MXPA01006805A - Co-expression of proteins - Google Patents

Abstract

The subject invention pertains to materials and methods for transformed plants and plant tissues that are capable of expressing high levels of stable proteins which are localized as protein bodies within the plant cell. Transformed plants co-expressing high levels of both the 15kD and 10kD zein proteins are disclosed which accumulate to high levels as protein bodies in the vegetative tissue of the plant. Transformed plants co-expressing the 15kD and 10kD zein proteins are useful for providing forage crops containing increased levels of sulfur containing amino acids, such as methionine, in the diet of animals that normally feed on such crops. Also contemplated by the subject invention are transformed plants or plant tissue comprising stable protein bodies which contain heterologous proteinaceous material. In one embodiment, a stable protein body is expressed in a plant or plant tissue as a fusion protein comprising a zein protein and an operably linked protein or peptide. The protein bodies provided in the present invention are resistant to rumin digestion or environmental degradation.

Description

CO-EXPRESSION OF PROTEINS REFERENCE TO RELATED REQUESTS This is a continuation request in part of a co-pending serial application No. 08 / 866,879, filed May 30, 1997; and Serial Provisional Application No. 60 / 020,424, filed on May 31, 1996, now abandoned.

BACKGROUND OF THE INVENTION Alfalfa (Medicago sativa L) is considered to be the most important crop crop in the world (Hanson et al., 1988; Michaud et al., 1988) and is often referred to as "the queen of fodder crops. "because it grows widely, has a superb balance of vitamins and minerals, is highly resistant, is an excellent biological source of nitrogen fixation, and serves as a source of attractive nectar for bees (Barnes et al., 1988; Smoliak and Bjorge, 1983). Alfalfa has been the daily sustenance for years both for its quality as forage and for its plant performance. Although alfalfa and other leguminous crops as forage are high in protein, these plants are deficient in sulfur amino acids (S-amino acids), methionine and cysteine (Kaldy et al., 1979). It has been shown that wool growth in sheep is limited for the availability of S-amino acids. Similarly, the production of milk by livestock is affected by the deficiency of S-amino acids in the plants. Efforts to use conventional plant cross-breeding and cell selection techniques to increase the S-amino acid content of alfalfa have met with little or no success. A genetic engineering method to improve the amino acid balance of alfalfa and other forage crops could be introduced into these plant genes that code for high methionine proteins driven by a strong constitutive promoter or a leaf promoter. In order to significantly alter the amino acid balance of the legume forage, the outer proteins should contain around 15 to 25% of S-amino acids and constitute 5 to 10% of the total protein of the leaf. To achieve these levels of protein accumulation, one has to ensure not only maximum levels of transcription and translation of the gene but also the stability of the protein. With respect to fodder crops for ruminant animals, the digestibility of proteins containing S-amino acids by rumen bacteria and stomach enzymes is also an extremely critical issue with respect to providing a suitable forage crop for ruminant animals, but it is often overlooked. Therefore, the protein rich in S-amino acids should be relatively resistant to degradation in the rumen (first stomach) of ruminant animals and should be assimilated in the lower gastrointestinal tract.

Most of the concerted efforts with respect to nutritional improvement in plants have focused on seed proteins. Since maize and other serial crops are not easily transformable, most of the work aimed at modifying the seed protein has involved the stability test of the modified prolamin proteins in transgenic tobacco (Wiulliamson et al., 1988; Ohtani et al., 1990) and Xenopus oocytes (Wallace et al., 1988). The synthesis of glycine-containing zein was also analyzed in transgenic tobacco and petunia seeds (Williamson et al., 1988, Ohtani et al., 1990). Both the normal and the modified proteins were found to have a very short half-life. Efforts to improve the S-amino acid content of legume seed proteins have included the introduction of a 45 bp oligonucleotide containing six methionine codons within the third exon of a β-phaseolin gene. The transformants containing this modified gene show that the phaseolin in methionine was synthesized at the same level as the normal protein, but it was very unstable and was processed quickly (Hoffman et al., 1988). The introduction of extra amino acids into the β-phaseolin protein probably caused a distortion in its secondary structure making it more susceptible to proteolytic degradation. DeClercq eí al. (1990), replaced a segment coding for 23 amino acids between the sixth and seventh cysteine residues of the 2S albumin of Arabidopsis, with three different fragments that encoded for high methionine content. These modified 2S genes of Arabidopsis were transformed into A. thaliana, B. Napus and into tobacco. There was some accumulation of protein in the seeds but not as much as predicted. (Chrispeefs, M., personal communication). The 2S albumin-brazilian gene, which contains up to 19% methionine, and which is targeted by the β-phaseolin gene promoter, has been introduced into tobacco (Guerche et al., 1990), rapeseed (Altenbach et al., 1992) and soybean (Pioneer Seed Co.). recently, Saalbach went to. (1994) synthesized the albumin 2S gene and designed it together with the 35S promoter of CaMV. The gene was introduced into the tobacco and some grains of legume, and showed a high level of expression in the leaves of the plants and the protein was located in the vacuoles. However, the albumin protein of the Brazil nut is extremely allergenic and may not be acceptable for consumption. One method of increasing the sets of particular amino acids in the plant has been to introduce bacterial genes that code for key enzymes in the regulation of the biosynthetic routes of amino acids in plants. A bacterial gene coding for aspartate kinase which is desensitized by the inhibition of feedback by lysine and threonine was fused to the β-phaseolin gene promoter and introduced into the tobacco. The seeds of transgenic tobacco showed increased levels of threonine and free methionine (Karchi et al., 1993, Galili, 1995). Very little effort has been made to improve the quality of the forage crop protein. Schoeder ei al., (1991) introduced the chicken ovalbumin gene (cDNA), directed by the 35S promoter of CaMV, into the alfalfa. The transgenic alfalfa plants, however, showed very little protein accumulation in the leaves (0.005%). The base of said low abundance of this protein in transgenic alfalfa leaves was not determined. Some efforts to obtain alfalfa mutants that have higher levels of free methionine have also been attempted at the University of Wisconsin. It has been continuously reported that cell lines with resistance to inhibition of growth by an amino acid analogue produce higher than normal amounts of the corresponding natural amino acids. Therefore, growth in specific amino acid analogs has been used as a screening tool to select plants that accumulate high levels of a particular amino acid. The overproduction of amino acids is usually due to a relaxed feedback control of an enzyme involved in its production (Malega, 1978). In an attempt to improve the methionine content of alfalfa, alfalfa cells grown in suspension and mutagenized were selected for resistance to inhibition of growth by a methionine analog (Reish et al., 1981). Few cell lines containing high methionine assemblies were obtained, however, the regeneration of these cell lines did not produce plants with high methionine content (Bingham, ET, personal communication).

Zein proteins are a group of alcohol-soluble proteins that are synthesized during the development of the endosperm in corn and constitute 50% of the total protein in mature seeds (Lee et al., 1976). Zein proteins can be divided into four groups, a, ß,? and d, based on their solubility (Larkins et al., 1989). Zein proteins can also be separated by their size into groups. Zein a proteins, which are the most abundant class, are made of zein of 22kD and 19kD; the central region of these proteins consists of repetitive peptides of around 20 amino acid residues (Argos, 1982). Zein β proteins comprise 15 kD zein proteins which contains less proline and glutamine than zein a proteins. The zein proteins? they include the class of 27kD and 16kD and are very rich in proline (25%). Zein d proteins are a relatively minor class consisting of 10 kD zein proteins (Kirihara et al., 1988). All kinds of zein proteins are structurally unique. The repeated regions of the zein proteins a and? probably has a major role in the packaging of protein bodies. Zein proteins, in general, contain extremely low levels of the essential amino acids lysine, tryptophan and to a lesser degree methionine. The zein proteins of 15 kD and 10 kD, however, are distinguished by their extremely high methionine content (10% and 22.5%, respectively) (Giannaza et al., 1977). Zein proteins are synthesized in the rough endoplasmic reticulum (RER) and these are added into protein bodies directly in the RER (Larkins and Hurkman, 1978). Based on the analysis of the zein composition of the protein bodies in development in the maize endosperm, Lending and Larkins (1989), have proposed a descriptive model for the pattern of deposition of zein during the formation of the protein body in the corn endosperm; the zein ß and? are those that initially accumulate within the RER. Subsequently, zein a begin to accumulate in the spaces within the zein ß and?. Over time, the elements of the zein a merge and form a central nucleus while the zein ß and? they form a continuous layer around the periphery of the protein body. In a separate study, Esen and Stetter (1992) showed that zein d occurs through the central region of the protein body. Mutations in corn affect the expression of different zein genes. Changes in the expression of the zein gene in turn have a direct impact on the amino acid composition of the seeds. Plant seeds homozygous for the recessive opaque-2 mutation have increased lysine levels compared to wild-type seed (Misra et al, 1972). The increase in lysine is due to the reduced expression of zein at 22kD (Langridge et al, 1983). The BSSS-53 breeding line has a level greater than 30% methionine in the seed compared to other lines. This increase in methionine content is due to a two-fold increase in the 10 kD zein level (Phillips and McClure 1985). It is known that the proteins that accumulate in the endoplasmic reticulum have the amino acid sequence Lys (his) Asp Glu Leu (K (H) DEL) near its terminal carboxyl end which prevents them from leaving towards Golgi (Pelham, 1990). Zein and other prolamines, however, lack this sequence. It has been shown that an analogue of the 70-kD heat shock protein, BiP which works with a molecular chaperone is involved in the formation of the prolamin protein body formation in the rice endosperm (Li et al., 1993b ). The involvement of BiP in the formation of zein protein bodies is based on the fact that BiP accumulates at high levels in the ER and in the abnormal protein bodies of some of the corn zein regulatory mutants (Boston et al. , 1991; Zhang &Boston, 1992). In general, however, the mechanisms for targeting and assembly of zein in protein bodies are poorly understood and it is not known whether inter- and intramolecular interactions play a key role in the formation of the protein body. Abe et al. (1991), has suggested that the cytoskeleton plays a role in the biogenesis of zein protein bodies. As can be understood from the foregoing, a need remains in the art for forage plants and crops that contain stable protein bodies that are high in S-amino acids. The object of the invention provides a new and advantageous way to improve the quality of the forage of the plants.

BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1B show a pattern of accumulation of a resting state of the 15 kD zein protein at the levels of transgenic L. japonicus (panel A) and Regen SY alfalfa (panel B). The protein soluble in 70% ethanol (EtOH) (equivalent to 50 μg of the fraction soluble in phosphate salt buffer) from the leaves of different independent transformants was subjected to SDS-PAGE, electrophoresis on nitrocellulose and subjected to to immunoblot analysis using the antibody for 15 kD zein. Figure 1 C shows a diagrammatic representation of the construction of the 15 kD zein gene. Figures 2A-2B show a pattern of accumulation of a resting state of the zein protein of 15 kD at the levels of L japonicus (panel A) transgenic and Regen SY alfalfa (panel B). The protein soluble in 70% ethanol (EtOH) (equivalent to 50 μg of the fraction soluble in phosphate salt buffer) from the leaves of different independent transformants was subjected to SDS-PAGE, electrophoresis on nitrocellulose and subjected to to immunoblot analysis using the antibody for 10 kD zein. Figure 2C shows a diagrammatic representation of the zein construction of 10 kD. Figures 3A-3C show a pattern of accumulation in the resting state of the 10 kD zein in transgenic tobacco.

Figure 3A is a diagrammatic representation of pM10Z. The construct consists of the CaMV 35S promoter fused to the BglII site of a 470 bp BglII-Xhol fragment containing the region coding for the 10 kD zein gene. This was followed by the NOS 3 'terminator of pMON316 (Rogers et al., 1987). Figure 3B is an analysis of the different independent transformants for 10 kD zein accumulation. The soluble EtOH protein extracted from the leaves (equivalent to 50 μg of soluble protein in PBS) was subjected to SDS PAGE, transferred to nitrocellulose and then by immunoblot analysis using the 10 kD zein antibodies. The lines marked 1 to 7 (under transformants), contain samples from the leaves of different transformants while lines 1 and 2 (under control), are leaf samples from non-transformed tobacco plants. Figure 3C is an analysis of different plant organs (transformant 6) for 10 kD zein accumulation. The soluble fractions in EtOH (equivalent to 50 μg of the soluble protein in PBS) from several indicated plant parts, together with 2 μg of corn seed protein were subjected to SDS PAGE followed by Western analysis using the antibodies for the zein protein of 10 kD. NT and Mad are established for non-transformed seeds and mature seeds, respectively. Molecular weight standards were included in the gels and the size of two of the relevant markers is indicated.

Figure 4 shows the fate of the 10 kD zein in germination seeds / shoots of transgenic tobacco. The seeds of a 10 kD zein plant were sterilized and allowed to germinate under sterile conditions and at a defined time as indicated in the figure, the seeds / shoots were harvested and the fraction soluble in EtOH was extracted. The EtOH soluble fraction equivalent to 50 μg of PBS soluble protein was subjected to SDS PAGE followed by 10 kD analysis using the 10 kD zein antibody. The position of the 10 kD zein on the gel is indicated, and DDG is established for days after germination. Figures 5A-5D are the ultrastructural and immuno-gold location of the 10 kD zein in the transgenic tobacco leaves. Figure 5A are the regions of two mesophilic cells showing several 10 kD zein protein bodies (indicated by arrow heads) in a 10 kD zein transformant. Figure 5B is a major amplification of zein protein bodies of 10 kD (indicated by arrowheads). Figure 5C is the structure of a 15 kD zein protein body in the mesophilic cells of a 15 kD zein transformant. Figure 5D is an immunolocalization of the 10 kD zein in the leaf cells of a 10 kD zein transformant with the 5 nm gold particles (indicated by arrowheads).

Figures 6A-6D are a comparison of zein levels of 10 kD and 15 kD in the leaves and seeds of zein plants of 10 kD, 15 kD and 10 kD / 15 kD. Figure 6A is a fraction soluble in EtOH from the leaves (equivalent to 10 μg of soluble protein in PBS) and seeds (equivalent to 50 μg of soluble protein in PBS) of the 10 kD zein and 10 kD / 15 kD of plants were subjected to SDS PAGE followed by Western analysis using the 10 kD zein antibodies. Figure 6B is a quantization of the band intensity from Figure 6A using the Bio Image Intelligent Quantifier. Figure 6C is a fraction soluble in EtOH from the leaves and seeds (equivalent to 50 μg of soluble protein in PBS) of the zein of 10 kD and 10 kD / 15 kD of plants that were subjected to SDS PAGE followed by analysis of Western using antibodies to 15 kD zein. Figure 6D is a quantization of the band intensity from Figure 6C using the Bio Image Intelligent Quantifier. Figure 7A-7D is a subcellular localization of the 10 kD zein and 15 kD in the leaves of zein plants of 10 kD / 15 kD. Figure 7A are conventionally stained and leaf-stained sections from plants containing 10 kD zein. The arrow heads point to the protein bodies formed in the cytoplasm.

Figure 7B is an immunolocalization of the 10 kD zein protein using 10 kD anti-zein antibody diluted 1: 50 followed by gold-conjugated goat anti-mouse IgG of 10 kD diameter. Figure 7C is a coinmunolocalization of the 10 kD and 15 kD zeins using the 10 kD anti-zein mouse antibody and the 15 kD anti-zein rabbit antibody followed by gold-conjugated goat anti-mouse IgG in diameter of 10 nm and goat anti-rabbit IgG conjugated with gold of nm. Figure 7D is a major amplification of a region showing double labeling from panel C. Arrowheads point to 10 nm gold particles while arrows point to 5 nm gold particles. Figure 8 is an analysis of the pattern of BiP accumulation in tobacco transformants for zein d-, β-, and d- / β-. Soluble extract (100 μg of protein) was taken from plant leaves of a control (NT), in saline at pH regulated with phosphates, zein d-, zein β- and zein d- / β- were submitted to SDS PAGE followed by Western blot using an antibody generated for BiP from corn. A positive control line containing purified BiP (1 μg) was included in the gel. The lower panel represents the results of band quantization using the I ntelligent Quantifier. Figure 9A represents SEQ ID NO: 5. Figure 9B represents SEQ ID NO: 6.

Figure 10 is a generalization of the construction of plasmid Z10 / OCI which was transformed into tobacco. Figures 11A and 11B are Western blot for samples extracted from the transgenic tobacco plants following a positive immunoreaction with both antibodies Z10 (14A) and OCI (14B).

BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 represents the PA primer which was used to amplify a Z10 fragment from the prep (993) Z10 pMON 316 / DH5d plasmid. SEQ ID NO: 2. Represents a PB primer which was used to amplify a Z10 fragment from the prep (993) Z10 pMON 316 / DH5cc plasmid. SEQ ID NO: 3 represents the PC primer which was used to amplify an OC-1 fragment from the plasmid (809) OclpSP73 / DH5a. SEQ ID NO: 4 represents the PD primer which was used to amplify an OC-1 fragment from the plasmid (809) OclpSP73 / DH5a. SEQ ID NO: 5 represents a fragment Z10 as illustrated in Figure 9A. SEQ ID NO: 6 represents an OC-1 fragment as illustrated in Figure 9B.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to the coexpression of proteins that results in a greater accumulation in a cell of one of the proteins when compared to the levels of the same protein when expressed alone. The proteins are expressed in prokaryotic or eukaryotic cells. One or both of these proteins accumulate in the cell at higher amounts when they are expressed together than when the proteins are expressed alone in a cell. Standard, routine genetic engineering techniques were employed to (i) isolate the appropriate DNA encoding the desired proteins including the regulatory sequences, (ii) transform a target cell and, in the case of plants, generate a transgenic plant. The transgenic cells decreased under conditions sufficient to result in the accumulation of one or both proteins at high levels. The proteins accumulated in the cell exhibited a greater increase in stability and resistance to degradation. The object of the invention also relates to plants and plant tissues that are capable of expressing high levels of stable proteins which are located as protein bodies within plant cells. Specifically, plants coexpressing zein proteins of 15 kD and 10 kD are specifically exemplified. Transformed plants coexpress the 15 kD and 10 kD zein proteins and are useful for providing forage crops that contain high levels of sulfur-containing amino acids, such as methionine, in the diet of animals that normally eat such crops, it is also contemplated by the objective of the present invention plants or plant tissues containing novel heterotypic protein bodies raised in one or more essential amino acids (eg, arginine, histidine, leucine, isoleucine , lysine, phenylalanine, threonine, tryptophan, tyrosine and valine). Protein bodies that result in the improved accumulation of protein normally unstable in plant tissues are also contemplated by the present invention. The present invention also concerns plants or plant tissues comprising rumin-stable protein bodies which contain another proteinaceous material, for example, an antigenic determinant capable of producing an immune response, a proteinaceous drug, pesticide or antimicrobial peptide. The heterologous proteins can be expressed in plants transformed with the stored proteins of the present invention which can act as a "carrier protein", where the proteins bind and accumulate in the cells as a protein body. In an alternative embodiment, a rumin-stable protein body is provided in a plant or plant tissue as a fusion protein expressed in the cell comprising a zein protein and a heterologous protein or peptide.

DETAILED DESCRIPTION OF THE INVENTION The present invention concerns plants and plant tissues that are capable of expressing high levels of storage stable proteins which are located as protein bodies within the plant cell. Plants contemplated within the scope of the invention include forage crop plants, including, for example, alfalfa, clover, corn silage, sorghum and other leguminous crops, transformed to express the proteins of the invention. Plants for human consumption which have been transformed to express proteins that improve the protein quality of the plant for better nutrition are also contemplated within the scope of the present invention. Plants expressing proteins containing high levels of S-amino acids, such as methionine and cysteine, are specifically exemplified. In a preferred embodiment, a zein protein is expressed in the plant or plant tissue. More preferably, the expressed zein protein is the zein protein of 15 kD or 10 kD. More preferably, both the 15 kD and 10 kD zein proteins are coexpressed in the plant or plant tissue. Plants that have genotypes that carry the 10 kD and 15 kD zein genes cross sexually to create hybrids that carry both constructions. Zein proteins expressed in transformed plants are resistant to degradation by rumin and, therefore, are useful for providing nutritionally important amino acids that can be digested in the stomach and absorbed by the ruminant animal due to the ability of proteins to "avoid" the rumen. Also contemplated by the present invention are plants or plant tissue comprising rumin-stable protein bodies which contain another proteinaceous material, for example, an antigenic determinant capable of producing an immune response, a proteinaceous drug, pesticide or antimicrobial peptide. The heterologous and endogenous proteins and the synthetic peptides having essential amino acids can be expressed in plants transformed with the stored proteins of the objective of the invention which can act as a "carrier protein", where the proteins bind and accumulate in the cell as a protein body. In an alternative embodiment, a rumin-stable protein body is expressed in a plant or plant tissue as a fusion protein comprising a zein protein and a heterologous protein or peptide. The fusion protein can be designated to produce the heterologous protein portion by cleavage with a selected enzyme or under certain physiological conditions. Preferably, zein protein is expressed as part of the fusion protein in the 15 kD or 10 kD zein protein. More preferably, both 15 kD and 10 kD zein proteins are coexpressed in the plant or plant tissue comprising the fusion protein. The present invention also relates to a stable protein body in the rumen. The protein bodies of the invention stable in the rumen are not subjected to digestion by ruminal bacteria in the rumen of a animal but can be digested by proteolytic enzymes of an animal's stomach. The stable protein body of the present invention can be prepared in the rumen containing heterologous proteinaceous material in addition to the stable protein in the rumen. For example, an antigenic determinant capable of producing an immune response, a proteinaceous drug, pesticide or antimicrobial peptide. The stable protein bodies in the rumen can be isolated from plants that have been transformed with polynucleotide molecules that encode the desired rumin-stable proteins. Plant cells expressing the polynucleotide molecules that encode the desired stable rumen proteins can be easily selected and regenerated in plant or plant tissues using standard techniques known in the art. In one embodiment of the present invention, a storage protein gene is coexpressed in a cell with a second protein gene where the second protein accumulates in the cell at a level that is higher than when the second gene is expressed only in the cell, that is, in the absence of the storage protein gene. In a preferred embodiment, the storage protein gene is a gene from a seed storage protein, the target cell is a plant cell, and the secondary protein gene can be any gene that encodes a desired protein. The regulatory sequences employed with the protein genes (promoters, initiation sequences, termination sequences, polyadenylation sequences, enhancers, etc.) are easily chosen by an expert in the art. technique based on a variety of factors, such as, for example, i) the specific protein genes employed, ii) the target cell to be transformed, iii) the plant tissue where expression / accumulation is desired, iv) the particular plant (monocotyledonous, dicotyledonous, etc.) species to be transformed, etc. For example, when a plant cell is the target cell then a constitutive promoter can be chosen (eg, 35S CaMV ubiquitin etc.) or a specific tissue promoter can be employed which will express high levels in specific tissues (seeds, green tissues, etc). In another embodiment of the present invention, a 15 kD zein protein gene is employed with a gene of a second protein in a plant cell that results in the accumulation of the second protein in the plant cell. The genes can be contained in a single expression cassette and inserted into the plant genome using standard transformation and regeneration techniques. Alternatively, the protein genes can be inserted into a plant cell genome independently in separate expression cassettes and the transgenic plants can be regenerated therefrom. Also, protein genes can be inserted into separate plant cells and regenerated into fertile, transgenic plants each containing one of the protein genes. These transgenic plants can then be cross-fertilized using standard plant-crossing techniques to result in a cross that contains both genes of the 15 kD zein protein and the secondary protein gene where the second protein accumulates in one or more plant tissues .

In a preferred embodiment of the present invention, alfalfa, tobacco or other plant cells are transformed with a gene of the 15 kD zein protein and a 10 kD zein protein (secondary protein) where both genes are directed by a promoter constitutive. The fertile, transgenic plants that contain both gene constructions are regenerated. The plants of the progeny are grown and the 10 kD zein protein accumulates in the green tissue at the level of 5 to 10 times or more when compared to the accumulation level of the 10 kD protein when expressed alone. Additionally, the present invention encompasses novel protein bodies formed as a result of expressing a storage protein gene and a second protein gene in green plant tissues. In a modality, the novel protein body comprises a 15 kD zein protein and a second protein. The protein body is typically located in leaf tissues. In a preferred embodiment, the novel protein body is located in the leaf tissues and comprises a 15 kD zein protein and a 10 kD zein protein. The present invention also relates to a method for increasing the forage quality of a plant comprising transforming a plant or plant tissue with a polynucleotide molecule encoding a storage protein of the present invention. Methods for transforming plants and selecting for the expression of the transformed genotype are known in the art. In a preferred embodiment of the method, the polynucleotide encodes a zein protein which is expressed in the plant or Plant tissue. More preferably, the expressed zein protein is the zein protein of 15 kD or 10 kD more preferably, both zein proteins of 15 kD and 10 kD are coexpressed in the transformed plant or plant tissue. Transgenic plants can be easily prepared from transformed plants or plant tissue using standard techniques known in the art. The present invention also relates to methods for increasing the stability and storage of a heterologous protein in a plant or plant tissue. Heteroteric proteins can be expressed in plants transformed with the storage proteins of the objective of the invention, they can act as a "carrier protein" in which proteins bind and accumulate in a cell as a protein body. In an alternative embodiment of the present method, a plant is transformed with a polynucleotide molecule encoding a fusion protein comprising a storage protein of the present invention operatively linked to a heterologous protein or peptide. The zein proteins of the present invention not only include those proteins that have the same amino acid sequence found in nature, including allelic variants, but also include those variants of zein proteins that have conservative amino acid substitutions, additions and deletions in the protein sequence, as long as the variant protein retains substantially the same relevant biological activity as the native zein protein. Technicians Qualified, who have the benefit of the teachings described herein, can easily determine whether a variant protein retains substantially the same biological activity as the unmodified protein.

Materials and methods Recombinant DNA techniques Standard procedures were used for DNA manipulations (Maniatis et al., 1982). Plasmid pMZEUOk containing the 10 kD zein cDNA isolated from a corn endosperm cDNA library (Kirihara et al., 1988) was a gift from Dr. J. Messing. A 470 bp EcoR1 / Xba1 fragment containing the entire coding region was removed from EcoR1 and Xbal and cloned into the pSP73 sites. The stop codon for the 10 kD zein is contained within the Xbal site. The 10 kD zein gene was removed as a BglII / Xhol fragment and inserted into the BglII and Xhol sites of the pMON316 polylinker (Rogers et al., 1987). The translation terminator that follows the stop codon of the 10 kD zein is the NOS terminator. The resulting plasmid was designated pM10z (Fig. 1A). Plasmid pMEZ is as described by Bagga et al. (nineteen ninety five).

Transformation and plant regeneration Plasmid pM10Z was mobilized from E. coli DH5a within the pTiT37ASE receptor strain of Agrobacterium tumefaciens by triparental mating (Rogers et al., 1987). The Nicotiana tabacum cv Xanthi it was transformed by the leaf disc method (Horsch et al., 1987). The transformants were sectioned and regenerated in MS medium containing 100 μg kanamycin / ml the shoots appeared within 4-6 weeks of inoculation. The shoots generated roots in the same medium without hormones and were transferred to soil. To obtain the 10 kD / zein 15 kD zein plants containing both zein genes driven by the CaMV 35S promoter, the tobacco transformants containing either the pMlOZ or pMEZ were crossed and the seeds obtained were germinated in medium containing 200 μg / ml kanamycin. The Westem analysis was carried out with protein extracts from the shoots using both antibodies for 15 kD zein and for 10 kD zein. Plants that express both zein genes (10 kD / 15 kD zein plants) and parental plants (10 kD zein and 15 kD zein plants) were used in all comparative analyzes Zein extraction v Westem analysis Plant tissues they were grown and extracted in saline at pH regulated with phosphates (PBS) and centrifuged. Supernatants were used for protein determination using the Bradford assay (BIORAD). The concentrate from the centrifugation was incubated in 70% ethanol containing 1% mercaptoethanol at 65 ° C for 30 minutes to extract zein proteins. For Western analyzes the extractable fraction with EtOH equivalent to a known amount of soluble protein extract in PBS underwent SDS-PAGE (Laemmli, 1970), followed by electroblot on nitrocellulose membrane. The membrane was blocked for 1 to 2 hours with 1% BSA in Tris saline pH buffer containing 0.05% Tween 20 (TBST), followed by overnight incubation in the same solution containing the appropriate antibodies. Monoclonal antibodies to 10 kD zein were supplied by DEKALB Genetics Corporation, polyclonal 10 kD zein antibodies were supplied by Dr. J. Messing and polyclonal 15 kD zein antibodies were supplied by Dr. B. Larkins. The protein bands that reacted with the antibodies became visible by using a secondary antibody bound to alkaline phosphatase (goat antibody or rabbit IgG in the case of the polyclonal antibody or IgG in the case of the monoclonal antibody and the substrates, nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate according to the manufacturer's instructions (Promega). Both polyclonal and monoclonal antibodies to zein 10 of kD gave similar results in Western analysis for 10 kD zein. and immunolocalization of the 10 kD zein plants but the polyclonal antibodies showed some degree of cross-reactivity with 15 kD zein and since this occurred in all the comparative analyzes involving the crossed parental progeny, only the monoclonal antibodies were used.

BiP Analysis Phosphate saline pH regulator (PBS) soluble extracts from the leaves of the different plants were subjected to SDS PAGE followed by Western analysis using the polyclonal antibodies to corn BiP (provided by Dr. R. Boston) using the procedure described in zein extraction and in the Western analysis of the aforementioned section.

Marking of in vivo leaf discs Four leaf discs (7 mm in diameters) from young leaves in expansion were incubated in 120 μl of labeling mixture (1 mM potassium phosphate pH 6, 1% sucrose and 50 μg of chloramphenicol) containing 120 μCi of 35S methionine (specific activity of 1047 Ci / mMol), for two hours in the light. The discs were washed well with the incubation buffer and the samples were placed in cold PBS. The samples were extracted in PBS, the protein was estimated in the fraction soluble in PBS and the zein were recovered from the concentrate as described by Bagga et al. (nineteen ninety five). Proteins were analyzed by SDS PAGE followed by electroblot on PVDF membranes (Millipore). The membranes were sprayed with an enhancer (NEN), and dried and exposed to an X-ray film.

Electron microscopy Small pieces of leaf and seed tissue were fixed in 2.5% glutaraldehyde in pH buffer of 0.07 M sodium cacodylate for 2 h and then post-fixed in 1% aqueous osmium tetraoxide for 1 hr. The samples were dehydrated in EtOH and imbibed in Spurr resin at 70 ° C. The silver sections on copper grids were stained in uranyl acetate and in Reynold lead citrate. The gratings were examined under a Hitachi H7000 transmission electron microscope.

Immunoelectron microscopy Small pieces of leaf and seed tissue were fixed for 2 h in 4% paraformaldehyde and 0.6% glutaraldehyde on ice in 0.33 M potassium phosphate / pH buffer (pH 7.3) containing 0.1 M sucrose. The tissue was washed with three changes of pH regulator containing 7% sucrose and remained at the last change overnight at 4 ° C. Two different protocols were used in this stage: the fixed tissue was dehydrated in EtOH, infiltrated with Lowicryl at -10 ° C and the resin was polymerized under UV light at -10 ° C for 24 hr and then at room temperature for 24 hr . In the second protocol the tissue was dehydrated in EtOH and imbibed either in Spurr resin or in LR White resin and polymerized at 50 ° C. The remaining steps were all made at room temperature, (the different resins were obtained from Electron Microscopy Sciences, Ft. Washington, PA). The silver sections on the nickel grids were initially incubated in a mM Tris-saline blocking solution containing 1% BSA (Sigma), 0.05% Tween 20 (Sigma), and 15 mM NaCl. This pH regulator mixture was used in all the remaining steps. For the immunomarked seed sections, normal 5% to 20% serum was added to the blocking solution from the animal source of the antibody in order to reduce non-specific staining.

Immunolabelled with antibodies to 10 kD zein Segment gratings from the 10 kD / 15 kD zein crosses were drained and incubated with the monoclonal antibody to dilute the zein from 10 kD to 1: 50 in buffer. pH for 45 min at 4 h. The controls were incubated in non-immune mouse IgG. These were then washed in the pH regulator and placed in gold-labeled goat anti-mouse IgG with a diameter of 10 nm (Sigma) diluted 1: 50 in pH buffer for 45 min. In the case of sections from the Zein 10 kD plant, the gratings were incubated with the 10 kD anti-zein rabbit polyclonal antibody diluted 1: 1000 in buffer for 60 min. These were then washed and incubated in a solution of gold-conjugated anti-rabbit IgG with a diameter of 5 nM, diluted at 1:50 for 60 min. Since the polyclonal antibody for 10 kD zein cross-reacts with 15 kD zein, in the case of the 10 kD / 15 kD zein crossing, the grids were incubated with the monoclonal antibody for 10 kD zein followed by IgG anti-mouse conjugate with gold with a diameter of 10 nm. The grids were washed in Tris-saline containing Tween and 1% BSA followed by double distilled water. The grids were examined either without staining or lightly stained in uranyl acetate and lead citrate.

Double labeled with 10 kD and 15 kD zein antibodies. The grids were incubated in 15 kP anti-zein rabbit antibody diluted 1: 100 for 45 to 60 min. The gratings were washed and incubated in goat anti-rabbit IgG conjugated with gold with a diameter of 5 nm, diluted at 1:50 for 45-60 min. The gratings were extensively rinsed in the pH regulator and then incubated with 10 kP mouse anti-zein antibody diluted 1: 50 in pH buffer for 45 to 60 min. These were then washed in pH regulator followed by distilled water and incubated in goat anti-mouse IgG conjugated with gold with a diameter of 10 nm diluted to 1: 50 in pH regulator for 45 min. The gratings were washed in Tris-saline containing Tween 20 and 1% BSA, followed by double distilled water. The grids were then examined either unstained or slightly post-stained in uranyl acetate and lead citrate. Following are the examples that exemplify certain embodiments of the present invention, these examples are illustrative and should not be construed as limiting the present invention in any way.

EXAMPLE 1 Accumulation of 15 kD zein and 10 kD in vegetative tissues of L. iaponicus and alfalfa The coding sequences of 15 kD and 10 kD zein under the control of a 35S CaMV promoter were introduced into L. japonicus and alfalfa (Regen SY). As shown in figure 1 and 2, both zein proteins showed high levels of accumulation in the vegetative tissues of all the transformants (1 to 2% of the total protein). In contrast, the ß-phaseolin gene directed by the 35S promoter of CaMV, which showed constitutive accumulation of the transcript, but accumulation of the specific protein only in the seed. The results suggest that zein are stable in vegetative tissues while β-phaseolin, which is a vacuolar protein, is not. The stability of zein proteins can be attributed to the intrinsic properties of the protein or its subcellular location.

EXAMPLE 2 Accumulation of zein protein in vegetative tissues of tobacco transformants Tobacco plants were transformed with the construction of the pM10Z gene, which consisted of the 10 kD zein gene driven by the 35S promoter of CaMV (Figure 3A). The leaves from the transformants independently selected at random 7 were subjected to Western analysis to measure the accumulation of zein 10 of kD (Figure 3B). all the transformants showed two immunoreactive proteins, one of which co-migrated with the 10 kD zein of the corn seeds (position indicated by the arrow) and the other as a 29 kD band. The latter did not co-migrate with the high molecular weight immunoreactive band seen in the corn seeds (figure 3E). The 29 kD immunoreactive band obtained from the leaves of the transgenic plants probably represents an aggregate of the 20 kD zein and another endogenous leaf protein. Similarly, the band of the 10 kD immunoreactive protein may represent an aggregate of the 10 kD zein with an endogenous corn protein. The accumulation of the immunoreactive bands of 10 kD and 29 kD differ by about 10 times between the different transformants. Four transformants showed almost negligible levels of both immunoreactive bands. The differences in the accumulation amount of the 10 kD zein in the different transformants can probably be attributed to the position effect or to the copy number of the integrated gene. To determine the accumulation of the zein protein of 10 kD between the different plant parts, equal amounts of the protein extract (equivalent to 50 μg of the soluble protein in PBS) from the leaf, stem, root and seeds of 6 transformants were subjected to Western analysis together with the corn seed extract (equivalent of 2 μg of the fraction soluble in PBS) (Figure 3C). The leaves showed the highest level of accumulation of kD zein followed by the stem. The seeds are about 10 times lower than the 10 kD zein compared to the leaves, as was the case with the 15 kD zein in the transgenic tobacco (Bagga et al., 1995). Taken together, the results of the inventors suggest that 10 kD zein accumulates to significant levels in all organs of transgenic tobacco, as the inventors have previously reported for 15 kD zein (Bagga et al., 1995).

EXAMPLE 3 Stability of zein in seeds in tobacco germination It was previously shown that 15 kD zein in transgenic tobacco seeds is not digested proteolytically during germination (Hoffman et al., 1987). To determine if zein of 10 kD behaves in a similar way, the seeds of the zein plant of 10 kD were allowed to germinate for different periods of time (0 to 10 days), the seeds / shoots harvested and their soluble proteins in ethanol they were extracted and analyzed by Western analysis using the 10 kD zein antibodies (Figure 4). The zein level of 10 kD remained essentially unchanged during the first four days of germination, after which the level showed a dramatic increase in concentration. A slight drop in zein level of 10 kD was observed between day 0 and 1 after germination (DGA- for its acronym in English), but after this the level was kept up to 4 DAG. The decrease was observed with the 3 DAG sample that was not consistent within the different experiments and was attributed to a lower load of the protein extract in that line. The 4 DAG time point coincided with the appearance of the first set of green leaves and can be related to the activation of the CaMV 35S promoter in the development of the shoot. The immunoreactive band of 10 kD zein also appeared barely diffuse in the SDS gels of proteins from the shoot stage, as observed with the leaf sample, suggesting that the leaves have some material in the soluble protein fraction in the sample. ethanol that interferes with the mobility of 10 kD zein. These results suggest that 10 kD zein does not degrade during the germination of tobacco seeds.

EXAMPLE 4 Immunolocalization of 15 kD and 10 kD zein proteins in novel protein bodies in transgenic plants To understand the basis of the stability of the 15 kD and 10 kD zein proteins in the leaves of transgenic plants, the location of these proteins at a subcellular level was examined. The leaves of the transformants, together with the control plants, were subjected to ultrastructural analysis followed by immunocytochemistry (using antibodies for zein of 15 kD and 10 kD). The 15 kD zein protein appears to be uniformly distributed in the unique rosette-shaped protein bodies bordering the RER (Bagga et al., 1995, appendix). These protein bodies were also observed in L. japonicus and alfalfa that expressed this zein gene of 15 kD. Electron microscopy was carried out on leaf tissue from transgenic tobacco expressing 10 kD zein to check the presence of any protein body. As seen in Figure 5A and 5B, very different protein bodies from the Zein protein bodies of 15 kD (Figure 5C) were observed in the leaves of the 10 kD zein plants. The protein bodies in zein plants of 10 kP appeared very osmofilic, the osmophilia being concentrated along the circumference of the bodies. In some cross sections, osmophilia appears as radiated in discrete spots from a central axis (Figure 5B). The protein bodies seen in the 15 kP zein plants did not exhibit this extreme osmophilia (Figure 5C). In some of the leaf sections, zein protein bodies of 10 kP were found to be associated with ER but in most cases due to the large size of the bodies the RE membranes appeared separated. Based on the immunolocalization, it was found that the 10 kP zein is homogeneously distributed in these unique protein bodies, suggesting that these result from the 10 kP zein assembly (Figure 5D).nR.

EXAMPLE 5 Simultaneous Accumulation of 15 kD and 10 kD Zein in Transformants Expressing Both Genes Sexual crosses were made between tobacco transformants expressing either 15 kD or 10 kD zein in order to determine whether these proteins interact with each other and affect the accumulation of protein in the plant cell. The seeds from these crosses were germinated on 200 μg / ml kanamycin and the shoots expressing both genes were selected based on positive PCR using both primers specific for the zein gene of 15 kD and 10 kD. Protein extracts from the leaves of two independent plants expressing both genes and their respective parent were analyzed by immunoblot using both zein 15 kD and 10 kD antibodies. The accumulation of the 15 kD zein protein appeared similar in both the parental plants and the cross plants of zein of 10 kD / 15 kD, while the accumulation of zein of 10 kD was many times higher in the crossed plants of zein 10 kD / 15 kP compared to the corresponding parent of zein of 10 kP. To determine the exact level of zein increment of 10 kP due to co-expression with zein of 15 kP, equal amounts of the protein extracts were analyzed from the leaves and seeds of one of the 10 kP zein plants, and a of the zein plants of 15 kP and the zein cross of kD / 15 kP corresponding by Western analysis followed by quantification of the immunoreactive bands using an Intelligent Quantifier (Biolmage) (Figure 6). This quantitative analysis showed that the zein levels of 15 kP in both seeds and leaves of zein plants of 10 kP / 15 kP were essentially similar to those of the parental zein plant of 15 kP (Figure 6C, 6P). However, the zein amount of 10 kP was 4 to 5 times higher in the leaves and seeds of the 10 kP / 15 kP zein cross compared to the parent plant (Figure 6A, 6B). The zein level of 15 kP and 10 kP in the cross or parental lines could not be directly compared to each other due to differences in the antigenicity of the two antibodies and the concentration of antibodies used for the development of the blots. These results also confirm previous studies that indicate leaves accumulate more zein proteins than seeds. Note that in the case of the 10 kP zein protein (Figure 6A, 6B), the amount of protein loaded in the gel is 10 μg for a leaf sample and 50 μg for a seed sample. EXAMPLE 6 10 kD zein protein located in the same protein bodies derived from ER and the 15 kD zein in the plant that coexpresses the zein genes of 10 k and 15 kD The increased zein accumulation of 10 kP at the zein cross of 10 kP / 15 kP compared to the zein 10 kP plant alone is suggestive of some kind of interaction between zein of 10 kP and 15 kP. Electron microscopy and the immunocytochemistry of leaf tissue from a zein plant of 10 kP / 15 kP revealed only the protein bodies derived from ERs typical of zein of 15 kP (Figure 7A). The inventors did not observe any protein body similar to that detected in zein plants of 10 kP. However, immunoblotting of 10 kP zein showed that the protein was exclusively confined to the 15 kP zein protein body (Figure 7B). To determine if both zein of 10 kP and zein of 15 kP were located in the zein protein bodies of 15 kP, the inventors carried out double labeling by immunocytochemistry on leaf sections and seeds of the zein plant of 10 kP / 15 kP using monoclonal antibodies to 10 kP zein and polyclonal antibodies to 15 kP zein. Both 10 kP zein (represented by the larger 10 nm gold particles) and 15 kP zein (represented by the smallest 5 nm gold particles) were immunolocalized in the same 15 kP zein protein bodies (FIG. 7C, P). Therefore, the 15 kP and 10 kP zeins have been shown to interact with each other and their interaction stabilizes the two proteins.

EXAMPLE 7 Introduction of multiple copies of zein genes of 15 kP and 10 kP in alfalfa Multiple copies of the 15 kP and 10 kP genes can be introduced into plants as a method to increase the content of total leaf proteins containing S-amino acids. In addition to these constructs using the 35S promoter, the gene constructs managed by the SSU promoter and the manopin synthase promoter can be used to avoid any potential cosuppression problems. Isogenic populations that carry either the zein construction of 10 kP, of 15 kP, or both of 10 kP and 15 kP can develop sexually. The trends in the effects of zein doses on the expression of 10 kP in alfalfa, interactions between the constructions, and the influence of each construction on the development of the plant, quality of the forage and production can be determined based on general comparisons of the average number of zein constructions expected within a population. Genetically defined genotypes for three populations carrying one to four copies of either the 10 kP or 15 kP construct or one to two copies of both 10 kP and 15 kP constructs can also be examined. The most direct method for sexually increasing the zein copy number among regenerated somatoclones can be individual self-pollination for regeneration or for cross-linking. The regenerated intercrossed, without However, they are genetically equivalent to the plants themselves in this case. To minimize the effects that confuse depression by crossing, a series of hybrid populations can be developed to examine the influence of zein construction on forage production and the quality of alfalfa.

EXAMPLE 8 Protein digestion by ruminants In ruminant animals, the food is first processed by microorganisms that inhabit the first stomach (rumen) of the animal. The cellulose in the plant material is digested by the microorganisms that inhabit these animals that do not produce cellulase by themselves. These microorganisms, however, are also capable of breaking down plant proteins and of using the amino acids released for their own growth. These ruminant microbes are subsequently digested as they pass through the rest of the animal's digestive tract, thereby providing an important source of protein and other nutrients. However, a large part of these proteins are deaminated during the excretion of nitrogen in the urine. This not only reduces the nutritional quality of the feed material, but also results in an excess of nitrogen pollution in the environment. The problem is exacerbated when ruminant animals are fed diets too high in protein in an effort to maximize milk production. The supplements of amino acids (eg, methionine olefin) are also subject to substantial degradation within the rumen and, therefore, several amino acid supplements protected against rumen have been developed. Therefore, it would be extremely desirable to feed with intact proteins which are the most resistant to microbial degradation. Therefore, it is more important to determine if the zein proteins can be digested by the rumen bacteria and to determine if the zein proteins are digestible by the enzymes in the stomach of ruminant animals. The plant tissue was processed using mortar and pestle. The samples were placed inside PACRON polyester bags (pore size 52 μm). Approximately 3 g of each sample was maintained for comparison purposes and the remaining amount was incubated within the rumen of a Holstein cow with a cannula for a period of 12 hours. The bags were then removed from the rumen, washed and dried in an oven overnight at 60 ° C. The zein proteins of 15 kP and zein of 10 kP were monitored immunologically (Western blot) and by staining procedures. Ribulose bisphosphate carboxylase which is highly degradable by ruminal bacteria (Nugent et al., 1983) was monitored and used as an internal control. Very low levels of zein degradation were observed, while ribulose bisphosphate carboxylase was completely degraded after treatment. The levels of zein in the treated and untreated samples were determined as comparable. It was also determined that the Zein protein is digested by the stomach enzymes of ruminant animals.

EXAMPLE 9 Induction of BiP in transgenic plants expressing zein genes Since BiP, an endogenous plant protein, has been implicated to have a role in the biogenesis of the prolamin protein body (Li et al., 1993a; Zhang and Boston, 1991), it was felt that BiP could have a role in the formation of zein protein bodies in transgenic tobacco plants. To test whether BiP is increased in zein protein bodies made by plants, protein samples from leaves of zein-d, zein-ß and zein-d- / ß plants were subjected to quantitative Western analysis using a BiP antibody. of corn (Zhang and Boston, 1992). The sample soluble in PBS (100 μg) from a control plant and three transgenic plants (plants zein d- / ß-, and d- / ß-) at the same stage of development, all growing under the same conditions, together with 1 μg of purified BiP from corn, they were subjected to SOS PAGE followed by Western analysis (figure 8, upper panel). The immunoreactive bands were subsequently analyzed using Intelligent Quantifier. The lower panel in Figure 8 is the graphic representation of the relative intensity of the immunoreactive bands. The three transgenic plants showed a significantly higher level of BiP accumulation when compared to the control; BiP levels were more or less similar in the three transformants. Therefore, the synthesis of zein proteins in transgenic plants induces the synthesis or stable accumulation of BiP.

EXAMPLE 10 Expression and stabilization of proteins for the purpose of pest control in plants A chimeric gene (Z10 / OCT) consisting of a 10 kO zein gene (Z10) fused in reading frame in front of a protease inhibitor gene orizacistatin 1 (OCI) was designed to improve the stability and effectiveness of OCI in the transgenic plants for use in the control of plant pests. The chimeric gene includes both the coding regions and the 10 kP zein signal peptide region and the OCI coding region, and is controlled by the 35S constitutive promoter of CaMV. An anticipated protein product of approximately 26kP was expressed in the plants transformed with the chimeric gene, as demonstrated in Western blot assayed with both OCI and 10 kP zein antibodies. The inventors have previously shown that plants transformed with 10 kP zein, alone, express an expected protein product tested with zein antibodies, while plants transformed with OCI, alone, do not show detectable expression when tested with OCI antibodies. This observation shows that the Z10 / OCI chimeric gene results in a increased stabilization of OCI, and further demonstrates the considerable stabilization of the protein product by virtue of the discovery that zein has a tendency to localize in closed protein bodies. Others have reported the effectiveness of the protease inhibitor against several plant pests, including the Colorado potato beetle and plant parasitic nematodes.

EXAMPLE 11 Construction of transgenic plants expressing the zein fusion protein of 10 kP / OCI The fusion 10 kDsplO kDzeinOC- | (Z10 / OCI) was constructed using the overlay extension for processing (SOE) technique (Horton, R.M. et al., 1989). This technique uses the polymerase chain reaction (PCR) to process two separate fragments together. PCR was initially used to amplify the Z10 fragment from the plasmid (993) Z10pMON316 / DH5a using the primers: SEQ ID NO: 1 PA (CTACAAGATCTGATATCATCGATG) and SEQ ID NO: 2 PB (GACATGGATCCGAATGCAGCAC) to produce a product of about 500 base pairs (bp) in length. The OC-1 fragment was amplified from the plasmid (809) OclpSP73 / DH5a using the primers: SEQ ID NO: 3 PC (GTGCTGCATTCGGATCCATGTCG) and SEQ ID NO: 4 PD (CCGGTACCCTTAAATCGATGC) to produce a product of a 322 bp fragment. The two PCR products were combined in equal concentrations and used as a template for the second PCR reaction. To obtain the desired Z10 / OCI fragment, primers, PA and PD were used to produce an 800 bp fragment. The largest and boldest nucleotides in the initiator sequence PA, PB, and PC represent the sequences taken from the Z10 fragment. The smallest nucleotides in the primer sequence PA, PB, and PC represent the sequences taken from Ocl. The bold nucleotides are from the Z10 sequence and the smaller nucleotides are from the Ocl sequence. The sequence of the primer in Figure 9 is underlined and the name of the primer is in bold above or below the starter sequence. The underlined primer sequences PB and PD in Figure 9 are the reverse complement of the sequence PB and PD listed above. The orientation of the initiator is indicated by arrows. In order to clone this fragment into NewpFLAG-1 (NPF-1) the PCR fragment was blunt-ended by the addition of Klenow and dNTP and ligated to digest NPF-1 with EcoR1 and blunt-ended. the addition of Klenow and dNTP. The Z10 / OCINP was ligated and transformed into competent DH5a cells. Once the presence of the insert was confirmed by PCR, Z10 / OCINPF-1 was induced with IPTG and the induced protein was run in a Western blot. Protein samples were run in triplicate and tested with antibodies polyclonal for Z10, OC-1, and FLAG. The reaction with the three antibodies proved that the entire construction was in reading frame. These Western blot data together with sequence analyzes confirm the accuracy of the nucleotide sequence. The sequence analysis was important to confirm that no error was introduced in the PCR. However, prior to sequencing, the construct was digested with Bgl II and Kpnl and ligated into pSP73 digested in a similar manner.

EXAMPLE 12 Transformation of tobacco leaf discs In order to transform tobacco plants, it was necessary to subclone the construction within the pGG plasmid. Both Z10 / OCINPF-1 and pGG were digested with Bgl II and Kpn I, ligated and transformed into DH5a. The presence of the insert was confirmed with PCR. Figure 10 is a generalization of the construction of Z10 / OCI. Plasmid pGG-2 is a derivative of pMON316 (Rogers et al., 1987) with the addition of the AMV coat protein to improve translation (Sutton, D.W. et al., 1992). Triparental matings with pTiT37SE (Rogers et al., Supra), were used to cointegrate pGG-2 containing the Z10 / OCI insert. Tobacco leaf discs were transformed by the method of Horsch et al., 1985). When the individual tobacco shoots were visible these were transferred to Murashige and Skoog medium (Murashige, T. and Skoog, F., 1962) containing data (500 pfu / ml) and kanamycin (100 pg / ml). Individual plants were evaluated for protein expression by Western blot. Figures 11A and 11B are Western blot showing the positive reaction with both antibodies Z10 and OC1. It will be understood that the examples and embodiments described herein are for illustrative purp only and that various modifications or changes in light thereof will be suggested by persons skilled in the art and are included within the spirit and scope of this application and the scope of the claims. annexes.

REFERENCES Abe, S., W. You and E. Davis (1991) "Protein bodies in corn endosperm are encl by and enmeshed in F-actin" Protoplasma 165: 139-149. Argos, P., K. Pederson, M. D. Marks and B.A. Larkins (1982) "A structural model for maize zein proteins" J. Biol. Chem. 257: 9984-9990. Altenbach, S.B., C.C. Kua, L.C. Staraci, K.W. Pearson, C. Wainwright, A. Georgescu, and J. Townsend (1992) "Accumulation of a Brazil nut albumin in seeds of transgenic cañola results in enhanced levéis of seed protein methionine" Pl. Mol. Biol. 18: 235-245.

Aycock, M.K., Jr., and C.P. Wilsie (1967) "Inbreeding Medicago sativa L. by sibmating: Cross-sib- and self-fertility" Crop Sci. 7: 281-284. Bagga, S., Adams Hanke, J.D. Kemp. and C. Sengupta-Gopalan (1995) "Accumulation of the 15 kD zein protein in novel protein bodies in transgenic tobacco" Plant Physiol. 107 (1): 13-23. Bagga, S., Temple, S.J., Kemp, J.D. and Sengupta-Gopalan, C. (1997a) "A genetic engineering approach for improving protein quality of forage legumes" Plant Molecular Biology and Biotechnology, K.K. Tiwari and G.S. Singhal (eds.): Narosa Publishing House, pp. 305-319. Bagga, S., Rodriguez, F., Adams, H., Kemp, J.D. and Sengupta-Gopalan, C. (1997) "Co-expression of the maize a- and ß-zein genes results in stable accumulation of the d-zein in endoplasmic reticulum-derived protein bodies formed by ß-zein" Plant Cell 9: 1683 -1696 Barnes, D.K. B.P. Goplen, and J.E. Baylor (1988) "Highlights in the USA and Canada" in A.A. Hanson, D.K. Barnes, and R.R. Hill, Jr. (ed). Alfalfa and alfalfa improvement. Agron. Magr. 29. ASA, Madison, Wl. Bednarek, S.Y. and N.V. Raikhel (1991) "The barley lectin carboxy-terminal propeptide is a vacuolar sorting determinant of plants" Plant Cell 3: 1195-1206. Bingham, E.T. and T.J. McCoy (1979) "Cultivated alfalfa at the diploid level: Origin, reproductive stability, and yield or seed and forage" Crop Sci. 19: 97-100.

Bingham, E.T. (1983a) "Maximizing hybrid vigor in autotetraploid alfalfa, P. 130-143, in Better Crops for Food, CIBA Found Symp, 97. Pitman Books, London, Bingham, E.T. (1983b)" Molecular genetic engineering vs. Plant breeding "Plant Mol. Biol. 2: 221-228, Boston, RS, EBP Fontes, B .. Shank and RL Wrobel (1991)" Increased expression of the maize immunoglobulinbinding protein homology b-70 in three zein regulatory mutants "Plant Cell 3: 497-505 Ceriotti, A., E. Pedrazzini, MS Fabbrini, M. Zoppe, R. Bollini and A. Vitale (1991) "Expression of the wild type and mutated vacuolar storage protein phaseolin in xenopus oocytes reveals relationships between assembly and intracellular transport. Eur. J. Biochem. 202: 959-968. Chrispeels, M.J. (1991) "Sorting of protein in the secretory system" Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 21-53. Chrispeels, M.J. and N.V. Raikhel (1992) "Short peptide domains target proteins to plant vacuoles" Cell 68: 613-616. De Barros, E.G. and B.A. Larkins (1990) "Purification and characterization of zein degrading proteinases from germinating maize endosperm" Plant Physiol. 94: 297-303. PeClercq. A., M. Vandewlele, R. Pe Rycke, J. Van Pamme, M.

Van aMontagu, E. Krebbers, J. Vandekerckjove (1990) "Expression and processing of an Arabidopsis 2S albumin in transgenic tabacco" Plant Physiol. 94: 970-979.

Punbier, M.W., and E.T. Bingham (1975) "Maximun heterozygosity in alfalfa: Results using haploid-derived autotetraploids" Crop Sci. 15-527-531. Edwards, G.A., A Hepher, S.P. Clerk and P. Boulter (1991) "Pea lectin is correctly processed, stable and active in leaves of transgenic potato plants" Plant Mol. Biol. 17: 89-100. Esen, A. and P.A. Stetter (1992) "Immunochemical location of? -zein in the protein bodies of maize endosperm" Am. J. Bot. 79: 243-248. Finnegan, J. and P. McEIroy (1994) "Transgene Inactivation: Plants fight back!" Biotechnology 12: 883-888. Flavell, R.B. (1994) "Inactivation of gene expression in plants as a consequence of specific sequence duplication" Proc. Nati Acad. Sci. USA 91: 3490-3496. Galláis, A. (1984) "An analysis of heterosis vs. Inbreeding effects with an autotetraploid crossfertilized plant: Medicago sativa L" Genetics 106: 123-137. Giannazza, E., V. Viglienghi, P.B. Righetti, F. Salamini, and C. Soave (1977) "Amino acid composition of zein molecular components" Phytochemistry 16: 315-317. Galili, G. (1995) "Regulation of lysine and threonine systhesis" The Plant Cell 7: 899-906. Goldsbrough, P., B., S.B. Gelvin and B.A. Larkins (1986) "Expression of maize zein genes in transformed sunflower cells" Mol. Gen. Genet. 202: 374-381.

Groóse, R. W., W.P. Kojis, and E.T. Bingham (1988) "Combining ability differences between isogenic diploid and tetraploid alfalfa" Crop Sci. 28: 7-10. Groóse, R.W., L.E. Talbert, W.P. Kojis, and E.T. Bingham (1989) "Progressive heterosis in autotetraploid alfalfa: studies using two types of inbreds" Crop Sci. 29: 1173-1177. Guerche, P., E.R.P. Pe Almeida, M.A. Schwarztein, E.S. Gander, E. Krebbers, and G. Pelletier (1990) "Expression of the 2S albumin from Bertholletia exceisa in Brassica napus" Mol Gen. Genet. 221: 305-314. Hanson, A.A., P. K. Barnes, and R.R. Hill (1988) "Alfalfa and Alfalfa improvements" Agronomy Monographs 29, ASA, CSSA and SSA, Madison Wisconsin USA. Hilder, V.A., A.M.R., Gatehouse, S.E. Sheerman, R.F. Barker and P. Boulter (1987) "A novel mechanism of insect resistance engineered into tobacco" Nature 300: 160-163. Hoffman, L.M., P.P. Ponaldson, R. Bookland, K. Rashka, and E.M. Herman (1987) "Synthesis and protein body deposition of maize 15 kP zein in transgenic tobacco seeds" EMBO. J. 6: 3213-3221. Hoffman, L.M., Ponaldson, and E.M. Herman (1988) "A modified storage protein is synthesized, and degraded in the seeds of transgenic plants" Plant Mol. Biol. 11: 717-729. Horsch et al. (1985) Science 227: 1229-1231. Horton, R.M. et al. (1989) Gene 77: 61-68.

Jorgensen, R.A. (1995) "Cosuppression, flower color patterns, and metastable gene expression states" Science 268: 686-691. Kaldy, M.S., M.R. Hanna, S. Smoliak (1979) "Aminoacid composition of holy forage" Grass and Forage Sci 34: 145-148. Karchi, H., O. Shaul and G. Galili (1993) "Seed-specific expression of a bacterial disensitized aspartate kinase increases the production of seed threonine and methionine in transgenic tobacco" The Plant J. 3: 721-727. Kempthorne, O. (1969) "An introduction to genetic statistics" Lowa State University Press, Ames. Kirhara, J.A., J.P. Hunsperger, W.C. Mahoney, and J.W. Messing (1988) "Pifferential expression of a gene for a methionine-rich storage protein in maize" Mol. Gen. Genet. 211: 477-484. Langridge, P. and G. Felix (1983) "A zein gene of maize is transcribed from two widely separated promoter regions" Cell 34: 1015-1022. Larkins, B.A., C.R. Landing, J.C. Wallace, G. Galili, E.E. Kawata, K.B. Geetha, A.L. Kirz, P.M. Martin, and C.E. Bracker (1989) "Zein gene expression during maize endosperm development" in: Goldbert R.B. (Ed) The molecular basis of plant development. Alan R. Liss, NY pp. 109-120. Larkins, B.A. and W.J. Hurkman (1978) "Synthesis and deposition of zein in protein bodies of maize endosperm" Plant Physiol. 62: 256-263. Lee, K.H., R.A. Jones, A. Palby, and C.Y. Tsai (1976) "Genetic regulation of storage protein content in maize endosperm" Biochemical Genetics 14: 641-650.

Lending, C.R. and B.A. Larkins (1989) "Changes in the zein composition of protein bodies during maize endosperm development" Plant Cell 1: 1011-1023. Levanony, H., R. Rubin and Galili G. Altschuler (1992) "Evidence for a novel routing of wheat storage proteins to vacuoles" J. Cell Biol. 119: 1117-1128. Li, X., Franceshi, V.R. and T.W. Okita (1993a) "Segregation of storage protein mRNAs on the rough endoplasmic reticulum membranes of rice endosperm cells" Cell 72: 869-879. Li, X., Wu, Y., P-Z Zhang, J.W. Gillikin, R.S. Boston, V.R.

Franceschi and T.W. .Okita (1993b) "Rice prolamine protein body biogenesis: a BiP-mediated process" Science 262: 1054-1056. Matsuoka, K., K. Nakamura (1991) "Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting" PNAS USA 88: 834-838. Maliga, P. (1978) "Resistant mutant and their use in genetic manipulation" In: Frontiers of plant tissue culture (Ed: Thorpe TA) pp 381-392. Masumura, T., T. Hibino, K. Kidza, N. Mitsukawa, K. Tanaka and S.

Fujii (1990) "Cloning and characterization of cPNA enconding a rice 13 KP prolamin" Mol. Gen. Genet 221: 17. Meyer, P. and I. Heidman (1994) "Epigenetic variants of transgenic petunia line shows hypermethylation in transgene PNA: an indication for specific recognition of foreign PNA in transgenic plants" Mo. Gen. Genet. 243: 390-399.

Michaud, R., W.F. Lehman, and M.P. Rumbaugh (1988) "World distribution and historical development" In A.A. Hanson, P.K.J. Barnes, and R.R. Hill, Jr. (Ed) Alfalfa and alfalfa improvement. Agron. Mongr. 29, ASA, Madison, Wl. Minson, P.J. (1990) Protein. In: Forage in Ruminant Nutrition, Academic Press Inc., New York). Misra, P.S., R. Jumbunathan, E.T. Mertz, P.V. Glover, H.M. Barbosa, K.S. McWhirter (1972) "Endosperm protein synthesis in maize mutants with increased lysine content" Science 176: 1425-1426. Murashige, T., F. Skoog (1962) Physiology Plant 15: 485. Nugent, J.H.A., W.T. Jones, P. J. Jones and J.L. Mangan (1983) "Rates of proteolysis in the rumen of soluble proteins casein, Fraction I (18S) leaf protein bovine serum and bovine submaxillary mucoprotein". J. Nutr. 50: 357-368. Ohtani, T., J.C. Wallace, G.A. Thompson, G. Galili, and B.A. Larkins (1990) "Normal and lisyne containing zeins are unstable in transgenic tobacco seeds" Plant Mol. Biol. 15: 117-128. Pelham, H.R.B. (1990) "The retention signal soluble proteins of the endoplasmic reticulum" Trends Biochem Sci. 15: 483-485. Phillips, R.L., B.A. McClure (1985) "Element protein bound methionine in seed of maize line resistance to lysine plus threonine cereal chem." 62: 213-218, Rogers, et al. (1987) Methods of Enzymology 153: 253-277.

Sutton, P. W. et al. (1992) Transgenic Research 1: 228-236. Tabe, L.M., Higgins, C.M., McNabb, W.C. and Higgins, T.J.V. (1993) "Genetic engineering of grain and pasture legumes for improved nutritive value" Genetics 90: 181.

LIST OF SEQUENCES < 110 > New Mexico State University Technology Transfer Corporation < 120 > Co-Expression of Proteins < 130 > MPS-410C2 < 140 09 / 224,655 < 141 > 1998-12-31 < 150 > 08 / 866,879 < 151 > 1997-05-30 < 150 > 60/020/424 < 151 > 1996-05-30 < 160 > 6 < 170 > Patentln Ver. 2.0 < 21O > 1 < 211 > 24 < 212 > AON < 213 > Pesconocido < 220 > < 223 > Pesos of the Pesquished Organism: Synthetic < 400 > 1 ctacaagatc tgatatcatc gatg 24 < 210 > 2 < 211 > 22 < 212 > APN < 213 > Unknown < 220 > < 223 > Pescadoocido Organism: Synthetic < 400 > 2 gacatggatc cgaatgcagc ac 22 < 210 > 3 < 211 > 23 < 212 > APN < 213 > Unknown < 220 > < 223 > Pescadoocido Organism: Synthetic < 400 > 3 gtgctgcatt cggatccatg teg 23 < 210 > 4 < 211 > 21 < 212 > APN < 213 > Pesconocido < 220 > < 223 > Pescadoocido Organism: Synthetic < 400 > 4 ccggtaccct taaatcgatg c 21 < 210 > 5 < 211 > 444 < 212 > DNA < 213 > Zea mays < 400 > 5 agatctgtat catcgatgaa ttccggaagc aaggacacca ccgccatggc agccaagatg 60 catattccag ggcacttgcc accagtcatg ccattgggta ccatgaaccc atgcatgcag 120 tactgcatga tgcaacaggg gcttgccagc ttgatggcgt gtccgtccct gatgctgcag 180 caactgttgg ccttaccgct tcagacgatg ccagtgatga tgccacagat gatgacgcct 240 aacatgatgt caccattgat gatgccgagc atgatgtcac caatggtctt gccgagcatg 300 atgtcgcaaa tgatgatgcc acaatgtcac tgcgacgccg tctcgcagat tatgctgcaa 360 cagcagttac cattcatgtt caacccaatg gccatgacga ttccacccat gttcttacag 420 caaccctttg ttggtgctgc attc 444 < 210 > 6 < 211 > 322 < 212 > DNA < 213 > Oryza sativa < 400 > 6 ggatccatgt cgagcgacgg agggccggtg cttggcggcc tcgagccggt ggggaacgag 60 aacgacctcc acctcgtcga cctcgcccgc ttcgccgtca ccgagcacaa caagaaggcc 120 aattccctgc tggagttcga gaagcttgtg agtgtgaagc agcaagttgt cgctggcact 180 tcacaattga ttgtactatt ggtgaaggaa ggggatgcca agaagctcta tgatgctaag 240 gtctgggaga aaccatggat ggacttcaag gagctccagg agttcaagcc tgtcgatgcc 300 tttaagggta tcggcatcga 322 cc

Claims (20)

NOVELTY OF THE INVENTION CLAIMS

1. - A plant or plant tissue characterized in that it comprises a storage protein that is expressed and accumulates as a protein body in a vegetative tissue of said plant or plant tissue.

2. The plant tissue or plant, according to claim 1, further characterized in that said storage protein is stable in the rumen.

3. The plant tissue or plant, according to claim 2, further characterized in that said stable protein in the rumen is a zein protein.

4. The tissue or plant plant according to claim 3, further characterized in that said zein protein is selected from the group consisting of the 15 kD zein protein and the 10 kD zein protein.

5. The woven or plant plant according to claim 1, further characterized in that said plant co-expresses both zein proteins of 15 kD and zein of 10 kD.

6. The plant or plant, according to claim 1, further characterized in that said storage protein is constitutively expressed in said plant or plant tissue.

7. - A method for increasing the forage quality of a plant, characterized in that it comprises transforming a plant or plant tissue with a polynucleotide molecule that encodes a storage protein that is expressed and accumulates in a proteinaceous body in a vegetative tissue of said plant or tissue vegetable.

8. The method according to claim 7, further characterized in that said storage protein is stable in the rumen.

9. The method according to claim 8, further characterized in that said stable protein in the rumen is a zein protein.

10. The method according to claim 9, further characterized in that said zein protein is selected from the group consisting of the 15 kD zein protein and the 10 kD zein protein.

11. The method according to claim 7, further characterized in that said plant coexpresses both zein proteins of 15 kD and 10 kD.

12. A method for increasing the stability and storage of a heterologous protein in a plant, characterized in that it comprises transforming a plant or plant tissue expressing a heterologous protein with a polynucleotide molecule that encodes a storage protein that is expressed and accumulated as a protein body in a vegetative tissue in said plant or plant tissue.

13. - The method according to claim 12, further characterized in that said protein is stable in the rumen.

14. The method according to claim 13, further characterized in that said stable protein in the rumen is a zein protein.

15. The method according to claim 14, further characterized in that said zein protein is selected from the group consisting of the 15 kD zein protein and the 10 kD zein protein.

16. The method according to claim 12, further characterized in that said plant coexpresses both zein proteins of 15 kD and 10 kD.

17. A composition characterized in that it comprises a stable protein body in the rumen, wherein said protein body is expressed and accumulated in a plant.

18. The composition according to claim 17, further characterized in that said protein body comprises a zein protein.

19. The composition according to claim 18, further characterized in that said zein protein is selected from the group consisting of the 15 kD zein protein and the 10 kD protein.

20. The composition according to claim 17, further characterized in that said protein body comprises the 15 kD zein protein and the 10 kD zein protein.