CN1334877A - Co-expression of proteins - Google Patents

Abstract

The subject invention pertains to materials and methods for transformed plants and plant tissues that are capable of expressing high levels of stable proteins which are localized as protein bodies within the plant cell. Transformed plants co-expressing high levels of both the 15kD and 10kD zein proteins are disclosed which accumulate to high levels as protein bodies in the vegetative tissue of the plant. Transformed plants co-expressing the 15kD and 10kD zein proteins are useful for providing forage crops containing increased levels of sulfur containing amino acids, such as methionine, in the diet of animals that normally feed on such crops. Also contemplated by the subject invention are transformed plants or plant tissue comprising stable protein bodies which contain heterologous proteinaceous material. In one embodiment, a stable protein body is expressed in a plant or plant tissue as a fusion protein comprising a zein protein and an operably linked protein or peptide. The protein bodies provided in the present invention are resistant to rumin digestion or environmental degradation.

Description

Co-expression of proteins

The reference of related application

This is the part continuity application of common pending application of submitting on May 30th, 1,997 08/866,879 and the provisional application of submitting on May 31st, 1,996 60/020,424 (now abandoning).

Background of invention

Alfalfa (Medicago sativa L.) is plantation extensively, has fabulous VITAMIN and mineral equilibrium, and the output height is the fabulous source of biology fixed nitrogen, and as attractive honeybee nectar source (people such as Barnes, 1988; Smoliak and Bjorge, 1983), thereby be considered to the whole world most important plantation feed farm crop (people such as Hanson, 1988; People such as Michaud, 1988), usually be called as " feed farm crop queen consort ".For its feed quality and plant performance, clover is cultivated for many years.Though clover and other legume forage farm crop protein content height, these plants lack sulfur-containing amino acid (S-amino acid), methionine(Met) and halfcystine people such as (, 1979) Kaldy.The woolen growth shows the restriction that is subjected to S-amino acid availability.Similar, the breast production of milcher is subjected to the influence of S-amino acid starvation in the plant.Use traditional plant breeding and cell to select the effort as yet success of technology, or progress is very little with the S-aminoacids content of raising clover.

The gene engineering method that is used to improve the amino acid balance of clover and other feed farm crop is, coding is rich in the proteinic gene of methionine(Met) imports these plants, and these genes are by the strong composition promoters driven in the leaf promotor.In order significantly to change the amino acid balance of legume forage, foreign protein should comprise the S-amino acid of about 15-25%, and accounts for the 5-10% of leaf gross protein.In order to reach these protein accumulation levels, not only need to guarantee the maximum horizontal of genetic transcription and translation, also to guarantee proteinic stability.As for the feed farm crop of ruminating animal, rumen bacteria and gastric enzyme are unusual important problem for the digestion ability that contains the S-aminoacid protein for suitable feed farm crop are provided for ruminating animal, but usually are left in the basket.Therefore, being rich in the amino acid whose protein of S-should have resistance relatively to the degraded of ruminant tumor gastric (first stomach), and should assimilate in lower gi tract.

The most concentrated effort about nutrition improvement in the plant concentrates on seed protein.Because corn and other cereal farm crop are not easy to transform, relate to test transgene tobacco (people such as Williamson, 1988 so be devoted to major part work that seed protein modifies; People such as Ohtani, 1990) stability of modified prolamine and in the xenopus leavis oocytes (Xenopus oocytes) (people such as Wallace, 1988).Synthetic (people such as Williamson, 1988 of α-zein of containing Methionin in transgene tobacco and the petunia seed have also been analyzed; People such as Ohtani, 1990).Find that normal and modified protein all has very short half life.

For comprising the 45bp oligonucleotide that will contain 6 methionine(Met) codons, the effort that improves the proteinic S-aminoacids content of leguminous seeds imports the 3rd exon of β-Kidney bean protein gene.The transformant that comprises this modified gene shows that the Kidney bean albumen of homomethionine is synthetic with the level identical with normal protein matter, but very unstable, and transforms people such as (, 1988) Hoffman rapidly.The importing of additional amino acid may cause the distortion of its secondary structure in β-Kidney bean albumen, makes it easier and is degraded by proteolyzing.People such as DeClercq (1990) have replaced mustard with three kinds of different homomethionine encode fragments and have belonged to 23 amino acid whose encode fragments between the 6th and the 7th cysteine residues of 2S white protein.The Arabidopis thaliana 2S gene transformation that these are modified is in Arabidopis thaliana (Arabidopsis thaliana), B.napus and tobacco.Some protein accumulations are arranged in the seed, but not as recording many (M.Chrispeefs, person-to-person communications) in advance.Will contain nearly 19% methionine(Met) and import tobacco people such as (, 1990) Guerche, rape people such as (, 1992) Altenbach and soybean (Pioneer seeds company) by the Brazilian nut 2S albumin gene that β-Kidney bean protein gene promoter drives.Recently, people (1994) such as Saalbach has synthesized the 2S albumin gene and has connected after the CaMV 35S promoter.After importing tobacco and some cereal beans, gene shows high expression level in leaf, and protein is positioned at vacuole.Yet Brazilian nut white protein very easily causes allergy, can not be accepted to be used for consumption.

A kind of method that is used for increasing plant the specific amino acids storehouse is, the bacterial gene of the important regulating and controlling enzyme in the coded amino acid biosynthetic pathway is imported plant.Coding is merged through desensitization bacterial gene and β-Kidney bean protein gene promoter with the E.C. 2.7.2.4. of feedback Methionin and Threonine inhibition, and import tobacco.The seed of transgene tobacco shows free threonine and methionine level raise (people such as Karchi, 1993; Galili, 1995).

About improving the protein quality of feed farm crop, done effort seldom.People such as Schoeder (1991) will import clover by the little chicken ovalbumin gene (cDNA) that the CaMV 35S promoter drives.Yet the transgenic alfalfa plant shows very low protein accumulation level (0.005%) in leaf.Also do not determine the so low reason of this protein abundance.

Winconsin university has also attempted some effort, to obtain clover mutant with higher free methionine level.According to reports, the clone generation corresponding natural amino acid higher that the growth-inhibiting of amino acid analogue is had resistance than normal amount.Thus, the growth on the specific amino acids analogue has been used as selection tool, is used to select the plant of high level accumulation specific amino acids.Amino acid whose excessive production usually is attributed to the absent-mindedness (Malega, 1978) of the feedback control of the enzyme that participates in its production.In the trial that improves first Mu methionine(Met) content, select the growth-inhibiting of methionine(Met) analogue to be had clover suspended culture cell people such as (, 1981) Reish of resistance through mutagenesis.Obtained the clone that minority comprises the homomethionine storehouse, yet the regeneration of these clones do not produce the plant (E.T.Bingham person-to-person communication) with homomethionine content.

Zein is a class protein,alcohol-soluble matter, and is synthetic in the growth course of corn embryosperm, accounts for 50% people such as (, 1976) Lee of mature seed gross protein.Zein can be divided into 4 classes according to its solubleness, α, β, γ and δ (people such as Larkins, 1989).Zein can also be according to magnitude classification.The α zein is a abundantest class, is made up of 22kD and 19kD zein; These proteinic central areas are formed (Argos, 1982) by the repeated peptide of about 20 amino-acid residues.The β zein comprises the 15kD zein, and contained proline(Pro) and glutamine lack than the α zein.The γ zein comprises 27kD and 16kD type, very proline rich (25%).The δ zein is a less relatively class, comprises 10kD zein (people such as Kirihara, 1988).The all types of zein structurally is unique.Iteron in α and the γ zein may play a major role in the proteoplast packing.Zein comprises extremely low-level indispensable amino acid usually, Methionin, tryptophane and than the methionine(Met) of low degree.Yet 15kD and 10kD zein are because high methionine(Met) content and unusual (being respectively 10% and 22.5%) people such as (, 1977) Giannaza.

Zein is gone up synthetic at ergastoplasm (RER), and directly is gathered into proteoplast (Larkins and Hurkman, 1978) in RER.According to the zein compositional analysis of developmental proteoplast in the corn embryosperm, Lending and Larkins (1989) have proposed in the corn embryosperm that the descriptive model of zein sedimentation model: β and γ zein at first begin to accumulate in the proteoplast forming process in RER; Subsequently, the α zein begins to accumulate in the loculus of β and γ zein; Along with the time, α zein loculus merges and forms medium pore, and β and γ zein form proteoplast successive layers on every side.In independently studying, Esen and Stetter (1992) prove that there is the δ zein in the porose area of proteoplast.

Sudden change in the Zea mays influences the expression of different zein spirit-soluble genes.The change that zein spirit-soluble gene is expressed has direct influence to the amino acid composition of seed conversely.The lysine level of the seed of opaque-2 homozygote plant of recessive mutation is with respect to wild type seeds raise people such as (, 1972) Misra.The reduction that 22kD α zein expresses people such as (, 1983) Langridge is given the credit in the rising of Methionin.The methionine level of inbred lines line of breeding BSSS-53 seed is high by 30% than other inbreeding.The rising of methionine(Met) content is because 10kD zein level has raise 2 times (Phillips and McClure, 1985).

Known protein in the endoplasmic reticulum accumulation has aminoacid sequence Lys (his) Asp Glu Leu (K (H) DEL) near its C-terminal, enter golgi body (Pelham, 1990) to prevent them.Yet zein and other prolamine lack this sequence.The homologue of 70kD heat shock protein, BiP, as molecular chaperones, show the formation relate to prolamine proteoplast in the paddy endosperm (people such as Li, 1993b).The effect of BiP in the zein proteoplast forms is based on BiP in the ER of some zein regulation and control mutant of corn and the fact that accumulates on the paraprotein body (people such as Boston, 1991; Zhang and Boston, 1992).In a word, the mechanism of zein targeting proteins body and assembling is therein understood seldom, and do not known intermolecular as yet and whether intramolecular interaction has vital role in proteoplast forms.People such as Abe (1991) propose cytoskeleton and have vital role in the biogenesis of zein proteoplast.

According to above, be appreciated that this area still needs to comprise the plant and the feed farm crop of proteoplast stable, that the S-aminoacids content is high.The invention provides the new and advantageous method of the feed quality that is used to improve plant.

The concise and to the point description of figure

Figure 1A-1B shows the steady state accumulation pattern of 15kD zein in the leaf of transgenosis L.japonicus (figure A) and clover Regen SY (figure B).To carry out SDS-PAGE from 70% ethanol (EtOH) soluble proteins (being equivalent to 50 μ g phosphate buffered saline buffer soluble fraction) of the leaf of the independent transformant of difference, electricity is transferred to nitrocellulose filter, carries out immunoblotting assay with 15kD zein antibody subsequently.

Fig. 1 C shows the synoptic diagram of 15kD zein spirit-soluble gene construct.

Fig. 2 A-2B shows the steady state accumulation pattern of 10kD zein in the leaf of transgenosis L.japonicus (figure A) and clover Regen SY (figure B).To carry out SDS-PAGE from the 70%EtOH soluble proteins (being equivalent to 50 μ g phosphate buffered saline buffer soluble fractionss) of the leaf of the independent transformant of difference, electricity is transferred to nitrocellulose filter, carries out immunoblotting assay with 10kD zein antibody subsequently.

Fig. 2 C shows the synoptic diagram of 10kD zein spirit-soluble gene construct.

Fig. 3 A-3C shows the steady state accumulation pattern of 10kD zein in transgene tobacco.

The synoptic diagram of Fig. 3 A.pM10Z.Construct is merged in the BglII-XhoI segmental BglII site of the 470bp that contains 10kD zein spirit-soluble gene coding region by the CaMV 35S promoter to be formed.Follow NOS 3 ' terminator by pMON316 (people such as Rogers, 1987).

The analysis of the 10kD zein accumulation of the different independent transformants of Fig. 3 B..To carry out SDS-PAGE by the EtOH soluble proteins (being equivalent to 50 μ g PBS soluble proteinss) that leaf extracts, change nitrocellulose filter, carry out immunoblotting assay with 10kD zein antibody subsequently.The swimming lane of transformant lower label 1-7 contains the sample from the leaf of different transformants, and the swimming lane of contrast lower label 1-2 is the leaf sample from unconverted tobacco plant.

The analysis of the 10kD zein accumulation of the different plant organs of Fig. 3 C. (transformant 6).To carry out SDS-PAGE with 2 μ g corn seed albumen from the EtOH soluble fractions (being equivalent to 50 μ g PBS soluble proteinss) of the various plant parts of indicating, and carry out Western with 10kD zein antibody subsequently and analyze.UT and Mat represent unconverted and mature seed respectively.Comprise molecular weight standard in the gel, indicated the size of 2 kinds of mark of correlations.

Fig. 4 shows the destiny of 10kD zein in transgene tobacco chitting piece/seedling.With the seed sterilization of 10kD zein plant, and under aseptic condition, germinate.Precise time results seed/seedling of indicating in the drawings, and extract the EtOH soluble fractions.The EtOH soluble fraction that will be equivalent to 50 μ g PBS soluble proteinss is then carried out SDS-PAGE, carries out Western with 10kD zein antibody subsequently and analyzes.Indicated the position of 10kD zein in gel, the fate after DAG represents to germinate.

The ultrastructure of Fig. 5 A-5D.10kD zein in the transgene tobacco leaf and immunity gold location.

A.10kD, Fig. 5 shows 2 mesophyll cell zones of a plurality of 10kD zein proteoplasts (being indicated by arrow) in the zein transformant.

Fig. 5 is the enlarged image of the bigger multiple of zein proteoplast (being indicated by arrow) B.10kD.

Fig. 5 is the structure of 15kD zein proteoplast in the mesophyll cell of zein transformant C.15kD.

Fig. 5 is the 5nm gold grain immunolocalization (by arrow indicated) of zein in the leaf cell of 10kD zein transformant D.10kD.

The comparison of 10kD and 15kD zein level in leaf of Fig. 6 A-6D.10kD, 15kD and 10kD/15kD zein plant and the seed.

Fig. 6 A. will carry out SDS-PAGE from the leaf (being equivalent to 10 μ g PBS soluble proteinss) of 10kD and 10kD/15kD zein plant and the EtOH soluble fraction of seed (being equivalent to 50 μ g PBS soluble proteinss), carry out Western with 10kD zein antibody subsequently and analyze.

Fig. 6 B. uses biological image intelligence quantitative instrument (Bio Image IntelligentQuantifier) that the band brightness of Fig. 6 A is carried out quantitatively.

Fig. 6 C. will carry out SDS-PAGE from the leaf of 10kD and 10kD/15kD zein plant and the EtOH soluble fraction of seed (being equivalent to 50 μ g PBS soluble proteinss), carry out Western with 15kD zein antibody subsequently and analyze.

Fig. 6 D. uses biological image intelligence quantitative instrument that the band brightness of Fig. 6 C is carried out quantitatively.

The Subcellular Localization of 10kD and 15kD zein in the leaf of Fig. 7 A-7D.10kD/15kD zein plant.

Fig. 7 A. is from the conventional fixed and the coloured portions of the leaf of 10kD/15kD zein plant.The proteoplast that forms in the arrow points tenuigenin.

Fig. 7 B. use mouse anti 10kD zein antibody (dilution in 1: 50) gold of 10nm diameter is subsequently puted together the immunolocalization of the 10kD zein of goat anti-mouse IgG.

Fig. 7 C. use mouse anti 10kD zein antibody and the anti-15kD zein of rabbit antibody subsequently the gold of 10nm diameter put together goat anti-mouse IgG and the 5nm gold is puted together the 10kD of goat anti-rabbit igg and the common immunolocalization of 15kD zein.

The enlarged image of the bigger multiple in the zone of Fig. 7 D. figure C demonstration double-tagging.The gold grain of arrow points 10nm and arrow point to the 5nm gold grain.

Fig. 8. δ-, β-and δ-/β-zein tobacco transformant in the analysis of BiP accumulation pattern.

Will from contrast (NT), δ-zein, β-zein and δ-/the phosphate buffer salt soluble extract (100 μ g protein) of the leaf of β-zein plant carries out SDS-PAGE, uses subsequently at the antibody from zeistic BiP and carry out the Western trace.The positive control swimming lane that gel comprises contains purifying BiP (1 μ g).Figure below represents to use the band quantitative results of intelligent quantitative instrument.

Fig. 9 A represents SEQ ID NO:5.

Fig. 9 B represents SEQ ID NO:6.

Figure 10 is the structure general introduction figure that is transformed into the Z10/OCI plasmid of tobacco.

Figure 11 A and 11B are the Western traces of the extraction sample of transformation of tobacco plant, show the positive immune response with Z10 (14A) and OCI (14B) antibody.

The concise and to the point description of sequence

SEQ ID NO:1 represents primer PA, is used for the fragment by plasmid prep (993) Z10 pMON316/DH5 δ amplification Z10.

SEQ ID NO:2 represents primer PB, is used for the fragment by plasmid prep (993) Z10 pMON316/DH5 α amplification Z10.

SEQ ID NO:3 represents primer PC, is used for the fragment by plasmid (809) OclpSP73/DH5 α amplification OC-1.

SEQ ID NO:4 represents primer PD, is used for the fragment by plasmid (809) OclpSP73/DH5 α amplification OC-1.

SEQ ID NO:5 represents the Z10 fragment, shown in Fig. 9 A.

SEQ ID NO:6 represents the OCI fragment, shown in Fig. 9 B.

Summary of the invention

The co-expression of proteins that the present invention relates to cause a kind of protein for the level of the accumulation in the cell during, to increase with respect to the same protein single expression.Protein is expressed in protokaryon or eukaryotic cell.When expressing together, one or both in these two kinds of protein accumulate with the level that is higher than single expression in cell in cell.The employing standard, conventional genetic engineering technique separates the suitable DNA of coding expectation protein (comprising regulating and controlling sequence) with (i), (ii) transformed target cell, and in the situation that is plant, the regeneration of transgenic plant.Under one or both conditions that are enough to cause in two kinds of protein, cultivate transgenic cell with the high level accumulation.The protein that accumulates in cell is showed stability and the resistance to degrading that raises.

The invention still further relates to can the high level expression stabilizing protein plant and plant tissue, these protein form with proteoplast in vegetable cell exists.Special illustration the plant of coexpression 15kD and 10kD zein.Coexpression 15kD and 10kD zein can be used for providing the feed farm crop through transforming plant, containing the sulfur-containing amino acid (such as methionine(Met)) of increase in the described fodder crop, is the level of sulfur-containing amino acid (such as methionine(Met)) in the food of animal of food thereby increase usually with these farm crop.Plant or the plant tissue that comprises new paraprotein body through conversion also contained in the present invention, and one or more indispensable amino acids of these proteoplasts (as arginine, Histidine, leucine, Isoleucine, Methionin, phenylalanine, Threonine, tryptophane, tyrosine and Xie Ansuan) raise.The present invention is also contained and is caused the proteoplast that normally unstable proteinic accumulation increases in plant tissue.

The invention still further relates to the plant or the plant tissue that comprise the stable proteoplast of cud, these proteoplasts comprise other proteinaceous substances, for example can cause antigenic determinant, pharmaceutical grade protein, sterilant or the antimicrobial peptide of immunne response.Heterologous protein can be expressed in being used as the storage protein plant transformed of the present invention of " carrier proteins ", and protein form combination with proteoplast in cell also accumulates thus.In another embodiment, the form with fusion rotein in plant or plant tissue provides cud stable proteoplast, and fusion rotein is expressed in the cell that comprises zein and heterologous protein or peptide.

Detailed Description Of The Invention

The present invention relates to the plant and the plant tissue of can high level expression stable storage protein, these protein form with proteoplast in vegetable cell exists.The plant that the scope of the invention contains comprises through transforming expresses the proteinic feed crop plants of the present invention, comprises for example clover, trifolium, maize silage, Chinese sorghum and other pulse family farm crop.The scope of the invention also contains and is used for the human consumption, expresses proteinic plant through transforming, thereby these protein have strengthened the protein quality improvement nutrition of plant.Special illustration the proteinic plant of expression contained high levels S-amino acid (such as methionine(Met) and halfcystine).In preferred embodiments, zein is expressed in plant or plant tissue.Preferred, the zein of expression is 15kD and 10kD zein.Most preferred, 15kD and 10kD zein coexpression in plant or plant tissue.With the plant sexual hybridization that genotype is carried 10kD and 15kD zein spirit-soluble gene, the hybrid of carrying two kinds of constructs with generation.Degraded has resistance to cud at the zein of expressing in transforming plant, because this protein can " be avoided " cud, therefore can be used for providing the amino acid of important nutrition, and amino acid can digest under one's belt, and is absorbed by ruminating animal.

Plant or the plant tissue that comprises the stable proteoplast of cud also contained in the present invention, and these proteoplasts comprise other proteinaceous substances, for example can cause antigenic determinant, pharmaceutical grade protein, sterilant or the antimicrobial peptide of immunne response.Have the allos of indispensable amino acid and endogenous protein and synthetic peptide can be expressed in being used as the storage protein plant transformed of the present invention of " carrier proteins ", thus protein in cell with the form of proteoplast in conjunction with and accumulation.In another embodiment, the stable proteoplast of cud in plant or plant tissue with the formal representation of the fusion rotein that comprises zein and heterologous protein or peptide.Fusion rotein can design and produce the heterologous protein part by the cutting of selected enzyme or under specific physiological conditions.Preferably, the zein of expressing as a fusion rotein part is 15kD or 10kD zein.Preferred, 15kD and 10kD zein coexpression in plant that comprises fusion rotein or plant tissue.

The stable proteoplast of cud is also contained in the present invention.The stable proteoplast of cud of the present invention is not digested by the rumen bacteria in the animal cud, but can be by the proteolytic enzyme digest in the animal stomach.The stable proteoplast of cud of the present invention can be prepared into except the stable protein of cud and also comprise the heterologous protein metallic substance.For example, can cause antigenic determinant, pharmaceutical grade protein, sterilant or the antimicrobial peptide of immunne response.The stable proteoplast of cud can separate in the polynucleotide molecule plant transformed by the cud stabilizing protein of expecting with coding.Use standard technique known in the art, can be easy to select to express the vegetable cell of polynucleotide molecule of the cud stabilizing protein of coding expectation, and regeneration plant or plant tissue.

In one embodiment of the invention, storage protein gene in cell with second kind of protein gene coexpression, thus second kind of protein in cell to be higher than the level accumulation of single expression in cell when (promptly not having storage protein gene).In preferred embodiments, storage protein gene is the seed storage protein gene, and target cell is a vegetable cell, and second kind of gene that protein gene can be any coding desirable protein matter.The regulating and controlling sequence that adopts with protein gene (promotor, homing sequence, terminator sequence, polyadenylation sequence, enhanser, or the like) can be easy to select according to multiple factor by those of ordinary skills, such as i) the specific protein plasmagene that adopts, the ii) target cell that will transform, iii) expect the plant tissue of expression/accumulation, the iv) specified plant that will transform (monocotyledons, dicotyledons, or the like) species, or the like.For example, if vegetable cell is target cell, then can select the composition promotor (as CaMV 35S, ubiquitin, or the like), perhaps can adopt tissue-specific promotor, thus in particular organization's (seed, chlorenchyma, or the like) high level expression.

In another embodiment of the invention, adopt 15kD zein spirit-soluble gene and second kind of protein gene in the vegetable cell together, cause second kind of protein in vegetable cell, to accumulate.Adopt standard conversion and regeneration techniques, can be contained in two kinds of genes in the single expression cassette and insert Plant Genome.Perhaps, two kinds of protein genes independently can be inserted the vegetable cell genome with the expression cassette that separates, and regeneration of transgenic plant thus.Equally, two kinds of protein genes can be inserted vegetable cell separately, and each self-contained a kind of protein gene of regeneration, can educate transfer-gen plant.Adopt standard plant breeding technology with these transgenic plant cross pollination then, comprise the hybrid of 15kD zein spirit-soluble gene and second kind of protein gene with generation, wherein second kind of protein accumulates in one or more plant tissues.

In a preferred embodiment of the invention, transform clover, tobacco or other vegetable cell with 15kD zein spirit-soluble gene and 10kD zein (second kind of protein), wherein two kinds of genes are all by the composition promoters driven.The educated transgenic plant regeneration that will comprise two kinds of gene constructs.Cultivate the offspring plant, the 5-10 of 10kD zein accumulating level with respect to 10kD protein single expression time the in chlorenchyma doubly or the higher level accumulation.

In addition, the new proteoplast that forms as express the result of storage protein gene and second kind of protein gene in the green plants tissue is contained in the present invention.In one embodiment, new proteoplast comprises 15kD zein and second kind of protein.Proteoplast is usually located at leaf texture.In preferred embodiments, new proteoplast is positioned at leaf texture, and comprises 15kD zein and 10kD zein.

The method of the feed quality that is used to improve plant is also contained in the present invention, comprises that the polynucleotide molecule with code book invention storage protein transforms plant or plant tissue.Being used to transform plant and selecting the method for the expression of transforming gene type is known in this area.In the preferred embodiment of this method, the zein that polynucleotide encoding is expressed in plant or plant tissue.Preferred, the zein of expression is 15kD or 10kD zein.Most preferred, 15kD and 10kD zein are at coexpression in transforming plant or plant tissue.Use standard technique known in the art, can be by being easy to the preparation transgenic plant through transforming plant or plant tissue.

The present invention is also contained and is used for improving heterologous protein in the stability of plant or plant tissue and the method for storage.Heterologous protein can be expressed in being used as the storage protein plant transformed of the present invention of " carrier proteins ", and protein form combination with proteoplast in cell also accumulates thus.In another embodiment of the invention, with the polynucleotide molecule conversion plant of encoding fusion protein, fusion rotein comprises the storage protein of the present invention that can be operatively connected with heterologous protein or peptide.

Zein of the present invention comprises that not only those have the protein (comprising allele variant) of the aminoacid sequence of finding at occurring in nature, comprise that also those have the variant zein that conserved amino acid substitutes, adds and delete in protein sequence, as long as these variant proteins have kept the related biological activity identical with the natural corn prolamine substantially.Those of skill in the art can be easy to determine according to technology disclosed herein whether variant proteins has kept the biology chemistry identical with unmodified protein matter substantially.

Material and method recombinant DNA technology

Use standard step to carry out recombinant DNA operation people such as (, 1982) Maniatis.Comprise plasmid pMZEI10k (people such as Kirihara, 1988), be so kind as to give by Dr.J.Messing by corn embryosperm cDNA library isolating 10kD zein cDNA.Obtain to comprise the 470bp EcoRI/XbaI fragment of complete coding region by pUC119, and be cloned among the EcoRI and XbaI site of pSP73.The terminator codon of 10kD zein is contained in the XbaI site.Reclaim the 10kD zein spirit-soluble gene with the BglII/XhoI fragment then, and insert the BglII of pMON316 polylinker and XhoI site people such as (, 1987) Rogers.Translation termination after the terminator codon of 10kD zein is the NOS terminator.The plasmid that produces is called pM10Z (Figure 1A).Plasmid pMEZ is described by people such as Gagga (1995).Plant Transformation and regeneration

By triparental mating (people such as Rogers, 1987) plasmid pM10Z is mobilized among Agrobacterium tumefaciems (Agrobacterium tumefaciens) the F-strain pTiT37ASE by bacillus coli DH 5 alpha.By Ye Panfa (people such as Horsch, 1987) transformation of tobacco (Nicotianatabacum cv Xanthi).The selection transformant is also regenerated on the MS substratum that contains 100 μ g/ml kantlex, and seedling 4-6 after inoculation occurred in week.Seedling is taken root on the same medium that does not contain hormone, and be transferred to soil.

In order to obtain to comprise the 10kD zein/15kD zein plant of two kinds of zein spirit-soluble genes that drive by the CaMV 35S promoter, to comprise the tobacco transformant hybridization of pM10Z or pMEZ, and the seed that obtains will be germinateed on the substratum that contains 200 μ g/ml kantlex.Use 15kD zein and 10kD zein antibody, the protein extract from seedling is carried out Western analyze.The plant (10kD/15kD zein plant) and the stock plant (10kD zein and 15kD zein plant) of expressing two kinds of zein spirit-soluble genes are used for all comparative analysis.Zein extracts and Western analyzes

Plant tissue is ground, in phosphate buffered saline buffer (PBS), extract, and centrifugal.Use Bradford experiment (BIO-RAD) that supernatant liquor is used for protein determination.To be deposited in 70% ethanol that contains 1% mercaptoethanol in 65 ℃ of incubations 30 minutes to extract zein from centrifugal.Analyze for Western, EtOH can be extracted part (the PBS soluble protein extract that is equivalent to known quantity) carry out SDS-PAGE (Laemmli, 1970), change nitrocellulose filter subsequently.Film was sealed 1-2 hour with 1%BSA in containing the Tris damping fluid (TBST) of 0.05% polysorbas20, in containing the same buffer of suitable antibody, be incubated overnight subsequently.10kD zein monoclonal antibody is provided by DEKALB Genetics company, and 10kD zein polyclonal antibody is provided by Dr.J.Messing, and 15kD zein polyclonal antibody is provided by Dr.B.Larkins.Use alkaline phosphatase link coupled two to resist and (in the situation of polyclonal antibody, use goat antibody or rabbit igg; In the situation of monoclonal antibody, use mouse IgG) and substrate nitroblue tetrazolium(NBT) and 5-bromo-4-chloro-3-indolylphosphate, according to the indication (Promega) of manufacturers, will develop the color with the protein band of antibody response.The mono-clonal of 10kD zein and polyclonal antibody the Western of 10kD zein plant analyze with immunolocalization on all provided similar result, but polyclonal antibody shows to a certain degree the cross reactivity with the 15kD zein, therefore, all relate in the comparative analysis of parent and filial generation and only use monoclonal antibody at us.BiP analyzes

To carry out SDS-PAGE from phosphate buffered saline buffer (PBS) soluble extract of the leaf of different plants, the polyclonal antibody (providing by Dr.R.Boston) of corn BiP is provided subsequently, use the step of describing in above zein extraction and the Western analysis part, carry out Western and analyze.The body internal labeling of leaf dish

To mix in the liquid (1mM potassiumphosphate, pH6,1% sucrose, 50 μ g paraxin) under illumination incubation 2 hours at the 120 μ l marks that contain 120 μ ci 35S methionine(Met)s (than 1047ci/mMol alive) from four leaf dishes (diameter 7mm) of young, the leaf just expanded.Then disk is cleaned up with incubation buffering liquid, and sample is ground in cold PBS.In PBS, extract sample, estimate the protein in the PBS soluble fractions, and as described in people such as Gagga (1995), reclaim zein by precipitation.By SDS-PAGE protein is analyzed, on pvdf membrane (Millipore), carried out electroblotting subsequently.Film is sprayed Enhance (NEN), dry air, and make the X-ray film exposure.Electron microscopy

Small pieces leaf and seed tissue are fixed 2 hours in containing the 0.07M sodium cacodylate buffer liquid of 2.5% glutaraldehyde, fix 1 hour after then in 1% water-soluble perosmic anhydride.Sample is dewatered in EtOH, and in the SpurrShi resin in 70 ℃ of embeddings.Then the part of the silver color on the copper mesh is dyeed in uranyl acetate and ReynoldShi lead citrate.In the H7000 of Hitachi transmission electron microscope, check aperture plate.Immuno-electromicroscopy

Small pieces leaf and seed tissue are fixed 2 hours on ice in containing the 0.33M sodium phosphate of 4% polyoxymethylene and 0.6% glutaraldehyde and 0.1M sucrose/potassium damping fluid (pH7.3).Tissue with the buffer solution for cleaning 3 times that contains 7% sucrose, and is spent the night in 4 ℃ of preservations in the damping fluid the last time.This is used two kinds of different schemes in stage: will in EtOH, dewater through fixing organization, with Lowicryl in-10 ℃ of infiltrations, and with resin under UV light in-10 ℃ of polymerizations 24 hours, then in room temperature 24 hours.In second kind of scheme, will be organized among the EtOH and dewater, embedding in SpurrShi resin or LR White resin, and in 50 ℃ of polymerizations.Remaining step all carries out in room temperature.(different resins is available from EIecton Microscopy Sciences, Ft.Washington, PA).At first with the silver color on nickel screen part at confining liquid, contain incubation in the 10mMTris damping fluid of 1%BSA (Sigma), 0.05% polysorbas20 (Sigma) and 15mM NaCl.The mixed liquid of this buffering is used for all remaining steps.For immune labeled kind subdivision, in confining liquid, add normal serum, to reduce unspecific staining from the 5-20% in antibody animal source.

Carry out immune labeled with 10kD zein antibody: the aperture plate of 10kD and 10kD/15kD zein hybrid section is blotted, and with the 10kD zein monoclonal antibody incubation of dilution in 1: 50 in damping fluid 45 minutes-4 hours.To contrast with immune mouse IgG incubation not.Then they are cleaned in damping fluid, and preserving 45 minutes with the goat anti-mouse IgG golden mark, diameter 10nm (Sigma) of damping fluid dilution in 1: 50.In situation from the section of 10kD zein plant, with aperture plate with the anti-10kD zein of the multi-clone rabbit incubation of damping fluid dilution in 1: 1,000 60 minutes.Then they are cleaned, and in the gold anti-rabbit igg that put together, diameter 5nm of dilution in 1: 50 incubation 60 minutes.Because polyclone 10kD zein antibody and the cross reaction of 15kD zein, so in the situation of 10kD/15kD zein hybrid, aperture plate with 10kD zein monoclonal antibody incubation, is followed anti-mouse IgG that put together by gold, diameter 10nm.Aperture plate is cleaned in containing the Tris damping fluid of polysorbas20 and 1%BSA, use distilled water subsequently.Check aperture plate undyed or slight poststaining in acetic acid dioxygen osmium and lead citrate then.

Carry out double-tagging with 10kD and 15kD zein antibody: with aperture plate 1: 100 the dilution the anti-15kD zein of rabbit in incubation 45-60 minute.Clean aperture plate, and in the gold goat anti-rabbit igg that put together, diameter 5nm of dilution in 1: 50 incubation 45-60 minute.In damping fluid, thoroughly clean aperture plate then, with the mouse anti 10kD zein incubation of damping fluid dilution in 1: 50 45-60 minute.Use the buffer solution for cleaning aperture plate then, use distilled water subsequently, and in the gold goat anti-mouse IgG that put together, diameter 10nm of damping fluid 1: 50 dilution incubation 45 minutes.With the Tris buffer solution for cleaning aperture plate that contains polysorbas20 and 1%BSA, use distilled water subsequently.Check aperture plate undyed or slight poststaining in acetic acid dioxygen osmium and lead citrate then.

Hereinafter be the embodiment of illustration certain embodiments of the invention.These embodiment are exemplary, should not be interpreted as limitation of the present invention by any way.Embodiment 1-15kD and the accumulation of 10kD zein in the nutritive issue of L.japonicus and clover

To be subjected to the 15kD of CaMV 35S promoter control and the encoding sequence of 10kD zein to import L.japonicus and clover (Regen SY).As illustrated in fig. 1 and 2, two kinds of zein show high level accumulation (accounting for the 1-2% of gross protein) in the nutritive issue of all transformants.Opposite, the β-Kidney bean protein gene that is driven by the CaMV 35S promoter shows the composition accumulation of transcript, but has only seed to show proteinic specificity accumulation.These presentation of results zein are stable in nutritive issue, and quite different as the β-Kidney bean albumen of vacuole protein matter.The stability of zein can give the credit to proteinic intrinsiccharacteristic or its Subcellular Localization.The accumulation of embodiment 2-zein in the nutritive issue of tobacco transformant

With gene construct pM10Z (Fig. 3 A) the transformation of tobacco plant that comprises the 10kD zein spirit-soluble gene that drives by the CaMV 35S promoter.To carry out Western from the leaf of the independent transformant of 7 strain picked at random and analyze, to measure the accumulation (Fig. 3 B) of 10kD zein.All transformants show two kinds of immune-reactive protein matter, and a band is with from the 10kD zein of corn seed (position that is shown by arrow) migration altogether, and another band is the 29kD band.The latter does not move (Fig. 3 C) altogether with the immune response band of the larger molecular weight of seeing in corn seed.The 29kD immune response band that is obtained by the leaf of transfer-gen plant may be represented the aggregation of 10kD zein and another kind of endogenous leaf protein matter.Similar, the 20kD immune-reactive protein matter in the corn seed may be represented the aggregation of 10kD zein and endogenous corn protein.In different transformants, about 10 times of the accumulation volume difference of 10kD and 29kD immune response band.The level of two kinds of immune response bands that transformant 4 shows almost can be ignored.In each transformant, the difference of 10kD zein accumulation volume may be attributed to the copy number of position effect or integrator gene.

In order to measure the accumulation volume of the 10kD zein between different plant parts, will be from the equal protein matter extract (being equivalent to 50 μ gPBS soluble proteins) of leaf, stem, root and the seed of transformant 6, with corn seed extract (being equivalent to 2 μ g PBS soluble proteins), carry out Western and analyze (Fig. 3 C).Leaf shows the highest level of 10kD zein accumulation, follows by stem.The 10kD zein level of seed is lower about 10 times than leaf, as the situation (people such as Bagga, 1995) of the 15kD zein in the transgene tobacco.In a word, our presentation of results 10kD zein builds up to conspicuous level in all organs of transgene tobacco, as before us about the report of 15kD zein people such as (, 1995) Bagga.The stability of embodiment 3-zein in the tobacco seed that germinates

Shown in the past 15kD zein in the transgene tobacco seed in germination process not by proteolytic digestion (people such as Hoffman, 1987; People such as Bagga, 1997).Whether similar in order to determine the 10kD zein, to carry out the germination of different time (0-10 days) from the seed of 10kD zein plant, results seed/seedling, extract their ethanol soluble protein, and use 10kD zein antibody to carry out Western and analyze (Fig. 4).The level of 10kD zein remained unchanged substantially at initial 4 days that germinate, and after this its horizontal display density significantly increases.After the germination between the 0th day and the 1st day (DAG) observe 10kD zein level and descend slightly, but after this level is maintained until 4DAG.Inconsistent in different experiments by the observed decline of 3DAG sample, it is less that this is attributed in the swimming lane applied sample amount of protein extract.The 4DAG time point is consistent with the appearance of first group of greenery, may be relevant with the activation of CaMV 35S promoter in the growth seedling.The suitable disperse that in proteinic SDS-gel, also seems of immunoreactive 10kD zein band from the seedling stage, as observed, illustrate that leaf has the migration that some materials have hindered the 10kD zein in ethanol soluble protein part by the leaf sample.These presentation of results 10kD zein is not degraded in the germination process of tobacco seed.Embodiment 4-15kD and the 10kD zein immunolocalization in the new proteoplast of transfer-gen plant

In order to understand the basis of 15kD and the stability of 10kD zein in the leaf of transfer-gen plant, checked the location of these protein at subcellsular level.With the leaf of transformant, with adjoining tree, carry out analysis of Ultrastructure, follow by immunocytochemistry (using 15kD and 10kD zein antibody).The 15kD zein seems that homogeneous is distributed in unique bow structure shape proteoplast of arranging along RER (people such as Gagga, 1995, appendix).These proteoplasts are also found in L.japonicus that expresses the 15kD zein spirit-soluble gene and clover.

Also in leaf texture, carried out electron microscopic examination, to check existing of any proteoplast from the transgene tobacco of expressing the 10kD zein.Shown in Fig. 5 A and Fig. 5 B, in the leaf of 10kD zein plant, see and the very different proteoplast of 15kD zein proteoplast (Fig. 5 C).Proteoplast in the 10kD zein plant seems, and having a liking for very much height oozes, have a liking for height ooze thing (osmophilia) be concentrated in (protein) body around.In the section of some hybrids, have a liking for height and ooze thing and seem by the discontinuous radiation in center (Fig. 5 B).The proteoplast of seeing in 15kD zein plant is not showed and is thisly extremely had a liking for height and ooze thing (Fig. 5 C).In some leaf sections, find that 10kD zein proteoplast is relevant with ER, but in most applications, because the bodily form of proteoplast is bigger, the ER film seems discontinuous.According to immunolocalization, find 10kD zein equilibrium distribution in these unique proteoplasts, illustrate that they produce (Fig. 5 D) by the assembling of 10kD zein.Embodiment 5-15kD and 10kD zein in expressing the transformant of these two kinds of genes in accumulation

Express sexual hybridization between the tobacco transformant of 15kD or 10kD zein, whether interact and influence protein accumulation in vegetable cell to determine these protein.To on 200 μ g/ml kantlex, germinate from the seed of these hybrids, and use 15kD and 10kD zein spirit-soluble gene special primer, select to express the seedling of two kinds of genes according to positive PCR.Use 15kD and 10kD zein antibody,, the protein extract from two strain independence plant of expressing two kinds of genes and parent's thereof leaf is analyzed by immunoblotting.Being accumulated in two parents and the 10kD/15kD zein hybridization plant of 15kD zein seems similar, and the 10kD zein accumulation in the 10kD/15kD zein hybridization plant is than much higher times of corresponding 10kD zein parent.

In order to measure the accurate level that the 10kD zein increases owing to the coexpression with the 15kD zein, to carry out the Western analysis from the leaf of a strain 10kD zein plant, a strain 15kD zein plant and corresponding 10kD/15kD zein hybrid and the equal protein body extract of seed, and use intelligent quantitative instrument (BioImage) that the immune response band is carried out quantitatively (Fig. 6) subsequently.This quantitative analysis shows that seed of 10kD/15kD zein plant and the 15kD zein level in the leaf are to 15kD zein stock plant similar substantially (Fig. 6 C and 6D).Yet, the 10kD zein in the leaf of 10kD/15kD zein hybrid and the amount in the seed than the high 4-5 of stock plant doubly (Fig. 6 A and 6B).Owing to be used to form the antigenicity and the concentration difference of two kinds of antibody of trace, 15kD and the 10kD zein level in hybrid and parent system can not directly compare.Research before these results have also confirmed points out that leaf accumulates more zein than seed.Notice that in the situation of 10kD zein (Fig. 6 A and 6B), the protein applied sample amount on the gel is leaf sample 10 μ g, seed sample 50 μ g.Embodiment 6-10kD zein and 15kD zein are positioned same ER derived protein body in the plant of coexpression 10kD and 15kD zein spirit-soluble gene

There is certain interaction in the accumulation of 10kD zein in 10kD/15kD zein hybrid than only 10kD zein plant increase between hint 10kD and the 15kD zein.Electronic Speculum and immunocytochemistry from the leaf texture of 10kD/15kD zein plant only show the normally ER derived protein body (Fig. 7 A) of 15kD zein.We do not observe any and detected similar proteoplast in 10kD zein plant.Yet the immunolocalization of 10kD zein shows that protein restriction is (Fig. 7 B) in 15kD zein proteoplast.In order to determine whether 10kD zein and 15kD zein all are arranged in 15kD zein proteoplast, we use the monoclonal antibody of 10kD zein and the polyclonal antibody of 15kD zein, and the double-tagging immunocytochemistry has been carried out in leaf and the seed section of 10kD/15kD zein plant.10kD zein (representing) and 15kD zein (representing) by less 5nm gold grain by bigger 10nm gold grain all immunolocalization in same 15kD zein proteoplast (Fig. 7 C and 7D).Therefore, 15kD and 10kD zein are verified interaction, and this two kinds of protein have been stablized in this interaction.Embodiment 7-imports clover with the 15kD and the 10kD zein spirit-soluble gene of multiple copied

Contain the method for the total leaf content of S-aminoacid protein as raising, can be with the 15kD and the 10kD gene transfered plant of multiple copied.Except those constructs that adopts 35S promoter, can use the gene construct that drives by SSU promotor and mannopine synthase promoter, suppress problem altogether to avoid any potential.Can sexual formation carry the two the homogenic population of construct of 10kD, 15kD or 10kD and 15kD zein.According to the generality of the average number of expectation zein construct in the population relatively, can determine zein dosage in clover to the influence of the influence of expressing " self ", interaction between the construct and every kind of construct to development of plants, feed quality and output.Can also check that these three populations are carried the 10kD or the 15kD construct of 1-4 copy respectively from the genotype of 3 population genetic definition, perhaps 10kD and the two construct of 15kD of 1-2 copy.The direct method of zein copy number is in the sexual increase regenerate cell clone, individual regeneration of self-pollination or hybridization.Yet in this case, hybridization regeneration is equal to selfing on genetics.For the confusion effect that inbreeding is suppressed minimizes, can form a series of hybridization populations, to check that the zein construct is to the forage yield of clover and the influence of quality.The proteinic ruminal digestion of embodiment 8-

In ruminating animal, food at first is subjected to inhabiting the microbial process in first stomach of animal (cud).Because these animals self do not produce cellulase, the Mierocrystalline cellulose in the vegetable material is perched microorganism digestion.Yet these microorganisms can also be destroyed plant protein and the amino acid that discharges are used for the growth of himself.These rumen microorganisms are degraded when the residue digestive tube by animal subsequently, and important protein matter and other source of nutrition are provided thus.Yet, be deamination in the nitrogen of very most these protein in being excreted to urine.This has not only reduced the nutritional quality of foodstuff, also causes the over-drastic nitrogen environment to pollute.When in making the maximized effort of milk crop, giving ruminating animal with high protein foods very, problem worse.Also degraded substantially in cud of amino acid supplementation (as methionine(Met) or Methionin) has therefore developed multiple cud protection amino acid supplementation.Thus, extremely expectation is fed microbiological deterioration more there is the whole protein of resistance.Thus, determine importantly whether zein can be degraded by rumen bacteria, and whether definite zein can be by the enzymic digestion in the stomach of ruminants.

Use mortar and newborn pestle processing plant tissue.Sample is placed DACRON polyester bag (aperture 52 μ m).Every kind of sample keeps about 0.3g and is used for the comparison purpose, with residual content incubation 12 hours in the Holstein of intubate (a kind of cow of Holland) cow cud.By taking out sack in the cud, clean then, and in 60 ℃ of baking ovens dried overnight.By immunology (Western trace) and staining procedure, monitoring 15kD zein and 10kD zein.The carboxydismutase of monitoring rumen bacteria height degraded people such as (, 1983) Nugent contrasts as the inherence.Observe very low-level zein degraded after the processing, and carboxydismutase is degraded fully.Measure the zein level in treated and the untreated samples, to compare.Determined that also zein degraded by the gastric enzyme of ruminating animal.BiP in the transfer-gen plant of embodiment 9-expression zein spirit-soluble gene induces

(people such as Li, 1993a because BiP (a kind of endogenous plant protein) plays a role in the biogenesis of prolamine proteoplast; Zhang and Boston, 1991), inference BiP may play a role in the formation of the zein proteoplast of transgenic tobacco plant.For whether test b iP raises in the plant that produces the zein proteoplast, use corn BiP antibody, to from δ-zein, β-zein and δ-/protein example of the leaf of β-zein plant carries out quantitative Western and analyzes (Zhang and Bostong, 1992).Come comfortable system condition down the adjoining tree of the identical etap of growth and 3 strain transfer-gen plants (δ-, β-and δ-/β-zein plant) PBS solubility sample (100 μ g), with the purifying BiP of 1 μ g from corn, carry out SDS-PAGE, Western analyzes (Fig. 8, last figure) subsequently.Use intelligent quantitative instrument to analyze the immune response band then.Figure below among Fig. 8 is the synoptic diagram of expression immune response band relative brightness.The BiP accumulating level that all 3 strain transfer-gen plants show is all significantly compared according to high; More or less some is similar for BiP level in the 3 strain transformants.Therefore, the synthetic synthetic or stable accumulation of having induced BiP of the zein in the transfer-gen plant.Embodiment 10-is used for the protein expression of plant pest control purpose and fixes

Designed to comprise and merged mosaic gene (Z10/OCT), be used for transfer-gen plant stability and the validity of controlling plant insect to strengthen OCI at the 10kD zein spirit-soluble gene (Z10) of rice Guang protein I (OCI) protease inhibitor gene front end to meet frame ground.Mosaic gene comprises the coding region and the signal peptide district of 10kD zein, and the coding region of OCI, by the CaMV 35S promoter control of composition.The Western trace of detecting with OCI and 10kD zein antibody proves that approximately the expection protein of 26kD is expressed in the mosaic gene plant transformed.We had shown in the past, when using zein antibody to detect, express the expectation protein with the independent plant transformed of 10kD zein, and when detecting, do not show detectable expression with the independent plant transformed of OCI with OCI antibody.This observations shows that the Z10/OCI mosaic gene causes the stability of OCI to increase, and, be positioned discovery in the closed protein body according to the zein trend, further prove the protein quite stable.Others has reported the validity of proteinase inhibitor to the various plants insect, comprises Colorado colorado potato bug and plant nematode.Embodiment 11-expresses the structure of the transfer-gen plant of 10kD zein/OCI fusion rotein

Use the overlapping extension of montage (SOE) technology people such as (, 1989) R.M.Horton, made up 10kDsp10kD zein OC-I (Z10/OCI) syzygy.This technology utilizes polymerase chain reaction (PCR) with two kinds of fragment montages that separate together.At first use following primer by PCR by plasmid prep (993) Z10pMON316/DH5 α amplification Z10 fragment:

SEQ ID NO:1PA (CTACAAGATCTGATATCATCGATG) and

SEQ ID NO:2PB (GACATGGATCCGAATGCAGCAC) thus produce the product of about 500 base pairs of length (bp).Use following primer by plasmid (809) OclpSP73/DH5 α amplification OC-I fragment:

SEQ ID NO:3PC (GTGCTGCATTCGGATCCATGTCG) and

SEQ ID NO:4PD (CCGGTACCCTTAAATCGATGC) thus produce the segmental product of 322bp.Two kinds of PCR products are mixed with same concentrations, and be used for second as template and take turns the PCR reaction.For the Z10/OCI fragment that obtains to expect, use primer PA and PD to produce the product of 800bp.The big Nucleotide of runic among primer sequence PA, PB and the PC represents to take from the Z10 fragments sequence.Less Nucleotide among primer sequence PB, PC and the PD represents to take from the sequence of Ocl.Runic Nucleotide is from the Z10 sequence, and less Nucleotide is from the Ocl sequence.Primer sequence among Fig. 9 has been marked underscore, the primer title on primer sequence or below mark with runic.Fig. 9 got the bid the primer sequence PB of underscore and the reverse complemental of PD and above listed PB and PD sequence.The orientation of primer is indicated by arrow.

For with this fragment cloning in NewpFLAG-1 (NPF-1), add Klenow and dNTP the PCR fragment is mended flat terminal, and be connected with EcoRI digestion and with the NPF-1 that Klenow and dNTP mend flat end.Connect Z10/OCINPF-1, and be transformed in the DH5 α competent cell.In case confirmed to insert segmental existence by PCR, induced Z10/OCINPF-1 with IPTG, and inductive protein is carried out the Western trace.Use 3 parts of protein examples, detect with Z10, OC-I and FLAG polyclonal antibody.With all the 3 kinds of antibody complete structure of proof in the reading frame that react.These Western trace data with sequential analysis, have been confirmed the exactness of nucleotide sequence.To induce mistake be important for confirming not introduce PCR in sequential analysis.Yet, before order-checking,, and be connected among the pSP73 of similar digestion with BglII and KpnI digestion construct.Embodiment 12-tobacco leaf disc transforms

For the transformation of tobacco plant, need be in plasmid pGG with the construct subclone.Z10/OCINPF-1 and pGG are used BglII and KpnI digestion, connect, and be transformed among the DH5 α.Confirm to insert segmental existence with PCR.Figure 10 is the design of graphics of Z10/OCI.Plasmid pGG-2 is derivative people such as (, 1987) Rogers of pMON316, has added the AMV coat protein to strengthen translation people such as (, 1992) D.V.Sutton.Use to integrate altogether and contain Z10/OCI and insert segmental pGG-2 with the triparental mating of pTiT37SE people such as (, see above) Rogers.By people's such as Horsch method (people such as Horsch, 1985), transformation of tobacco leaf dish.When seeing indivedual tobacco seedling, they are transferred to Murashige and the Skoog substratum (T.Murashige and F.Skoog, 1962) that contains cefotaxime (500 μ g/ml) and kantlex (100 μ g/ml).By the Western trace indivedual plant test proteins are expressed then.

The positive reaction of the Western trace demonstration of Figure 11 A and 11B and Z10 and OCI antibody.

Should understand like this, embodiment described herein and embodiment are just for exemplary purpose, and those skilled in the art will propose various modifications or change according to them, and are contained within the scope of the application's spirit and scope and claims.

Reference S.Abe, W.You, and E.Davis (1991) " proteoplast in the corn embryosperm is by F-Actin muscle parcel ", protoplasma (Protoplasma) 165:139-149.P.Argos, K.Pederson, M.D.Marks, and B.A.Larkins (1982) " structural models of zeistic zein ", journal of biological chemistry (J.Biol.Chem.) 257:9984-9990.S.B.Altenbach, C.C.Kua, L.C.Staraci, K.W.Pearson, C.Wainwright, A.Georgescu, and J.Townsend (1992) " accumulation of Brazilian nut white protein in the transgenosis brassica seed causes increasing of seed albumen methionine level ", molecular biology of plants (Pl.Mol.Biol.) 18:235-245.Jr.M.K.Aycock, and C.P.Wilsie (1967) " by the close relative inbreeding clover that breeds: intersection, close relative and idiogamy ", farm crop science (Crop Sci.) 7:281-284.S.Bagga, Adams Hanke, J.D.Kemp, and C.Sengupta-Gopalan (1995) " accumulation of 15kD zein in new proteoplast in the transgene tobacco ", plant physiology (Plant Physiol.) 107 (1): 13-23.S.Bagga, S.J.Temple, J.D.Kemp, and C.Sengupta-Gopalan (1997a) " is used to improve the gene engineering method of the protein quality of feed pod ", molecular biology of plants and plant technology (Plant Molecular Biology and Biotechnology) (K.K.Tiwari and G.S.Singhal compile, Narosa Publishing House): 305-319.S.Bagga, F.Rodriguez, H.Adams, J.D.Kemp, and C.Sengupta-Gopalan (1997b) " Zea mays α-and the coexpression of β-zein spirit-soluble gene cause the stable accumulation of δ-zein in the endoplasmic reticulum derived protein body that forms by β-zein ", vegetable cell (Plant Cell) 9:1683-1696.D.K.Barnes, B.P.Goplen, and J.E.Baylor (1988) " U.S. and Canadian outstanding achievement ", the improvement of clover and clover (Alfalfa and alfalfa improvement) (A.A.Hanson, D.K.Barnse and Jr.R.R.Hill compile), Agron.Magr.29, ASA, Madison, WI.S.Y.Bednarek and N.V.Raikhel (1991) " the plain C-terminal propetide of barley lectin is the ghost letter sorting determiner in the plant ", vegetable cell (Plant Cell) 3:1195-1206.E.T.Bingham and T.J.McCoy (1979) " alfalfa planting of diploid level: origin, regenerating stability and output or seed and feed ", farm crop science (Crop Sci.) 19:97-100.E.T.Bingham (1983a) " maximizes the hybridization vigor in the autotetraploid clover ", is used for better farm crop (Better Crops for Food) (CIBA Found Symp., 97, Pitman Books, London): the 130-134 of food.E.T.Bingham (1983b) " the molecular gene engineering is to plant breeding ", molecular biology of plants (Plant Mol.Biol.) 2:221-228.R.S.Boston, E.B.P.Fontes, B.B.Shank, and R.L.Wrobel (1991) " expression of Zea mays immunoglobulin-binding proteins homologue b-70 in three kinds of zein regulation and control mutant raises ", vegetable cell (Plant Cell) 3:497-505.A.Ceriotti, E.Pedrazzini, M.S.Fabbrini, M.Zoppe, R.Bollini, and the expression in xenopus leavis oocytes of A.Vitale (1991) wild-type and mutant ghost storage protein phaseollin discloses the relation between assembling and the intracellular transport ", European biochemical magazine (Eur.J.Biochem.) 202:959-968.M.J.Chrispeels (1991) " the protein letter sorting in the excretory system ", plant physiology and molecular biology of plants yearbook (Annu.Rev.Plant Physiol.Plant Mol.Biol.) 42:221-53.M.J.Chrispeels and N.V.Raikhel (1992) " the small peptide structural domain is with protein targeted plants ghost ", cell (Cell) 68:613-616.E.G.De Barros and B.A.Larkins (1990) " from the purifying and the qualitative analysis of the zein degrading proteinase of germination Zea mays endosperm ", plant physiology (PlantPhysiol.) 94:297-303.A.DeClercq, M.Vandewlele, R.De Rycke, J.Van Damme, M.VanaMontagu, E.Krebbers, J.Vandekerckjove (1990) " expression and the processing of Arabidopis thaliana 2S white protein in transgene tobacco ", plant physiology (Plant Physiol.) 94:90-979.M.W.Dunbier and E.T.Bingham (1975) " the maximum heterozygosis in the clover: the result who uses monoploid deutero-autotetraploid ", farm crop science (Crop Sci.) 15:527-531.G.A.Edwards, A.Hepher, S.P.Clerk, and D.Boulter (1991) " pisum sativum agglutinin is correct processing, stable and activated in the leaf of transgenic tobacco plant ", molecular biology of plants (Plant Mol.Biol.) 17:89-100.A.Esen and D.A.Stetter (1992) " the immunochemistry location of γ-zein in Zea mays endosperm protein body ", american plant is learned magazine (Am.J.Bot.) 79:243-248.J.Finnegan and D.McElroy (1994) " transgenosis inactivation: the opposing of plant ", biotechnology (Biotechnology) 12:883-888.R.B.Flavell (1994) " inactivation of genetic expression in plant is as the particular sequence reproducible results ", progress (Proc.Natl.Acad.Sci.USA) 91:3490-3496 of NAS.A.Gallais (1984) " hybrid vigour is to the inbreeding effect Analysis of autotetraploid intersection fertilization plant clover ", genetics (Genetics) 106:123-137.E.Giannazza, V.Viglienghi, P.B.Righetti, F.Salamini, and C.Soave (1977) " zein divides the amino acid of subconstiuent to form ", vegetable chemistry (Phytochemistry) 16:315-317.G.Galili (1995) " Methionin and the regulation and control of Threonine synthetic ", vegetable cell (The PlantCell) 7:899-906.P.B.Goldsbrough, S.B.Gelvin, and B.A.Larins (1986) " expression of zeistic zein spirit-soluble gene in transforming the Sunflower Receptacle cell ", MGG (Mol.Gen.Genet.) 202:374-381.R.W.Groose, W.P.Kojis, and E.T.Bingham (1988) " the combining ability difference between homogenic diploid and the tetraploid clover ", farm crop science (Crop Sci.) 28:7-10.R.W.Groose, L.E.Talbert, W.P.Kojis, and E.T.Bingham (1989) " the advancing property hybrid vigour in the autotetraploid clover: use two types inbred research ", farm crop science (Crop Sci.) 29:1173-1177.P.Guerche, E.R.P.De Almeida, M.A.Schwarztein, E.S.Gander, E.Krebbers, and G.Pelletier (1990) " from the expression of 2S white protein in Brassica napus of Bertholletia exeeisa ", MGG (Mol.Gen.Genet.) 221:305-314.A.A.Hanson, D.K.Barnes and R.R Hill (1988) " improvement of clover and clover ", agronomy symposium 29, ASA, CSSA and SSA, Madison, Wisconsin State, the U.S..V.A.Hilder, A.M.R.Gatehouse, S.E.Sheerman, R.F.Barker, and D.Boulter (1987) " transforms the new mechanism of the insect-resistant of tobacco ", nature (Nature) 300:160-163.L.M.Hoffman, D.D.Donaldson, R.Bookland, K.Rashka, and E.M.Herman (1987) " the synthetic and proteoplast deposition of zeistic 15kD zein in the transgene tobacco seed ", European molecular biology magazine (EMBO J.) 6:3213-3221.L.M.Hoffman, D.D.Donaldson, and E.M.Herman (1988) modification storage protein synthesizes in the seed of transgenic plant, processes, also degrades ", molecular biology of plants (Plant Mol.Biol.) 11:717-729.People such as Horsch (1985), science (Science) 227:1229-1231.People such as R.M.Horton (1989), gene (Gene) 77:61-68.R.A.Jorgensen (1995) " inhibition, pattern pattern and genetic expression metastable condition altogether ", science (Science) 268:686-691.M.S.Kaldy, M.R.Hanna, and S.Smoliak (1979) " amino acid of santoin feed is formed ", forage and forage science (Grass and Forage Sci.) 34:145-148.H.Karchi, O.Shaul, and G.Galili (1993) " seed-specific expression of the bacterium desensitization E.C. 2.7.2.4. in transgene tobacco has improved the output of seed Threonine and methionine(Met) ", plant magazine (The Plant J.) 3:721-727.O.Kempthorne (1969), genetic statistics introduction (An introduction to geneticstatistics), press of Iowa State University, Ames.J.A.Kirhara, J.P.Hunsperger, W.C.Mahoney, and J.W.Messing (1988) " is rich in the differential expression of the storage protein gene of methionine(Met) ", MGG (Mol.Gen.Genet.) 211:477-484 in the Zea mays.P.Langridge and G.Felix (1983) " separate far promoter region by two kinds and transcribe zeistic zein spirit-soluble gene ", cell (Cell) 34:1015-1022.B.A.Lardins, C.R.Lending, J.C.Wallace, G.Galili, E.E.Kawata, K.B.Geetha, A.L.Kirz, D.M.Martin, and C.E.Bracker (1989) " zein spirit-soluble gene in the Zea mays endosperm development process is expressed ", the molecular basis of development of plants (The molecular basis ofplant development) (R.B.Goldbert compiles, Alan R.Liss, New York): 109-120.B.A.Lardins and W.J.Hurkman (1978) " the synthetic and deposition of the zein in the Zea mays endosperm protein body ", plant physiology (Plant Physiol.) 62:256-263.K.H.Lee, R.A.Jones, A.Dalby, and C.Y.Tsai (1976) " gene regulating of storage protein content in the Zea mays endosperm ", biochemical genetics (Biochemical Genetics) 14:641-650.C.R.Lending and B.A.Larkins (1989) " variation that the zein of proteoplast is formed in the Zea mays endosperm development process ", vegetable cell (Plant Cell) 1:1011-1023.H.Levanony, R.Rubin and Galili G.ALtschuler (1992) " the wheat storage protein enters the evidence of the variation route of ghost ", cytobiology magazine (J.Cell Biol.) 119:1117-1128.X.Li, V.R.Franceshi is with T.W.Okita (1993a) " storage protein mRNA's separates on the rice-embryo milk cell ergastoplasm film ", cell (Cell) 72:869-879.X.Li, Y.Wu, D-Z Zhang, J.W.Gillikin, R.S.Boston, V.R.Franceshi, and T.W.Okita (1993b) " process of the biogenesis of paddy rice prolamine proteoplast: BiP mediation ", science (Science) 262:1054-1056.K.Matsuoka and K.Nakamura (1991) give birth to the propetide of the essential plant ghost protein precursor of born of the same parents' target ", progress (PNAS USA) 88:834-838 of NAS.P.Maliga (1978) " resistant mutants and the use in genetic manipulation thereof ", plant tissue culture frontier (Frontiers of plant tissue culture) (T.A.Thorpe volume): 381-392.T.Masumura, T.Hibino, K.Kidza, N.Mitsukawa, K.Tanaka, and S.Fujii (1990) " clone and the evaluation of the cDNA of coding paddy rice 13kD prolamine ", MGG (Mol.Gen.Genet.) 221:1-7.P.Meyer and I.Heidman (1994) " the back living mutant of genetically modified morning glory system shows the hyper-methylation of transgenosis DNA: in the transgenic plant to the indication of the specific recognition of foreign DNA ", MGG (Mol.Gen.Genet.) 243:390-399.R.Michaud, W.F.Lehman, and M.D.Rumbaugh (1988) " worldwide distribution and historic development ", the improvement of clover and clover (Alfalfa and alfalfaimprovement) (A.A.Hanson, D.K.J.Barnes and Jr.R.R.Hill compile, agronomy symposium 29, ASA, Madison, WI).D.J.Minson (1990) protein ", the feed in the ruminant animal nutrition (Forage inRuminant Nutrition) (Academic Press Inc., New York).P.S.Misra, R.Jumbunathan, E.T.Mertz, D.V.Glover, H.M.Barbosa, K.S.McWhirter (1972) " endosperm protein is synthetic in the Zea mays mutant that lysine content raises ", science (Science) 176:1425-1426.T.Murashige and F.Skoog (1962), the physiology of plant (Physiology Plant) 15:485.J.H.A.Nugent, W.T.Jones, D.J.Jones, and J.L.Mangan (1983) " soluble protein casein, fragment 1 (18S) leaf protein matter, bovine serum and the proteolysis speed of ox lower jaw mucoprotein in cud ", Britain's trophology magazine (Br.J.Nutr.) 50:357-368.T.Ohtani, J.C.Wallace, G.A.Thompson, G.Galili, and B.A.Larkins (1990) " in the transgene tobacco seed, being unsettled normally " with the zein that contains Methionin, molecular biology of plants (Plant Mol.Biol.) 15:117-128.H.R.B.Pelham (1990) " endoplasmic reticulum soluble protein possess signal ", biochemical science trend (Trends Biochem Sci) 15:483-485.R.L.Phillips and B.A.McClure (1985) " elerated protein bound Methionin and Threonine resistance Zea mays are the methionine(Met) in the seed ", cereal chemistry (Cereal Chem.) 62:213-218.People such as Rogers (1987), Enzymology method (Methods ofEnzymology) 153:253-277.People such as D.W.Sutton (1992), transgenic research (Transgenic Research) 1:228-236.

L.M.Tabe, C.M.Higgins, W.C.McNabb, and T.J.V.Higgins (1993) " cereal and herbage beans genetically engineered are to improve nutritive value ", genetics (Genetica) 90:181.

Claims (20)

1. a plant or plant tissue that comprises storage protein, this protein in the nutritive issue of described plant or plant tissue with the formal representation and the accumulation of proteoplast.

2. the plant of claim 1 or plant tissue, wherein said storage protein is that cud is stable.

3. the plant of claim 2 or plant tissue, wherein said cud stabilizing protein is a zein.

4. the plant of claim 3 or plant tissue, wherein said zein is selected from 15kD zein and 10kD zein.

5. the plant of claim 1 or plant tissue, wherein said plant coexpression 15kD and 10kD zein.

6. the plant of claim 1 or plant tissue, wherein said storage protein is the constructive expression in described plant or plant tissue.

7. a method that improves the feed quality of plant comprises that the polynucleotide molecule with the coding storage protein transforms plant or plant tissue, and described storage protein formal representation with proteoplast in the nutritive issue of described plant or plant tissue also accumulates.

8. the method for claim 7, wherein said storage protein is that cud is stable.

9. the method for claim 8, wherein said cud stabilizing protein is a zein.

10. the method for claim 9, wherein said zein is selected from 15kD zein and 10kD zein.

11. the method for claim 7, wherein said plant coexpression 15kD and 10kD zein.

12. one kind is improved exogenous protein stability and the method for preserving in plant, comprise and use the polynucleotide molecule of coding storage protein to transform the plant or the plant tissue of expressing heterologous protein that described storage protein formal representation with proteoplast in the nutritive issue of described plant or plant tissue also accumulates.

13. the method for claim 12, wherein said storage protein are that cud is stable.

14. the method for claim 13, wherein said cud stabilizing protein is a zein.

15. the method for claim 14, wherein said zein are selected from 15kD zein and 10kD zein.

16. the method for claim 12, wherein said plant coexpression 15kD and 10kD zein.

17. a composition that comprises cud stabilize proteins body, wherein said proteoplast is expressed in plant and is accumulated.

18. the composition of claim 17, wherein said proteoplast comprises zein.

19. the composition of claim 18, wherein said zein are selected from 15kD and 10kD zein.

20. the composition of claim 17, wherein said proteoplast comprise 15kD and 10kD zein.

Images