CN1369559A - Hydantoin hydrolae and its application - Google Patents

Hydantoin hydrolae and its application Download PDF

Info

Publication number
CN1369559A
CN1369559A CN01105347A CN01105347A CN1369559A CN 1369559 A CN1369559 A CN 1369559A CN 01105347 A CN01105347 A CN 01105347A CN 01105347 A CN01105347 A CN 01105347A CN 1369559 A CN1369559 A CN 1369559A
Authority
CN
China
Prior art keywords
enzyme
polynucleotide
sequence
glycolylurea
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN01105347A
Other languages
Chinese (zh)
Other versions
CN1152956C (en
Inventor
杨蕴刘
许祯
白骅
姜卫红
陶正利
陈军
焦瑞身
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Institutes for Biological Sciences SIBS of CAS
Original Assignee
SHANGHAI INST OF PLANT PHYSIOL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI INST OF PLANT PHYSIOL filed Critical SHANGHAI INST OF PLANT PHYSIOL
Priority to CNB01105347XA priority Critical patent/CN1152956C/en
Publication of CN1369559A publication Critical patent/CN1369559A/en
Application granted granted Critical
Publication of CN1152956C publication Critical patent/CN1152956C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Landscapes

  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A novel hydrantoin hydrolase, the polynucelotide for coding it, the process for preparing said enzyme by recombination, the carrier and host cell containing said enzyme, its application in preparing D-p-hydroxyphenyl glycine (D-pHPG) as intermediate of medicines, and the carbamyl hydrolase and engineering bacteria for preparing D-pHPG are disclosed.

Description

New Phenylhydantoinase and application thereof
The present invention relates to the synthetic field of microbial project, fermentation and pharmaceutical intermediate.More specifically, the present invention relates to the polynucleotide of a kind of new glycolylurea enzyme (being called Phenylhydantoinase or Hydantoinase again), this glycolylurea enzyme of encoding and produce the method for this glycolylurea enzyme through recombinant technology.The invention still further relates to the carrier and host cell and the purposes aspect production pharmaceutical intermediate D-D-pHPG (D-pHPG) thereof that contain this glycolylurea enzyme.The invention still further relates to the carbamyl hydrolysis enzyme that can be used for producing D-pHPG.
Because amoxycillin (Amoxyeillin), S 578 (cefadroxil), cefoperazone (cefoperazone), cephalo Luo Qi semi-synthetic beta-lactam antibioticss such as (cefaprozil), have antibiotic energetic, characteristics such as wide spectrum low toxicity have become the choice drug of clinic control infectation of bacteria.As the D-D-pHPG of one of such medicinal intermediates, also therefore be subjected to the attention of pharmacy and chemical industry.
The traditional processing technology of D-D-pHPG (D-pHPG) is meant the method by chemosynthesis and fractionation, but drawback such as this technology exists yield low, and environmental pollution is serious.
Since the eighties, research and application that enzyme process prepares the D-D-pHPG obtain paying attention to.Generally speaking, earlier obtain D by oxoethanoic acid, phenol, urea condensation, L-para hydroxybenzene glycolylurea (pHPH), pHPH can be by D-glycolylurea enzyme (D-hydantoinase, E.C.3.5.2.2, DHase) the stereospecificity hydrolysis generates D-N-carboxamide-D-pHPG (D-CpHPG), in alkalescence or exist under the racemase condition, is not turned to the D-type by the L-type enantiomorph racemization of open loop and is further transformed.Therefore, mix the racemization substrate by this enzymatic asymmetric hydrolysis, pHPH can be transformed fully, and does not resemble chemical resolution method, and yield is less than 50%.Carry out the report of this step reaction at industrial existing employing immobilized D-glycolylurea enzyme or immobilized cell.D-CpHPG by the enzyme catalysis of D-glycolylurea generates can slough carbamyl by following two kinds of methods, obtains end product D-pHPG:(1) HNO 2Diazotizing chemical method and (2) carbamyl hydrolysis enzyme (D-Carbamylase, biotransformation method DCase) (Fig. 1).
S.Takahashi etc. once adopted the zymochemistry technology that glycolylurea chemosynthesis, enzymatic asymmetric hydrolysis and nitrous acid diazotization deamination formyl radical three are combined; by D; the L-5-glycolylurea is produced D-amino acid, but has the chemomorphosis effect of nitrous acid and problems such as the three-waste pollution that causes and labor protection.
With the double-enzyme method that the enzymically hydrolyse substituted chemistry diazotization method of carbamyl is carried out the reaction of second step,, all be extremely significant no matter consider from feasibility and environment protection.Kanegafuchi company and China's Taiyuan, Shanxi biological study once adopt respectively and produce the Agrobacteriumradiobacter of glycolylurea enzyme and carbamyl hydrolysis enzyme simultaneously or the resting cell of Pseudomonas sp2262 is converted into D-pHPG with pHPH.The shortcoming of this technology is that transformation efficiency is low, needs inductor, peculiar smell infringement HUMAN HEALTH and contaminate environment that inductor produces.
In recent years, when separating bacterium producing multi enzyme preparation, (1) has been produced the Pseudomonasfluorescens DSM84 of DHase, Bacillus stearothermophilis NS1122A, Pseudomonasputida CCRC12857, (2) the Agrobacterium sp KNK003 of product DCase, and the relative enzyme gene that (3) produce the Agrobacterium radiobacter B11921 of DHase and DCase is simultaneously cloned, obtained relative enzyme gene wherein, and the gene behind the clone is carried out molecular biology operate, to improve the zymologic property of relevant enzyme.Yet, also do not clone the glycolylurea enzyme of Burholderiapickettii (Pi Shi bulkholderia cepasea) and the gene of carbamyl hydrolysis enzyme up to now.
Therefore, this area presses for the glycolylurea enzyme and the carbamyl hydrolysis enzyme of exploitation different sources, and the technology of new production D-D-pHPG.
Purpose of the present invention just provide a kind of new glycolylurea enzyme with and fragment, analogue and derivative, and encoding sequence.
Another object of the present invention provide the method for producing the glycolylurea enzyme with and uses thereof.
Another object of the present invention provides the technology of new efficient, harmless production D-D-pHPG.
In a first aspect of the present invention, novel isolated glycolylurea enzyme is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ IDNO:4 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:4 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of the isolating glycolylurea enzyme of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned glycolylurea enzyme of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:4.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence with 1758-3128 position among the SEQ ID NO:3; Sequence with 1-3439 position among the SEQ ID NO:3.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of glycolylurea enzymic activity, this method comprises: (a) under the condition that is fit to expression glycolylurea enzyme, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with glycolylurea enzymic activity.
In a fifth aspect of the present invention, provide the purposes of glycolylurea enzyme of the present invention, its encoding sequence, carrier or host cell.They can be used for producing the D-D-pHPG.
In a sixth aspect of the present invention, a kind of technology of new production D-D-pHPG and carbamyl hydrolysis enzyme and the engineering bacteria that is used for this technology are provided.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Fig. 1 is the composite diagram of D-D-pHPG.
Fig. 2 A is the structure synoptic diagram of DCase expression vector pXZpC2.
Fig. 2 B is the structure synoptic diagram of DHase expression vector pXZpH2.
Fig. 3 is the electrophorogram of glycolylurea enzyme and carbamyl hydrolysis enzyme expression product.Wherein each swimming lane is: 1. the pXZpH2/BL21 before inducing; 2. the pXZpH2/BL21 after inducing; 3,7. albumen Maker; 4. empty carrier; 5. the pXZpC2/BL21 before inducing; 6. the pXZpC2/BL21 after inducing.
Fig. 4 is DNA and the aminoacid sequence of DCase.
Fig. 5 is DNA and the aminoacid sequence of DHase.
In the present invention, term " hydantoin enzyme ", " Hydantoinase ", " Phenylhydantoinase " or " DHase " are used interchangeably, all refer to have hydantoin enzyme amino acid sequence albumen or the polypeptide of (SEQ ID NO:2). They comprise the hydantoin enzyme that contains or do not contain initial methionine.
As used herein, " separation " refers to that material separates (if crude, primal environment namely is natural surroundings) from its primal environment. Do not have separation and purification such as the polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " hydantoin enzyme albumen or the polypeptide of separation " refers to that hydantoin enzyme is substantially free of natural relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can use the purified technology of protein purifying hydantoin enzyme of standard. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel
Hydantoin enzyme of the present invention can be restructuring, natural, synthetic, preferably recombinates. Hydantoin enzyme of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses the restructuring technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). According to the used host of restructuring production decision, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated. Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analog of hydantoin enzyme. As used herein, term " fragment ", " derivative " refer to basically keep the identical biological function of natural hydantoin enzyme of the present invention or active polypeptide with " analog ". Polypeptide fragment of the present invention, derivative or analog can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide half-life, polyethylene glycol for example) merge formed polypeptide, or (iv) additional amino acid sequence is fused to this peptide sequence and the polypeptide that forms (such as targeting sequencing or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying). According to the instruction of this paper, these fragments, derivative and analog belong to the known scope of those skilled in the art.
In the present invention, term " hydantoin enzyme " refers to have the polypeptide of the SEQ ID NO.4 sequence of hydantoin enzyme activity. This term also comprises having and the variant form hydantoin enzyme identical function, SEQ ID NO.4 sequence. These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several and (be generally in 20 in that C end and/or N are terminal, preferably being in 10, more preferably is in 5) amino acid. For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein. Again such as, add the function that or several amino acid also can not change protein usually in that C end and/or N are terminal. This term also comprises active fragment and the reactive derivative of hydantoin enzyme.
The variant form of this polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutation body, under high or low stringency condition can with the coded albumen of the DNA of glycolylurea enzyme dna hybridization and the polypeptide or the albumen that utilize the antiserum of anti-hydantoin enzyme to obtain. The present invention also provides other polypeptide, as comprises the fusion of hydantoin enzyme or its fragment. Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of hydantoin enzyme. Usually, this fragment have the hydantoin enzyme sequence at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analog of hydantoin enzyme or polypeptide. The difference of these analogs and natural hydantoin enzyme can be the difference on the amino acid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps haves both at the same time. These polypeptide comprise genetic variant natural or that induce. The induce variation body can obtain by various technology, as by radiation or be exposed to mutagens and produce random mutagenesis, also can pass through direct mutagenesis method or the biological technology of other known moleculars. Analog also comprises having the analog that is different from the amino acid whose residue of natural L-(such as D-amino acid), and the analog with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid). Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing primary structure) form of modification comprises: chemically derived form such as acetylation or the carboxylated of the polypeptide that body is interior or external. Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing such as those in the synthetic and processing of polypeptide or further. This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to. Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as phosphotyrosine, phosphoserine, phosphothreonine). Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " hydantoin enzyme conservative variation polypeptide " refers to compare with the amino acid sequence of SEQ ID NO:4, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best. These conservative variation polypeptide preferably carry out amino acid substitution according to Table A and produce.
Table A
Initial residue Representational replacement The preferred replacement
Ala(A) Val；Leu；Ile Val
Arg(R) Lys；Gln；Asn Lys
Asn(N) Gln；His；Lys；Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro；Ala Ala
His(H) Asn；Gln；Lys；Arg Arg
Ile(I) Leu；Val；Met；Ala；Phe Leu
Leu(L) Ile；Val；Met；Ala；Phe Ile
Lys(K) Arg；Gln；Asn Arg
Met(M) Leu；Phe；Ile Leu
Phe(F) Leu；Val；Ile；Ala；Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr；Phe Tyr
Tyr(Y) Trp；Phe；Thr；Ser Phe
Val(V) Ile；Leu；Met；Phe；Ala Leu
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:3 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:4, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:3.
The polynucleotide of coding glycolylurea enzyme mature polypeptide comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide+various additional code sequences; The encoding sequence of mature polypeptide (with optional additional code sequence)+non-coding sequence.
Term " polynucleotide of coding glycolylurea enzyme " can be the polynucleotide that comprise the glycolylurea enzyme of only encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:4.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding glycolylurea enzyme.
Glycolylurea enzyme Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or glycolylurea enzyme encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the glycolylurea enzyme of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding glycolylurea enzyme of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, glycolylurea enzyme polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125).In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains glycolylurea enzyme DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, to cultivate the Tetrahydrofolate dehydrogenase and the neomycin resistance of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells.Be preferably intestinal bacteria.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast etc.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Enzyme of the present invention also comprises the immobilized enzyme that is fixed on the carrier.Various enzyme immobilization technology well known in the art all can be used for preparing immobilized glycolylurea enzyme of the present invention and or carbamyl hydrolysis enzyme.
In addition, the invention provides the purposes of glycolylurea enzyme, its encoding sequence, carrier or host cell, they are used to produce the dual-enzymatic process of D-D-pHPG.This technology comprises step:
(a) under the pH8-9 condition, the katalysis by the glycolylurea enzyme makes D-para hydroxybenzene glycolylurea generation asymmetric hydrolysis, forms N-carboxamide-D-D-pHPG;
(b) N-carboxamide-D-D-pHPG is converted into the D-D-pHPG by the carbamyl hydrolysis enzyme or the recombinant bacterial strain of expressing this carbamyl hydrolysis enzyme.
In addition, L-para hydroxybenzene glycolylurea is formed D-para hydroxybenzene glycolylurea again by racemization, as the raw material (Fig. 1) of step (a).
Therefore, the present invention also provides a kind of technology of new production D-D-pHPG and carbamyl hydrolysis enzyme and the engineering bacteria that is used for this technology.A kind of from the Pi Shi bulkholderia cepasea new isolated carbamyl hydrolysis enzyme have the aminoacid sequence shown in the SEQ ID NO:2, its nucleotide sequence is shown in SEQ ID NO:1, wherein reads frame and is positioned at the 2065-2976 position.
Identical with top description about the glycolylurea enzyme, the invention provides the polynucleotide of encoding carbamoyl lytic enzyme, the carrier that contains these polynucleotide, and transformed by this carrier or the host cell of transduceing or directly transformed by above-mentioned polynucleotide or the host cell of transduction.
In view of glycolylurea enzyme and carbamyl hydrolysis enzyme all are used for the technology of D-D-pHPG, therefore a kind of preferred engineering bacteria is to carry glycolylurea enzyme and carbamyl hydrolysis enzyme gene simultaneously, and expresses the engineering bacteria of glycolylurea enzyme and carbamyl hydrolysis enzyme, for example intestinal bacteria.
Technological advantage of the present invention is: it is low to have overcome the transformation efficiency in the original production process, and the production cycle is long, and particularly serious environmental is polluted, and workman's labour protection problem.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1:
The cultivation of Pi Shi bulkholderia cepasea (Burkholderia pickettii) separates with total DNA's
Single bacterium colony of inoculation in the LB liquid nutrient medium of 50ml (every liter of substratum contains the 10g yeast powder, 5g peptone, 10g sodium chloride, pH value 7.0) was cultivated 36 hours for 28 ℃.The nutrient solution 4000 of results is left the heart 10 minutes collect thalline, the suspension bacterial precipitation adds Proteinase K and SDS and is respectively 100ug/ml and 0.5% to final concentration in 15ml TE damping fluid.Mixing, and it is limpid to solution to be incubated overnight in 37 ℃.Add isopyknic phenol/chloroform/primary isoamyl alcohol (25: 24: 1), slowly left the heart 10 minutes in 8000 behind the mixing, shift out the upper strata water with a big mouth transfer pipet.Extracting repeatedly is until there not being white middle layer.For the last time the upper strata is changed over to new pipe (noting not bringing into organic phase), the acetic acid that adds the 3M of 1/10 volume is received, and adds the dehydrated alcohol of 2 times of volumes again, mixing.Lay out DNA with the glass dropper that seals, it is changed in the new bottle, with 70% ethanol flush away salt, dry DNA is dissolved in the TE damping fluid.Add RNAase therein to final concentration 100ug/ml, in 37 ℃ of incubations 1.5 hours.The ammonium acetate that adds the 10M of 0.2 volume then therein adds the dehydrated alcohol of 2 times of volumes again, lays out DNA with the glass dropper that seals, and it is changed in the new bottle, and with 70% ethanol flush away salt, dry DNA is dissolved in the TE damping fluid to final concentration 250ng/ul.In 4 ℃ of preservations.
Embodiment 2:
The segmental detection of purpose
Get the total DNA of 40ul respectively, use 8ul ClaI in the reaction system of 200ul, EcoRI, EcoRV, the corresponding reaction buffer of XhoI and 20ul carry out the restriction enzyme digestion reaction.React after two hours, take out 5ul from reaction system, add the 0.5ul sample loading buffer, the agarose with 0.8% carries out gel electrophoresis, and whether enzyme cuts entirely to observe.After treating that total DNA enzyme cuts entirely, add isopyknic phenol/chloroform/primary isoamyl alcohol (25: 24: 1), left the heart 5 minutes with 12000 behind the mixing, change the upper strata water over to new pipe, the sodium-acetate that adds the 3M of 1/10 volume, the dehydrated alcohol that adds 2 times of volumes again in-70 ℃ of placements 5 minutes, left the heart 5 minutes in 12000 behind the mixing then.Remove liquid, with 70% ethanol flush away salt, room temperature is dried, and is dissolved in the 40ul distilled water.Agarose with 0.8% carries out gel electrophoresis, and the 1V/cm electrophoresis spends the night.To be immersed in the 0.25M hydrochloric acid soln of 20 times of volumes 5-15 minute under the sepharose room temperature behind the electrophoresis, the tetrabromophenol sulfonphthalein in gel becomes till the yellow just.Glue is transferred to the 1.5MNaCl that fills 20 times of volumes, in the 0.5M NaOH solution, soaked 20 minutes under the room temperature, more renew liquid, soaked again 20 minutes.Glue is transferred to the 1.0M Tris-Cl that fills 20 times of volumes, in the 1.5MNacl solution (pH7.5), soaked 20 minutes under the room temperature, more renew liquid, soaked again 20 minutes.To be placed on up at the bottom of the glue on the plate face of horizontal glass plate, drive the bubble between two-layer away.Cut out one and carry out mark, soak with distilled water before using, use 10 * SSC submergence at least 5 minutes again, be placed on the gel, drive the bubble between two-layer away with gel nylon membrane of a size.Cut out two and No. two filter paper of gel Xinhua of a size, after nylon membrane carries out identical processing, be placed on the nylon membrane, drive bubble away, on filter paper, put a stacker towel again, above paper handkerchief, put the weights of a glass plate and 500 grams, shifted about two hours or longer.Take off and shift good nylon membrane, soaked 5 minutes in 4 * SSC, drying at room temperature 30 minutes was dried 30 minutes for 80 ℃, used for hybridization.
Hybridize according to the DIG High Primer DNA Labeling and DetectionStarter Kit II service manual that Roche company provides.Add the 1ug template DNA and be diluted to 16ul, boil rapid ice bath after 10 minutes, add 37 ℃ of placements of 4ul DIG-High Primer and spend the night, use 10 minutes inactivators of 65 ℃ of water-baths again with distilled water.Certification mark efficient is 100ng/ul.With 42 ℃ of prehybridizations of DIG Easy Hyb 10ml 30 minutes, to use new DIG Easy Hyb instead and add the 250ng dna probe of the DIG-mark of sex change therein, 42 ℃ of placements are spent the night.68 ℃ with 0.5 * SSC, and 0.1%SDS washes film twice, each 15 minutes.Washed 1-5 minute with lavation buffer solution, handled 30 minutes with sealing damping fluid room temperature, handled 30 minutes with antibody-solutions again, lavation buffer solution effect 2 * 15 minutes detects damping fluid and handles after 2-5 minute, and The addition of C SPD is added on the film, on film, seal, room temperature was put 15-25 minute, put 10 minutes for 37 ℃, and the band of hybridization is arranged with X-mating plate exposure tests.What wherein clip size was suitable is the hybridization band of EcoR V.
Embodiment 3
The segmental separation of purpose
Get the total DNA of 40ul, in the reaction system of 200ul, carry out the restriction enzyme digestion reaction with 8ul EcoRV and the corresponding reaction buffer of 20ul.React after two hours, take out 5ul from reaction system, add the 0.5ul sample loading buffer, the agarose with 0.8% carries out gel electrophoresis, and whether enzyme cuts entirely to observe.After treating that total DNA enzyme cuts entirely, add isopyknic phenol/chloroform/primary isoamyl alcohol (25: 24: 1), left the heart 5 minutes with 12000 behind the mixing, change the upper strata water over to new pipe, the sodium-acetate that adds the 3M of 1/10 volume, the dehydrated alcohol that adds 2 times of volumes again in-70 ℃ of placements 5 minutes, left the heart 5 minutes in 12000 behind the mixing then.Remove liquid, with 70% ethanol flush away salt, room temperature is dried, and is dissolved in 40 ul distilled waters.Agarose with 0.8% carries out gel electrophoresis, and the 1V/cm electrophoresis spends the night.Cut off the agarose band identical with the position that detects hybridization behind the electrophoresis, the glue that utilizes Hua Shun company to produce reclaims post and reclaims purpose fragment (50ng/ul).
Method according to a small amount of extracting plasmid in " molecular cloning ", extracting pBluKS, the plasmid that the 17ul extracting is good (100ng/ul) carries out the restriction enzyme digestion reaction with 1ul EcoRI and the corresponding reaction buffer of 2ul in the reaction system of 20ul, react that the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes after two hours.Cut off near the agarose band of 3kb, the glue that utilizes Hua Shun company to produce reclaims post and is recovered in the system of 40ul.
The dephosphorylation enzyme (Promega company) of getting 17ul regenerant adding 2ul dephosphorylation enzyme buffer liquid and 0.1 unit was in 37 ℃ of reactions 30 minutes, and the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes.Cut off near the agarose band of 3kb, the glue that utilizes Hua Shun company to produce reclaims post and reclaims (60ng/ul).
External source fragment 2ul and carrier 1ul and damping fluid 2ul are provided among the ligase enzyme optimal reaction system 20ul that provides according to MBI company are connected at 22 ℃ with enzyme 0.5ul and spend the night, 65 ℃ of deactivations 10 minutes.The transformation efficiency of getting the preparation of 2ul adding 100ul Calcium Chloride Method reaches 10 7 Bacillus coli DH 5 alpha, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add the 700ulLB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the X-gal that contains normality and the penbritin flat board of IPTG.37 ℃ of overnight incubation.
The picking hickie is inoculated into earlier on the penbritin flat board, inoculates the penbritin flat board that is covered with nylon membrane.37 ℃ of overnight incubation, correspond to each filter membrane, on a slice Saran packing film, make the little low-lying area (0.75ml) that 0.5mol/L NaOH is housed, bacterium colony is faced up, filter membrane is put on the little low-lying area, flatten the Saran packing film, make filter membrane evenly moistening, allow filter membrane be stayed, blot filter membrane from the below of filter membrane, repeat above process with the paper handkerchief of doing in original place 2-3 minute.Blot filter membrane once more, filter membrane is transferred on the new little low-lying area of Saran packing film that has 1mol/L Tris-Cl (pH7.4), after 5 minutes, blot filter membrane, repeat this step.Blot filter membrane, filter membrane is transferred on the new little low-lying area of Saran packing film that has 1.5mol/L NaCl, 0.5mol/LTris-Cl (pH7.4), after 5 minutes, blot filter membrane, it is transferred on the dried 3MM filter paper, dried in the air at least 30 minutes, make the filter membrane drying in room temperature.Filter membrane clip between two dried 3MM filter paper, was done roasting 2 hours in 80 ℃ in vacuum oven, with fixed dna.
Press the method described in the embodiment 2, film is hybridized.The pairing clone of hybridization spot is and has the segmental clone of purpose.The result obtains a positive colony-plasmid pXZ-total.
Embodiment 4
The segmental analysis of purpose
To have the segmental clone of purpose and use ClaI, EcoRV, HincII, NotI, SacI, SmaI, SpeI carry out the restriction enzyme digestion reaction with 1ul enzyme and the corresponding reaction buffer of 2ul in the reaction system of 20ul, react that the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes after two hours.Then, carry out identical commentaries on classics membrane operations with embodiment 2.The DIG High PrimerDNA Labeling and Detection Starter Kit II service manual that provides according to Roche company is hybridized equally.
The result shows that the fragment that NotI cuts out is fit to order-checking.Cut off three agarose bands that NotI cuts out, the glue that utilizes Hua Shun company to produce reclaims post and reclaims.Method extracting pBluKS according to a small amount of extracting plasmid in " molecular cloning ".The plasmid that the 17ul extracting is good (100ng/ul) carries out restriction enzyme digestion reaction with 1ul NotI and the corresponding reaction buffer of 2ul in the reaction system of 20ul, react that the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes after two hours.Cut off near the agarose band of 3kb, the glue that utilizes Hua Shun company to produce reclaims post and is recovered in the system of 40ul.
The dephosphorylation enzyme (Promega company) of getting 17ul regenerant adding 2ul dephosphorylation enzyme buffer liquid and 0.1 unit was in 37 ℃ of reactions 30 minutes, and the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes.Cut off near the agarose band of 3kb, the glue that utilizes Hua Shun company to produce reclaims post and reclaims (60ng/ul).
External source fragment 2ul and carrier 1ul and damping fluid 2ul are provided among the ligase enzyme optimal reaction system 20ul that provides according to MBI company are connected at 22 ℃ with enzyme 0.5ul and spend the night, 65 ℃ of deactivations 10 minutes.Get 2ul adding 100ul transformation efficiency and reach 10 7 Bacillus coli DH 5 α, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add 700ul LB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the X-gal that contains normality and the penbritin flat board of IPTG.37 ℃ of overnight incubation.The picking hickie is used for order-checking.Order-checking is finished by the sequenator of last sea base Kanggong department.
Two goal gene of separately order-checking are analyzed with BioEdit, be spliced into two complete frames (seeing SEQID NO:1-4), SEQ ID NO:1 and 2 is the dna sequence dna and the aminoacid sequence of carbamyl hydrolysis enzyme, read frame and be arranged in SEQ ID NO:1 2065-2976 position, 347 the amino acid whose carbamyl hydrolysis enzyme of encoding.SEQ ID NO:3 and 4 is the dna sequence dna and the aminoacid sequence of glycolylurea enzyme, reads frame and is arranged in SEQ ID NO:3 1758-3128 position, 457 the amino acid whose carbamyl hydrolysis enzyme of encoding.What is interesting is that these two enzymes lay respectively on two chains of same-3439bp double-stranded DNA.
Carry out the homology analysis with GCG, the result shows: Pi Shi bulkholderia cepasea glycolylurea enzyme and Agrobacterim.radiobacter glycolylurea enzyme have 85% homology at amino acid levels, with Bacillus.sterothermophilus glycolylurea enzyme 47% homology is arranged, 35% homology is arranged with the glycolylurea enzyme of Pseudomonas.putida.The carbamyl hydrolysis enzyme gene height homology of the gene of carbamyl hydrolysis enzyme and other species: have 98% homology Agrobacterim.radiobacter that 92% homology is arranged with Agrobacterim.sp KNK712.
Embodiment 5
The structure that contains carboxamide amino acid lytic enzyme destination gene expression carrier and engineering bacteria
Referring to Fig. 2 A.With Primer programdesign primer, carboxamide amino acid lytic enzyme is with 5 ' cgagctagcatgacacgtcagatgatac and two primers of 5 ' aagctttcagagttccgcga, to have the segmental clone of purpose is template, 94 ℃ of sex change are after 5 minutes, 94 ℃ of sex change 1 minute, 52 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, carry out 30 circulations altogether, put and be used to add A in 10 minutes, obtain a large amount of target gene fragment for last 72 ℃.The glue that utilizes Hua Shun company to produce behind the electrophoresis reclaims post and reclaims (50ng/ul) target gene fragment (external source fragment).
External source fragment 1ul is provided among the optimal reaction system 10ul that provides according to the pGEMT-EASY vector system of Promega company is connected 1 hour with enzyme 0.5ul at 22 ℃, 65 ℃ of deactivations 10 minutes with carrier pGEMT-EASY 1ul and damping fluid 5ul.Get 5ul adding 100ul transformation efficiency and reach 10 7 Bacillus coli DH 5 alpha, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add the 500ulLB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the X-gal that contains normality and the penbritin flat board of IPTG.37 ℃ of overnight incubation, the picking hickie inserts test tube.According to a small amount of of the method described in " molecular cloning " extracting plasmid pXZpCl, in containing the reaction system of corresponding reaction buffer, 20ul carries out the restriction enzyme digestion reaction with 0.5ul NheI and 0.5ul HindIII, react that the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes after two hours.Cut off near the agarose band of 0.9kb, the glue that utilizes Hua Shun company to produce reclaims post and is recovered in the system of 20ul.
In ligation system 10ul, add external source fragment 4ul and the carrier pET28b 4ul that cuts through NheI and HindIII enzyme and damping fluid 1ul and be connected at 16 ℃ with enzyme 0.5ul and spend the night, 65 ℃ of deactivations 10 minutes.Get 5ul adding 100ul transformation efficiency and reach 10 7 Bacillus coli DH 5 alpha, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add the 500ulLB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the kantlex flat board that contains normality.37 ℃ of overnight incubation, picking list bacterium colony inserts test tube.According to a small amount of of method described in " molecular cloning " extracting plasmid pXZpC2, in containing the reaction system of corresponding reaction buffer, 20ul carries out the restriction enzyme digestion reaction with 0.5ul NheI and 0.5ul HindIII, react that the agarose with 0.8% carries out gel electrophoresis after two hours, 5V/cm electrophoresis 30 minutes, whether correct with the clone of checking institute picking.
Expression vector pXZpC2 Calcium Chloride Method Transformed E .coli BL21 (DE3) with building obtains e. coli bl21 (DE3)-pXZpC2 engineering bacteria.The intestinal bacteria of carrying plasmid pXZpC2 that obtain are deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC, China, Beijing) on December 6th, 2000 and on November 6th, 2000, and preserving number is CGMCC No.0520.2.
Embodiment 6
The structure that contains glycolylurea enzyme destination gene expression carrier and engineering bacteria
Referring to Fig. 2 B.With 5 ' gctagcatggacatcattatcaaa and two primers of 5 ' aagcttaatgccggtttactg, to have the segmental clone of purpose is template, 94 ℃ of sex change are after 5 minutes, 94 ℃ of sex change 1 minute, annealed 1 minute for 51 ℃, 72 ℃ were extended 1.5 minutes, and carried out 30 circulations altogether, put and be used to add A in 10 minutes, obtain a large amount of hydantoin-containing lytic enzyme target gene fragment for last 72 ℃.The glue that utilizes Hua Shun company to produce behind the electrophoresis reclaims post and reclaims (100ng/ul).
External source fragment 1ul is provided among the optimal reaction system 10ul that provides according to the pGEMT-EASY vector system of Promega company is connected 1 hour with enzyme 0.5ul at 22 ℃, 65 ℃ of deactivations 10 minutes with carrier 1ul and damping fluid 5ul.Get 5ul adding 100ul transformation efficiency and reach 10 7Bacillus coli DH 5 alpha, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add the 500ulLB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the X-gal that contains normality and the penbritin flat board of IPTG.37 ℃ of overnight incubation, the picking hickie inserts test tube.According to " molecular cloning " described method a small amount of extracting plasmid pXZpH1, in containing the reaction system of corresponding reaction buffer, 20ul carries out the restriction enzyme digestion reaction with 0.5ul NheI and 0.5ul HindIII, react that the agarose with 0.8% carries out gel electrophoresis, 5V/cm electrophoresis 30 minutes after two hours.Cut off near the agarose band of 1.4kb, the glue that utilizes Hua Shun company to produce reclaims post and is recovered in the system of 20ul.In ligation system 10ul, add external source fragment 5.5ul and the carrier pET28b 3ul that cuts through NheI and HindIII enzyme and damping fluid 1ul and be connected at 16 ℃ with enzyme 0.5ul and spend the night, 65 ℃ of deactivations 10 minutes.Get 5ul adding 100ul transformation efficiency and reach 10 7Bacillus coli DH 5 alpha, placed on ice 30 minutes, 42 ℃ of heat shocks 70 seconds add the 500ulLB liquid nutrient medium and cultivate rejuvenation in 45 minutes for 37 ℃, get 200ul and are coated in the kantlex flat board that contains normality.37 ℃ of overnight incubation, picking list bacterium colony inserts test tube.According to a small amount of of the method described in " molecular cloning " extracting plasmid pXZpH2, in containing the reaction system of corresponding reaction buffer, 20ul carries out the restriction enzyme digestion reaction with 0.5ul NheI and 0.5ulHindIII, react that the agarose with 0.8% carries out gel electrophoresis after two hours, 5V/cm electrophoresis 30 minutes, whether correct with the clone of checking institute picking.
Expression vector pXZpH2 Calcium Chloride Method Transformed E .coli BL21 (DE3) with building obtains e. coli bl21 (DE3)-pXZpH2 engineering bacteria.The intestinal bacteria of carrying plasmid pXZpH2 that obtain are deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC, China, Beijing) on December 6th, 2000 and on November 6th, 2000, and preserving number is CGMCC No.0520.1.
Embodiment 7
The expression of goal gene
Picking list bacterium colony inserts the LB test tube that contains the 50ug/ml kantlex, overnight incubation, again by in the new LB test tube that contains the 50ug/ml kantlex of 1% inoculum size access one pipe, 37 ℃ when being cultured to OD600=0.6, the IPTG that adds final concentration 1mM, cultivated again 2 hours, and collected before inducing respectively and the thalline after inducing.The full cell of thalline is carried out SDS-PAGE, analyzing proteins expression amount (see figure 3), wherein the expression amount of glycolylurea enzyme accounts for the 30..8% of total bacterial protein, and the expression amount of carbamyl hydrolysis enzyme accounts for 42.2% of total bacterial protein.
Embodiment 8
Have the pulsating thalline vitality test of purpose
A. carboxamide amino acid lytic enzyme enzyme activity determination
Method: with pXZpC2/BL21 (DE3) the bacterium liquid of incubated overnight, by 1% inoculum size inoculation 48mlLB liquid shaking bottle, when being cultured to OD600=0.6, add IPTG again, final concentration is 1mM, induced 2 hours for 37 ℃, centrifugal collection thalline is suspended in 3ml pH8.0 NaH at last with the washing of 20ml physiological saline 2PO 4-Na 2HPO 4In the damping fluid, dilute 50 times and survey OD600.Frozen spending the night in refrigerator, the NaH of the pH8.0 of the bacterium liquid 0.2ml of the 40 ℃ of preheatings of learning from else's experience and 0.2ml 1% concentration of substrate 2PO 4-Na 2HPO 4The damping fluid mixing was 40 ℃ of reactions 30 minutes, after reaction finishes, centrifugation thalline at once, get the NaAc-HAc damping fluid that the 100ul supernatant adds 100ul pH5.5, the ethylene glycol monomethyl ether solution that adds 3ml 0.5%ninhydrin and 0.5%hydrindantin again, 60 ℃ of reactions 30 minutes are vibrated then in ambient-temp-stable 1 hour, measure OD 570The NaAc-HAc damping fluid that adds 100ul pH5.5 with concentration known solution 100ul, the ethylene glycol monomethyl ether solution that adds 3ml 0.5%ninhydrin and 0.5%hydrindantin again, 60 ℃ were reacted 30 minutes, vibrate then in ambient-temp-stable 1 hour, measure OD570, the drawing standard curve is obtained the K value, according to formula, calculate enzyme and live.
The result is as shown in table 1:
Table 1:pXZpC2 carboxamide amino acid lytic enzyme vitality test
N-carboxamide-right-hydroxyphenylglycine 121.94ug/ml·h ??65.91ug/OD·h ??0.45U/ml
The test bacterium is intestinal bacteria-pXZpC2
Enzyme activity (U/ml)=K * OD570 * 4 * 15/0.5 * 48 * M
The work of 1U enzyme is defined as and per hour produces the required enzyme amount of the corresponding product of 1um.
B. Phenylhydantoinase enzyme activity determination
Method: with pXZpH2/BL21 (DE3) the bacterium liquid of incubated overnight, by 1% inoculum size inoculation 48mlLB liquid shaking bottle, when being cultured to OD600=0.6, add IPTG again, final concentration is 1mM, induced 2 hours for 37 ℃, centrifugal collection thalline is suspended in 3ml pH8.0 NaH at last with the washing of 20ml physiological saline 2PO 4-Na 2HPO 4In the damping fluid, dilute 50 times and survey OD600.Bacterium liquid is packed as every pipe 1ml, and centrifugal, thalline is suspended in the NaH of the pH8.0 of 1.2ml suitable substrates solution (1% para hydroxybenzene glycolylurea, glycolylurea, 0.5% dihydrouracil) 2PO 4-Na 2HPO 4Damping fluid, every pipe 0.3ml, 40 ℃ were reacted 1 hour, and centrifuging and taking supernatant 250ul adds the 6N hydrochloric acid soln of 5% pair of dimethylin phenyl aldehyde of 550ul at once, measures OD 438With the 6N hydrochloric acid soln of 5% pair of dimethylin phenyl aldehyde of concentration known solution 250ul adding 550ul, measure OD438, the drawing standard curve is obtained the K value, according to formula, calculates enzyme and lives.
The result is as shown in table 2:
Table 2:pXZpH2 glycolylurea enzyme activity determination result
Right-the hydroxybenzene glycolylurea 138.78ug/ml·h ?100.48ug/OD·h ????0.83U/ml
Glycolylurea 68.28ug/ml·h ?49.43ug/OD·h ????0.58U/ml
Dihydrouracil 85.15ug/ml·h ?61.65ug/OD·h ????0.64U/ml
The test bacterium is intestinal bacteria-pXZpH2
Enzyme activity (U/ml)=K * OD438 * 300 * 12/250 * 48 * M
The work of 1U enzyme is defined as and per hour produces the required enzyme amount of the corresponding product of 1um.
Embodiment 9
Double-enzyme method is produced D-D-pHPG (D-pHPG)
Get by embodiment 8, use instead 28 ℃ induce obtain 0.5 gram have the colibacillary wet thallus cell of pXZpC2, the sodium phosphate buffer of 0.1M pH8.0 with 0.035% carries out conversion reaction, after reaction is carried out 1,2,3,5 hour respectively, there is the D-D-pHPG of 0.45mg, 0.81mg, 1.18mg, 1.26mg to generate in the mensuration system.Transformation efficiency is 90.8% after 5 hours.
Get by embodiment 8, use 28 ℃ of colibacillary wet thallus cells of inducing 0.4 gram that obtains to have pXZpH2 instead, the sodium phosphate buffer of 0.1M pH8.0 with 0.45% carries out conversion reaction, after reaction is carried out 1,2,3,5 hour respectively, there is N-carboxamide-D-pHPG of 14.64mg, 20.89mg, 23.23mg, 23.75mg to generate in the mensuration system.Transformation efficiency reaches 96.7% after 5 hours.
So when adopting double-enzyme method to produce the D-D-pHPG, transformation efficiency reaches 87.5% after 5 hours.
Be modified in all documents that the present invention mentions and all quote in this application as a reference, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (ii) denomination of invention: new Phenylhydantoinase and use (iii) sequence number: the information of 4 (2) SEQ ID NO:1: (i) sequence signature:
(A) length: 3439bp
(B) type: nucleic acid
(C) chain: two strands
( D ) ： ( ii ) ：DNA ( xi ) ：SEQ ID NO：1：tctcggggtc cgtcaccacg atgaccgaac acggtctgca tgttggagga tgtcgcagcc 60gactgacccg ccgccatcag catttccagc gtgcctgggg ggagaggttc ccccgtgtag 120cgtctgacgg aacggtgctt cagcatcagc gcgatgcagt ccgacaccag ccgttcgccc 180gatggtatct gattgaatgt cggtgcgccg taacgcctgt cgaaggcgct tgcaacgctt 240gtcgccgtca ggcgcgacga cacttgtcga agtgtgtatt gtcatcatcg ttctcgtaga 300atgccggttt actgcttgta tttgcgacgt ttcaggaatt tcccgtccgt cggttcgccg 360acataggaac cttcgtcgac gataaccttg ccacgcagga gcaccgtctt cggcacgccc 420ttgaccttgt gtccctcgta ggaggagtaa tccatggcgt tgtgcatggc ggtctgttcg 480atcaccattt cggcctcggg gtcccaaagg acgatgtcgg cgtccgaacc gaccgcgatc 540gtcccctttt gcggaaacat tccgaagacc ttggccgggc gcgtggcgac cagttccacg 600aactgggtaa gggaaatccg gccttcgttg acgccctgat agaccatcat caaccgttcc 660tcgacgcccg gcgcgccgtt cgggatggcg cgaaagtcgt tccggccccg gtccttgtgc 720cccttgaaga gccaggagca atggtcggag gaaaccgttt cgaacacacc gtttctgagt 780gcgttccaga gaacgtcatg gtctttcttc gcgcgggccg gcggtgtgaa aacgtatttc 840gcaccttcga aatccggccg ctccaggtct tccttggtga ggtaaaggta atgcgtgcag 900gtttccgcca gagcgcggac gcctcgcgat tttgcgcgca tcacctcctc aagggactcc 960tcgcaggtca catggactat gtagatcggg gcgttgacga tttcggccag ggcgagggcc 1020cgcgcggttg cctcggcttc gacccggggc gggcggctga gcgcgtggta gatcggcgcg 1080gttttgccct cggccacgaa cttgtcgcgc agatagtcgg cggcgtcgcc gttttccgcg 1140tgcaccatga cgagcgatcc ggtcttgacc gccttgtcga gcgtcttcag cagcgtcacg 1200tcgtcgatca tgttcatgcc gcgataggcc atgaagacct tgaaggaggt aatgccaaga 1260tcgggaagca cctccagctc ctcaatcacg ctgtcggtcg ggtcgagcac gatgatgtgg 1320tagccgtaat cgatcgccga cttgccgccg gccataccgt cccacttggc gacggcttcc 1380gccaggctgt ggccgcgatc ctgctgacag aaatcgacga tggttgtcgt tccgccacag 1440gcggccgcga ccgtcgctgt tgcgaacgtg tcggccgact gcgtgttgaa gctgaccgtt 1500tcgacatgcg tgtgaacgtc tatgccgccc ggaaagacgt agcggccggc cgcgtcgatc 1560gtccgctccg ctgggccgag cgcgccgccg atctgggtga tcttgccatc cttgatcccg 1620agatcggcgc gagaaatgcc atccgcggtc acgatggttc cgtttttgat aatgatgtcc 1680atgatgtcgc tctcaggatt gaagagtttg ttccgtatat ggaatgtaat tctttataca 1740agtttgcatg gtgttttgaa gctgtcaagc ggaacggcgg cctagcgaag acgattctgt 1800gcagagcgct ctcgttcgag gcggaacgag ttgaagtcga cggcgggctc gcgcgagagc 1860ttgtcaagca gcgcaaattc cggttccgct ccggttgaca gatcaaaaat tttacgcctg 1920ttattgtcgt gctgcatgta atatttcgta ctttatgtag aatttgcatt gcgccgcgag 1980tcacaaagcc ggttttcggc gatgtgtttc acaacgtttt cccggccgct gggccggaca 2040tcacctagga aggagcagag gttcatgaca cgtcagatga tacttgcagt gggacaacaa 2100ggtccgatcg cgcgcgcgga gacacgcgaa caggtcgtcg ttcgtcttct ctacatgctg 2160acgaaagccg cgagccgggg cgcgaatttc attgtcttcc ccgaactcgc gcttacgacc 2220ttcttcccgc gctggcattt caccgacgag gccgagctcg atagcttcta tgagaccgaa 2280atgcccggcc cggtggtccg tccactcttt gagaaggccg cggaactcgg gatcggcttc 2340aatctgggct acgctgaact cgtcgtcgaa ggcggcgtca agcgtcgctt caacacgtcc 2400attttggtgg ataagtcagg caagatcgtc ggcaagtatc gtaagatcca tttgccgggt 2460cacaaggagt acgaggccta ccggccgttc cagcatcttg aaaagcgtta tttcgagccg 2520ggcgatctcg gcttcccggt ctatgacgtc gacgccgcga aaatggggat gttcatctgc 2580aacgatcgcc gctggcctga agcctggcgg gtgatgggcc tcaggggcgc cgagatcatc 2640tgcggcggct acaacacgcc gacccacaat ccccctgttc cccagcacga ccacctgacg 2700tccttccacc atctcctatc gatgcaggcc gggtcttatc agaacggggc ctggtccgcg 2760gccgcgggca aggtgggcat ggaggagaac tgcatgctgc tcggccactc ctgcatcgtg 2820gcgccgaccg gggaaatcgt cgctctcact acgacgctgg aagacgaggt gatcaccgcc 2880gccgtcgatc tcgatcgctg ccgggaactg cgtgaacaca tcttcaactt caagcagcat 2940cgtcagcccc agcactatgg tctgatcgcg gaactctgag gttgccgaaa agcatgtgtg 3000tcgttgttct cggcgcctgg gtcacatcca ggcgcgccag ggtgacgctg gtggaatagt 3060accacgaccg cttcagggcg atccgcaagg agatgcgggt cgccggagcg gcaaagcccg 3120acattcgttt cgcaccgacg gccgtcgtga actcgacagt ccgcgagaag ggcgtattgc 3180gcggcctgga cctgtacgtg gaactgtagc ccatatatag atttccaaag agtttcggcg 3240aggcgcggcg cgcctagccc catgtgagcg agaaccgtgc ccagatcaaa gaatgagacc 3300gacgcgccgg ccgcggcaaa ggatgatcct cagggtcgga tctatcgctc cgccctgaag 3360caggagggcg cacgctggct gcttgacggc ggaggaaggg gttgctggca aagcccaagc 3420cgcccggcct tgttccggc 3439 ( 2 ) SEQ ID NO：2： ( i ) ：
(A) length: 304 amino acid
(B) type: amino acid
(D) topological framework: linearity is molecule type (ii): polypeptide
(xi) sequence description: SEQ ID NO:2:MTRQMILAVG QQGPIARAET REQVVVRLLY MLTKAASRGA NFIVFPELAL 50TTFFPRWHFT DEAELDSFYE TEMPGPVVRP LFEKAAELGI GFNLGYAELV 100VEGGVKRRFN TSILVDKSGK IVGKYRKIHL PGHKEYEAYR PFQHLEKRYF 150EPGDLGFPVY DVDAAKMGMF ICNDRRWPEA WRVMGLRGAE IICGGYNTPT 200HNPPVPQHDH LTSFHHLLSM QAGSYQNGAW SAAAGKVGME ENCMLLGHSC 250IVAPTGEIVA LTTTLEDEVI TAAVDLDRCR ELREHIFNFK QHRQPQHYGL 300IAEL 304
(2) information of SEQ ID NO:3
(i) sequence signature
(A) length: 3439 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
( xi ) ：SEQ ID NO：3：gccggaacaa ggccgggcgg cttgggcttt gccagcaacc ccttcctccg ccgtcaagca 60gccagcgtgc gccctcctgc ttcagggcgg agcgatagat ccgaccctga ggatcatcct 120ttgccgcggc cggcgcgtcg gtctcattct ttgatctggg cacggttctc gctcacatgg 180ggctaggcgc gccgcgcctc gccgaaactc tttggaaatc tatatatggg ctacagttcc 240acgtacaggt ccaggccgcg caatacgccc ttctcgcgga ctgtcgagtt cacgacggcc 300gtcggtgcga aacgaatgtc gggctttgcc gctccggcga cccgcatctc cttgcggatc 360gccctgaagc ggtcgtggta ctattccacc agcgtcaccc tggcgcgcct ggatgtgacc 420caggcgccga gaacaacgac acacatgctt ttcggcaacc tcagagttcc gcgatcagac 480catagtgctg gggctgacga tgctgcttga agttgaagat gtgttcacgc agttcccggc 540agcgatcgag atcgacggcg gcggtgatca cctcgtcttc cagcgtcgta gtgagagcga 600cgatttcccc ggtcggcgcc acgatgcagg agtggccgag cagcatgcag ttctcctcca 660tgcccacctt gcccgcggcc gcggaccagg ccccgttctg ataagacccg gcctgcatcg 720ataggagatg gtggaaggac gtcaggtggt cgtgctgggg aacaggggga ttgtgggtcg 780gcgtgttgta gccgccgcag atgatctcgg cgcccctgag gcccatcacc cgccaggctt 840caggccagcg gcgatcgttg cagatgaaca tccccatttt cgcggcgtcg acgtcataga 900ccgggaagcc gagatcgccc ggctcgaaat aacgcttttc aagatgctgg aacggccggt 960aggcctcgta ctccttgtga cccggcaaat ggatcttacg atacttgccg acgatcttgc 1020ctgacttatc caccaaaatg gacgtgttga agcgacgctt gacgccgcct tcgacgacga 1080gttcagcgta gcccagattg aagccgatcc cgagttccgc ggccttctca aagagtggac 1140ggaccaccgg gccgggcatt tcggtctcat agaagctatc gagctcggcc tcgtcggtga 1200aatgccagcg cgggaagaag gtcgtaagcg cgagttcggg gaagacaatg aaattcgcgc 1260cccggctcgc ggctttcgtc agcatgtaga gaagacgaac gacgacctgt tcgcgtgtct 1320ccgcgcgcgc gatcggacct tgttgtccca ctgcaagtat catctgacgt gtcatgaacc 1380tctgctcctt cctaggtgat gtccggccca gcggccggga aaacgttgtg aaacacatcg 1440ccgaaaaccg gctttgtgac tcgcggcgca atgcaaattc tacataaagt acgaaatatt 1500acatgcagca cgacaataac aggcgtaaaa tttttgatct gtcaaccgga gcggaaccgg 1560aatttgcgct gcttgacaag ctctcgcgcg agcccgccgt cgacttcaac tcgttccgcc 1620tcgaacgaga gcgctctgca cagaatcgtc ttcgctaggc cgccgttccg cttgacagct 1680tcaaaacacc atgcaaactt gtataaagaa ttacattcca tatacggaac aaactcttca 1740atcctgagag cgacatcatg gacatcatta tcaaaaacgg aaccatcgtg accgcggatg 1800gcatttctcg cgccgatctc gggatcaagg atggcaagat cacccagatc ggcggcgcgc 1860tcggcccagc ggagcggacg atcgacgcgg ccggccgcta cgtctttccg ggcggcatag 1920acgttcacac gcatgtcgaa acggtcagct tcaacacgca gtcggccgac acgttcgcaa 1980cagcgacggt cgcggccgcc tgtggcggaa cgacaaccat cgtcgatttc tgtcagcagg 2040atcgcggcca cagcctggcg gaagccgtcg ccaagtggga cggtatggcc ggcggcaagt 2100cggcgatcga ttacggctac cacatcatcg tgctcgaccc gaccgacagc gtgattgagg 2160agctggaggt gcttcccgat cttggcatta cctccttcaa ggtcttcatg gcctatcgcg 2220gcatgaacat gatcgacgac gtgacgctgc tgaagacgct cgacaaggcg gtcaagaccg 2280gatcgctcgt catggtgcac gcggaaaacg gcgacgccgc cgactatctg cgcgacaagt 2340tcgtggccga gggcaaaacc gcgccgatct accacgcgct cagccgcccg ccccgggtcg 2400aagccgaggc aaccgcgcgg gccctcgccc tggccgaaat cgtcaacgcc ccgatctaca 2460tagtccatgt gacctgcgag gagtcccttg aggaggtgat gcgcgcaaaa tcgcgaggcg 2520tccgcgctct ggcggaaacc tgcacgcatt acctttacct caccaaggaa gacctggagc 2580ggccggattt cgaaggtgcg aaatacgttt tcacaccgcc ggcccgcgcg aagaaagacc 2640atgacgttct ctggaacgca ctcagaaacg gtgtgttcga aacggtttcc tccgaccatt 2700gctcctggct cttcaagggg cacaaggacc ggggccggaa cgactttcgc gccatcccga 2760acggcgcgcc gggcgtcgag gaacggttga tgatggtcta tcagggcgtc aacgaaggcc 2820ggatttccct tacccagttc gtggaactgg tcgccacgcg cccggccaag gtcttcggaa 2880tgtttccgca aaaggggacg atcgcggtcg gttcggacgc cgacatcgtc ctttgggacc 2940ccgaggccga aatggtgatc gaacagaccg ccatgcacaa cgccatggat tactcctcct 3000acgagggaca caaggtcaag ggcgtgccga agacggtgct cctgcgtggc aaggttatcg 3060tcgacgaagg ttcctatgtc ggcgaaccga cggacgggaa attcctgaaa cgtcgcaaat 3120acaagcagta aaccggcatt ctacgagaac gatgatgaca atacacactt cgacaagtgt 3180cgtcgcgcct gacggcgaca agcgttgcaa gcgccttcga caggcgttac ggcgcaccga 3240cattcaatca gataccatcg ggcgaacggc tggtgtcgga ctgcatcgcg ctgatgctga 3300agcaccgttc cgtcagacgc tacacggggg aacctctccc cccaggcacg ctggaaatgc 3360tgatggcggc gggtcagtcg gctgcgacat cctccaacat gcagaccgtg ttcggtcatc 3420gtggtgacgg accccgaga 3439
(2) information of SEQ ID NO:4:
(i) sequence signature:
(A) length: 457 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide
(xi) sequence description: SEQ ID NO:4:MDIIIKNGTI VTADGISRAD LGIKDGKITQ IGGALGPAER TIDAAGRYVF 50PGGIDVHTHV ETVSFNTQSA DTFATATVAA ACGGTTTIVD FCQQDRGHSL 100AEAVAKWDGM AGGKSAIDYG YHIIVLDPTD SVIEELEVLP DLGITSFKVF 150MAYRGMNMID DVTLLKTLDK AVKTGSLVMV HAENGDAADY LRDKFVAEGK 200TAPIYHALSR PPRVEAEATA RALALAEIVN APIYIVHVTC EESLEEVMRA 250KSRGVRALAE TCTHYLYLTK EDLERPDFEG AKYVFTPPAR AKKDHDVLWN 300ALRNGVFETV SSDHCSWLFK GHKDRGRNDF RAIPNGAPGV EERLMMVYQG 350VNEGRISLTQ FVELVATRPA KVFGMFPQKG TIAVGSDADI VLWDPEAEMV 400IEQTAMHNAM DYSSYEGHKV KGVPKTVLLR GKVIVDEGSY VGEPTDGKFL 450KRRKYKQ 457

Claims (10)

1. an isolating glycolylurea enzyme is characterized in that it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:4 aminoacid sequence.
2. glycolylurea enzyme as claimed in claim 1 is characterized in that, this enzyme has SEQ ID NO:4 aminoacid sequence.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group:
(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, these polynucleotide are selected from down group:
(a) coding has the polynucleotide of aminoacid sequence shown in the SEQ ID NO:4;
(b) has the nucleotide sequence of 1758-3128 position among the SEQ ID NO:3;
(c) has the nucleotide sequence of 1-3439 position among the SEQ ID NO:3.
5. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
6. a transformed host cells is characterized in that, it contains the described carrier of claim 6.
7. host cell as claimed in claim 7 is characterized in that, it is e. coli bl21 (DE3)-pXZpH2, and preserving number is CGMCC No.0520.1.
8. the preparation method of a glycolylurea enzyme is characterized in that, this method comprises:
(a) being fit to express under the condition of glycolylurea enzyme, cultivate the described host cell of claim 7;
(b) from culture, isolate the glycolylurea enzyme.
9. the purposes of glycolylurea enzyme as claimed in claim 1 or the described host cell of claim 6 is characterized in that, is used to produce the technology of D-D-pHPG.
10. purposes as claimed in claim 9, it is characterized in that, the technology of this production D-D-pHPG also comprises: use to have the carbamyl hydrolysis enzyme of aminoacid sequence shown in the SEQ ID NO:2 or the recombinant bacterial strain of expressing this carbamyl hydrolysis enzyme, N-carboxamide-D-D-pHPG is converted into the D-D-pHPG.
CNB01105347XA 2001-02-15 2001-02-15 Hydantoin hydrolae and its application Expired - Fee Related CN1152956C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB01105347XA CN1152956C (en) 2001-02-15 2001-02-15 Hydantoin hydrolae and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB01105347XA CN1152956C (en) 2001-02-15 2001-02-15 Hydantoin hydrolae and its application

Publications (2)

Publication Number Publication Date
CN1369559A true CN1369559A (en) 2002-09-18
CN1152956C CN1152956C (en) 2004-06-09

Family

ID=4654428

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB01105347XA Expired - Fee Related CN1152956C (en) 2001-02-15 2001-02-15 Hydantoin hydrolae and its application

Country Status (1)

Country Link
CN (1) CN1152956C (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1908159B (en) * 2005-02-07 2011-04-20 中国科学院上海生命科学研究院 D-amino acid preparation strain and construction method thereof
CN106337057A (en) * 2015-07-09 2017-01-18 重庆桑禾动物药业有限公司 Construction of N-carbamoylase expression genes and engineering bacteria of N-carbamoylase expression genes

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1908159B (en) * 2005-02-07 2011-04-20 中国科学院上海生命科学研究院 D-amino acid preparation strain and construction method thereof
CN106337057A (en) * 2015-07-09 2017-01-18 重庆桑禾动物药业有限公司 Construction of N-carbamoylase expression genes and engineering bacteria of N-carbamoylase expression genes

Also Published As

Publication number Publication date
CN1152956C (en) 2004-06-09

Similar Documents

Publication Publication Date Title
RU2103364C1 (en) Dna sequence, protein, method of protein producing
CN1057120C (en) Activity of 2-amino-4-methyl phosphoryl butyric acid resistence gene in plant and use
CN101240285B (en) Cephalosporin C acrylase and its vector and application
CN87104039A (en) The method of cloning restriction modification system
CN110592058A (en) Threonine aldolase, coding gene thereof and application of threonine aldolase in droxidopa biosynthesis
CN113564171A (en) Method for improving soluble expression yield of polypeptide
CN1080306C (en) Adjusting and controlling factor for expression of nitrile solution deenzyme and gene thereof
CN113308453B (en) Amidohydrolase SaAH, and coding gene and application thereof
CN1374970A (en) Signal sequence for the productino of leu-hirudine via secretion by E coli in a culture medium
CN113462678A (en) Glutamic acid decarboxylase mutant
CN110592045B (en) Recombinant esterase, gene, engineering bacterium and application of recombinant esterase to resolution of (R, S) -indoline-2-ethyl formate
CN1369559A (en) Hydantoin hydrolae and its application
CN102747060B (en) Mutant of D-carbamoylase and its preparation method and application
CN114958867B (en) Corn ear grain weight and yield regulation gene KWE2, coded protein, functional marker, expression vector and application thereof
CN110129305A (en) A kind of Cephalosporin C acylase mutant being used to prepare 7-ACA
CN1166182A (en) D-pantolactone hydrolase and gene encoding the same
US7399611B2 (en) Descendants of bacteria devoid of N terminal formylation useful for the production of proteins and peptides
CN112608911B (en) RNA polymerase mutant and application thereof
CN1058616A (en) From leuconostoc dextranicum bacteria clone and overexpression glucose-6-phosphate dehydrogenase
RU2560577C2 (en) Compositions and methods of obtaining enterokinase in yeasts
CN1270224A (en) DNA molecules of aminopeptidase with new code and production of the aminopeptidase
CN1184231C (en) Wheat TaDREB, its code gene and method for culturing adverse-resistant plant
CN113684195B (en) Sterol esterase and coding gene and mutant thereof
CN1178835A (en) Hear resisting basic phosphatase and its expression
CN113755539B (en) Dihydropyrimidine amino hydrolase and application thereof

Legal Events

Date Code Title Description
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C56 Change in the name or address of the patentee

Owner name: SHANGHAI INST. OF LIFE SCIENCE, CAS

Free format text: FORMER NAME OR ADDRESS: SHANGHAI INST. OF PLANT PHYSIOLOGY, CHINESE ACADEMY OF SCIENCES

CP03 Change of name, title or address

Address after: 200031 No. 320, Yueyang Road, Shanghai

Patentee after: Shanghai Institute of life Sciences, Chinese Academy of Sciences

Address before: 200032 Shanghai Fenglin Road No. 300

Patentee before: Shanghai Botanical Physiology Inst., Chinese Academy of Sciences

EE01 Entry into force of recordation of patent licensing contract

Assignee: Luoyang Hong'an Biochemical Technology Co., Ltd.

Assignor: Shanghai Institute of life Sciences, Chinese Academy of Sciences

Contract fulfillment period: 2009.7.2 to 2010.12.31

Contract record no.: 2009310000202

Denomination of invention: Hydantoin hydrolae and its application

Granted publication date: 20040609

License type: exclusive license

Record date: 2009.9.8

LIC Patent licence contract for exploitation submitted for record

Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2009.7.2 TO 2010.12.31; CHANGE OF CONTRACT

Name of requester: LUOYANG HONGAN BIOCHEMICAL CO., LTD.

Effective date: 20090908

CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20040609

Termination date: 20180215