the phenol extracting, carry out double digestion with SnaBI/AvrII respectively with pPIC 9K carrier afterwards, reclaim endonuclease bamhi with 1% low melting-point agarose gel electrophoresis, the phenol extracting, the enzyme of DNA is cut, and connects and transform all to carry out with reference to the Sambrook method.Competent cell is intestinal bacteria TOP10F '.3. the clone identifies: 3.1 enzymes are cut evaluation: the bacterium colony that conversion is grown carries out little upgrading grain, carries out preliminary evaluation with the SnaBI/AvrII double digestion.3.2 sequential analysis: positive bacterium colony is shaken bacterium, and middle upgrading grain carries out sequence through automatic dna sequencer and examines.4. yeast transforms and screens the preparation of the preceding DNA of 4.1 conversions: the pPIC 9k/mtPA4A SalI single endonuclease digestion of upgrading grain purifying in the warp, carry out linearization process, and after cutting, enzyme carries out phenol extracting, ethanol sedimentation and lyophilize.4.2 circle is given birth to the preparation of plastid:, sketch it with reference to the operation of Invitrogen test kit specification sheets.Get the single bacterium colony of fresh GS115 amplification cultivation in the TPD substratum, get the Best Times that the part mycetocyte is determined the enzymolysis enzymic digestion, the preparation circle is given birth to plastid then.4.3 Pichia transforms: 10ug DNA is joined the 100ul circle give birth in the plastid, put room temperature 10min, add the freshly prepared PEG/CaT of 1ml, the slight mixing, room temperature 10min, centrifugal 750 * g the 10min of room temperature, the careful suction removed supernatant, with the resuspended transformant of 150ulSDS, room temperature 20min, add 850ul 1M Sorbitol Powder again, get 300ul speroplast-DNA liquid and 10ml RD top agar mixing bed board at last, cultivated 4-6 days for 29 ℃.4.4 G418 resistance screening: transform back the 6th day, with toothpick picking list bacterium colony mixing in the 100ul YPD liquid, (0.75mg/ml rules on YPD flat board 1mg/ml) for 0.25mg/ml, 0.5mg/ml, cultivates 4 days for 29 ℃ containing the G418 different concns respectively again.4.5.Mut ⁴And Mut ⁵The screening that transforms:

With reference to the operation of Invitrogen test kit specification sheets, preparation MD and MM flat board are rule on MM flat board and MD flat board with aseptic toothpick picking list bacterium colony earlier, cultivate observations 2 days for 30 ℃.5. the expression of reorganization Pichia bacterium: picking list bacterium colony spends the night to 29 ℃ of joltings of 25ml MGYk, abduction delivering spends the night in the bacterium that will the spend the night morning next day adding 10ml BMMY substratum, replenish methyl alcohol in the 3rd day substratum to final concentration 0.5%, continue jolting, collect sample behind the 48h.6. how anti-preparation and immunoblottings of the evaluation 6.1 anti-tpA of expression product

Get two of the heavy white rabbits of about 1.5kg, every rabbit is used rhCHO-tPA 1mg and Freund's complete adjuvant, the subcutaneous multi-point injection in back, 7-10 days duplicate injection rhCHO-tPA 1mg Freunds continuous 5 times, are got the blood survey and are tired＞1:32 (two expansion) at interval, bloodletting, preparation serum.10mgCHO-tpA is coupled on the active Sepharose 4B of 5ml CNBr.Immune serum is crossed post, with 10mM Tris-HCl pH8.0-0.15M NaCL balance columns and wash-out foreign protein.The anti-tPA antibody of specificity is used 1M Tris-HCl with 10mM glycine-hydrochloric acid pH3.0-0.15M NaCl wash-out, and pH9.5 is neutralized to pH7.0.

Go up samples with reaching the different amounts of yeast expressed tPA mutant supernatant liquor, 10%SDS-PAGE is transferred on the nitrocellulose filter, seals 30 fens with the 1%BSA room temperature.Add 37 ℃ of reactions of anti-CHO-tPA antibody (dilution in 1: 500) 30 minutes.Behind the Xian Di 3 times, add the goat-anti rabbit two anti-(1: 2000) of alkali phosphatase enzyme mark, 37 ℃ were reacted 30 fens, and Xian Di 3 times adds the colour developing of NBT and BCIP substrate solution.6.2 activity identification: with method among the embodiment one.6.3 PAI-1 is to the TPA activity inhibition: with method among the embodiment one.The result: 1. recombinant plasmid (pPIC 9K/mtPA 4A) evaluation 1.1 usefulness SnaBI/AvrII double digestions are identified its recombinant plasmid dna, can obtain the band (Figure 10) of an about 9.3kb band and an about 1kb.1.2 the nucleic acid sequence analysis of cloned sequence shows that to the full length sequence analytical results of cloned sequence the result of segmental nucleotide sequence and the design of surveying is in full accord.2. contain the screening of high copy recombination bacterial strain

Obtain 6 through the G418 screening and contained the bacterial strain of growing on the 1mg/ml G418 YPD flat board.3. the expression of recombinant plasmid in eukaryotic cell

The cell conditioned medium 2-10ul of abduction delivering is gone up sample, be Western blot (Figure 11), be about 40 * 10 at Mr ³The visible dyeing protein band of D.3. expression activity detects

The TPA mutant increases along with the increase of time the hydrolysis of substrate as seen from Figure 12, and is linear in 60min, and the hydrolytic activity that compares substrate with the CHO-TPA of equivalent is lower.4.PAI-1 activity inhibition to the tPA mutant of yeast expression

As seen from Figure 13, along with the increase of PAI-1 concentration, the activity of natural CHO-TPA reduces gradually, and the activity of natural CHO-TPA has dropped to 2.1% when PAI-1 concentration is 15U.And TPA mutant activity is not subjected to the inhibition of PAI-1, and when PAI-1 concentration was 15U, TPA mutant activity still remained on more than 100%.

Claims (5)

1.TPA ( 5’-3’ ) ：1 atgtcttaccaaggaaacagtgactgctactttgggaatgggtcagcctaccgtggcacg 6061 cacagcctcaccgagtcgggtgcctcctgcctcccgtggaattccatgatcctgataggc 120121 aaggtttacacagcacagaaccccagtgcccaggcactgggcctgggcaaacataattac 180181 tgccggaatcctgatggggatgccaagccctggtgccacgtgctgaagaaccgcaggctg 240241 acgtgggagtactgtgatgtgccctcctgctccacctgcggcctgagacagtacagccag 300301 cctcagtttcgcatcaaaggagggctcttcgccgacatcgcctcccacccctggcaggct 360361 gccatctttgccgcggccgcggcgtcgcccggagagcggttcctgtgcgggggcatactc 420421 atcagctcctgctggattctctctgccgcccactgcttccaggagaggtttccgccccac 480481 cacctgacggtgatcttgggcagaacataccgggtggtccctggcgaggaggagcagaaa 540541 tttgaagtcgaaaaatacattgtccataaggaattcgatgatgacacttacgacaatgac 600601 attgcgctgctgcagctgaaatcggattcgtcccgctgtgcccaggagagcagcgtggtc 660661 cgcactgtgtgccttcccccggcggacctgcagctgccggactggacggagtgtgagctc 720721 tccggctacggcaagcatgaggccttgtctcctttctattcggagcggctgaaggaggct 780781 catgtcagactgtacccatccagccgctgcacatcacaacatttacttaacagaacagtc 840841 accgacaacatgctgtgtgctggagacactcggagcggcgggccccaggcaaacttgcac 900901 gacgcctgccagggcgattcgggaggccccctggtgtgtctgaacgatggccgcatgact 960961 ttggtgggcatcatcagctggggcctgggctgtggacagaaggatgtcccgggtgtgtac 10201021 accaaggttaccaactacctagactggattcgtgacaacatgcgaccg 1068

2.TPA the aminoacid sequence of mutant (M is initial methionine(Met)):

(M)1 SYQGNSDCYF?GNGSAYRGTH?SLTESGASCL?PWNSMILIGK?VYTAQNPSAQ51 ALGLGKHNYC?RNPDGDAKPW?CHVLKNRRLT?WEYCDVPSCS?TCGLRQYSQP101?QFRIKGGLFA?DIASHPWQAA?IFAAAAASPG?ERFLCGGILI?SSCWILSAAH151?CFQERFPPHH?LTVILGRTYR?VVPGEEEQKF?EVEKYIVHKE?FDDDTYDNDI201?ALLQLKSDSS?RCAQESSVVR?TVCLPPADLQ?LPDWTECELS?GYGKHEALSP251?FYSERLKEAH?VRLYPSSRCT?SQHLLNRTVT?DNMLCAGDTR?SGGPQANLHD301?ACQGDSGGPL?VCLNDGRMTL?VGIISWGLGC?GQKDVPGVYT?KVTNYLDWIR351?DNMRP

3. the nucleotide sequence 373-384 in claims 1 and its corresponding aminoacid sequence influence PAI-1 in conjunction with activity.

4. according to aminoacid sequence in the nucleotide sequence in claims 1 and claims 2 and 3 constructed TPA mutant, in the expression of expression systems such as protokaryon and eucaryon.

5. according to TPA mutant expression product in claims 4 and the application of preparation in the treatment of dependency thrombotic diseases such as myocardial infarction and cerebral thrombosis thereof.

Images